>Feature sequence01 1297 776 gene locus_tag LOCUS_00010 1297 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2274 5156 gene locus_tag LOCUS_00020 2274 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 6910 5918 gene locus_tag LOCUS_00030 6910 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 7700 7002 gene locus_tag LOCUS_00040 7700 7002 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_00040 8246 7758 gene locus_tag LOCUS_00050 8246 7758 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567630.1 protein_id gnl|my_center|LOCUS_00050 8571 8293 gene locus_tag LOCUS_00060 8571 8293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9306 9031 gene locus_tag LOCUS_00070 9306 9031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9614 9375 gene locus_tag LOCUS_00080 9614 9375 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234978.1 protein_id gnl|my_center|LOCUS_00080 9951 9676 gene locus_tag LOCUS_00090 gene hbs 9951 9676 CDS product non-specific DNA-binding protein Hbs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153447.1 protein_id gnl|my_center|LOCUS_00090 10768 9980 gene locus_tag LOCUS_00100 10768 9980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12476 10797 gene locus_tag LOCUS_00110 12476 10797 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_00110 13801 12473 gene locus_tag LOCUS_00120 13801 12473 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_00120 15288 13798 gene locus_tag LOCUS_00130 15288 13798 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_00130 15890 15285 gene locus_tag LOCUS_00140 15890 15285 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965570.1 protein_id gnl|my_center|LOCUS_00140 16351 15902 gene locus_tag LOCUS_00150 gene dtd 16351 15902 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393181.1 protein_id gnl|my_center|LOCUS_00150 18526 16361 gene locus_tag LOCUS_00160 18526 16361 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810772.1 protein_id gnl|my_center|LOCUS_00160 20593 18527 gene locus_tag LOCUS_00170 gene recJ 20593 18527 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944688.1 protein_id gnl|my_center|LOCUS_00170 20811 21653 gene locus_tag LOCUS_00180 20811 21653 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_00180 22041 22658 gene locus_tag LOCUS_00190 22041 22658 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681208.1 protein_id gnl|my_center|LOCUS_00190 22887 23021 gene locus_tag LOCUS_00200 22887 23021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23370 23212 gene locus_tag LOCUS_00210 23370 23212 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_00210 23594 23391 gene locus_tag LOCUS_00220 23594 23391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 24183 23596 gene locus_tag LOCUS_00230 24183 23596 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_00230 24643 24236 gene locus_tag LOCUS_00240 24643 24236 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392341.1 protein_id gnl|my_center|LOCUS_00240 25815 24736 gene locus_tag LOCUS_00250 25815 24736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 25977 26735 gene locus_tag LOCUS_00260 gene minD 25977 26735 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255922.1 protein_id gnl|my_center|LOCUS_00260 26755 27168 gene locus_tag LOCUS_00270 gene mgsA 26755 27168 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684755.1 protein_id gnl|my_center|LOCUS_00270 27665 29017 gene locus_tag LOCUS_00280 gene hisS 27665 29017 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036976.1 protein_id gnl|my_center|LOCUS_00280 29075 30847 gene locus_tag LOCUS_00290 gene aspS 29075 30847 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_00290 31401 32696 gene locus_tag LOCUS_00300 31401 32696 CDS product DUF3798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868876.1 protein_id gnl|my_center|LOCUS_00300 33005 34591 gene locus_tag LOCUS_00310 33005 34591 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868877.1 protein_id gnl|my_center|LOCUS_00310 34602 35708 gene locus_tag LOCUS_00320 34602 35708 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868878.1 protein_id gnl|my_center|LOCUS_00320 35705 36832 gene locus_tag LOCUS_00330 35705 36832 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868879.1 protein_id gnl|my_center|LOCUS_00330 36829 37302 gene locus_tag LOCUS_00340 36829 37302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 37635 38936 gene locus_tag LOCUS_00350 gene lysA 37635 38936 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_00350 41439 39343 gene locus_tag LOCUS_00360 41439 39343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 41695 42390 gene locus_tag LOCUS_00370 41695 42390 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_00370 42387 43820 gene locus_tag LOCUS_00380 42387 43820 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966495.1 protein_id gnl|my_center|LOCUS_00380 43949 45325 gene locus_tag LOCUS_00390 43949 45325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 46221 45433 gene locus_tag LOCUS_00400 46221 45433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 46772 46248 gene locus_tag LOCUS_00410 46772 46248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 47508 46804 gene locus_tag LOCUS_00420 47508 46804 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_00420 48719 47505 gene locus_tag LOCUS_00430 48719 47505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 48973 48746 gene locus_tag LOCUS_00440 gene hfq 48973 48746 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811582.1 protein_id gnl|my_center|LOCUS_00440 49981 49049 gene locus_tag LOCUS_00450 gene miaA 49981 49049 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_00450 52022 50016 gene locus_tag LOCUS_00460 gene mutL 52022 50016 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020571.1 protein_id gnl|my_center|LOCUS_00460 52735 52034 gene locus_tag LOCUS_00470 52735 52034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 55358 52758 gene locus_tag LOCUS_00480 gene mutS 55358 52758 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_00480 56954 55548 gene locus_tag LOCUS_00490 gene miaB 56954 55548 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_00490 57283 58911 gene locus_tag LOCUS_00500 57283 58911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 58943 59845 gene locus_tag LOCUS_00510 58943 59845 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_00510 60046 61113 gene locus_tag LOCUS_00520 gene hrcA 60046 61113 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_00520 61135 61728 gene locus_tag LOCUS_00530 gene grpE 61135 61728 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_00530 61824 63671 gene locus_tag LOCUS_00540 gene dnaK 61824 63671 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_00540 63790 64941 gene locus_tag LOCUS_00550 gene dnaJ 63790 64941 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142730484.1 protein_id gnl|my_center|LOCUS_00550 65246 65025 gene locus_tag LOCUS_00560 65246 65025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 65699 66301 gene locus_tag LOCUS_00570 65699 66301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 66947 67276 gene locus_tag LOCUS_00580 66947 67276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 67278 67937 gene locus_tag LOCUS_00590 67278 67937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 67939 68577 gene locus_tag LOCUS_00600 67939 68577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 69988 68615 gene locus_tag LOCUS_00610 69988 68615 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_00610 70330 70890 gene locus_tag LOCUS_00620 gene thiT 70330 70890 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246588.1 protein_id gnl|my_center|LOCUS_00620 71679 70987 gene locus_tag LOCUS_00630 gene rsmG 71679 70987 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966992.1 protein_id gnl|my_center|LOCUS_00630 72528 71683 gene locus_tag LOCUS_00640 72528 71683 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811761.1 protein_id gnl|my_center|LOCUS_00640 73018 72518 gene locus_tag LOCUS_00650 gene tadA 73018 72518 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169006.1 protein_id gnl|my_center|LOCUS_00650 73323 73538 gene locus_tag LOCUS_00660 73323 73538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 73535 73768 gene locus_tag LOCUS_00670 73535 73768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 73749 73991 gene locus_tag LOCUS_00680 73749 73991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 74567 74337 gene locus_tag LOCUS_00690 74567 74337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 74726 76603 gene locus_tag LOCUS_00700 gene mnmG 74726 76603 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_00700 76605 77375 gene locus_tag LOCUS_00710 76605 77375 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_00710 77936 77472 gene locus_tag LOCUS_00720 77936 77472 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968867.1 protein_id gnl|my_center|LOCUS_00720 78401 77937 gene locus_tag LOCUS_00730 78401 77937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 78742 79914 gene locus_tag LOCUS_00740 gene ugpC 78742 79914 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_00740 80130 80426 gene locus_tag LOCUS_00750 gene rpsF 80130 80426 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_00750 80438 80896 gene locus_tag LOCUS_00760 80438 80896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 80948 81187 gene locus_tag LOCUS_00770 gene rpsR 80948 81187 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_00770 81430 81912 gene locus_tag LOCUS_00780 gene rlmH 81430 81912 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329688.1 protein_id gnl|my_center|LOCUS_00780 82078 83355 gene locus_tag LOCUS_00790 82078 83355 CDS product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296334.1 protein_id gnl|my_center|LOCUS_00790 83368 83730 gene locus_tag LOCUS_00800 83368 83730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 84591 83665 gene locus_tag LOCUS_00810 84591 83665 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814617.1 protein_id gnl|my_center|LOCUS_00810 85759 84653 gene locus_tag LOCUS_00820 85759 84653 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460323.1 protein_id gnl|my_center|LOCUS_00820 85884 86324 gene locus_tag LOCUS_00830 85884 86324 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_00830 86341 87531 gene locus_tag LOCUS_00840 86341 87531 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966572.1 protein_id gnl|my_center|LOCUS_00840 87544 88737 gene locus_tag LOCUS_00850 87544 88737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 88755 89963 gene locus_tag LOCUS_00860 88755 89963 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_00860 90033 90515 gene locus_tag LOCUS_00870 90033 90515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 90776 91240 gene locus_tag LOCUS_00880 gene infC 90776 91240 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973215.1 protein_id gnl|my_center|LOCUS_00880 91276 91473 gene locus_tag LOCUS_00890 gene rpmI 91276 91473 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_00890 91510 91863 gene locus_tag LOCUS_00900 gene rplT 91510 91863 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386545.1 protein_id gnl|my_center|LOCUS_00900 93057 92167 gene locus_tag LOCUS_00910 93057 92167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 94267 93281 gene locus_tag LOCUS_00920 gene bsh 94267 93281 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317802.1 protein_id gnl|my_center|LOCUS_00920 95740 94346 gene locus_tag LOCUS_00930 95740 94346 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_00930 97416 95908 gene locus_tag LOCUS_00940 97416 95908 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888725.1 protein_id gnl|my_center|LOCUS_00940 98951 98196 gene locus_tag LOCUS_00950 98951 98196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 99915 98989 gene locus_tag LOCUS_00960 99915 98989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 101317 99929 gene locus_tag LOCUS_00970 101317 99929 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_00970 102109 101450 gene locus_tag LOCUS_00980 102109 101450 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_00980 102297 102989 gene locus_tag LOCUS_00990 102297 102989 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426384.1 protein_id gnl|my_center|LOCUS_00990 102982 104331 gene locus_tag LOCUS_01000 102982 104331 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809171.1 protein_id gnl|my_center|LOCUS_01000 104451 107006 gene locus_tag LOCUS_01010 104451 107006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 107091 107990 gene locus_tag LOCUS_01020 107091 107990 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963984.1 protein_id gnl|my_center|LOCUS_01020 107987 108871 gene locus_tag LOCUS_01030 107987 108871 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814246.1 protein_id gnl|my_center|LOCUS_01030 108878 110845 gene locus_tag LOCUS_01040 108878 110845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 110842 111951 gene locus_tag LOCUS_01050 110842 111951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 112944 112384 gene locus_tag LOCUS_01060 112944 112384 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963535.1 protein_id gnl|my_center|LOCUS_01060 113037 114008 gene locus_tag LOCUS_01070 113037 114008 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948775.1 protein_id gnl|my_center|LOCUS_01070 114081 114605 gene locus_tag LOCUS_01080 114081 114605 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_01080 114638 115984 gene locus_tag LOCUS_01090 gene dsdA 114638 115984 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658347.1 protein_id gnl|my_center|LOCUS_01090 116839 116246 gene locus_tag LOCUS_01100 116839 116246 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_01100 118546 116960 gene locus_tag LOCUS_01110 118546 116960 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861453.1 protein_id gnl|my_center|LOCUS_01110 119256 118546 gene locus_tag LOCUS_01120 119256 118546 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889773.1 protein_id gnl|my_center|LOCUS_01120 119467 119895 gene locus_tag LOCUS_01130 119467 119895 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245055.1 protein_id gnl|my_center|LOCUS_01130 121402 120341 gene locus_tag LOCUS_01140 121402 120341 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_01140 122389 121439 gene locus_tag LOCUS_01150 122389 121439 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016957.1 protein_id gnl|my_center|LOCUS_01150 123979 122441 gene locus_tag LOCUS_01160 123979 122441 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940285.1 protein_id gnl|my_center|LOCUS_01160 124338 124126 gene locus_tag LOCUS_01170 124338 124126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 124685 126070 gene locus_tag LOCUS_01180 124685 126070 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_01180 127123 126383 gene locus_tag LOCUS_01190 127123 126383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 127696 127250 gene locus_tag LOCUS_01200 127696 127250 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055906.1 protein_id gnl|my_center|LOCUS_01200 128010 129275 gene locus_tag LOCUS_01210 128010 129275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 129544 129963 gene locus_tag LOCUS_01220 129544 129963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 131900 130020 gene locus_tag LOCUS_01230 131900 130020 CDS product DUF4914 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583124.1 protein_id gnl|my_center|LOCUS_01230 134225 132249 gene locus_tag LOCUS_01240 gene uvrB 134225 132249 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891935.1 protein_id gnl|my_center|LOCUS_01240 134904 134215 gene locus_tag LOCUS_01250 gene radC 134904 134215 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338763.1 protein_id gnl|my_center|LOCUS_01250 137764 134939 gene locus_tag LOCUS_01260 gene uvrA 137764 134939 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 protein_id gnl|my_center|LOCUS_01260 137954 139483 gene locus_tag LOCUS_01270 gene cls 137954 139483 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461555.1 protein_id gnl|my_center|LOCUS_01270 139806 140516 gene locus_tag LOCUS_01280 139806 140516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 140749 143331 gene locus_tag LOCUS_01290 gene xdh 140749 143331 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891588.1 protein_id gnl|my_center|LOCUS_01290 143334 143810 gene locus_tag LOCUS_01300 143334 143810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 143931 144842 gene locus_tag LOCUS_01310 143931 144842 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_01310 145146 145697 gene locus_tag LOCUS_01320 145146 145697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 145831 146154 gene locus_tag LOCUS_01330 145831 146154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 146147 147352 gene locus_tag LOCUS_01340 146147 147352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 148449 147481 gene locus_tag LOCUS_01350 148449 147481 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906252.1 protein_id gnl|my_center|LOCUS_01350 149767 148460 gene locus_tag LOCUS_01360 149767 148460 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682090.1 protein_id gnl|my_center|LOCUS_01360 149907 151130 gene locus_tag LOCUS_01370 149907 151130 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429165.1 protein_id gnl|my_center|LOCUS_01370 152236 151199 gene locus_tag LOCUS_01380 152236 151199 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964009.1 protein_id gnl|my_center|LOCUS_01380 152386 152994 gene locus_tag LOCUS_01390 gene plsY 152386 152994 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383394.1 protein_id gnl|my_center|LOCUS_01390 153393 153043 gene locus_tag LOCUS_01400 153393 153043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 155016 153553 gene locus_tag LOCUS_01410 155016 153553 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836536.1 protein_id gnl|my_center|LOCUS_01410 156062 155007 gene locus_tag LOCUS_01420 gene cobD 156062 155007 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173241.1 protein_id gnl|my_center|LOCUS_01420 157034 156072 gene locus_tag LOCUS_01430 gene cbiB 157034 156072 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816688.1 protein_id gnl|my_center|LOCUS_01430 159013 157031 gene locus_tag LOCUS_01440 159013 157031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 159737 159006 gene locus_tag LOCUS_01450 gene cobJ 159737 159006 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392608.1 protein_id gnl|my_center|LOCUS_01450 160740 159730 gene locus_tag LOCUS_01460 gene cbiG 160740 159730 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964679.1 protein_id gnl|my_center|LOCUS_01460 161492 160737 gene locus_tag LOCUS_01470 161492 160737 CDS product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891957.1 protein_id gnl|my_center|LOCUS_01470 162623 161496 gene locus_tag LOCUS_01480 gene cbiD 162623 161496 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168467.1 protein_id gnl|my_center|LOCUS_01480 163251 162625 gene locus_tag LOCUS_01490 163251 162625 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 protein_id gnl|my_center|LOCUS_01490 164596 163220 gene locus_tag LOCUS_01500 164596 163220 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989704.1 protein_id gnl|my_center|LOCUS_01500 165296 164601 gene locus_tag LOCUS_01510 gene cobI 165296 164601 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392605.1 protein_id gnl|my_center|LOCUS_01510 166074 165304 gene locus_tag LOCUS_01520 166074 165304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 167087 166077 gene locus_tag LOCUS_01530 167087 166077 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682008.1 protein_id gnl|my_center|LOCUS_01530 168255 167113 gene locus_tag LOCUS_01540 168255 167113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 169202 168270 gene locus_tag LOCUS_01550 169202 168270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 170544 169276 gene locus_tag LOCUS_01560 170544 169276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 170780 170592 gene locus_tag LOCUS_01570 170780 170592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 171153 171410 gene locus_tag LOCUS_01580 171153 171410 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_01580 171568 172572 gene locus_tag LOCUS_01590 171568 172572 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021255.1 protein_id gnl|my_center|LOCUS_01590 172569 173363 gene locus_tag LOCUS_01600 172569 173363 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367330.1 protein_id gnl|my_center|LOCUS_01600 173378 174439 gene locus_tag LOCUS_01610 gene hydE 173378 174439 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_01610 174436 175200 gene locus_tag LOCUS_01620 174436 175200 CDS product nitrogenase iron protein NifH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461419.1 protein_id gnl|my_center|LOCUS_01620 175194 176513 gene locus_tag LOCUS_01630 175194 176513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 176510 177631 gene locus_tag LOCUS_01640 176510 177631 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272909.1 protein_id gnl|my_center|LOCUS_01640 177694 178908 gene locus_tag LOCUS_01650 177694 178908 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495003.1 protein_id gnl|my_center|LOCUS_01650 178941 180137 gene locus_tag LOCUS_01660 gene hydF 178941 180137 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_01660 >Feature sequence02 95 20 gene locus_tag LOCUS_t00010 95 20 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 619 1338 gene locus_tag LOCUS_01670 gene trmB 619 1338 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939002.1 protein_id gnl|my_center|LOCUS_01670 1335 1505 gene locus_tag LOCUS_01680 1335 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 1829 1584 gene locus_tag LOCUS_01690 1829 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 3895 1940 gene locus_tag LOCUS_01700 3895 1940 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_01700 5633 3888 gene locus_tag LOCUS_01710 5633 3888 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_01710 6097 5630 gene locus_tag LOCUS_01720 6097 5630 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130017.1 protein_id gnl|my_center|LOCUS_01720 7324 6239 gene locus_tag LOCUS_01730 7324 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 7498 8430 gene locus_tag LOCUS_01740 7498 8430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 8914 9138 gene locus_tag LOCUS_01750 8914 9138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 9526 9212 gene locus_tag LOCUS_01760 9526 9212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 10303 9557 gene locus_tag LOCUS_01770 gene spo0A 10303 9557 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_01770 10900 10601 gene locus_tag LOCUS_01780 10900 10601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 11634 10897 gene locus_tag LOCUS_01790 11634 10897 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174109.1 protein_id gnl|my_center|LOCUS_01790 11737 12597 gene locus_tag LOCUS_01800 11737 12597 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059810.1 protein_id gnl|my_center|LOCUS_01800 12700 13734 gene locus_tag LOCUS_01810 12700 13734 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_01810 14732 13785 gene locus_tag LOCUS_01820 14732 13785 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083014.1 protein_id gnl|my_center|LOCUS_01820 15439 14753 gene locus_tag LOCUS_01830 15439 14753 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209520.1 protein_id gnl|my_center|LOCUS_01830 15658 15449 gene locus_tag LOCUS_01840 15658 15449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 16789 15695 gene locus_tag LOCUS_01850 gene ylbJ 16789 15695 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392455.1 protein_id gnl|my_center|LOCUS_01850 16877 17173 gene locus_tag LOCUS_01860 16877 17173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 17161 18357 gene locus_tag LOCUS_01870 17161 18357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 18354 19382 gene locus_tag LOCUS_01880 18354 19382 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_01880 19379 19876 gene locus_tag LOCUS_01890 gene ybeY 19379 19876 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047996.1 protein_id gnl|my_center|LOCUS_01890 19889 20782 gene locus_tag LOCUS_01900 gene era 19889 20782 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_01900 20896 21375 gene locus_tag LOCUS_01910 20896 21375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 21350 22207 gene locus_tag LOCUS_01920 21350 22207 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228320.1 protein_id gnl|my_center|LOCUS_01920 22341 22466 gene locus_tag LOCUS_01930 22341 22466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 22457 23224 gene locus_tag LOCUS_01940 22457 23224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 23243 25621 gene locus_tag LOCUS_01950 23243 25621 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048130.1 protein_id gnl|my_center|LOCUS_01950 25984 26244 gene locus_tag LOCUS_01960 25984 26244 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362134.1 protein_id gnl|my_center|LOCUS_01960 26301 28133 gene locus_tag LOCUS_01970 gene uvrC 26301 28133 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436264.1 protein_id gnl|my_center|LOCUS_01970 28130 28690 gene locus_tag LOCUS_01980 gene rsmD 28130 28690 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_01980 28687 29184 gene locus_tag LOCUS_01990 gene coaD 28687 29184 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388467.1 protein_id gnl|my_center|LOCUS_01990 29186 29683 gene locus_tag LOCUS_02000 29186 29683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 30062 32710 gene locus_tag LOCUS_02010 30062 32710 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_02010 32812 33141 gene locus_tag LOCUS_02020 gene spoIIAA 32812 33141 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_02020 33131 33571 gene locus_tag LOCUS_02030 gene spoIIAB 33131 33571 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_02030 33571 34272 gene locus_tag LOCUS_02040 gene sigF 33571 34272 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350729.1 protein_id gnl|my_center|LOCUS_02040 34329 36758 gene locus_tag LOCUS_02050 gene pcrA 34329 36758 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817187.1 protein_id gnl|my_center|LOCUS_02050 36861 37484 gene locus_tag LOCUS_02060 gene yunB 36861 37484 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418439.1 protein_id gnl|my_center|LOCUS_02060 37501 39474 gene locus_tag LOCUS_02070 gene ligA 37501 39474 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812372.1 protein_id gnl|my_center|LOCUS_02070 39471 40145 gene locus_tag LOCUS_02080 39471 40145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 40265 40735 gene locus_tag LOCUS_02090 40265 40735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 40742 41338 gene locus_tag LOCUS_02100 40742 41338 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392905.1 protein_id gnl|my_center|LOCUS_02100 43758 41383 gene locus_tag LOCUS_02110 43758 41383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 45745 44066 gene locus_tag LOCUS_02120 45745 44066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 45882 46904 gene locus_tag LOCUS_02130 gene spoIID 45882 46904 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393851.1 protein_id gnl|my_center|LOCUS_02130 47184 46948 gene locus_tag LOCUS_02140 47184 46948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 48479 47349 gene locus_tag LOCUS_02150 gene prfB 48479 47349 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191976281.1 protein_id gnl|my_center|LOCUS_02150 49973 48762 gene locus_tag LOCUS_02160 49973 48762 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068831.1 protein_id gnl|my_center|LOCUS_02160 50108 50365 gene locus_tag LOCUS_02170 50108 50365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 51677 50439 gene locus_tag LOCUS_02180 51677 50439 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288208.1 protein_id gnl|my_center|LOCUS_02180 52159 51674 gene locus_tag LOCUS_02190 52159 51674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 53282 52260 gene locus_tag LOCUS_02200 53282 52260 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288210.1 protein_id gnl|my_center|LOCUS_02200 54557 54850 gene locus_tag LOCUS_02210 54557 54850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 55916 54822 gene locus_tag LOCUS_02220 55916 54822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 57028 56081 gene locus_tag LOCUS_02230 57028 56081 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_02230 58263 57025 gene locus_tag LOCUS_02240 58263 57025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 59369 58260 gene locus_tag LOCUS_02250 59369 58260 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_02250 60412 59369 gene locus_tag LOCUS_02260 60412 59369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 61181 60417 gene locus_tag LOCUS_02270 61181 60417 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706684.1 protein_id gnl|my_center|LOCUS_02270 61921 61187 gene locus_tag LOCUS_02280 61921 61187 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476100.1 protein_id gnl|my_center|LOCUS_02280 63213 61930 gene locus_tag LOCUS_02290 63213 61930 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476101.1 protein_id gnl|my_center|LOCUS_02290 65239 63266 gene locus_tag LOCUS_02300 65239 63266 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897930.1 protein_id gnl|my_center|LOCUS_02300 65507 66712 gene locus_tag LOCUS_02310 65507 66712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 66953 75121 gene locus_tag LOCUS_02320 66953 75121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 75146 75265 gene locus_tag LOCUS_02330 75146 75265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 75432 75992 gene locus_tag LOCUS_02340 75432 75992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 75979 76245 gene locus_tag LOCUS_02350 75979 76245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 76287 77267 gene locus_tag LOCUS_02360 76287 77267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 77290 77739 gene locus_tag LOCUS_02370 77290 77739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 77736 79394 gene locus_tag LOCUS_02380 77736 79394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 79627 80385 gene locus_tag LOCUS_02390 79627 80385 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986983.1 protein_id gnl|my_center|LOCUS_02390 80382 81221 gene locus_tag LOCUS_02400 80382 81221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 81218 81925 gene locus_tag LOCUS_02410 gene cps4B 81218 81925 CDS product capsular polysaccharide biosynthesis protein Cps4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922734.1 protein_id gnl|my_center|LOCUS_02410 81918 82733 gene locus_tag LOCUS_02420 81918 82733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 82749 83426 gene locus_tag LOCUS_02430 82749 83426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 83447 84460 gene locus_tag LOCUS_02440 83447 84460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 86168 84813 gene locus_tag LOCUS_02450 gene brnQ 86168 84813 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032833879.1 protein_id gnl|my_center|LOCUS_02450 86289 87170 gene locus_tag LOCUS_02460 86289 87170 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100419.1 protein_id gnl|my_center|LOCUS_02460 87657 87211 gene locus_tag LOCUS_02470 87657 87211 CDS product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721544.1 protein_id gnl|my_center|LOCUS_02470 88010 87654 gene locus_tag LOCUS_02480 88010 87654 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423973.1 protein_id gnl|my_center|LOCUS_02480 88566 88021 gene locus_tag LOCUS_02490 88566 88021 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933856.1 protein_id gnl|my_center|LOCUS_02490 89921 88578 gene locus_tag LOCUS_02500 89921 88578 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989691.1 protein_id gnl|my_center|LOCUS_02500 90214 89936 gene locus_tag LOCUS_02510 90214 89936 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815267.1 protein_id gnl|my_center|LOCUS_02510 91108 90230 gene locus_tag LOCUS_02520 91108 90230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 91869 91105 gene locus_tag LOCUS_02530 91869 91105 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868838.1 protein_id gnl|my_center|LOCUS_02530 92244 91951 gene locus_tag LOCUS_02540 92244 91951 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868831.1 protein_id gnl|my_center|LOCUS_02540 93783 92290 gene locus_tag LOCUS_02550 93783 92290 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836566.1 protein_id gnl|my_center|LOCUS_02550 94108 93818 gene locus_tag LOCUS_02560 94108 93818 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868831.1 protein_id gnl|my_center|LOCUS_02560 94800 94147 gene locus_tag LOCUS_02570 gene eutL 94800 94147 CDS product ethanolamine utilization microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016126.1 protein_id gnl|my_center|LOCUS_02570 95677 94811 gene locus_tag LOCUS_02580 gene eutC 95677 94811 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904029.1 protein_id gnl|my_center|LOCUS_02580 97053 95683 gene locus_tag LOCUS_02590 97053 95683 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868826.1 protein_id gnl|my_center|LOCUS_02590 98492 97065 gene locus_tag LOCUS_02600 gene eutA 98492 97065 CDS product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861388.1 protein_id gnl|my_center|LOCUS_02600 98984 98583 gene locus_tag LOCUS_02610 98984 98583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 100086 99157 gene locus_tag LOCUS_02620 100086 99157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 101032 100169 gene locus_tag LOCUS_02630 101032 100169 CDS product DUF4438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080391.1 protein_id gnl|my_center|LOCUS_02630 101652 101068 gene locus_tag LOCUS_02640 101652 101068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 102989 101649 gene locus_tag LOCUS_02650 gene rpoN 102989 101649 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242595.1 protein_id gnl|my_center|LOCUS_02650 103796 103077 gene locus_tag LOCUS_02660 103796 103077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 105271 103802 gene locus_tag LOCUS_02670 105271 103802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 106299 105334 gene locus_tag LOCUS_02680 106299 105334 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_02680 107326 106292 gene locus_tag LOCUS_02690 107326 106292 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_02690 107990 107340 gene locus_tag LOCUS_02700 107990 107340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02700 109179 108244 gene locus_tag LOCUS_02710 109179 108244 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_02710 110873 109284 gene locus_tag LOCUS_02720 110873 109284 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_02720 112475 111405 gene locus_tag LOCUS_02730 112475 111405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 112829 112488 gene locus_tag LOCUS_02740 112829 112488 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888340.1 protein_id gnl|my_center|LOCUS_02740 113318 114334 gene locus_tag LOCUS_02750 113318 114334 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_02750 115109 114405 gene locus_tag LOCUS_02760 115109 114405 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_02760 115965 115111 gene locus_tag LOCUS_02770 115965 115111 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_02770 117025 115952 gene locus_tag LOCUS_02780 117025 115952 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797307.1 protein_id gnl|my_center|LOCUS_02780 117917 117042 gene locus_tag LOCUS_02790 117917 117042 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_02790 119335 118064 gene locus_tag LOCUS_02800 119335 118064 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_02800 119758 119468 gene locus_tag LOCUS_02810 119758 119468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 119995 120873 gene locus_tag LOCUS_02820 119995 120873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 124590 120988 gene locus_tag LOCUS_02830 124590 120988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 124958 124587 gene locus_tag LOCUS_02840 124958 124587 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460033.1 protein_id gnl|my_center|LOCUS_02840 125641 125078 gene locus_tag LOCUS_02850 125641 125078 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198788.1 protein_id gnl|my_center|LOCUS_02850 127019 125658 gene locus_tag LOCUS_02860 gene radA 127019 125658 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_02860 127726 127016 gene locus_tag LOCUS_02870 gene cwlD 127726 127016 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048347.1 protein_id gnl|my_center|LOCUS_02870 129062 127839 gene locus_tag LOCUS_02880 gene tyrS 129062 127839 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_02880 >Feature sequence03 505 311 gene locus_tag LOCUS_02890 505 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 1102 563 gene locus_tag LOCUS_02900 gene raiA 1102 563 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722643.1 protein_id gnl|my_center|LOCUS_02900 1467 1252 gene locus_tag LOCUS_02910 1467 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 2001 1471 gene locus_tag LOCUS_02920 2001 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 2164 2829 gene locus_tag LOCUS_02930 2164 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 3167 4009 gene locus_tag LOCUS_02940 gene dpsA 3167 4009 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439770.1 protein_id gnl|my_center|LOCUS_02940 4006 4578 gene locus_tag LOCUS_02950 4006 4578 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_02950 5840 4638 gene locus_tag LOCUS_02960 gene wecC 5840 4638 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791918.1 protein_id gnl|my_center|LOCUS_02960 7052 5892 gene locus_tag LOCUS_02970 gene metK 7052 5892 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_02970 7446 8327 gene locus_tag LOCUS_02980 7446 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 8839 8528 gene locus_tag LOCUS_02990 gene trxA 8839 8528 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393175.1 protein_id gnl|my_center|LOCUS_02990 9054 8845 gene locus_tag LOCUS_03000 9054 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 9911 9168 gene locus_tag LOCUS_03010 9911 9168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 11447 9912 gene locus_tag LOCUS_03020 11447 9912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 17306 11556 gene locus_tag LOCUS_03030 17306 11556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 19585 17744 gene locus_tag LOCUS_03040 19585 17744 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585259.1 protein_id gnl|my_center|LOCUS_03040 21994 19592 gene locus_tag LOCUS_03050 21994 19592 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141000.1 protein_id gnl|my_center|LOCUS_03050 23433 21991 gene locus_tag LOCUS_03060 gene glgA 23433 21991 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262948.1 protein_id gnl|my_center|LOCUS_03060 24542 23430 gene locus_tag LOCUS_03070 gene glgD 24542 23430 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_03070 25745 24561 gene locus_tag LOCUS_03080 25745 24561 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_03080 27655 25766 gene locus_tag LOCUS_03090 gene glgB 27655 25766 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880434.1 protein_id gnl|my_center|LOCUS_03090 29220 28189 gene locus_tag LOCUS_03100 gene gap 29220 28189 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_03100 29479 29306 gene locus_tag LOCUS_03110 29479 29306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 31044 29446 gene locus_tag LOCUS_03120 31044 29446 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_03120 33665 31344 gene locus_tag LOCUS_03130 33665 31344 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016705.1 protein_id gnl|my_center|LOCUS_03130 35241 33760 gene locus_tag LOCUS_03140 gene malQ 35241 33760 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_03140 36260 35244 gene locus_tag LOCUS_03150 36260 35244 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356351.1 protein_id gnl|my_center|LOCUS_03150 37150 36290 gene locus_tag LOCUS_03160 37150 36290 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 protein_id gnl|my_center|LOCUS_03160 38061 37147 gene locus_tag LOCUS_03170 38061 37147 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052964.1 protein_id gnl|my_center|LOCUS_03170 39674 38283 gene locus_tag LOCUS_03180 39674 38283 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_03180 40746 39955 gene locus_tag LOCUS_03190 40746 39955 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681896.1 protein_id gnl|my_center|LOCUS_03190 41936 40746 gene locus_tag LOCUS_03200 41936 40746 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_03200 42415 41972 gene locus_tag LOCUS_03210 42415 41972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 42577 43089 gene locus_tag LOCUS_03220 42577 43089 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814019.1 protein_id gnl|my_center|LOCUS_03220 44420 43314 gene locus_tag LOCUS_03230 44420 43314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 46272 44524 gene locus_tag LOCUS_03240 46272 44524 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_03240 47996 46269 gene locus_tag LOCUS_03250 47996 46269 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_03250 49760 48024 gene locus_tag LOCUS_03260 49760 48024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 50595 49897 gene locus_tag LOCUS_03270 50595 49897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 51104 52474 gene locus_tag LOCUS_03280 51104 52474 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_03280 53525 52530 gene locus_tag LOCUS_03290 gene mutY 53525 52530 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243838.1 protein_id gnl|my_center|LOCUS_03290 53688 55034 gene locus_tag LOCUS_03300 53688 55034 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867389.1 protein_id gnl|my_center|LOCUS_03300 55054 55872 gene locus_tag LOCUS_03310 55054 55872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 55990 56850 gene locus_tag LOCUS_03320 55990 56850 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458966.1 protein_id gnl|my_center|LOCUS_03320 56946 58358 gene locus_tag LOCUS_03330 56946 58358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 60383 58626 gene locus_tag LOCUS_03340 gene thrS 60383 58626 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_03340 60998 61684 gene locus_tag LOCUS_03350 60998 61684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 61770 62624 gene locus_tag LOCUS_03360 gene rsmA 61770 62624 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294004.1 protein_id gnl|my_center|LOCUS_03360 62621 62965 gene locus_tag LOCUS_03370 62621 62965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 64981 63098 gene locus_tag LOCUS_03380 64981 63098 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 protein_id gnl|my_center|LOCUS_03380 65288 65070 gene locus_tag LOCUS_03390 65288 65070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 65449 65841 gene locus_tag LOCUS_03400 65449 65841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 65825 66700 gene locus_tag LOCUS_03410 65825 66700 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460636.1 protein_id gnl|my_center|LOCUS_03410 66759 67655 gene locus_tag LOCUS_03420 66759 67655 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338796.1 protein_id gnl|my_center|LOCUS_03420 68182 67781 gene locus_tag LOCUS_03430 68182 67781 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227688.1 protein_id gnl|my_center|LOCUS_03430 69573 68179 gene locus_tag LOCUS_03440 gene atpD 69573 68179 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_03440 70433 69588 gene locus_tag LOCUS_03450 gene atpG 70433 69588 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_03450 71963 70449 gene locus_tag LOCUS_03460 gene atpA 71963 70449 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421367.1 protein_id gnl|my_center|LOCUS_03460 72539 71997 gene locus_tag LOCUS_03470 72539 71997 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 protein_id gnl|my_center|LOCUS_03470 73039 72536 gene locus_tag LOCUS_03480 73039 72536 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940784.1 protein_id gnl|my_center|LOCUS_03480 73337 73074 gene locus_tag LOCUS_03490 gene atpE 73337 73074 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902609.1 protein_id gnl|my_center|LOCUS_03490 74154 73411 gene locus_tag LOCUS_03500 gene atpB 74154 73411 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_03500 74601 74155 gene locus_tag LOCUS_03510 74601 74155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 74894 74622 gene locus_tag LOCUS_03520 74894 74622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 75248 75424 gene locus_tag LOCUS_03530 75248 75424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 75881 75483 gene locus_tag LOCUS_03540 75881 75483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 76087 77130 gene locus_tag LOCUS_03550 76087 77130 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392937.1 protein_id gnl|my_center|LOCUS_03550 77120 77914 gene locus_tag LOCUS_03560 77120 77914 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816411.1 protein_id gnl|my_center|LOCUS_03560 77914 78639 gene locus_tag LOCUS_03570 77914 78639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 78636 79673 gene locus_tag LOCUS_03580 78636 79673 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362591.1 protein_id gnl|my_center|LOCUS_03580 79676 80581 gene locus_tag LOCUS_03590 79676 80581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 80876 81709 gene locus_tag LOCUS_03600 80876 81709 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016086425.1 protein_id gnl|my_center|LOCUS_03600 81702 82772 gene locus_tag LOCUS_03610 81702 82772 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017134.1 protein_id gnl|my_center|LOCUS_03610 82926 83177 gene locus_tag LOCUS_03620 82926 83177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 83495 84274 gene locus_tag LOCUS_03630 gene proB 83495 84274 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_03630 84271 85527 gene locus_tag LOCUS_03640 84271 85527 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255283.1 protein_id gnl|my_center|LOCUS_03640 85985 87103 gene locus_tag LOCUS_03650 85985 87103 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945303.1 protein_id gnl|my_center|LOCUS_03650 87182 88111 gene locus_tag LOCUS_03660 87182 88111 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461145.1 protein_id gnl|my_center|LOCUS_03660 88114 88899 gene locus_tag LOCUS_03670 88114 88899 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_03670 89102 89791 gene locus_tag LOCUS_03680 89102 89791 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460301.1 protein_id gnl|my_center|LOCUS_03680 89788 90111 gene locus_tag LOCUS_03690 89788 90111 CDS product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065708.1 protein_id gnl|my_center|LOCUS_03690 91043 90162 gene locus_tag LOCUS_03700 91043 90162 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818363.1 protein_id gnl|my_center|LOCUS_03700 91649 91053 gene locus_tag LOCUS_03710 91649 91053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 92368 91799 gene locus_tag LOCUS_03720 92368 91799 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 protein_id gnl|my_center|LOCUS_03720 102080 92697 gene locus_tag LOCUS_03730 102080 92697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 103006 102473 gene locus_tag LOCUS_03740 103006 102473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 104457 103006 gene locus_tag LOCUS_03750 104457 103006 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949007.1 protein_id gnl|my_center|LOCUS_03750 105146 104541 gene locus_tag LOCUS_03760 105146 104541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 105328 107361 gene locus_tag LOCUS_03770 105328 107361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 107388 107642 gene locus_tag LOCUS_03780 107388 107642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 108374 107613 gene locus_tag LOCUS_03790 108374 107613 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255171.1 protein_id gnl|my_center|LOCUS_03790 109092 108364 gene locus_tag LOCUS_03800 109092 108364 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903444.1 protein_id gnl|my_center|LOCUS_03800 109966 109166 gene locus_tag LOCUS_03810 109966 109166 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047707.1 protein_id gnl|my_center|LOCUS_03810 110977 110189 gene locus_tag LOCUS_03820 gene yecC 110977 110189 CDS product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096023.1 protein_id gnl|my_center|LOCUS_03820 111777 110989 gene locus_tag LOCUS_03830 111777 110989 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303625.1 protein_id gnl|my_center|LOCUS_03830 112814 111912 gene locus_tag LOCUS_03840 112814 111912 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941466.1 protein_id gnl|my_center|LOCUS_03840 113904 112981 gene locus_tag LOCUS_03850 113904 112981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 116056 114773 gene locus_tag LOCUS_03860 116056 114773 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_03860 116295 116053 gene locus_tag LOCUS_03870 116295 116053 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461313.1 protein_id gnl|my_center|LOCUS_03870 117308 116430 gene locus_tag LOCUS_03880 117308 116430 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982687.1 protein_id gnl|my_center|LOCUS_03880 117448 118053 gene locus_tag LOCUS_03890 117448 118053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 119533 118403 gene locus_tag LOCUS_03900 119533 118403 CDS product DUF4317 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964047.1 protein_id gnl|my_center|LOCUS_03900 119683 120696 gene locus_tag LOCUS_03910 gene hflK 119683 120696 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311785.1 protein_id gnl|my_center|LOCUS_03910 120693 121580 gene locus_tag LOCUS_03920 120693 121580 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937986.1 protein_id gnl|my_center|LOCUS_03920 121577 122041 gene locus_tag LOCUS_03930 121577 122041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 >Feature sequence04 1802 2095 gene locus_tag LOCUS_03940 1802 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 2213 3394 gene locus_tag LOCUS_03950 2213 3394 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286587.1 protein_id gnl|my_center|LOCUS_03950 3498 4595 gene locus_tag LOCUS_03960 gene ychF 3498 4595 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_03960 5294 4647 gene locus_tag LOCUS_03970 5294 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 6632 5307 gene locus_tag LOCUS_03980 6632 5307 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203192.1 protein_id gnl|my_center|LOCUS_03980 6876 7751 gene locus_tag LOCUS_03990 6876 7751 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776998.1 protein_id gnl|my_center|LOCUS_03990 10011 8236 gene locus_tag LOCUS_04000 10011 8236 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_04000 11960 10236 gene locus_tag LOCUS_04010 gene glnS 11960 10236 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287115.1 protein_id gnl|my_center|LOCUS_04010 12320 13042 gene locus_tag LOCUS_04020 gene pyrH 12320 13042 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_04020 13044 13595 gene locus_tag LOCUS_04030 gene frr 13044 13595 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430598.1 protein_id gnl|my_center|LOCUS_04030 13869 14609 gene locus_tag LOCUS_04040 13869 14609 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_04040 14606 15415 gene locus_tag LOCUS_04050 14606 15415 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583559.1 protein_id gnl|my_center|LOCUS_04050 15412 16560 gene locus_tag LOCUS_04060 15412 16560 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_04060 16590 17645 gene locus_tag LOCUS_04070 gene rseP 16590 17645 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_04070 17659 18696 gene locus_tag LOCUS_04080 gene ispG 17659 18696 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460411.1 protein_id gnl|my_center|LOCUS_04080 18881 23176 gene locus_tag LOCUS_04090 18881 23176 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_04090 23193 23381 gene locus_tag LOCUS_04100 23193 23381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 24363 23422 gene locus_tag LOCUS_04110 24363 23422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 25563 24373 gene locus_tag LOCUS_04120 25563 24373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 25727 25815 gene locus_tag LOCUS_t00020 25727 25815 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 25851 25942 gene locus_tag LOCUS_t00030 25851 25942 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 27265 26141 gene locus_tag LOCUS_04130 27265 26141 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948743.1 protein_id gnl|my_center|LOCUS_04130 27838 30504 gene locus_tag LOCUS_04140 27838 30504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 30616 30996 gene locus_tag LOCUS_04150 gene gcvH 30616 30996 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723327.1 protein_id gnl|my_center|LOCUS_04150 30998 32317 gene locus_tag LOCUS_04160 gene gcvPA 30998 32317 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678346.1 protein_id gnl|my_center|LOCUS_04160 32317 33747 gene locus_tag LOCUS_04170 gene gcvPB 32317 33747 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679310.1 protein_id gnl|my_center|LOCUS_04170 33744 34730 gene locus_tag LOCUS_04180 33744 34730 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812232.1 protein_id gnl|my_center|LOCUS_04180 35056 36066 gene locus_tag LOCUS_04190 35056 36066 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530643.1 protein_id gnl|my_center|LOCUS_04190 36201 38183 gene locus_tag LOCUS_04200 36201 38183 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_04200 40430 38538 gene locus_tag LOCUS_04210 gene htpG 40430 38538 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243561.1 protein_id gnl|my_center|LOCUS_04210 41851 40877 gene locus_tag LOCUS_04220 41851 40877 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889546.1 protein_id gnl|my_center|LOCUS_04220 43181 41943 gene locus_tag LOCUS_04230 43181 41943 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889545.1 protein_id gnl|my_center|LOCUS_04230 44404 43604 gene locus_tag LOCUS_04240 44404 43604 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964639.1 protein_id gnl|my_center|LOCUS_04240 44560 46161 gene locus_tag LOCUS_04250 44560 46161 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986363.1 protein_id gnl|my_center|LOCUS_04250 48292 46352 gene locus_tag LOCUS_04260 48292 46352 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811135.1 protein_id gnl|my_center|LOCUS_04260 48884 48246 gene locus_tag LOCUS_04270 48884 48246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 49558 48881 gene locus_tag LOCUS_04280 gene cmk 49558 48881 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361252.1 protein_id gnl|my_center|LOCUS_04280 50815 49562 gene locus_tag LOCUS_04290 50815 49562 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_04290 51641 50784 gene locus_tag LOCUS_04300 51641 50784 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_04300 52478 51777 gene locus_tag LOCUS_04310 52478 51777 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_04310 53544 52480 gene locus_tag LOCUS_04320 gene dacB 53544 52480 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230505.1 protein_id gnl|my_center|LOCUS_04320 54029 53628 gene locus_tag LOCUS_04330 gene ytfJ 54029 53628 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350005.1 protein_id gnl|my_center|LOCUS_04330 54646 54026 gene locus_tag LOCUS_04340 54646 54026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 55233 54643 gene locus_tag LOCUS_04350 gene scpB 55233 54643 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428258.1 protein_id gnl|my_center|LOCUS_04350 56219 55428 gene locus_tag LOCUS_04360 56219 55428 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_04360 56929 56237 gene locus_tag LOCUS_04370 56929 56237 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869499.1 protein_id gnl|my_center|LOCUS_04370 57840 57253 gene locus_tag LOCUS_04380 gene yihA 57840 57253 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045119.1 protein_id gnl|my_center|LOCUS_04380 60270 57850 gene locus_tag LOCUS_04390 gene lon 60270 57850 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_04390 61748 60483 gene locus_tag LOCUS_04400 gene clpX 61748 60483 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_04400 62428 61847 gene locus_tag LOCUS_04410 gene clpP 62428 61847 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_04410 63875 62553 gene locus_tag LOCUS_04420 gene tig 63875 62553 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_04420 64683 63994 gene locus_tag LOCUS_04430 64683 63994 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_04430 66167 64680 gene locus_tag LOCUS_04440 gene thrC 66167 64680 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_04440 67090 66155 gene locus_tag LOCUS_04450 67090 66155 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812947.1 protein_id gnl|my_center|LOCUS_04450 67452 67087 gene locus_tag LOCUS_04460 67452 67087 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384683.1 protein_id gnl|my_center|LOCUS_04460 68059 67442 gene locus_tag LOCUS_04470 68059 67442 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_04470 68934 68056 gene locus_tag LOCUS_04480 gene ylqF 68934 68056 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861161.1 protein_id gnl|my_center|LOCUS_04480 69717 68935 gene locus_tag LOCUS_04490 69717 68935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 70400 70059 gene locus_tag LOCUS_04500 gene rplS 70400 70059 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 protein_id gnl|my_center|LOCUS_04500 70639 70714 gene locus_tag LOCUS_t00040 70639 70714 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 71051 71533 gene locus_tag LOCUS_04510 gene crtO 71051 71533 CDS product glycosyl-4,4'-diaponeurosporenoate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001805835.1 protein_id gnl|my_center|LOCUS_04510 71536 72651 gene locus_tag LOCUS_04520 71536 72651 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_04520 74197 72710 gene locus_tag LOCUS_04530 gene xylB 74197 72710 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_04530 74415 75422 gene locus_tag LOCUS_04540 gene asnA 74415 75422 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_04540 75468 76865 gene locus_tag LOCUS_04550 gene asnS 75468 76865 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432161.1 protein_id gnl|my_center|LOCUS_04550 77348 78625 gene locus_tag LOCUS_04560 77348 78625 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080272.1 protein_id gnl|my_center|LOCUS_04560 79009 80244 gene locus_tag LOCUS_04570 79009 80244 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080272.1 protein_id gnl|my_center|LOCUS_04570 80584 81462 gene locus_tag LOCUS_04580 80584 81462 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_04580 81476 82591 gene locus_tag LOCUS_04590 81476 82591 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080270.1 protein_id gnl|my_center|LOCUS_04590 82584 83426 gene locus_tag LOCUS_04600 82584 83426 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002937291.1 protein_id gnl|my_center|LOCUS_04600 83419 84132 gene locus_tag LOCUS_04610 83419 84132 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_04610 84288 85481 gene locus_tag LOCUS_04620 84288 85481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 85478 86371 gene locus_tag LOCUS_04630 85478 86371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 87751 86597 gene locus_tag LOCUS_04640 87751 86597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 87884 88297 gene locus_tag LOCUS_04650 87884 88297 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293091.1 protein_id gnl|my_center|LOCUS_04650 88287 90047 gene locus_tag LOCUS_04660 88287 90047 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_04660 90049 90336 gene locus_tag LOCUS_04670 90049 90336 CDS product cysteine-rich small domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437519.1 protein_id gnl|my_center|LOCUS_04670 90377 90508 gene locus_tag LOCUS_04680 90377 90508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 90898 90599 gene locus_tag LOCUS_04690 90898 90599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 91072 91359 gene locus_tag LOCUS_04700 91072 91359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 92510 91467 gene locus_tag LOCUS_04710 92510 91467 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356366.1 protein_id gnl|my_center|LOCUS_04710 92632 93519 gene locus_tag LOCUS_04720 92632 93519 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 protein_id gnl|my_center|LOCUS_04720 93572 94315 gene locus_tag LOCUS_04730 93572 94315 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922794.1 protein_id gnl|my_center|LOCUS_04730 94312 94896 gene locus_tag LOCUS_04740 94312 94896 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966691.1 protein_id gnl|my_center|LOCUS_04740 95886 94954 gene locus_tag LOCUS_04750 gene rihA 95886 94954 CDS product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705366.1 protein_id gnl|my_center|LOCUS_04750 96833 95883 gene locus_tag LOCUS_04760 gene rihA 96833 95883 CDS product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207533.1 protein_id gnl|my_center|LOCUS_04760 98023 97067 gene locus_tag LOCUS_04770 98023 97067 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537587.1 protein_id gnl|my_center|LOCUS_04770 99179 98016 gene locus_tag LOCUS_04780 99179 98016 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383862.1 protein_id gnl|my_center|LOCUS_04780 100752 99172 gene locus_tag LOCUS_04790 100752 99172 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865052.1 protein_id gnl|my_center|LOCUS_04790 102131 100929 gene locus_tag LOCUS_04800 102131 100929 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383860.1 protein_id gnl|my_center|LOCUS_04800 102320 103339 gene locus_tag LOCUS_04810 gene add 102320 103339 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548323.1 protein_id gnl|my_center|LOCUS_04810 103364 103561 gene locus_tag LOCUS_04820 103364 103561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 103652 103960 gene locus_tag LOCUS_04830 103652 103960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 >Feature sequence05 319 1158 gene locus_tag LOCUS_04840 319 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 1579 1226 gene locus_tag LOCUS_04850 1579 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 2689 1634 gene locus_tag LOCUS_04860 2689 1634 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963395.1 protein_id gnl|my_center|LOCUS_04860 4829 2760 gene locus_tag LOCUS_04870 gene fusA 4829 2760 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_04870 7176 5011 gene locus_tag LOCUS_04880 7176 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 8039 7200 gene locus_tag LOCUS_04890 gene rlmB 8039 7200 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357423.1 protein_id gnl|my_center|LOCUS_04890 8278 10257 gene locus_tag LOCUS_04900 gene ftsH 8278 10257 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963922.1 protein_id gnl|my_center|LOCUS_04900 10370 11245 gene locus_tag LOCUS_04910 gene mscS 10370 11245 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 protein_id gnl|my_center|LOCUS_04910 11569 13470 gene locus_tag LOCUS_04920 gene cooS 11569 13470 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860935.1 protein_id gnl|my_center|LOCUS_04920 13502 14266 gene locus_tag LOCUS_04930 13502 14266 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888532.1 protein_id gnl|my_center|LOCUS_04930 14291 16432 gene locus_tag LOCUS_04940 gene acsB 14291 16432 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418359.1 protein_id gnl|my_center|LOCUS_04940 16628 16993 gene locus_tag LOCUS_04950 16628 16993 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548042.1 protein_id gnl|my_center|LOCUS_04950 16990 17877 gene locus_tag LOCUS_04960 16990 17877 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_04960 17852 19702 gene locus_tag LOCUS_04970 17852 19702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 19747 19938 gene locus_tag LOCUS_04980 19747 19938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 20225 19947 gene locus_tag LOCUS_04990 20225 19947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 21831 20230 gene locus_tag LOCUS_05000 21831 20230 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061070.1 protein_id gnl|my_center|LOCUS_05000 22518 21844 gene locus_tag LOCUS_05010 22518 21844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 23357 22530 gene locus_tag LOCUS_05020 23357 22530 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392335.1 protein_id gnl|my_center|LOCUS_05020 24375 23347 gene locus_tag LOCUS_05030 24375 23347 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_05030 25349 24372 gene locus_tag LOCUS_05040 25349 24372 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392333.1 protein_id gnl|my_center|LOCUS_05040 25768 25337 gene locus_tag LOCUS_05050 25768 25337 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932916.1 protein_id gnl|my_center|LOCUS_05050 27750 25759 gene locus_tag LOCUS_05060 27750 25759 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940767.1 protein_id gnl|my_center|LOCUS_05060 28146 27763 gene locus_tag LOCUS_05070 28146 27763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 28933 28148 gene locus_tag LOCUS_05080 28933 28148 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940768.1 protein_id gnl|my_center|LOCUS_05080 30324 28948 gene locus_tag LOCUS_05090 gene fumC 30324 28948 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456604.1 protein_id gnl|my_center|LOCUS_05090 31287 30337 gene locus_tag LOCUS_05100 31287 30337 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_05100 32363 31473 gene locus_tag LOCUS_05110 32363 31473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 33457 32537 gene locus_tag LOCUS_05120 33457 32537 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986890.1 protein_id gnl|my_center|LOCUS_05120 34682 33585 gene locus_tag LOCUS_05130 gene mglC 34682 33585 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016955.1 protein_id gnl|my_center|LOCUS_05130 36197 34698 gene locus_tag LOCUS_05140 gene mglA 36197 34698 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903113.1 protein_id gnl|my_center|LOCUS_05140 37541 36336 gene locus_tag LOCUS_05150 gene mglB 37541 36336 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036947.1 protein_id gnl|my_center|LOCUS_05150 38818 37853 gene locus_tag LOCUS_05160 38818 37853 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727630.1 protein_id gnl|my_center|LOCUS_05160 40511 38823 gene locus_tag LOCUS_05170 40511 38823 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 protein_id gnl|my_center|LOCUS_05170 41740 40508 gene locus_tag LOCUS_05180 41740 40508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 43228 41885 gene locus_tag LOCUS_05190 43228 41885 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 protein_id gnl|my_center|LOCUS_05190 45702 43348 gene locus_tag LOCUS_05200 45702 43348 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775478.1 protein_id gnl|my_center|LOCUS_05200 46759 46079 gene locus_tag LOCUS_05210 46759 46079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 46968 46756 gene locus_tag LOCUS_05220 46968 46756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 47281 46982 gene locus_tag LOCUS_05230 47281 46982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 47494 48102 gene locus_tag LOCUS_05240 47494 48102 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804965.1 protein_id gnl|my_center|LOCUS_05240 49231 48305 gene locus_tag LOCUS_05250 gene tsf 49231 48305 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384678.1 protein_id gnl|my_center|LOCUS_05250 50048 49314 gene locus_tag LOCUS_05260 gene rpsB 50048 49314 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_05260 50533 50255 gene locus_tag LOCUS_05270 50533 50255 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236745.1 protein_id gnl|my_center|LOCUS_05270 51567 50788 gene locus_tag LOCUS_05280 gene sigG 51567 50788 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_05280 52830 51976 gene locus_tag LOCUS_05290 gene gpr 52830 51976 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460511.1 protein_id gnl|my_center|LOCUS_05290 52997 53260 gene locus_tag LOCUS_05300 gene rpsT 52997 53260 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_05300 53600 55645 gene locus_tag LOCUS_05310 gene recG 53600 55645 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_05310 55744 56286 gene locus_tag LOCUS_05320 55744 56286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 56371 57939 gene locus_tag LOCUS_05330 gene gpmI 56371 57939 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_05330 58080 59615 gene locus_tag LOCUS_05340 58080 59615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 59733 60086 gene locus_tag LOCUS_05350 59733 60086 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965385.1 protein_id gnl|my_center|LOCUS_05350 60113 61801 gene locus_tag LOCUS_05360 60113 61801 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036677.1 protein_id gnl|my_center|LOCUS_05360 63762 62254 gene locus_tag LOCUS_05370 63762 62254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 65390 63936 gene locus_tag LOCUS_05380 gene putP 65390 63936 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_05380 66095 65472 gene locus_tag LOCUS_05390 66095 65472 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356215.1 protein_id gnl|my_center|LOCUS_05390 66866 66306 gene locus_tag LOCUS_05400 66866 66306 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433028.1 protein_id gnl|my_center|LOCUS_05400 68331 66871 gene locus_tag LOCUS_05410 68331 66871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 68516 69667 gene locus_tag LOCUS_05420 68516 69667 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808433.1 protein_id gnl|my_center|LOCUS_05420 69958 71724 gene locus_tag LOCUS_05430 69958 71724 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460241.1 protein_id gnl|my_center|LOCUS_05430 71785 72504 gene locus_tag LOCUS_05440 71785 72504 CDS product heparan-alpha-glucosaminide N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458912.1 protein_id gnl|my_center|LOCUS_05440 73195 72590 gene locus_tag LOCUS_05450 73195 72590 CDS product DUF3786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813269.1 protein_id gnl|my_center|LOCUS_05450 74223 73195 gene locus_tag LOCUS_05460 74223 73195 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_05460 75197 74556 gene locus_tag LOCUS_05470 75197 74556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 75434 76093 gene locus_tag LOCUS_05480 75434 76093 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085042.1 protein_id gnl|my_center|LOCUS_05480 76090 76356 gene locus_tag LOCUS_05490 76090 76356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 76532 76957 gene locus_tag LOCUS_05500 76532 76957 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436247.1 protein_id gnl|my_center|LOCUS_05500 77977 77045 gene locus_tag LOCUS_05510 77977 77045 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964780.1 protein_id gnl|my_center|LOCUS_05510 78430 78131 gene locus_tag LOCUS_05520 78430 78131 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272449.1 protein_id gnl|my_center|LOCUS_05520 79167 79006 gene locus_tag LOCUS_05530 79167 79006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 79281 79616 gene locus_tag LOCUS_05540 79281 79616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 >Feature sequence06 1910 711 gene locus_tag LOCUS_05550 1910 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 3589 1907 gene locus_tag LOCUS_05560 gene recN 3589 1907 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645158.1 protein_id gnl|my_center|LOCUS_05560 4084 3614 gene locus_tag LOCUS_05570 4084 3614 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_05570 4958 4089 gene locus_tag LOCUS_05580 4958 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 5767 4964 gene locus_tag LOCUS_05590 5767 4964 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_05590 7595 5757 gene locus_tag LOCUS_05600 gene dxs 7595 5757 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_05600 8212 7622 gene locus_tag LOCUS_05610 8212 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986441.1 protein_id gnl|my_center|LOCUS_05610 8407 8231 gene locus_tag LOCUS_05620 8407 8231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 10386 9520 gene locus_tag LOCUS_05630 10386 9520 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810943.1 protein_id gnl|my_center|LOCUS_05630 10612 10376 gene locus_tag LOCUS_05640 10612 10376 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948035.1 protein_id gnl|my_center|LOCUS_05640 11819 10605 gene locus_tag LOCUS_05650 gene xseA 11819 10605 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_05650 12742 11822 gene locus_tag LOCUS_05660 12742 11822 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393029.1 protein_id gnl|my_center|LOCUS_05660 13188 12739 gene locus_tag LOCUS_05670 gene nusB 13188 12739 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_05670 13689 13306 gene locus_tag LOCUS_05680 13689 13306 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810919.1 protein_id gnl|my_center|LOCUS_05680 14322 13759 gene locus_tag LOCUS_05690 14322 13759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 14858 14334 gene locus_tag LOCUS_05700 14858 14334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 15322 14843 gene locus_tag LOCUS_05710 15322 14843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 16416 15322 gene locus_tag LOCUS_05720 16416 15322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 16808 16416 gene locus_tag LOCUS_05730 16808 16416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 17007 16813 gene locus_tag LOCUS_05740 gene spoIIIAC 17007 16813 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358967.1 protein_id gnl|my_center|LOCUS_05740 17525 17010 gene locus_tag LOCUS_05750 17525 17010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 18358 17519 gene locus_tag LOCUS_05760 gene spoIIIAA 18358 17519 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358945.1 protein_id gnl|my_center|LOCUS_05760 18520 19263 gene locus_tag LOCUS_05770 gene larE 18520 19263 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964093.1 protein_id gnl|my_center|LOCUS_05770 19266 20033 gene locus_tag LOCUS_05780 gene larB 19266 20033 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435015.1 protein_id gnl|my_center|LOCUS_05780 20208 21410 gene locus_tag LOCUS_05790 gene larC 20208 21410 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_05790 22392 21511 gene locus_tag LOCUS_05800 gene xerD 22392 21511 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_05800 23288 22893 gene locus_tag LOCUS_05810 23288 22893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 24645 23629 gene locus_tag LOCUS_05820 gene tsaD 24645 23629 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_05820 25088 24642 gene locus_tag LOCUS_05830 gene rimI 25088 24642 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380294.1 protein_id gnl|my_center|LOCUS_05830 27697 25088 gene locus_tag LOCUS_05840 gene polA 27697 25088 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048038.1 protein_id gnl|my_center|LOCUS_05840 29273 27822 gene locus_tag LOCUS_05850 29273 27822 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_05850 29899 29291 gene locus_tag LOCUS_05860 gene cysE 29899 29291 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285050.1 protein_id gnl|my_center|LOCUS_05860 30215 30030 gene locus_tag LOCUS_05870 30215 30030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 30882 30337 gene locus_tag LOCUS_05880 gene pgsA 30882 30337 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_05880 32218 30866 gene locus_tag LOCUS_05890 gene rimO 32218 30866 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_05890 32853 32215 gene locus_tag LOCUS_05900 32853 32215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 33943 32843 gene locus_tag LOCUS_05910 gene recA 33943 32843 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918971.1 protein_id gnl|my_center|LOCUS_05910 34895 34032 gene locus_tag LOCUS_05920 gene prmC 34895 34032 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083051.1 protein_id gnl|my_center|LOCUS_05920 35845 34889 gene locus_tag LOCUS_05930 35845 34889 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421392.1 protein_id gnl|my_center|LOCUS_05930 37309 35855 gene locus_tag LOCUS_05940 37309 35855 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_05940 37983 37297 gene locus_tag LOCUS_05950 37983 37297 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896932.1 protein_id gnl|my_center|LOCUS_05950 39327 37999 gene locus_tag LOCUS_05960 39327 37999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 42885 39415 gene locus_tag LOCUS_05970 42885 39415 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_05970 43794 42889 gene locus_tag LOCUS_05980 gene whiA 43794 42889 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_05980 44832 43819 gene locus_tag LOCUS_05990 44832 43819 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891913.1 protein_id gnl|my_center|LOCUS_05990 45703 44837 gene locus_tag LOCUS_06000 gene rapZ 45703 44837 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_06000 46624 45713 gene locus_tag LOCUS_06010 gene murB 46624 45713 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641067.1 protein_id gnl|my_center|LOCUS_06010 47855 46917 gene locus_tag LOCUS_06020 gene hprK 47855 46917 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_06020 48108 48296 gene locus_tag LOCUS_06030 gene rpmB 48108 48296 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_06030 49202 48654 gene locus_tag LOCUS_06040 49202 48654 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081283.1 protein_id gnl|my_center|LOCUS_06040 50596 49265 gene locus_tag LOCUS_06050 gene der 50596 49265 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_06050 51057 50872 gene locus_tag LOCUS_06060 gene rpmF 51057 50872 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362601.1 protein_id gnl|my_center|LOCUS_06060 51602 51099 gene locus_tag LOCUS_06070 51602 51099 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419111.1 protein_id gnl|my_center|LOCUS_06070 51792 52745 gene locus_tag LOCUS_06080 51792 52745 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_06080 52902 54032 gene locus_tag LOCUS_06090 52902 54032 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_06090 54022 54840 gene locus_tag LOCUS_06100 54022 54840 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_06100 54837 55655 gene locus_tag LOCUS_06110 54837 55655 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_06110 55655 56851 gene locus_tag LOCUS_06120 55655 56851 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_06120 57440 57195 gene locus_tag LOCUS_06130 57440 57195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 58495 57929 gene locus_tag LOCUS_06140 58495 57929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 59166 58795 gene locus_tag LOCUS_06150 59166 58795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 59523 59341 gene locus_tag LOCUS_06160 59523 59341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 59738 59523 gene locus_tag LOCUS_06170 59738 59523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 59925 59731 gene locus_tag LOCUS_06180 59925 59731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 60098 60367 gene locus_tag LOCUS_06190 60098 60367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 60481 60834 gene locus_tag LOCUS_06200 60481 60834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 60845 61003 gene locus_tag LOCUS_06210 60845 61003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 61000 61305 gene locus_tag LOCUS_06220 61000 61305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 61310 61561 gene locus_tag LOCUS_06230 61310 61561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 63451 62012 gene locus_tag LOCUS_06240 63451 62012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 63989 63417 gene locus_tag LOCUS_06250 63989 63417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 64357 63986 gene locus_tag LOCUS_06260 64357 63986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 64691 64377 gene locus_tag LOCUS_06270 64691 64377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 65082 64678 gene locus_tag LOCUS_06280 65082 64678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 65710 65102 gene locus_tag LOCUS_06290 65710 65102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 65989 65789 gene locus_tag LOCUS_06300 65989 65789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 67447 66188 gene locus_tag LOCUS_06310 gene dnaB 67447 66188 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549341.1 protein_id gnl|my_center|LOCUS_06310 68190 67447 gene locus_tag LOCUS_06320 68190 67447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 68609 68190 gene locus_tag LOCUS_06330 68609 68190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 68859 68599 gene locus_tag LOCUS_06340 68859 68599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 69047 68856 gene locus_tag LOCUS_06350 69047 68856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 69193 69915 gene locus_tag LOCUS_06360 69193 69915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 69919 71307 gene locus_tag LOCUS_06370 69919 71307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 71525 71449 gene locus_tag LOCUS_t00050 71525 71449 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 71905 73248 gene locus_tag LOCUS_06380 gene ssnA 71905 73248 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359625.1 protein_id gnl|my_center|LOCUS_06380 73449 76397 gene locus_tag LOCUS_06390 gene ygfK 73449 76397 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387142.1 protein_id gnl|my_center|LOCUS_06390 76644 77999 gene locus_tag LOCUS_06400 76644 77999 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_06400 >Feature sequence07 311 1030 gene locus_tag LOCUS_06410 311 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 1885 1259 gene locus_tag LOCUS_06420 1885 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 2704 1928 gene locus_tag LOCUS_06430 2704 1928 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_06430 3423 2722 gene locus_tag LOCUS_06440 3423 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 4230 3472 gene locus_tag LOCUS_06450 4230 3472 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964759.1 protein_id gnl|my_center|LOCUS_06450 5024 4227 gene locus_tag LOCUS_06460 5024 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 6330 5248 gene locus_tag LOCUS_06470 gene ftsZ 6330 5248 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890867.1 protein_id gnl|my_center|LOCUS_06470 7277 6486 gene locus_tag LOCUS_06480 7277 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 8621 7341 gene locus_tag LOCUS_06490 gene murA 8621 7341 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143118.1 protein_id gnl|my_center|LOCUS_06490 9803 8676 gene locus_tag LOCUS_06500 gene murG 9803 8676 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286637.1 protein_id gnl|my_center|LOCUS_06500 11102 9918 gene locus_tag LOCUS_06510 gene spoVE 11102 9918 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_06510 12110 11133 gene locus_tag LOCUS_06520 gene mraY 12110 11133 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965426.1 protein_id gnl|my_center|LOCUS_06520 13522 12143 gene locus_tag LOCUS_06530 13522 12143 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246696.1 protein_id gnl|my_center|LOCUS_06530 14970 13519 gene locus_tag LOCUS_06540 14970 13519 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_06540 17401 15008 gene locus_tag LOCUS_06550 17401 15008 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_06550 18078 17533 gene locus_tag LOCUS_06560 18078 17533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 19050 18118 gene locus_tag LOCUS_06570 gene rsmH 19050 18118 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_06570 19466 19050 gene locus_tag LOCUS_06580 gene mraZ 19466 19050 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625480.1 protein_id gnl|my_center|LOCUS_06580 22010 19638 gene locus_tag LOCUS_06590 22010 19638 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585669.1 protein_id gnl|my_center|LOCUS_06590 22174 22344 gene locus_tag LOCUS_06600 22174 22344 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963626.1 protein_id gnl|my_center|LOCUS_06600 22544 23254 gene locus_tag LOCUS_06610 22544 23254 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674542.1 protein_id gnl|my_center|LOCUS_06610 23256 24092 gene locus_tag LOCUS_06620 gene rsmI 23256 24092 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435873.1 protein_id gnl|my_center|LOCUS_06620 25552 24149 gene locus_tag LOCUS_06630 25552 24149 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389802.1 protein_id gnl|my_center|LOCUS_06630 26327 27016 gene locus_tag LOCUS_06640 26327 27016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 27913 27293 gene locus_tag LOCUS_06650 27913 27293 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_06650 28418 27915 gene locus_tag LOCUS_06660 28418 27915 CDS product TIGR04002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888217.1 protein_id gnl|my_center|LOCUS_06660 29275 28415 gene locus_tag LOCUS_06670 29275 28415 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428191.1 protein_id gnl|my_center|LOCUS_06670 29516 29890 gene locus_tag LOCUS_06680 29516 29890 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_06680 30010 30726 gene locus_tag LOCUS_06690 30010 30726 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232924.1 protein_id gnl|my_center|LOCUS_06690 31718 30780 gene locus_tag LOCUS_06700 gene metA 31718 30780 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462040.1 protein_id gnl|my_center|LOCUS_06700 33009 31708 gene locus_tag LOCUS_06710 33009 31708 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_06710 33721 33062 gene locus_tag LOCUS_06720 33721 33062 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_06720 34387 33782 gene locus_tag LOCUS_06730 34387 33782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 37397 34563 gene locus_tag LOCUS_06740 37397 34563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 38242 37412 gene locus_tag LOCUS_06750 38242 37412 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546705.1 protein_id gnl|my_center|LOCUS_06750 39047 38334 gene locus_tag LOCUS_06760 39047 38334 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392585.1 protein_id gnl|my_center|LOCUS_06760 39584 39099 gene locus_tag LOCUS_06770 39584 39099 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_06770 39721 40191 gene locus_tag LOCUS_06780 gene ybaK 39721 40191 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_06780 40206 40457 gene locus_tag LOCUS_06790 40206 40457 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761253.1 protein_id gnl|my_center|LOCUS_06790 40489 40866 gene locus_tag LOCUS_06800 40489 40866 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668289.1 protein_id gnl|my_center|LOCUS_06800 43157 41127 gene locus_tag LOCUS_06810 43157 41127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 43412 43498 gene locus_tag LOCUS_t00060 43412 43498 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 43761 45344 gene locus_tag LOCUS_06820 43761 45344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 48832 45602 gene locus_tag LOCUS_06830 48832 45602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 49172 48978 gene locus_tag LOCUS_06840 49172 48978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 51077 49488 gene locus_tag LOCUS_06850 51077 49488 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_06850 51616 51257 gene locus_tag LOCUS_06860 51616 51257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 51933 51613 gene locus_tag LOCUS_06870 51933 51613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 52755 51937 gene locus_tag LOCUS_06880 52755 51937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 53929 52775 gene locus_tag LOCUS_06890 53929 52775 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258870.1 protein_id gnl|my_center|LOCUS_06890 54294 55673 gene locus_tag LOCUS_06900 gene mgtE 54294 55673 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_06900 56005 55742 gene locus_tag LOCUS_06910 56005 55742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 56484 56017 gene locus_tag LOCUS_06920 56484 56017 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_06920 56672 56535 gene locus_tag LOCUS_06930 56672 56535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 57106 56732 gene locus_tag LOCUS_06940 57106 56732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 57927 57103 gene locus_tag LOCUS_06950 gene yqeB 57927 57103 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393498.1 protein_id gnl|my_center|LOCUS_06950 58586 57915 gene locus_tag LOCUS_06960 gene yqeC 58586 57915 CDS product selenium cofactor biosynthesis protein YqeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459386.1 protein_id gnl|my_center|LOCUS_06960 58705 59466 gene locus_tag LOCUS_06970 58705 59466 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861298.1 protein_id gnl|my_center|LOCUS_06970 60415 59648 gene locus_tag LOCUS_06980 gene spo0A 60415 59648 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393014.1 protein_id gnl|my_center|LOCUS_06980 62192 60732 gene locus_tag LOCUS_06990 62192 60732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 63614 62205 gene locus_tag LOCUS_07000 63614 62205 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_07000 63895 64662 gene locus_tag LOCUS_07010 63895 64662 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719088.1 protein_id gnl|my_center|LOCUS_07010 65520 65134 gene locus_tag LOCUS_07020 65520 65134 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869552.1 protein_id gnl|my_center|LOCUS_07020 65809 66174 gene locus_tag LOCUS_07030 65809 66174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 67232 66228 gene locus_tag LOCUS_07040 67232 66228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 68153 67233 gene locus_tag LOCUS_07050 gene pyrF 68153 67233 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_07050 68286 68456 gene locus_tag LOCUS_07060 68286 68456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 68864 68499 gene locus_tag LOCUS_07070 68864 68499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 69252 69022 gene locus_tag LOCUS_07080 69252 69022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 70642 69641 gene locus_tag LOCUS_07090 70642 69641 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_07090 71353 70661 gene locus_tag LOCUS_07100 71353 70661 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_07100 72044 71508 gene locus_tag LOCUS_07110 72044 71508 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130536.1 protein_id gnl|my_center|LOCUS_07110 73165 72518 gene locus_tag LOCUS_07120 gene upp 73165 72518 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815407.1 protein_id gnl|my_center|LOCUS_07120 73894 73190 gene locus_tag LOCUS_07130 gene tsaB 73894 73190 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865764.1 protein_id gnl|my_center|LOCUS_07130 74318 73875 gene locus_tag LOCUS_07140 gene tsaE 74318 73875 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476188.1 protein_id gnl|my_center|LOCUS_07140 74492 75643 gene locus_tag LOCUS_07150 gene rodA 74492 75643 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_07150 >Feature sequence08 614 141 gene locus_tag LOCUS_07160 614 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 1785 604 gene locus_tag LOCUS_07170 gene thiI 1785 604 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_07170 3346 1820 gene locus_tag LOCUS_07180 3346 1820 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_07180 3568 7122 gene locus_tag LOCUS_07190 gene nifJ 3568 7122 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965527.1 protein_id gnl|my_center|LOCUS_07190 8068 7184 gene locus_tag LOCUS_07200 gene dapA 8068 7184 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_07200 9180 8092 gene locus_tag LOCUS_07210 gene asd 9180 8092 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963351.1 protein_id gnl|my_center|LOCUS_07210 9393 10418 gene locus_tag LOCUS_07220 gene queA 9393 10418 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_07220 10671 10937 gene locus_tag LOCUS_07230 10671 10937 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301196.1 protein_id gnl|my_center|LOCUS_07230 10950 11243 gene locus_tag LOCUS_07240 10950 11243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 11389 12519 gene locus_tag LOCUS_07250 gene tgt 11389 12519 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_07250 12621 12989 gene locus_tag LOCUS_07260 gene yajC 12621 12989 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_07260 13059 13286 gene locus_tag LOCUS_07270 13059 13286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 14968 13376 gene locus_tag LOCUS_07280 14968 13376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 15534 15097 gene locus_tag LOCUS_07290 gene aroQ 15534 15097 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964217.1 protein_id gnl|my_center|LOCUS_07290 16751 15531 gene locus_tag LOCUS_07300 16751 15531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 17893 16751 gene locus_tag LOCUS_07310 gene pheA 17893 16751 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_07310 18971 17907 gene locus_tag LOCUS_07320 gene aroC 18971 17907 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_07320 20230 18968 gene locus_tag LOCUS_07330 gene aroA 20230 18968 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_07330 21285 20227 gene locus_tag LOCUS_07340 gene aroB 21285 20227 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775572.1 protein_id gnl|my_center|LOCUS_07340 22115 21282 gene locus_tag LOCUS_07350 22115 21282 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_07350 23116 22112 gene locus_tag LOCUS_07360 gene aroF 23116 22112 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_07360 23431 23790 gene locus_tag LOCUS_07370 23431 23790 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459275.1 protein_id gnl|my_center|LOCUS_07370 23792 25591 gene locus_tag LOCUS_07380 23792 25591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 25657 25914 gene locus_tag LOCUS_07390 25657 25914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 25911 27155 gene locus_tag LOCUS_07400 25911 27155 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_07400 27160 28548 gene locus_tag LOCUS_07410 27160 28548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 28614 29378 gene locus_tag LOCUS_07420 28614 29378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 29405 30808 gene locus_tag LOCUS_07430 29405 30808 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_07430 30820 31917 gene locus_tag LOCUS_07440 30820 31917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 32038 33414 gene locus_tag LOCUS_07450 32038 33414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 33989 33633 gene locus_tag LOCUS_07460 33989 33633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 34787 34101 gene locus_tag LOCUS_07470 34787 34101 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665989.1 protein_id gnl|my_center|LOCUS_07470 34882 35169 gene locus_tag LOCUS_07480 34882 35169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 36190 35207 gene locus_tag LOCUS_07490 36190 35207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 36467 36540 gene locus_tag LOCUS_t00070 36467 36540 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 36613 37095 gene locus_tag LOCUS_07500 36613 37095 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385459.1 protein_id gnl|my_center|LOCUS_07500 37431 39731 gene locus_tag LOCUS_07510 37431 39731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07510 39644 41104 gene locus_tag LOCUS_07520 39644 41104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07520 41120 45043 gene locus_tag LOCUS_07530 41120 45043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 45469 45708 gene locus_tag LOCUS_07540 45469 45708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 45803 46228 gene locus_tag LOCUS_07550 gene rpsL 45803 46228 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_07550 46389 46859 gene locus_tag LOCUS_07560 gene rpsG 46389 46859 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421180.1 protein_id gnl|my_center|LOCUS_07560 46878 48956 gene locus_tag LOCUS_07570 gene fusA 46878 48956 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_07570 49087 50343 gene locus_tag LOCUS_07580 gene tuf 49087 50343 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_07580 50749 51153 gene locus_tag LOCUS_07590 50749 51153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 51098 53293 gene locus_tag LOCUS_07600 51098 53293 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_07600 53293 53955 gene locus_tag LOCUS_07610 53293 53955 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973102.1 protein_id gnl|my_center|LOCUS_07610 53963 54994 gene locus_tag LOCUS_07620 53963 54994 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393848.1 protein_id gnl|my_center|LOCUS_07620 56133 55234 gene locus_tag LOCUS_07630 56133 55234 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_07630 56243 57706 gene locus_tag LOCUS_07640 56243 57706 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_07640 57710 58408 gene locus_tag LOCUS_07650 57710 58408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 58685 60478 gene locus_tag LOCUS_07660 58685 60478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 60635 60874 gene locus_tag LOCUS_07670 60635 60874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 60871 62769 gene locus_tag LOCUS_07680 60871 62769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 63332 62958 gene locus_tag LOCUS_07690 63332 62958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 63909 63379 gene locus_tag LOCUS_07700 gene rplJ 63909 63379 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700677.1 protein_id gnl|my_center|LOCUS_07700 64777 64088 gene locus_tag LOCUS_07710 gene rplA 64777 64088 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_07710 65292 64867 gene locus_tag LOCUS_07720 gene rplK 65292 64867 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966425.1 protein_id gnl|my_center|LOCUS_07720 65907 65383 gene locus_tag LOCUS_07730 gene nusG 65907 65383 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_07730 66149 65916 gene locus_tag LOCUS_07740 66149 65916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 66334 66185 gene locus_tag LOCUS_07750 gene rpmG 66334 66185 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_07750 67675 66662 gene locus_tag LOCUS_07760 67675 66662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 68462 68016 gene locus_tag LOCUS_07770 68462 68016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 69146 68562 gene locus_tag LOCUS_07780 69146 68562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 69450 69689 gene locus_tag LOCUS_07790 69450 69689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 69889 70077 gene locus_tag LOCUS_07800 69889 70077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 >Feature sequence09 1947 673 gene locus_tag LOCUS_07810 gene obgE 1947 673 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_07810 2488 2207 gene locus_tag LOCUS_07820 gene rpmA 2488 2207 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726866.1 protein_id gnl|my_center|LOCUS_07820 2816 2481 gene locus_tag LOCUS_07830 2816 2481 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016913.1 protein_id gnl|my_center|LOCUS_07830 3137 2820 gene locus_tag LOCUS_07840 gene rplU 3137 2820 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048023.1 protein_id gnl|my_center|LOCUS_07840 3735 3304 gene locus_tag LOCUS_07850 3735 3304 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355850.1 protein_id gnl|my_center|LOCUS_07850 5215 3827 gene locus_tag LOCUS_07860 gene gltA 5215 3827 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_07860 6086 5232 gene locus_tag LOCUS_07870 6086 5232 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932161.1 protein_id gnl|my_center|LOCUS_07870 7096 6191 gene locus_tag LOCUS_07880 gene gluQRS 7096 6191 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_07880 8961 7201 gene locus_tag LOCUS_07890 8961 7201 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_07890 9122 9796 gene locus_tag LOCUS_07900 9122 9796 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_07900 9793 11439 gene locus_tag LOCUS_07910 9793 11439 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_07910 11672 13423 gene locus_tag LOCUS_07920 11672 13423 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_07920 13601 13526 gene locus_tag LOCUS_t00080 13601 13526 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 14917 13664 gene locus_tag LOCUS_07930 14917 13664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 15811 14945 gene locus_tag LOCUS_07940 15811 14945 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_07940 18061 15827 gene locus_tag LOCUS_07950 gene gyrA 18061 15827 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632827.1 protein_id gnl|my_center|LOCUS_07950 20070 18088 gene locus_tag LOCUS_07960 gene gyrB 20070 18088 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_07960 20362 21846 gene locus_tag LOCUS_07970 20362 21846 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_07970 21887 23236 gene locus_tag LOCUS_07980 21887 23236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 23270 23464 gene locus_tag LOCUS_07990 23270 23464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 24231 23659 gene locus_tag LOCUS_08000 24231 23659 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_08000 24368 24562 gene locus_tag LOCUS_08010 24368 24562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 24710 25492 gene locus_tag LOCUS_08020 24710 25492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 25496 27109 gene locus_tag LOCUS_08030 25496 27109 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_08030 27322 28416 gene locus_tag LOCUS_08040 27322 28416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 29081 28413 gene locus_tag LOCUS_08050 29081 28413 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722821.1 protein_id gnl|my_center|LOCUS_08050 29310 29738 gene locus_tag LOCUS_08060 29310 29738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 29752 30201 gene locus_tag LOCUS_08070 29752 30201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 31435 30563 gene locus_tag LOCUS_08080 31435 30563 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_08080 31641 32864 gene locus_tag LOCUS_08090 31641 32864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 32917 34647 gene locus_tag LOCUS_08100 32917 34647 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_08100 34664 35689 gene locus_tag LOCUS_08110 34664 35689 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770826.1 protein_id gnl|my_center|LOCUS_08110 36305 35673 gene locus_tag LOCUS_08120 36305 35673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 36809 37342 gene locus_tag LOCUS_08130 36809 37342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 37994 37335 gene locus_tag LOCUS_08140 37994 37335 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810083.1 protein_id gnl|my_center|LOCUS_08140 38082 39830 gene locus_tag LOCUS_08150 38082 39830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680150.1 protein_id gnl|my_center|LOCUS_08150 41431 40070 gene locus_tag LOCUS_08160 41431 40070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 41851 41576 gene locus_tag LOCUS_08170 41851 41576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 42402 41926 gene locus_tag LOCUS_08180 42402 41926 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_08180 42532 43605 gene locus_tag LOCUS_08190 42532 43605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 44191 43766 gene locus_tag LOCUS_08200 44191 43766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 45257 44193 gene locus_tag LOCUS_08210 45257 44193 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_08210 45434 45850 gene locus_tag LOCUS_08220 45434 45850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 46281 45787 gene locus_tag LOCUS_08230 46281 45787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08230 49266 46780 gene locus_tag LOCUS_08240 49266 46780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 49737 49516 gene locus_tag LOCUS_08250 49737 49516 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_08250 50023 49781 gene locus_tag LOCUS_08260 50023 49781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 50305 50565 gene locus_tag LOCUS_08270 50305 50565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 50751 51557 gene locus_tag LOCUS_08280 50751 51557 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_08280 51626 52507 gene locus_tag LOCUS_08290 gene pstC 51626 52507 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_08290 52509 53372 gene locus_tag LOCUS_08300 gene pstA 52509 53372 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432350.1 protein_id gnl|my_center|LOCUS_08300 53444 54199 gene locus_tag LOCUS_08310 gene pstB 53444 54199 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_08310 54199 54849 gene locus_tag LOCUS_08320 gene phoU 54199 54849 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_08320 54846 55520 gene locus_tag LOCUS_08330 54846 55520 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_08330 55517 57175 gene locus_tag LOCUS_08340 55517 57175 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_08340 57352 58179 gene locus_tag LOCUS_08350 57352 58179 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805101.1 protein_id gnl|my_center|LOCUS_08350 58424 59536 gene locus_tag LOCUS_08360 58424 59536 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729265.1 protein_id gnl|my_center|LOCUS_08360 60481 59783 gene locus_tag LOCUS_08370 60481 59783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 62678 60516 gene locus_tag LOCUS_08380 62678 60516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 64453 63008 gene locus_tag LOCUS_08390 64453 63008 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_08390 65830 64457 gene locus_tag LOCUS_08400 gene trkA 65830 64457 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_08400 65992 66468 gene locus_tag LOCUS_08410 65992 66468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence10 227 1486 gene locus_tag LOCUS_08420 gene hflX 227 1486 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804682.1 protein_id gnl|my_center|LOCUS_08420 1490 2107 gene locus_tag LOCUS_08430 1490 2107 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249474.1 protein_id gnl|my_center|LOCUS_08430 2177 3181 gene locus_tag LOCUS_08440 2177 3181 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_08440 3197 4936 gene locus_tag LOCUS_08450 gene dnaG 3197 4936 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896376.1 protein_id gnl|my_center|LOCUS_08450 4940 6115 gene locus_tag LOCUS_08460 gene rpoD 4940 6115 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_08460 6225 6443 gene locus_tag LOCUS_08470 gene acpP 6225 6443 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631656.1 protein_id gnl|my_center|LOCUS_08470 7043 8707 gene locus_tag LOCUS_08480 7043 8707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 8739 9092 gene locus_tag LOCUS_08490 8739 9092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 9110 9688 gene locus_tag LOCUS_08500 gene recR 9110 9688 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963454.1 protein_id gnl|my_center|LOCUS_08500 11030 9735 gene locus_tag LOCUS_08510 11030 9735 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007785170.1 protein_id gnl|my_center|LOCUS_08510 11753 11034 gene locus_tag LOCUS_08520 11753 11034 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812913.1 protein_id gnl|my_center|LOCUS_08520 11949 12275 gene locus_tag LOCUS_08530 11949 12275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 12308 14323 gene locus_tag LOCUS_08540 12308 14323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 14368 14724 gene locus_tag LOCUS_08550 14368 14724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 15288 14797 gene locus_tag LOCUS_08560 15288 14797 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_08560 16938 15301 gene locus_tag LOCUS_08570 16938 15301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 17741 16935 gene locus_tag LOCUS_08580 gene pgeF 17741 16935 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_08580 18208 17750 gene locus_tag LOCUS_08590 18208 17750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 21150 18382 gene locus_tag LOCUS_08600 gene secA 21150 18382 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_08600 21345 22172 gene locus_tag LOCUS_08610 21345 22172 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480161.1 protein_id gnl|my_center|LOCUS_08610 22173 22946 gene locus_tag LOCUS_08620 22173 22946 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_08620 22958 23665 gene locus_tag LOCUS_08630 22958 23665 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_08630 23953 25197 gene locus_tag LOCUS_08640 23953 25197 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_08640 25430 26707 gene locus_tag LOCUS_08650 25430 26707 CDS product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222431737.1 protein_id gnl|my_center|LOCUS_08650 26809 29370 gene locus_tag LOCUS_08660 26809 29370 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_08660 29856 30887 gene locus_tag LOCUS_08670 29856 30887 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_08670 30884 31270 gene locus_tag LOCUS_08680 30884 31270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 31267 31776 gene locus_tag LOCUS_08690 31267 31776 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399375.1 protein_id gnl|my_center|LOCUS_08690 31817 33163 gene locus_tag LOCUS_08700 gene rsxC 31817 33163 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_08700 33160 34065 gene locus_tag LOCUS_08710 33160 34065 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_08710 34062 34604 gene locus_tag LOCUS_08720 34062 34604 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902280.1 protein_id gnl|my_center|LOCUS_08720 34601 35278 gene locus_tag LOCUS_08730 34601 35278 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948148.1 protein_id gnl|my_center|LOCUS_08730 35275 35871 gene locus_tag LOCUS_08740 gene rsxA 35275 35871 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_08740 35885 36700 gene locus_tag LOCUS_08750 35885 36700 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_08750 36849 37868 gene locus_tag LOCUS_08760 36849 37868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 39513 38110 gene locus_tag LOCUS_08770 39513 38110 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_08770 39852 40190 gene locus_tag LOCUS_08780 39852 40190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 40295 40528 gene locus_tag LOCUS_08790 40295 40528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 40538 40903 gene locus_tag LOCUS_08800 40538 40903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 40897 41313 gene locus_tag LOCUS_08810 40897 41313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 41331 41588 gene locus_tag LOCUS_08820 41331 41588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 41572 42216 gene locus_tag LOCUS_08830 41572 42216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 42229 42405 gene locus_tag LOCUS_08840 42229 42405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 42389 42550 gene locus_tag LOCUS_08850 42389 42550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 42547 43404 gene locus_tag LOCUS_08860 42547 43404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 43394 43741 gene locus_tag LOCUS_08870 43394 43741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 43762 44403 gene locus_tag LOCUS_08880 43762 44403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 44418 45086 gene locus_tag LOCUS_08890 44418 45086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 45127 45462 gene locus_tag LOCUS_08900 45127 45462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 45487 46131 gene locus_tag LOCUS_08910 45487 46131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 46119 53060 gene locus_tag LOCUS_08920 46119 53060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 53470 53111 gene locus_tag LOCUS_08930 53470 53111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 53505 53702 gene locus_tag LOCUS_08940 53505 53702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 54099 54341 gene locus_tag LOCUS_08950 54099 54341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 54446 55501 gene locus_tag LOCUS_08960 54446 55501 CDS product IS30-like element ISTde2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956682.1 protein_id gnl|my_center|LOCUS_08960 55654 56211 gene locus_tag LOCUS_08970 55654 56211 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_08970 56763 56269 gene locus_tag LOCUS_08980 56763 56269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 57380 56760 gene locus_tag LOCUS_08990 57380 56760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 58111 57398 gene locus_tag LOCUS_09000 58111 57398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 58911 58114 gene locus_tag LOCUS_09010 58911 58114 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023395.1 protein_id gnl|my_center|LOCUS_09010 59602 58904 gene locus_tag LOCUS_09020 59602 58904 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811515.1 protein_id gnl|my_center|LOCUS_09020 59855 60739 gene locus_tag LOCUS_09030 59855 60739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 60736 61923 gene locus_tag LOCUS_09040 60736 61923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 63002 62196 gene locus_tag LOCUS_09050 63002 62196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816588.1 protein_id gnl|my_center|LOCUS_09050 63691 62987 gene locus_tag LOCUS_09060 63691 62987 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_09060 64067 63672 gene locus_tag LOCUS_09070 64067 63672 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687513.1 protein_id gnl|my_center|LOCUS_09070 64240 64755 gene locus_tag LOCUS_09080 64240 64755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 64779 65177 gene locus_tag LOCUS_09090 64779 65177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 65174 65908 gene locus_tag LOCUS_09100 gene truA 65174 65908 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294728.1 protein_id gnl|my_center|LOCUS_09100 >Feature sequence11 491 877 gene locus_tag LOCUS_09110 491 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 864 2873 gene locus_tag LOCUS_09120 864 2873 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_09120 2918 4300 gene locus_tag LOCUS_09130 2918 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 4332 4868 gene locus_tag LOCUS_09140 4332 4868 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904331.1 protein_id gnl|my_center|LOCUS_09140 5297 5052 gene locus_tag LOCUS_09150 5297 5052 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_09150 8135 5751 gene locus_tag LOCUS_09160 gene pheT 8135 5751 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_09160 9180 8152 gene locus_tag LOCUS_09170 gene pheS 9180 8152 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403382.1 protein_id gnl|my_center|LOCUS_09170 9571 10440 gene locus_tag LOCUS_09180 9571 10440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 10454 11062 gene locus_tag LOCUS_09190 10454 11062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 11034 12212 gene locus_tag LOCUS_09200 gene alr 11034 12212 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048315.1 protein_id gnl|my_center|LOCUS_09200 12339 12701 gene locus_tag LOCUS_09210 12339 12701 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_09210 14407 12917 gene locus_tag LOCUS_09220 gene gltX 14407 12917 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_09220 14547 15539 gene locus_tag LOCUS_09230 gene trpS 14547 15539 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817343.1 protein_id gnl|my_center|LOCUS_09230 15554 16675 gene locus_tag LOCUS_09240 15554 16675 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966159.1 protein_id gnl|my_center|LOCUS_09240 16662 17813 gene locus_tag LOCUS_09250 gene wecB 16662 17813 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947987.1 protein_id gnl|my_center|LOCUS_09250 17843 18616 gene locus_tag LOCUS_09260 17843 18616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 18986 18603 gene locus_tag LOCUS_09270 18986 18603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 19382 19002 gene locus_tag LOCUS_09280 19382 19002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 19624 19379 gene locus_tag LOCUS_09290 19624 19379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 19672 20151 gene locus_tag LOCUS_09300 19672 20151 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016060.1 protein_id gnl|my_center|LOCUS_09300 20188 20955 gene locus_tag LOCUS_09310 20188 20955 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861999.1 protein_id gnl|my_center|LOCUS_09310 20952 22193 gene locus_tag LOCUS_09320 20952 22193 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027623.1 protein_id gnl|my_center|LOCUS_09320 22398 22213 gene locus_tag LOCUS_09330 22398 22213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 22484 23395 gene locus_tag LOCUS_09340 22484 23395 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102581.1 protein_id gnl|my_center|LOCUS_09340 23519 24928 gene locus_tag LOCUS_09350 23519 24928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 25132 25473 gene locus_tag LOCUS_09360 25132 25473 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396628.1 protein_id gnl|my_center|LOCUS_09360 25787 25530 gene locus_tag LOCUS_09370 25787 25530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 26496 26017 gene locus_tag LOCUS_09380 26496 26017 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_09380 27127 29673 gene locus_tag LOCUS_09390 27127 29673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 29666 33997 gene locus_tag LOCUS_09400 29666 33997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 34229 34498 gene locus_tag LOCUS_09410 34229 34498 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721327.1 protein_id gnl|my_center|LOCUS_09410 34508 35866 gene locus_tag LOCUS_09420 34508 35866 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_09420 35913 36968 gene locus_tag LOCUS_09430 35913 36968 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867187.1 protein_id gnl|my_center|LOCUS_09430 37157 38161 gene locus_tag LOCUS_09440 37157 38161 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459857.1 protein_id gnl|my_center|LOCUS_09440 38952 38218 gene locus_tag LOCUS_09450 gene surE 38952 38218 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951167.1 protein_id gnl|my_center|LOCUS_09450 41049 39358 gene locus_tag LOCUS_09460 41049 39358 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_09460 42940 41054 gene locus_tag LOCUS_09470 gene nuoF 42940 41054 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817338.1 protein_id gnl|my_center|LOCUS_09470 43422 42937 gene locus_tag LOCUS_09480 gene nuoE 43422 42937 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_09480 45080 43911 gene locus_tag LOCUS_09490 45080 43911 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_09490 45386 45105 gene locus_tag LOCUS_09500 45386 45105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 46727 45405 gene locus_tag LOCUS_09510 46727 45405 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015963.1 protein_id gnl|my_center|LOCUS_09510 48983 47070 gene locus_tag LOCUS_09520 48983 47070 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_09520 49881 49066 gene locus_tag LOCUS_09530 49881 49066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 50199 49915 gene locus_tag LOCUS_09540 50199 49915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 51251 50259 gene locus_tag LOCUS_09550 gene pfkA 51251 50259 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_09550 51483 52409 gene locus_tag LOCUS_09560 51483 52409 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887563.1 protein_id gnl|my_center|LOCUS_09560 52412 53383 gene locus_tag LOCUS_09570 52412 53383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 53380 55584 gene locus_tag LOCUS_09580 53380 55584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 55716 55792 gene locus_tag LOCUS_t00090 55716 55792 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence12 143 68 gene locus_tag LOCUS_t00100 143 68 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 361 678 gene locus_tag LOCUS_09590 361 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1970 675 gene locus_tag LOCUS_09600 gene mtaB 1970 675 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_09600 2181 2429 gene locus_tag LOCUS_09610 2181 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 2511 3659 gene locus_tag LOCUS_09620 2511 3659 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428267.1 protein_id gnl|my_center|LOCUS_09620 3758 5038 gene locus_tag LOCUS_09630 3758 5038 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018262.1 protein_id gnl|my_center|LOCUS_09630 5185 5598 gene locus_tag LOCUS_09640 5185 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_09640 6986 5808 gene locus_tag LOCUS_09650 6986 5808 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_09650 7165 7452 gene locus_tag LOCUS_09660 7165 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 7442 8686 gene locus_tag LOCUS_09670 7442 8686 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_09670 8700 9836 gene locus_tag LOCUS_09680 8700 9836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 9833 10705 gene locus_tag LOCUS_09690 9833 10705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 10775 11119 gene locus_tag LOCUS_09700 10775 11119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 11138 12166 gene locus_tag LOCUS_09710 11138 12166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 12172 12543 gene locus_tag LOCUS_09720 12172 12543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 12540 12878 gene locus_tag LOCUS_09730 12540 12878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 12866 13348 gene locus_tag LOCUS_09740 12866 13348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 13345 14397 gene locus_tag LOCUS_09750 13345 14397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 14409 14798 gene locus_tag LOCUS_09760 14409 14798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 14795 15463 gene locus_tag LOCUS_09770 14795 15463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 15405 15908 gene locus_tag LOCUS_09780 15405 15908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 15960 16490 gene locus_tag LOCUS_09790 15960 16490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 16487 17410 gene locus_tag LOCUS_09800 16487 17410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 17368 17787 gene locus_tag LOCUS_09810 17368 17787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 17788 18132 gene locus_tag LOCUS_09820 17788 18132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 18129 19187 gene locus_tag LOCUS_09830 18129 19187 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939995.1 protein_id gnl|my_center|LOCUS_09830 19184 19750 gene locus_tag LOCUS_09840 19184 19750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 20532 19918 gene locus_tag LOCUS_09850 20532 19918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 20716 20640 gene locus_tag LOCUS_t00110 20716 20640 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 21011 21988 gene locus_tag LOCUS_09860 21011 21988 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902145.1 protein_id gnl|my_center|LOCUS_09860 23095 21926 gene locus_tag LOCUS_09870 23095 21926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 23262 24632 gene locus_tag LOCUS_09880 gene murC 23262 24632 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_09880 24713 24919 gene locus_tag LOCUS_09890 24713 24919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 25048 24851 gene locus_tag LOCUS_09900 25048 24851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 27561 25432 gene locus_tag LOCUS_09910 gene pnp 27561 25432 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965114.1 protein_id gnl|my_center|LOCUS_09910 28006 27740 gene locus_tag LOCUS_09920 gene rpsO 28006 27740 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814361.1 protein_id gnl|my_center|LOCUS_09920 29488 28187 gene locus_tag LOCUS_09930 29488 28187 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_09930 29879 29742 gene locus_tag LOCUS_09940 29879 29742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 30758 29958 gene locus_tag LOCUS_09950 gene pdaA 30758 29958 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438596.1 protein_id gnl|my_center|LOCUS_09950 30941 30810 gene locus_tag LOCUS_09960 30941 30810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 32933 30951 gene locus_tag LOCUS_09970 gene feoB 32933 30951 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_09970 33181 32930 gene locus_tag LOCUS_09980 33181 32930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 33365 33796 gene locus_tag LOCUS_09990 33365 33796 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 protein_id gnl|my_center|LOCUS_09990 33860 34597 gene locus_tag LOCUS_10000 33860 34597 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360546.1 protein_id gnl|my_center|LOCUS_10000 35003 34677 gene locus_tag LOCUS_10010 35003 34677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 35419 35078 gene locus_tag LOCUS_10020 35419 35078 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901934.1 protein_id gnl|my_center|LOCUS_10020 35577 35705 gene locus_tag LOCUS_10030 35577 35705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 36686 35784 gene locus_tag LOCUS_10040 36686 35784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 37610 36843 gene locus_tag LOCUS_10050 gene spo0A 37610 36843 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_10050 39334 37829 gene locus_tag LOCUS_10060 39334 37829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 39687 39331 gene locus_tag LOCUS_10070 39687 39331 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888340.1 protein_id gnl|my_center|LOCUS_10070 39902 42115 gene locus_tag LOCUS_10080 39902 42115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 42236 43015 gene locus_tag LOCUS_10090 42236 43015 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_10090 42960 43832 gene locus_tag LOCUS_10100 42960 43832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_10100 44704 43937 gene locus_tag LOCUS_10110 gene spo0A 44704 43937 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_10110 45277 46788 gene locus_tag LOCUS_10120 45277 46788 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289202.1 protein_id gnl|my_center|LOCUS_10120 46802 47869 gene locus_tag LOCUS_10130 46802 47869 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082660.1 protein_id gnl|my_center|LOCUS_10130 47869 48792 gene locus_tag LOCUS_10140 47869 48792 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528958.1 protein_id gnl|my_center|LOCUS_10140 48851 49957 gene locus_tag LOCUS_10150 48851 49957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 50970 50041 gene locus_tag LOCUS_10160 50970 50041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 52072 51080 gene locus_tag LOCUS_10170 52072 51080 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363756.1 protein_id gnl|my_center|LOCUS_10170 53035 52166 gene locus_tag LOCUS_10180 53035 52166 CDS product IS1595-like element ISRsp21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076611897.1 protein_id gnl|my_center|LOCUS_10180 53172 53597 gene locus_tag LOCUS_10190 53172 53597 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051407.1 protein_id gnl|my_center|LOCUS_10190 55109 54123 gene locus_tag LOCUS_10200 55109 54123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence13 1121 690 gene locus_tag LOCUS_10210 1121 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1225 1389 gene locus_tag LOCUS_10220 1225 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1436 2923 gene locus_tag LOCUS_10230 gene glpK 1436 2923 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964631.1 protein_id gnl|my_center|LOCUS_10230 3700 3134 gene locus_tag LOCUS_10240 3700 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 4777 3992 gene locus_tag LOCUS_10250 4777 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 4911 5843 gene locus_tag LOCUS_10260 4911 5843 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963925.1 protein_id gnl|my_center|LOCUS_10260 5848 6783 gene locus_tag LOCUS_10270 5848 6783 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272315.1 protein_id gnl|my_center|LOCUS_10270 6798 7829 gene locus_tag LOCUS_10280 6798 7829 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141484866.1 protein_id gnl|my_center|LOCUS_10280 8120 10345 gene locus_tag LOCUS_10290 gene nrdD 8120 10345 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_10290 10504 11319 gene locus_tag LOCUS_10300 10504 11319 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358274.1 protein_id gnl|my_center|LOCUS_10300 12805 11372 gene locus_tag LOCUS_10310 12805 11372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 14070 12796 gene locus_tag LOCUS_10320 14070 12796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 14374 14195 gene locus_tag LOCUS_10330 14374 14195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 14565 14347 gene locus_tag LOCUS_10340 14565 14347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 14672 14875 gene locus_tag LOCUS_10350 14672 14875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10350 15445 15023 gene locus_tag LOCUS_10360 15445 15023 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948564.1 protein_id gnl|my_center|LOCUS_10360 16210 15455 gene locus_tag LOCUS_10370 16210 15455 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_10370 16310 16825 gene locus_tag LOCUS_10380 gene nrdG 16310 16825 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905258.1 protein_id gnl|my_center|LOCUS_10380 16842 17273 gene locus_tag LOCUS_10390 gene dutA 16842 17273 CDS product dUTP diphosphatase DutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245820.1 protein_id gnl|my_center|LOCUS_10390 18409 17318 gene locus_tag LOCUS_10400 18409 17318 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675020.1 protein_id gnl|my_center|LOCUS_10400 18612 20456 gene locus_tag LOCUS_10410 18612 20456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 20698 22146 gene locus_tag LOCUS_10420 20698 22146 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987157.1 protein_id gnl|my_center|LOCUS_10420 22288 22920 gene locus_tag LOCUS_10430 22288 22920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 22931 23365 gene locus_tag LOCUS_10440 22931 23365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 23434 25233 gene locus_tag LOCUS_10450 gene dnaK 23434 25233 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_10450 26425 25451 gene locus_tag LOCUS_10460 26425 25451 CDS product N(5)-(carboxyethyl)ornithine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706688.1 protein_id gnl|my_center|LOCUS_10460 26575 27012 gene locus_tag LOCUS_10470 26575 27012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 27058 27234 gene locus_tag LOCUS_10480 27058 27234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 27754 27263 gene locus_tag LOCUS_10490 27754 27263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 28111 29370 gene locus_tag LOCUS_10500 28111 29370 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_10500 29699 31144 gene locus_tag LOCUS_10510 29699 31144 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287397.1 protein_id gnl|my_center|LOCUS_10510 31349 32740 gene locus_tag LOCUS_10520 31349 32740 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_10520 33617 32967 gene locus_tag LOCUS_10530 gene rpe 33617 32967 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_10530 33769 33614 gene locus_tag LOCUS_10540 33769 33614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 33909 34637 gene locus_tag LOCUS_10550 33909 34637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 34650 35804 gene locus_tag LOCUS_10560 34650 35804 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_10560 35801 36808 gene locus_tag LOCUS_10570 35801 36808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 36417 36340 gene locus_tag LOCUS_t00120 36417 36340 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 36925 37086 gene locus_tag LOCUS_10580 36925 37086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 38670 37174 gene locus_tag LOCUS_10590 38670 37174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 39311 38766 gene locus_tag LOCUS_10600 gene yfcE 39311 38766 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_10600 39531 41633 gene locus_tag LOCUS_10610 39531 41633 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_10610 43329 41863 gene locus_tag LOCUS_10620 43329 41863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 44153 43437 gene locus_tag LOCUS_10630 44153 43437 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 protein_id gnl|my_center|LOCUS_10630 44394 44822 gene locus_tag LOCUS_10640 gene rplM 44394 44822 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_10640 44840 45244 gene locus_tag LOCUS_10650 gene rpsI 44840 45244 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079986.1 protein_id gnl|my_center|LOCUS_10650 46384 45578 gene locus_tag LOCUS_10660 46384 45578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 47198 46386 gene locus_tag LOCUS_10670 47198 46386 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860221.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence14 1199 132 gene locus_tag LOCUS_10680 1199 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 1885 1451 gene locus_tag LOCUS_10690 gene mscL 1885 1451 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707044.1 protein_id gnl|my_center|LOCUS_10690 3453 2128 gene locus_tag LOCUS_10700 gene serS 3453 2128 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_10700 4021 3467 gene locus_tag LOCUS_10710 4021 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 4893 4021 gene locus_tag LOCUS_10720 4893 4021 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_10720 5654 4896 gene locus_tag LOCUS_10730 5654 4896 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_10730 5833 6540 gene locus_tag LOCUS_10740 5833 6540 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387025.1 protein_id gnl|my_center|LOCUS_10740 6649 7134 gene locus_tag LOCUS_10750 6649 7134 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814644.1 protein_id gnl|my_center|LOCUS_10750 7205 8404 gene locus_tag LOCUS_10760 7205 8404 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_10760 8731 9507 gene locus_tag LOCUS_10770 gene tpiA 8731 9507 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_10770 11129 9768 gene locus_tag LOCUS_10780 11129 9768 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_10780 11392 11482 gene locus_tag LOCUS_t00130 11392 11482 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12298 11909 gene locus_tag LOCUS_10790 12298 11909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322028.1 protein_id gnl|my_center|LOCUS_10790 13278 12394 gene locus_tag LOCUS_10800 13278 12394 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023177.1 protein_id gnl|my_center|LOCUS_10800 13469 16150 gene locus_tag LOCUS_10810 13469 16150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 16461 16946 gene locus_tag LOCUS_10820 16461 16946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 17457 16933 gene locus_tag LOCUS_10830 17457 16933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 18068 17478 gene locus_tag LOCUS_10840 18068 17478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 18616 18065 gene locus_tag LOCUS_10850 18616 18065 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964405.1 protein_id gnl|my_center|LOCUS_10850 19369 18671 gene locus_tag LOCUS_10860 19369 18671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 19507 20586 gene locus_tag LOCUS_10870 gene prfA 19507 20586 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_10870 20789 21811 gene locus_tag LOCUS_10880 20789 21811 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868714.1 protein_id gnl|my_center|LOCUS_10880 21813 22415 gene locus_tag LOCUS_10890 gene coaE 21813 22415 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014305.1 protein_id gnl|my_center|LOCUS_10890 22412 23800 gene locus_tag LOCUS_10900 22412 23800 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667252.1 protein_id gnl|my_center|LOCUS_10900 23858 24775 gene locus_tag LOCUS_10910 23858 24775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 26853 25033 gene locus_tag LOCUS_10920 gene typA 26853 25033 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393394.1 protein_id gnl|my_center|LOCUS_10920 27052 27570 gene locus_tag LOCUS_10930 27052 27570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 29085 27940 gene locus_tag LOCUS_10940 29085 27940 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169508.1 protein_id gnl|my_center|LOCUS_10940 29993 29121 gene locus_tag LOCUS_10950 29993 29121 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082812.1 protein_id gnl|my_center|LOCUS_10950 30189 30746 gene locus_tag LOCUS_10960 30189 30746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10960 30683 31078 gene locus_tag LOCUS_10970 30683 31078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10970 31068 31877 gene locus_tag LOCUS_10980 31068 31877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 31874 34063 gene locus_tag LOCUS_10990 31874 34063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 34260 34736 gene locus_tag LOCUS_11000 34260 34736 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462052.1 protein_id gnl|my_center|LOCUS_11000 34823 35044 gene locus_tag LOCUS_11010 34823 35044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 36399 35107 gene locus_tag LOCUS_11020 36399 35107 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_11020 37422 36595 gene locus_tag LOCUS_11030 37422 36595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 38713 37436 gene locus_tag LOCUS_11040 38713 37436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 40668 38914 gene locus_tag LOCUS_11050 gene walK 40668 38914 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379340.1 protein_id gnl|my_center|LOCUS_11050 41415 40714 gene locus_tag LOCUS_11060 gene yycF 41415 40714 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357947.1 protein_id gnl|my_center|LOCUS_11060 42768 41431 gene locus_tag LOCUS_11070 42768 41431 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_11070 43257 42913 gene locus_tag LOCUS_11080 43257 42913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 44586 43495 gene locus_tag LOCUS_11090 44586 43495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 45720 44731 gene locus_tag LOCUS_11100 45720 44731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 46096 45713 gene locus_tag LOCUS_11110 46096 45713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 46375 46100 gene locus_tag LOCUS_11120 46375 46100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence15 1175 114 gene locus_tag LOCUS_11130 1175 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1339 2292 gene locus_tag LOCUS_11140 1339 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 3272 2403 gene locus_tag LOCUS_11150 3272 2403 CDS product IS1595-like element ISRsp21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076611897.1 protein_id gnl|my_center|LOCUS_11150 3509 3889 gene locus_tag LOCUS_11160 3509 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11160 3985 4293 gene locus_tag LOCUS_11170 3985 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11170 4411 4725 gene locus_tag LOCUS_11180 4411 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 6097 4799 gene locus_tag LOCUS_11190 6097 4799 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_11190 6812 6102 gene locus_tag LOCUS_11200 6812 6102 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_11200 7598 6825 gene locus_tag LOCUS_11210 7598 6825 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194783.1 protein_id gnl|my_center|LOCUS_11210 8559 7591 gene locus_tag LOCUS_11220 8559 7591 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_11220 9447 8572 gene locus_tag LOCUS_11230 9447 8572 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052441.1 protein_id gnl|my_center|LOCUS_11230 10780 9560 gene locus_tag LOCUS_11240 10780 9560 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775268.1 protein_id gnl|my_center|LOCUS_11240 11716 10826 gene locus_tag LOCUS_11250 gene dapA 11716 10826 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878410.1 protein_id gnl|my_center|LOCUS_11250 12758 11733 gene locus_tag LOCUS_11260 12758 11733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 13735 12755 gene locus_tag LOCUS_11270 13735 12755 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_11270 14649 13864 gene locus_tag LOCUS_11280 14649 13864 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460928.1 protein_id gnl|my_center|LOCUS_11280 15208 15741 gene locus_tag LOCUS_11290 15208 15741 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_11290 16731 16417 gene locus_tag LOCUS_11300 16731 16417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 16798 16986 gene locus_tag LOCUS_11310 16798 16986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 17525 17449 gene locus_tag LOCUS_t00140 17525 17449 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 18141 17734 gene locus_tag LOCUS_11320 18141 17734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 19644 18229 gene locus_tag LOCUS_11330 19644 18229 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_11330 20960 19944 gene locus_tag LOCUS_11340 gene pta 20960 19944 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067221.1 protein_id gnl|my_center|LOCUS_11340 21443 21096 gene locus_tag LOCUS_11350 21443 21096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 22110 21535 gene locus_tag LOCUS_11360 22110 21535 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817332.1 protein_id gnl|my_center|LOCUS_11360 22808 22131 gene locus_tag LOCUS_11370 22808 22131 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_11370 24078 22900 gene locus_tag LOCUS_11380 24078 22900 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898047.1 protein_id gnl|my_center|LOCUS_11380 24391 24092 gene locus_tag LOCUS_11390 24391 24092 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812779.1 protein_id gnl|my_center|LOCUS_11390 25674 24397 gene locus_tag LOCUS_11400 gene larA 25674 24397 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948687.1 protein_id gnl|my_center|LOCUS_11400 26785 25733 gene locus_tag LOCUS_11410 26785 25733 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393144.1 protein_id gnl|my_center|LOCUS_11410 28244 26796 gene locus_tag LOCUS_11420 28244 26796 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399436.1 protein_id gnl|my_center|LOCUS_11420 28997 28317 gene locus_tag LOCUS_11430 28997 28317 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017137.1 protein_id gnl|my_center|LOCUS_11430 31854 29059 gene locus_tag LOCUS_11440 31854 29059 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392899.1 protein_id gnl|my_center|LOCUS_11440 33036 31861 gene locus_tag LOCUS_11450 33036 31861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 33586 33023 gene locus_tag LOCUS_11460 33586 33023 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808093.1 protein_id gnl|my_center|LOCUS_11460 35062 33599 gene locus_tag LOCUS_11470 35062 33599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 35519 35055 gene locus_tag LOCUS_11480 35519 35055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 36569 35598 gene locus_tag LOCUS_11490 36569 35598 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896747.1 protein_id gnl|my_center|LOCUS_11490 38074 36587 gene locus_tag LOCUS_11500 38074 36587 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860721.1 protein_id gnl|my_center|LOCUS_11500 39323 38208 gene locus_tag LOCUS_11510 39323 38208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 40586 39429 gene locus_tag LOCUS_11520 40586 39429 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454238.1 protein_id gnl|my_center|LOCUS_11520 41927 40599 gene locus_tag LOCUS_11530 41927 40599 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707738.1 protein_id gnl|my_center|LOCUS_11530 42336 41929 gene locus_tag LOCUS_11540 42336 41929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 43523 42339 gene locus_tag LOCUS_11550 43523 42339 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038984.1 protein_id gnl|my_center|LOCUS_11550 44924 43551 gene locus_tag LOCUS_11560 44924 43551 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454646.1 protein_id gnl|my_center|LOCUS_11560 45639 45917 gene locus_tag LOCUS_11570 45639 45917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence16 259 185 gene locus_tag LOCUS_t00150 259 185 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 377 302 gene locus_tag LOCUS_t00160 377 302 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 459 384 gene locus_tag LOCUS_t00170 459 384 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 573 497 gene locus_tag LOCUS_t00180 573 497 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 656 581 gene locus_tag LOCUS_t00190 656 581 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1333 809 gene locus_tag LOCUS_11580 1333 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1372 1638 gene locus_tag LOCUS_11590 1372 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 2847 1687 gene locus_tag LOCUS_11600 2847 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 4248 2857 gene locus_tag LOCUS_11610 4248 2857 CDS product MBOAT family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035887521.1 protein_id gnl|my_center|LOCUS_11610 4466 4251 gene locus_tag LOCUS_11620 4466 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 5275 4487 gene locus_tag LOCUS_11630 5275 4487 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476135.1 protein_id gnl|my_center|LOCUS_11630 5421 6644 gene locus_tag LOCUS_11640 5421 6644 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_11640 6641 8230 gene locus_tag LOCUS_11650 6641 8230 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_11650 8520 8269 gene locus_tag LOCUS_11660 8520 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 8643 8867 gene locus_tag LOCUS_11670 8643 8867 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105773.1 protein_id gnl|my_center|LOCUS_11670 9085 9306 gene locus_tag LOCUS_11680 9085 9306 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519083.1 protein_id gnl|my_center|LOCUS_11680 9368 10072 gene locus_tag LOCUS_11690 9368 10072 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644445.1 protein_id gnl|my_center|LOCUS_11690 10056 10847 gene locus_tag LOCUS_11700 10056 10847 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_11700 10928 11665 gene locus_tag LOCUS_11710 10928 11665 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_11710 12212 13948 gene locus_tag LOCUS_11720 12212 13948 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_11720 14561 14079 gene locus_tag LOCUS_11730 14561 14079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 15532 14657 gene locus_tag LOCUS_11740 gene lgt 15532 14657 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381830.1 protein_id gnl|my_center|LOCUS_11740 16816 15536 gene locus_tag LOCUS_11750 16816 15536 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861628.1 protein_id gnl|my_center|LOCUS_11750 18078 16813 gene locus_tag LOCUS_11760 18078 16813 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_11760 18297 18109 gene locus_tag LOCUS_11770 18297 18109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 18275 19243 gene locus_tag LOCUS_11780 gene prmA 18275 19243 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385115.1 protein_id gnl|my_center|LOCUS_11780 19262 20299 gene locus_tag LOCUS_11790 19262 20299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 22058 20556 gene locus_tag LOCUS_11800 gene putP 22058 20556 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_11800 22841 22248 gene locus_tag LOCUS_11810 22841 22248 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965893.1 protein_id gnl|my_center|LOCUS_11810 23762 22908 gene locus_tag LOCUS_11820 23762 22908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 23899 24957 gene locus_tag LOCUS_11830 23899 24957 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874921.1 protein_id gnl|my_center|LOCUS_11830 25276 25013 gene locus_tag LOCUS_11840 25276 25013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 25386 25610 gene locus_tag LOCUS_11850 25386 25610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 26443 28749 gene locus_tag LOCUS_11860 26443 28749 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228464.1 protein_id gnl|my_center|LOCUS_11860 28715 29770 gene locus_tag LOCUS_11870 gene holA 28715 29770 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048008.1 protein_id gnl|my_center|LOCUS_11870 29763 30353 gene locus_tag LOCUS_11880 gene rnmV 29763 30353 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437901.1 protein_id gnl|my_center|LOCUS_11880 30350 32236 gene locus_tag LOCUS_11890 30350 32236 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460094.1 protein_id gnl|my_center|LOCUS_11890 32236 32961 gene locus_tag LOCUS_11900 32236 32961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 33816 34643 gene locus_tag LOCUS_11910 33816 34643 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_11910 35677 34700 gene locus_tag LOCUS_11920 35677 34700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 35784 36635 gene locus_tag LOCUS_11930 35784 36635 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_11930 36711 37979 gene locus_tag LOCUS_11940 36711 37979 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_11940 38209 39927 gene locus_tag LOCUS_11950 38209 39927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 39924 41306 gene locus_tag LOCUS_11960 39924 41306 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048310.1 protein_id gnl|my_center|LOCUS_11960 41397 41488 gene locus_tag LOCUS_t00200 41397 41488 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 42716 41592 gene locus_tag LOCUS_11970 42716 41592 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_11970 42897 42721 gene locus_tag LOCUS_11980 42897 42721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 43702 42899 gene locus_tag LOCUS_11990 43702 42899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 44181 43975 gene locus_tag LOCUS_12000 44181 43975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 44463 44194 gene locus_tag LOCUS_12010 44463 44194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 44676 45080 gene locus_tag LOCUS_12020 44676 45080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 45619 45840 gene locus_tag LOCUS_12030 45619 45840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 >Feature sequence17 624 935 gene locus_tag LOCUS_12040 624 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 935 2302 gene locus_tag LOCUS_12050 935 2302 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102364993.1 protein_id gnl|my_center|LOCUS_12050 2653 2417 gene locus_tag LOCUS_12060 2653 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 2793 3008 gene locus_tag LOCUS_12070 2793 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 3080 4237 gene locus_tag LOCUS_12080 3080 4237 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_12080 4565 4489 gene locus_tag LOCUS_t00210 4565 4489 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5688 4627 gene locus_tag LOCUS_12090 5688 4627 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964034.1 protein_id gnl|my_center|LOCUS_12090 5847 7262 gene locus_tag LOCUS_12100 gene glyS 5847 7262 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287157.1 protein_id gnl|my_center|LOCUS_12100 7494 9020 gene locus_tag LOCUS_12110 7494 9020 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_12110 9033 10181 gene locus_tag LOCUS_12120 9033 10181 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_12120 10183 11103 gene locus_tag LOCUS_12130 10183 11103 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_12130 11444 12745 gene locus_tag LOCUS_12140 11444 12745 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243061.1 protein_id gnl|my_center|LOCUS_12140 12764 13384 gene locus_tag LOCUS_12150 gene udk 12764 13384 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537078.1 protein_id gnl|my_center|LOCUS_12150 13706 14269 gene locus_tag LOCUS_12160 13706 14269 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235787673.1 protein_id gnl|my_center|LOCUS_12160 14287 15111 gene locus_tag LOCUS_12170 14287 15111 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480161.1 protein_id gnl|my_center|LOCUS_12170 15114 15938 gene locus_tag LOCUS_12180 15114 15938 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_12180 16180 15905 gene locus_tag LOCUS_12190 16180 15905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 17487 16177 gene locus_tag LOCUS_12200 17487 16177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 17795 17655 gene locus_tag LOCUS_12210 17795 17655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 17869 18519 gene locus_tag LOCUS_12220 17869 18519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 18957 18751 gene locus_tag LOCUS_12230 18957 18751 CDS product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989432.1 protein_id gnl|my_center|LOCUS_12230 19885 18959 gene locus_tag LOCUS_12240 19885 18959 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_12240 20380 19940 gene locus_tag LOCUS_12250 20380 19940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 20556 21668 gene locus_tag LOCUS_12260 20556 21668 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732062.1 protein_id gnl|my_center|LOCUS_12260 21714 22631 gene locus_tag LOCUS_12270 21714 22631 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_12270 23073 23312 gene locus_tag LOCUS_12280 23073 23312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 23293 24144 gene locus_tag LOCUS_12290 23293 24144 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890775.1 protein_id gnl|my_center|LOCUS_12290 24141 24785 gene locus_tag LOCUS_12300 24141 24785 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890774.1 protein_id gnl|my_center|LOCUS_12300 26659 24926 gene locus_tag LOCUS_12310 26659 24926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 27646 26693 gene locus_tag LOCUS_12320 gene holB 27646 26693 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_12320 27895 29085 gene locus_tag LOCUS_12330 27895 29085 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816413.1 protein_id gnl|my_center|LOCUS_12330 30380 29190 gene locus_tag LOCUS_12340 30380 29190 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358889.1 protein_id gnl|my_center|LOCUS_12340 31629 30661 gene locus_tag LOCUS_12350 31629 30661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 33021 31633 gene locus_tag LOCUS_12360 33021 31633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 33282 33070 gene locus_tag LOCUS_12370 gene yidD 33282 33070 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809333.1 protein_id gnl|my_center|LOCUS_12370 33644 33279 gene locus_tag LOCUS_12380 33644 33279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 33901 33761 gene locus_tag LOCUS_12390 33901 33761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 35316 34093 gene locus_tag LOCUS_12400 gene hemW 35316 34093 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_12400 37114 35306 gene locus_tag LOCUS_12410 gene lepA 37114 35306 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_12410 39248 37158 gene locus_tag LOCUS_12420 39248 37158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 39773 39276 gene locus_tag LOCUS_12430 39773 39276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 40643 39807 gene locus_tag LOCUS_12440 gene mreC 40643 39807 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392075.1 protein_id gnl|my_center|LOCUS_12440 41255 40683 gene locus_tag LOCUS_12450 41255 40683 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_12450 43355 41268 gene locus_tag LOCUS_12460 43355 41268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 44728 43736 gene locus_tag LOCUS_12470 44728 43736 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_12470 45652 44732 gene locus_tag LOCUS_12480 45652 44732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence18 1053 1460 gene locus_tag LOCUS_12490 1053 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1453 6456 gene locus_tag LOCUS_12500 1453 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 6656 6955 gene locus_tag LOCUS_12510 6656 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 7460 7059 gene locus_tag LOCUS_12520 7460 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 7628 9133 gene locus_tag LOCUS_12530 gene galT 7628 9133 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_12530 9292 9834 gene locus_tag LOCUS_12540 9292 9834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 9884 10510 gene locus_tag LOCUS_12550 9884 10510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 10494 11105 gene locus_tag LOCUS_12560 10494 11105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 11107 11247 gene locus_tag LOCUS_12570 11107 11247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 11815 11315 gene locus_tag LOCUS_12580 11815 11315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 12807 12019 gene locus_tag LOCUS_12590 gene murI 12807 12019 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966524.1 protein_id gnl|my_center|LOCUS_12590 13905 12988 gene locus_tag LOCUS_12600 13905 12988 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_12600 15002 13902 gene locus_tag LOCUS_12610 15002 13902 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948815.1 protein_id gnl|my_center|LOCUS_12610 17296 15128 gene locus_tag LOCUS_12620 17296 15128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 17988 17293 gene locus_tag LOCUS_12630 17988 17293 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_12630 18150 18773 gene locus_tag LOCUS_12640 18150 18773 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_12640 18991 20211 gene locus_tag LOCUS_12650 18991 20211 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_12650 20277 21659 gene locus_tag LOCUS_12660 gene argH 20277 21659 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_12660 23807 21705 gene locus_tag LOCUS_12670 23807 21705 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_12670 24149 23877 gene locus_tag LOCUS_12680 24149 23877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 24425 24700 gene locus_tag LOCUS_12690 24425 24700 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_12690 24999 25469 gene locus_tag LOCUS_12700 24999 25469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12700 25555 25833 gene locus_tag LOCUS_12710 25555 25833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 26369 25773 gene locus_tag LOCUS_12720 26369 25773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 26600 28915 gene locus_tag LOCUS_12730 gene xdhA 26600 28915 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 protein_id gnl|my_center|LOCUS_12730 28919 29806 gene locus_tag LOCUS_12740 gene xdhB 28919 29806 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393457.1 protein_id gnl|my_center|LOCUS_12740 29806 30312 gene locus_tag LOCUS_12750 29806 30312 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948907.1 protein_id gnl|my_center|LOCUS_12750 30407 30646 gene locus_tag LOCUS_12760 30407 30646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 31631 30708 gene locus_tag LOCUS_12770 31631 30708 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527657.1 protein_id gnl|my_center|LOCUS_12770 32982 31693 gene locus_tag LOCUS_12780 32982 31693 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286872.1 protein_id gnl|my_center|LOCUS_12780 35639 33108 gene locus_tag LOCUS_12790 35639 33108 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_12790 35997 35689 gene locus_tag LOCUS_12800 35997 35689 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_12800 36284 36556 gene locus_tag LOCUS_12810 36284 36556 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420907.1 protein_id gnl|my_center|LOCUS_12810 36595 38238 gene locus_tag LOCUS_12820 gene groL 36595 38238 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_12820 38596 38672 gene locus_tag LOCUS_t00220 38596 38672 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 39952 38777 gene locus_tag LOCUS_12830 39952 38777 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_12830 40533 40090 gene locus_tag LOCUS_12840 40533 40090 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797437.1 protein_id gnl|my_center|LOCUS_12840 41051 40557 gene locus_tag LOCUS_12850 41051 40557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 41986 41009 gene locus_tag LOCUS_12860 41986 41009 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_12860 43383 42016 gene locus_tag LOCUS_12870 43383 42016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 43812 43498 gene locus_tag LOCUS_12880 43812 43498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence19 1514 141 gene locus_tag LOCUS_12890 1514 141 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_12890 2523 1624 gene locus_tag LOCUS_12900 2523 1624 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931936.1 protein_id gnl|my_center|LOCUS_12900 3404 2520 gene locus_tag LOCUS_12910 gene truB 3404 2520 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100522.1 protein_id gnl|my_center|LOCUS_12910 4366 3407 gene locus_tag LOCUS_12920 4366 3407 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_12920 4733 4353 gene locus_tag LOCUS_12930 gene rbfA 4733 4353 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428234.1 protein_id gnl|my_center|LOCUS_12930 7268 4794 gene locus_tag LOCUS_12940 7268 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 7712 7284 gene locus_tag LOCUS_12950 7712 7284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 7977 7705 gene locus_tag LOCUS_12960 7977 7705 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460394.1 protein_id gnl|my_center|LOCUS_12960 9153 8011 gene locus_tag LOCUS_12970 gene nusA 9153 8011 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_12970 9623 9171 gene locus_tag LOCUS_12980 9623 9171 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_12980 9898 10593 gene locus_tag LOCUS_12990 9898 10593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 10813 11193 gene locus_tag LOCUS_13000 10813 11193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 11197 11439 gene locus_tag LOCUS_13010 11197 11439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 11474 12277 gene locus_tag LOCUS_13020 11474 12277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 12347 13267 gene locus_tag LOCUS_13030 12347 13267 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476272.1 protein_id gnl|my_center|LOCUS_13030 13290 13847 gene locus_tag LOCUS_13040 13290 13847 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701817.1 protein_id gnl|my_center|LOCUS_13040 15294 13936 gene locus_tag LOCUS_13050 15294 13936 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618921.1 protein_id gnl|my_center|LOCUS_13050 16193 15618 gene locus_tag LOCUS_13060 gene yfbR 16193 15618 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482513.1 protein_id gnl|my_center|LOCUS_13060 17546 16206 gene locus_tag LOCUS_13070 17546 16206 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_13070 17675 18085 gene locus_tag LOCUS_13080 17675 18085 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172543.1 protein_id gnl|my_center|LOCUS_13080 19674 18334 gene locus_tag LOCUS_13090 19674 18334 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_13090 20662 19736 gene locus_tag LOCUS_13100 20662 19736 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_13100 21390 20656 gene locus_tag LOCUS_13110 21390 20656 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_13110 21630 22814 gene locus_tag LOCUS_13120 21630 22814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 22899 23849 gene locus_tag LOCUS_13130 22899 23849 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359343.1 protein_id gnl|my_center|LOCUS_13130 23851 24444 gene locus_tag LOCUS_13140 gene pth 23851 24444 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_13140 24618 28118 gene locus_tag LOCUS_13150 gene mfd 24618 28118 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391629.1 protein_id gnl|my_center|LOCUS_13150 28394 30244 gene locus_tag LOCUS_13160 28394 30244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 30730 30293 gene locus_tag LOCUS_13170 gene rnhA 30730 30293 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974731.1 protein_id gnl|my_center|LOCUS_13170 33339 30847 gene locus_tag LOCUS_13180 gene gyrA 33339 30847 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_13180 35328 33370 gene locus_tag LOCUS_13190 gene gyrB 35328 33370 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_13190 35630 35376 gene locus_tag LOCUS_13200 35630 35376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 36727 35621 gene locus_tag LOCUS_13210 gene recF 36727 35621 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831795.1 protein_id gnl|my_center|LOCUS_13210 36978 36724 gene locus_tag LOCUS_13220 36978 36724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 38091 36982 gene locus_tag LOCUS_13230 gene dnaN 38091 36982 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_13230 39677 38364 gene locus_tag LOCUS_13240 gene dnaA 39677 38364 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_13240 40598 40020 gene locus_tag LOCUS_13250 gene lexA 40598 40020 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965137.1 protein_id gnl|my_center|LOCUS_13250 41554 40667 gene locus_tag LOCUS_13260 41554 40667 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_13260 41651 42241 gene locus_tag LOCUS_13270 41651 42241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence20 1965 541 gene locus_tag LOCUS_13280 1965 541 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986686.1 protein_id gnl|my_center|LOCUS_13280 2979 1981 gene locus_tag LOCUS_13290 2979 1981 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 protein_id gnl|my_center|LOCUS_13290 3601 3900 gene locus_tag LOCUS_13300 3601 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 5533 4019 gene locus_tag LOCUS_13310 5533 4019 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119386.1 protein_id gnl|my_center|LOCUS_13310 6865 5603 gene locus_tag LOCUS_13320 6865 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 7277 6945 gene locus_tag LOCUS_13330 7277 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 8295 8966 gene locus_tag LOCUS_13340 8295 8966 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381503.1 protein_id gnl|my_center|LOCUS_13340 9409 9723 gene locus_tag LOCUS_13350 9409 9723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 10742 9876 gene locus_tag LOCUS_13360 10742 9876 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_13360 11369 10836 gene locus_tag LOCUS_13370 11369 10836 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_13370 11604 11374 gene locus_tag LOCUS_13380 11604 11374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13380 12014 11601 gene locus_tag LOCUS_13390 12014 11601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 12883 12245 gene locus_tag LOCUS_13400 12883 12245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13400 13240 13680 gene locus_tag LOCUS_13410 13240 13680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 13700 14104 gene locus_tag LOCUS_13420 13700 14104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 14120 14425 gene locus_tag LOCUS_13430 14120 14425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 14448 14648 gene locus_tag LOCUS_13440 14448 14648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 15160 14759 gene locus_tag LOCUS_13450 15160 14759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 16758 15304 gene locus_tag LOCUS_13460 gene gnd 16758 15304 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225759.1 protein_id gnl|my_center|LOCUS_13460 17727 16780 gene locus_tag LOCUS_13470 17727 16780 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_13470 18083 17724 gene locus_tag LOCUS_13480 18083 17724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 19193 18096 gene locus_tag LOCUS_13490 19193 18096 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_13490 20190 19216 gene locus_tag LOCUS_13500 20190 19216 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311044.1 protein_id gnl|my_center|LOCUS_13500 21696 20206 gene locus_tag LOCUS_13510 gene gguA 21696 20206 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992366.1 protein_id gnl|my_center|LOCUS_13510 22847 21780 gene locus_tag LOCUS_13520 22847 21780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 23852 22911 gene locus_tag LOCUS_13530 23852 22911 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226614.1 protein_id gnl|my_center|LOCUS_13530 24359 23865 gene locus_tag LOCUS_13540 24359 23865 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_13540 24841 25824 gene locus_tag LOCUS_13550 gene ccpA 24841 25824 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229285.1 protein_id gnl|my_center|LOCUS_13550 26860 25913 gene locus_tag LOCUS_13560 26860 25913 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_13560 27705 26857 gene locus_tag LOCUS_13570 27705 26857 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_13570 28005 28745 gene locus_tag LOCUS_13580 28005 28745 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966694.1 protein_id gnl|my_center|LOCUS_13580 28902 30029 gene locus_tag LOCUS_13590 28902 30029 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905271.1 protein_id gnl|my_center|LOCUS_13590 30187 30945 gene locus_tag LOCUS_13600 gene phnC 30187 30945 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905272.1 protein_id gnl|my_center|LOCUS_13600 30942 31763 gene locus_tag LOCUS_13610 gene phnE 30942 31763 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131699.1 protein_id gnl|my_center|LOCUS_13610 31777 32586 gene locus_tag LOCUS_13620 gene phnE 31777 32586 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905273.1 protein_id gnl|my_center|LOCUS_13620 32591 34105 gene locus_tag LOCUS_13630 32591 34105 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832016.1 protein_id gnl|my_center|LOCUS_13630 34275 34907 gene locus_tag LOCUS_13640 34275 34907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 35980 34967 gene locus_tag LOCUS_13650 gene ansA 35980 34967 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170154.1 protein_id gnl|my_center|LOCUS_13650 38151 36001 gene locus_tag LOCUS_13660 38151 36001 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461496.1 protein_id gnl|my_center|LOCUS_13660 38280 38960 gene locus_tag LOCUS_13670 38280 38960 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289749.1 protein_id gnl|my_center|LOCUS_13670 39884 39189 gene locus_tag LOCUS_13680 39884 39189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 40213 39965 gene locus_tag LOCUS_13690 40213 39965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 40730 40281 gene locus_tag LOCUS_13700 40730 40281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 41326 40757 gene locus_tag LOCUS_13710 gene efp 41326 40757 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_13710 42486 41419 gene locus_tag LOCUS_13720 gene pepQ 42486 41419 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411039.1 protein_id gnl|my_center|LOCUS_13720 42970 42473 gene locus_tag LOCUS_13730 42970 42473 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888598.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence21 184 633 gene locus_tag LOCUS_13740 184 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 914 645 gene locus_tag LOCUS_13750 914 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1539 2054 gene locus_tag LOCUS_13760 1539 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 2058 2264 gene locus_tag LOCUS_13770 2058 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 2509 3783 gene locus_tag LOCUS_13780 2509 3783 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783481.1 protein_id gnl|my_center|LOCUS_13780 3801 5216 gene locus_tag LOCUS_13790 gene purB 3801 5216 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965127.1 protein_id gnl|my_center|LOCUS_13790 5370 6743 gene locus_tag LOCUS_13800 5370 6743 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_13800 6864 6989 gene locus_tag LOCUS_13810 6864 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 7770 7084 gene locus_tag LOCUS_13820 gene rnc 7770 7084 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989817.1 protein_id gnl|my_center|LOCUS_13820 8797 7754 gene locus_tag LOCUS_13830 gene plsX 8797 7754 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684092.1 protein_id gnl|my_center|LOCUS_13830 10122 8815 gene locus_tag LOCUS_13840 gene trmFO 10122 8815 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989721.1 protein_id gnl|my_center|LOCUS_13840 12524 10119 gene locus_tag LOCUS_13850 gene topA 12524 10119 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541498.1 protein_id gnl|my_center|LOCUS_13850 13790 12537 gene locus_tag LOCUS_13860 gene dprA 13790 12537 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_13860 14567 13812 gene locus_tag LOCUS_13870 14567 13812 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299518.1 protein_id gnl|my_center|LOCUS_13870 15211 14564 gene locus_tag LOCUS_13880 15211 14564 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 protein_id gnl|my_center|LOCUS_13880 16639 15260 gene locus_tag LOCUS_13890 16639 15260 CDS product Trk family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888508.1 protein_id gnl|my_center|LOCUS_13890 17942 16797 gene locus_tag LOCUS_13900 gene rpoD 17942 16797 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_13900 19780 18125 gene locus_tag LOCUS_13910 19780 18125 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_13910 20368 22347 gene locus_tag LOCUS_13920 20368 22347 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966978.1 protein_id gnl|my_center|LOCUS_13920 22384 22827 gene locus_tag LOCUS_13930 gene rplI 22384 22827 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429267.1 protein_id gnl|my_center|LOCUS_13930 22885 24228 gene locus_tag LOCUS_13940 gene dnaB 22885 24228 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_13940 24218 25585 gene locus_tag LOCUS_13950 gene tilS 24218 25585 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_13950 25582 26142 gene locus_tag LOCUS_13960 gene hpt 25582 26142 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981838.1 protein_id gnl|my_center|LOCUS_13960 26161 28065 gene locus_tag LOCUS_13970 gene ftsH 26161 28065 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_13970 28116 29021 gene locus_tag LOCUS_13980 28116 29021 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_13980 29182 29688 gene locus_tag LOCUS_13990 29182 29688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 29956 32139 gene locus_tag LOCUS_14000 29956 32139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 33704 32325 gene locus_tag LOCUS_14010 33704 32325 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_14010 33988 36234 gene locus_tag LOCUS_14020 33988 36234 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_14020 36238 37458 gene locus_tag LOCUS_14030 36238 37458 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_14030 37628 39016 gene locus_tag LOCUS_14040 37628 39016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 39360 39226 gene locus_tag LOCUS_14050 39360 39226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 39891 40046 gene locus_tag LOCUS_14060 39891 40046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14060 40711 40992 gene locus_tag LOCUS_14070 40711 40992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence22 163 330 gene locus_tag LOCUS_14080 163 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 555 1040 gene locus_tag LOCUS_14090 555 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1115 2056 gene locus_tag LOCUS_14100 1115 2056 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285055.1 protein_id gnl|my_center|LOCUS_14100 2160 2393 gene locus_tag LOCUS_14110 2160 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 2344 3516 gene locus_tag LOCUS_14120 2344 3516 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_14120 3642 4289 gene locus_tag LOCUS_14130 3642 4289 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428771.1 protein_id gnl|my_center|LOCUS_14130 4322 5539 gene locus_tag LOCUS_14140 4322 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 5637 5864 gene locus_tag LOCUS_14150 5637 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 5899 6447 gene locus_tag LOCUS_14160 5899 6447 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081283.1 protein_id gnl|my_center|LOCUS_14160 7893 6676 gene locus_tag LOCUS_14170 7893 6676 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_14170 8183 7995 gene locus_tag LOCUS_14180 8183 7995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 8348 9784 gene locus_tag LOCUS_14190 gene proS 8348 9784 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040972.1 protein_id gnl|my_center|LOCUS_14190 10175 10486 gene locus_tag LOCUS_14200 gene rpsJ 10175 10486 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_14200 10620 11351 gene locus_tag LOCUS_14210 gene rplC 10620 11351 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_14210 11368 11988 gene locus_tag LOCUS_14220 gene rplD 11368 11988 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_14220 11988 12281 gene locus_tag LOCUS_14230 gene rplW 11988 12281 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_14230 12312 13148 gene locus_tag LOCUS_14240 gene rplB 12312 13148 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_14240 13161 13436 gene locus_tag LOCUS_14250 gene rpsS 13161 13436 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357326.1 protein_id gnl|my_center|LOCUS_14250 13457 13792 gene locus_tag LOCUS_14260 gene rplV 13457 13792 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183025.1 protein_id gnl|my_center|LOCUS_14260 13806 14597 gene locus_tag LOCUS_14270 gene rpsC 13806 14597 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421163.1 protein_id gnl|my_center|LOCUS_14270 14597 15031 gene locus_tag LOCUS_14280 gene rplP 14597 15031 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_14280 15018 15224 gene locus_tag LOCUS_14290 gene rpmC 15018 15224 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_14290 15240 15503 gene locus_tag LOCUS_14300 gene rpsQ 15240 15503 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_14300 15518 15886 gene locus_tag LOCUS_14310 gene rplN 15518 15886 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966402.1 protein_id gnl|my_center|LOCUS_14310 15902 16207 gene locus_tag LOCUS_14320 gene rplX 15902 16207 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546700.1 protein_id gnl|my_center|LOCUS_14320 16224 16763 gene locus_tag LOCUS_14330 gene rplE 16224 16763 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225809.1 protein_id gnl|my_center|LOCUS_14330 16780 16965 gene locus_tag LOCUS_14340 16780 16965 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966399.1 protein_id gnl|my_center|LOCUS_14340 17280 17678 gene locus_tag LOCUS_14350 gene rpsH 17280 17678 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_14350 17694 18239 gene locus_tag LOCUS_14360 gene rplF 17694 18239 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_14360 18257 18616 gene locus_tag LOCUS_14370 gene rplR 18257 18616 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003739848.1 protein_id gnl|my_center|LOCUS_14370 18634 19152 gene locus_tag LOCUS_14380 gene rpsE 18634 19152 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_14380 19166 19348 gene locus_tag LOCUS_14390 gene rpmD 19166 19348 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966394.1 protein_id gnl|my_center|LOCUS_14390 19362 19802 gene locus_tag LOCUS_14400 gene rplO 19362 19802 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 protein_id gnl|my_center|LOCUS_14400 19803 21089 gene locus_tag LOCUS_14410 gene secY 19803 21089 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_14410 21106 21738 gene locus_tag LOCUS_14420 gene adk 21106 21738 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706319.1 protein_id gnl|my_center|LOCUS_14420 21741 22496 gene locus_tag LOCUS_14430 gene map 21741 22496 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_14430 22501 22788 gene locus_tag LOCUS_14440 22501 22788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 22789 23013 gene locus_tag LOCUS_14450 gene infA 22789 23013 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_14450 23178 23546 gene locus_tag LOCUS_14460 gene rpsM 23178 23546 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966388.1 protein_id gnl|my_center|LOCUS_14460 23564 23962 gene locus_tag LOCUS_14470 gene rpsK 23564 23962 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_14470 23984 24580 gene locus_tag LOCUS_14480 gene rpsD 23984 24580 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 protein_id gnl|my_center|LOCUS_14480 24662 25627 gene locus_tag LOCUS_14490 24662 25627 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357472.1 protein_id gnl|my_center|LOCUS_14490 25659 26000 gene locus_tag LOCUS_14500 gene rplQ 25659 26000 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357477.1 protein_id gnl|my_center|LOCUS_14500 26101 26541 gene locus_tag LOCUS_14510 gene spoVAC 26101 26541 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944604.1 protein_id gnl|my_center|LOCUS_14510 27524 26592 gene locus_tag LOCUS_14520 27524 26592 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948372.1 protein_id gnl|my_center|LOCUS_14520 27650 28201 gene locus_tag LOCUS_14530 gene hpt 27650 28201 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226700.1 protein_id gnl|my_center|LOCUS_14530 28560 29135 gene locus_tag LOCUS_14540 28560 29135 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947081.1 protein_id gnl|my_center|LOCUS_14540 29276 29965 gene locus_tag LOCUS_14550 29276 29965 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459260.1 protein_id gnl|my_center|LOCUS_14550 30043 30657 gene locus_tag LOCUS_14560 30043 30657 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_14560 30775 31230 gene locus_tag LOCUS_14570 30775 31230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 31244 32626 gene locus_tag LOCUS_14580 31244 32626 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_14580 32849 33664 gene locus_tag LOCUS_14590 32849 33664 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_14590 34757 33885 gene locus_tag LOCUS_14600 34757 33885 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948436.1 protein_id gnl|my_center|LOCUS_14600 34874 36709 gene locus_tag LOCUS_14610 gene ftsH 34874 36709 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_14610 36706 37245 gene locus_tag LOCUS_14620 36706 37245 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356034.1 protein_id gnl|my_center|LOCUS_14620 37871 37308 gene locus_tag LOCUS_14630 37871 37308 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_14630 38296 39795 gene locus_tag LOCUS_14640 38296 39795 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567789.1 protein_id gnl|my_center|LOCUS_14640 39812 40120 gene locus_tag LOCUS_14650 39812 40120 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462153.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence23 385 173 gene locus_tag LOCUS_14660 385 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 722 2098 gene locus_tag LOCUS_14670 gene murD 722 2098 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_14670 2111 2848 gene locus_tag LOCUS_14680 gene ispD 2111 2848 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942744.1 protein_id gnl|my_center|LOCUS_14680 2845 3318 gene locus_tag LOCUS_14690 gene ispF 2845 3318 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_14690 3315 3671 gene locus_tag LOCUS_14700 3315 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 3690 3929 gene locus_tag LOCUS_14710 3690 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 3953 4276 gene locus_tag LOCUS_14720 3953 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 6083 4467 gene locus_tag LOCUS_14730 6083 4467 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_14730 6478 6741 gene locus_tag LOCUS_14740 6478 6741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 6728 7825 gene locus_tag LOCUS_14750 6728 7825 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393701.1 protein_id gnl|my_center|LOCUS_14750 7917 8792 gene locus_tag LOCUS_14760 gene cdaA 7917 8792 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420697.1 protein_id gnl|my_center|LOCUS_14760 8779 10017 gene locus_tag LOCUS_14770 8779 10017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 10061 10939 gene locus_tag LOCUS_14780 10061 10939 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_14780 10952 11212 gene locus_tag LOCUS_14790 10952 11212 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 protein_id gnl|my_center|LOCUS_14790 11209 11826 gene locus_tag LOCUS_14800 gene gmk 11209 11826 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633187.1 protein_id gnl|my_center|LOCUS_14800 11808 12014 gene locus_tag LOCUS_14810 11808 12014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 12086 14533 gene locus_tag LOCUS_14820 gene priA 12086 14533 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_14820 14545 15063 gene locus_tag LOCUS_14830 gene def 14545 15063 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_14830 15060 15977 gene locus_tag LOCUS_14840 gene fmt 15060 15977 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_14840 16010 17317 gene locus_tag LOCUS_14850 gene rsmB 16010 17317 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232068.1 protein_id gnl|my_center|LOCUS_14850 17314 18372 gene locus_tag LOCUS_14860 gene rlmN 17314 18372 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_14860 18410 19141 gene locus_tag LOCUS_14870 18410 19141 CDS product protein-serine/threonine phosphatase Stp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888486.1 protein_id gnl|my_center|LOCUS_14870 19157 21436 gene locus_tag LOCUS_14880 gene pknB 19157 21436 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087065956.1 protein_id gnl|my_center|LOCUS_14880 21433 22311 gene locus_tag LOCUS_14890 gene rsgA 21433 22311 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113935.1 protein_id gnl|my_center|LOCUS_14890 22323 22493 gene locus_tag LOCUS_14900 22323 22493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 22578 22757 gene locus_tag LOCUS_14910 22578 22757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 22855 24363 gene locus_tag LOCUS_14920 22855 24363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 24404 25885 gene locus_tag LOCUS_14930 gene spoIVA 24404 25885 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_14930 27461 26154 gene locus_tag LOCUS_14940 27461 26154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 28222 27458 gene locus_tag LOCUS_14950 28222 27458 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438367.1 protein_id gnl|my_center|LOCUS_14950 28352 29740 gene locus_tag LOCUS_14960 28352 29740 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948178.1 protein_id gnl|my_center|LOCUS_14960 29753 30481 gene locus_tag LOCUS_14970 29753 30481 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817427.1 protein_id gnl|my_center|LOCUS_14970 31242 30679 gene locus_tag LOCUS_14980 31242 30679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 32753 31263 gene locus_tag LOCUS_14990 32753 31263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 32861 33289 gene locus_tag LOCUS_15000 32861 33289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 33286 33972 gene locus_tag LOCUS_15010 gene yycF 33286 33972 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658889.1 protein_id gnl|my_center|LOCUS_15010 34028 35401 gene locus_tag LOCUS_15020 34028 35401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 35394 36296 gene locus_tag LOCUS_15030 35394 36296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 36928 36329 gene locus_tag LOCUS_15040 36928 36329 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556719.1 protein_id gnl|my_center|LOCUS_15040 38158 36944 gene locus_tag LOCUS_15050 38158 36944 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964998.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence24 2787 1540 gene locus_tag LOCUS_15060 2787 1540 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047697.1 protein_id gnl|my_center|LOCUS_15060 3663 2809 gene locus_tag LOCUS_15070 gene dapF 3663 2809 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_15070 3857 4495 gene locus_tag LOCUS_15080 3857 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 5130 4558 gene locus_tag LOCUS_15090 5130 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 6407 5127 gene locus_tag LOCUS_15100 6407 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15100 6812 6417 gene locus_tag LOCUS_15110 6812 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 7111 8022 gene locus_tag LOCUS_15120 7111 8022 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_15120 8039 9115 gene locus_tag LOCUS_15130 8039 9115 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812002.1 protein_id gnl|my_center|LOCUS_15130 9121 10131 gene locus_tag LOCUS_15140 9121 10131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812003.1 protein_id gnl|my_center|LOCUS_15140 10124 11083 gene locus_tag LOCUS_15150 10124 11083 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812005.1 protein_id gnl|my_center|LOCUS_15150 11340 13127 gene locus_tag LOCUS_15160 11340 13127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 14554 13310 gene locus_tag LOCUS_15170 14554 13310 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_15170 14746 14567 gene locus_tag LOCUS_15180 14746 14567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 16595 15114 gene locus_tag LOCUS_15190 16595 15114 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_15190 17245 16592 gene locus_tag LOCUS_15200 17245 16592 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381503.1 protein_id gnl|my_center|LOCUS_15200 18596 17421 gene locus_tag LOCUS_15210 18596 17421 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392231.1 protein_id gnl|my_center|LOCUS_15210 19345 18656 gene locus_tag LOCUS_15220 19345 18656 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122293.1 protein_id gnl|my_center|LOCUS_15220 19602 20999 gene locus_tag LOCUS_15230 19602 20999 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362247.1 protein_id gnl|my_center|LOCUS_15230 21143 22336 gene locus_tag LOCUS_15240 gene ygeW 21143 22336 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379712.1 protein_id gnl|my_center|LOCUS_15240 22540 23478 gene locus_tag LOCUS_15250 gene arcC 22540 23478 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367131.1 protein_id gnl|my_center|LOCUS_15250 23643 23846 gene locus_tag LOCUS_15260 23643 23846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 23831 25672 gene locus_tag LOCUS_15270 gene glmS 23831 25672 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_15270 25848 26597 gene locus_tag LOCUS_15280 25848 26597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 26918 28888 gene locus_tag LOCUS_15290 26918 28888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 28904 29539 gene locus_tag LOCUS_15300 28904 29539 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436912.1 protein_id gnl|my_center|LOCUS_15300 29556 30437 gene locus_tag LOCUS_15310 29556 30437 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436920.1 protein_id gnl|my_center|LOCUS_15310 31447 30863 gene locus_tag LOCUS_15320 gene lepB 31447 30863 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917214.1 protein_id gnl|my_center|LOCUS_15320 31863 31450 gene locus_tag LOCUS_15330 31863 31450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 36039 31888 gene locus_tag LOCUS_15340 36039 31888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence25 533 447 gene locus_tag LOCUS_t00230 533 447 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1231 590 gene locus_tag LOCUS_15350 1231 590 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770252.1 protein_id gnl|my_center|LOCUS_15350 2066 1359 gene locus_tag LOCUS_15360 gene sigE 2066 1359 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_15360 2911 2063 gene locus_tag LOCUS_15370 gene spoIIGA 2911 2063 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291042.1 protein_id gnl|my_center|LOCUS_15370 3228 3031 gene locus_tag LOCUS_15380 3228 3031 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_15380 4500 3241 gene locus_tag LOCUS_15390 4500 3241 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_15390 4647 5282 gene locus_tag LOCUS_15400 gene nth 4647 5282 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_15400 5509 5949 gene locus_tag LOCUS_15410 5509 5949 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363476.1 protein_id gnl|my_center|LOCUS_15410 6157 6360 gene locus_tag LOCUS_15420 6157 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 7978 6344 gene locus_tag LOCUS_15430 7978 6344 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861938.1 protein_id gnl|my_center|LOCUS_15430 8367 8660 gene locus_tag LOCUS_15440 8367 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 8831 9850 gene locus_tag LOCUS_15450 gene spoVAD 8831 9850 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_15450 9855 10211 gene locus_tag LOCUS_15460 gene spoVAE 9855 10211 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_15460 10274 10405 gene locus_tag LOCUS_15470 10274 10405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 13990 10448 gene locus_tag LOCUS_15480 gene addA 13990 10448 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572274.1 protein_id gnl|my_center|LOCUS_15480 17243 13983 gene locus_tag LOCUS_15490 gene addB 17243 13983 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392018.1 protein_id gnl|my_center|LOCUS_15490 17879 17322 gene locus_tag LOCUS_15500 gene spoIIR 17879 17322 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425996.1 protein_id gnl|my_center|LOCUS_15500 18894 17986 gene locus_tag LOCUS_15510 gene ispE 18894 17986 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894070.1 protein_id gnl|my_center|LOCUS_15510 20135 18894 gene locus_tag LOCUS_15520 20135 18894 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_15520 20799 20200 gene locus_tag LOCUS_15530 gene thrH 20799 20200 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765732.1 protein_id gnl|my_center|LOCUS_15530 21020 21220 gene locus_tag LOCUS_15540 21020 21220 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105789.1 protein_id gnl|my_center|LOCUS_15540 22562 21270 gene locus_tag LOCUS_15550 22562 21270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 22761 25490 gene locus_tag LOCUS_15560 22761 25490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 25673 27820 gene locus_tag LOCUS_15570 25673 27820 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787402.1 protein_id gnl|my_center|LOCUS_15570 28089 28733 gene locus_tag LOCUS_15580 gene cas5c 28089 28733 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388584.1 protein_id gnl|my_center|LOCUS_15580 28730 30514 gene locus_tag LOCUS_15590 gene cas8c 28730 30514 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388585.1 protein_id gnl|my_center|LOCUS_15590 30501 31382 gene locus_tag LOCUS_15600 gene cas7c 30501 31382 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_15600 31382 32044 gene locus_tag LOCUS_15610 gene cas4 31382 32044 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_15610 32041 33072 gene locus_tag LOCUS_15620 gene cas1c 32041 33072 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_15620 33083 33373 gene locus_tag LOCUS_15630 gene cas2 33083 33373 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_15630 33544 33910 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcaccccgcaaggggtgcgtggattgaaat 34612 34232 gene locus_tag LOCUS_15640 34612 34232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15640 35120 34833 gene locus_tag LOCUS_15650 35120 34833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15650 35404 35210 gene locus_tag LOCUS_15660 35404 35210 CDS product cysteine-rich KTR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012962334.1 protein_id gnl|my_center|LOCUS_15660 36550 35810 gene locus_tag LOCUS_15670 36550 35810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 36731 36510 gene locus_tag LOCUS_15680 36731 36510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 36817 37338 gene locus_tag LOCUS_15690 gene sigK 36817 37338 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428359.1 protein_id gnl|my_center|LOCUS_15690 >Feature sequence26 338 2932 gene locus_tag LOCUS_15700 gene clpB 338 2932 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_15700 3039 4049 gene locus_tag LOCUS_15710 3039 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 4065 5360 gene locus_tag LOCUS_15720 4065 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 5926 5492 gene locus_tag LOCUS_15730 gene nifU 5926 5492 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438275.1 protein_id gnl|my_center|LOCUS_15730 7134 5944 gene locus_tag LOCUS_15740 gene nifS 7134 5944 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_15740 7329 8498 gene locus_tag LOCUS_15750 7329 8498 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_15750 8530 8994 gene locus_tag LOCUS_15760 8530 8994 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106578.1 protein_id gnl|my_center|LOCUS_15760 9302 10456 gene locus_tag LOCUS_15770 9302 10456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 10453 11172 gene locus_tag LOCUS_15780 10453 11172 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_15780 11184 12533 gene locus_tag LOCUS_15790 11184 12533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 12548 13147 gene locus_tag LOCUS_15800 12548 13147 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964931.1 protein_id gnl|my_center|LOCUS_15800 14594 13611 gene locus_tag LOCUS_15810 14594 13611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 14781 15518 gene locus_tag LOCUS_15820 14781 15518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 16120 15515 gene locus_tag LOCUS_15830 16120 15515 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397458.1 protein_id gnl|my_center|LOCUS_15830 16264 17124 gene locus_tag LOCUS_15840 16264 17124 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126169.1 protein_id gnl|my_center|LOCUS_15840 17121 17873 gene locus_tag LOCUS_15850 gene znuC 17121 17873 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202986.1 protein_id gnl|my_center|LOCUS_15850 17870 18709 gene locus_tag LOCUS_15860 17870 18709 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390141.1 protein_id gnl|my_center|LOCUS_15860 24743 18930 gene locus_tag LOCUS_15870 24743 18930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 30230 25263 gene locus_tag LOCUS_15880 30230 25263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 31728 30481 gene locus_tag LOCUS_15890 31728 30481 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427751.1 protein_id gnl|my_center|LOCUS_15890 32148 31741 gene locus_tag LOCUS_15900 32148 31741 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_15900 32511 32152 gene locus_tag LOCUS_15910 32511 32152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 33926 32526 gene locus_tag LOCUS_15920 33926 32526 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence27 326 1150 gene locus_tag LOCUS_15930 326 1150 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837256.1 protein_id gnl|my_center|LOCUS_15930 1446 2696 gene locus_tag LOCUS_15940 1446 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 2689 3318 gene locus_tag LOCUS_15950 2689 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 3935 3369 gene locus_tag LOCUS_15960 3935 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 4048 5445 gene locus_tag LOCUS_15970 4048 5445 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_15970 6063 6995 gene locus_tag LOCUS_15980 gene cysK 6063 6995 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_15980 7424 7089 gene locus_tag LOCUS_15990 7424 7089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 8799 7462 gene locus_tag LOCUS_16000 8799 7462 CDS product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367092.1 protein_id gnl|my_center|LOCUS_16000 9750 8872 gene locus_tag LOCUS_16010 9750 8872 CDS product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948819.1 protein_id gnl|my_center|LOCUS_16010 10389 9769 gene locus_tag LOCUS_16020 10389 9769 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432265.1 protein_id gnl|my_center|LOCUS_16020 12284 10473 gene locus_tag LOCUS_16030 12284 10473 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546634.1 protein_id gnl|my_center|LOCUS_16030 13628 12663 gene locus_tag LOCUS_16040 13628 12663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 14271 13639 gene locus_tag LOCUS_16050 14271 13639 CDS product DUF3786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437313.1 protein_id gnl|my_center|LOCUS_16050 16207 14276 gene locus_tag LOCUS_16060 gene acsV 16207 14276 CDS product corrinoid activation/regeneration protein AcsV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436926.1 protein_id gnl|my_center|LOCUS_16060 18596 16461 gene locus_tag LOCUS_16070 gene acsB 18596 16461 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418359.1 protein_id gnl|my_center|LOCUS_16070 21027 18748 gene locus_tag LOCUS_16080 21027 18748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 21993 21049 gene locus_tag LOCUS_16090 gene acsD 21993 21049 CDS product acetyl-CoA decarbonylase/synthase complex subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432254.1 protein_id gnl|my_center|LOCUS_16090 22795 22028 gene locus_tag LOCUS_16100 22795 22028 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_16100 23798 22869 gene locus_tag LOCUS_16110 gene metF 23798 22869 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_16110 24224 23997 gene locus_tag LOCUS_16120 24224 23997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 24489 24295 gene locus_tag LOCUS_16130 24489 24295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 24859 24503 gene locus_tag LOCUS_16140 24859 24503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 25082 25501 gene locus_tag LOCUS_16150 25082 25501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 25773 27059 gene locus_tag LOCUS_16160 gene larA 25773 27059 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461442.1 protein_id gnl|my_center|LOCUS_16160 27056 28210 gene locus_tag LOCUS_16170 27056 28210 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986546.1 protein_id gnl|my_center|LOCUS_16170 28386 29324 gene locus_tag LOCUS_16180 28386 29324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 29463 30155 gene locus_tag LOCUS_16190 29463 30155 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358158.1 protein_id gnl|my_center|LOCUS_16190 30145 30891 gene locus_tag LOCUS_16200 30145 30891 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132766.1 protein_id gnl|my_center|LOCUS_16200 31352 32443 gene locus_tag LOCUS_16210 gene gcvT 31352 32443 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_16210 32613 32870 gene locus_tag LOCUS_16220 32613 32870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence28 422 159 gene locus_tag LOCUS_16230 422 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 1653 805 gene locus_tag LOCUS_16240 1653 805 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986202.1 protein_id gnl|my_center|LOCUS_16240 1759 2220 gene locus_tag LOCUS_16250 1759 2220 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 protein_id gnl|my_center|LOCUS_16250 2275 3039 gene locus_tag LOCUS_16260 2275 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 4154 3114 gene locus_tag LOCUS_16270 4154 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 4879 4259 gene locus_tag LOCUS_16280 4879 4259 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422086.1 protein_id gnl|my_center|LOCUS_16280 7031 4950 gene locus_tag LOCUS_16290 7031 4950 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_16290 8745 7873 gene locus_tag LOCUS_16300 8745 7873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 9484 8762 gene locus_tag LOCUS_16310 9484 8762 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_16310 10226 9435 gene locus_tag LOCUS_16320 gene trmD 10226 9435 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_16320 10716 10216 gene locus_tag LOCUS_16330 gene rimM 10716 10216 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965064.1 protein_id gnl|my_center|LOCUS_16330 11689 11027 gene locus_tag LOCUS_16340 11689 11027 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356305.1 protein_id gnl|my_center|LOCUS_16340 12548 11682 gene locus_tag LOCUS_16350 12548 11682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 13522 12647 gene locus_tag LOCUS_16360 13522 12647 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_16360 13573 13788 gene locus_tag LOCUS_16370 13573 13788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 14421 13912 gene locus_tag LOCUS_16380 14421 13912 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318917.1 protein_id gnl|my_center|LOCUS_16380 15656 14502 gene locus_tag LOCUS_16390 15656 14502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 16239 15814 gene locus_tag LOCUS_16400 16239 15814 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_16400 16827 16279 gene locus_tag LOCUS_16410 16827 16279 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_16410 17119 16829 gene locus_tag LOCUS_16420 17119 16829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 17454 19853 gene locus_tag LOCUS_16430 17454 19853 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130514.1 protein_id gnl|my_center|LOCUS_16430 19976 21073 gene locus_tag LOCUS_16440 gene mnmA 19976 21073 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_16440 21070 21495 gene locus_tag LOCUS_16450 21070 21495 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937835.1 protein_id gnl|my_center|LOCUS_16450 21960 23240 gene locus_tag LOCUS_16460 21960 23240 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_16460 23360 24130 gene locus_tag LOCUS_16470 23360 24130 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_16470 24223 24396 gene locus_tag LOCUS_16480 24223 24396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 24562 25431 gene locus_tag LOCUS_16490 24562 25431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 25481 26245 gene locus_tag LOCUS_16500 25481 26245 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943967.1 protein_id gnl|my_center|LOCUS_16500 26247 26984 gene locus_tag LOCUS_16510 26247 26984 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294240.1 protein_id gnl|my_center|LOCUS_16510 27557 27234 gene locus_tag LOCUS_16520 27557 27234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 29339 27744 gene locus_tag LOCUS_16530 gene hcp 29339 27744 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_16530 30373 29492 gene locus_tag LOCUS_16540 30373 29492 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902199.1 protein_id gnl|my_center|LOCUS_16540 31376 30366 gene locus_tag LOCUS_16550 31376 30366 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895878.1 protein_id gnl|my_center|LOCUS_16550 32278 31373 gene locus_tag LOCUS_16560 32278 31373 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385607.1 protein_id gnl|my_center|LOCUS_16560 33005 32268 gene locus_tag LOCUS_16570 33005 32268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence29 1317 505 gene locus_tag LOCUS_16580 1317 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2216 1317 gene locus_tag LOCUS_16590 2216 1317 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814607.1 protein_id gnl|my_center|LOCUS_16590 2378 4351 gene locus_tag LOCUS_16600 gene metG 2378 4351 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_16600 4552 5349 gene locus_tag LOCUS_16610 gene proC 4552 5349 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295331.1 protein_id gnl|my_center|LOCUS_16610 5593 6018 gene locus_tag LOCUS_16620 5593 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 6048 6608 gene locus_tag LOCUS_16630 6048 6608 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040134.1 protein_id gnl|my_center|LOCUS_16630 6803 7606 gene locus_tag LOCUS_16640 6803 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 7610 8710 gene locus_tag LOCUS_16650 gene cobT 7610 8710 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_16650 8707 9240 gene locus_tag LOCUS_16660 8707 9240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 9228 10010 gene locus_tag LOCUS_16670 gene cobS 9228 10010 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460078.1 protein_id gnl|my_center|LOCUS_16670 10001 10372 gene locus_tag LOCUS_16680 10001 10372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 10369 10944 gene locus_tag LOCUS_16690 10369 10944 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903719.1 protein_id gnl|my_center|LOCUS_16690 11050 12618 gene locus_tag LOCUS_16700 11050 12618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 12863 13759 gene locus_tag LOCUS_16710 12863 13759 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_16710 13732 16419 gene locus_tag LOCUS_16720 13732 16419 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812452.1 protein_id gnl|my_center|LOCUS_16720 16610 16762 gene locus_tag LOCUS_16730 16610 16762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 17098 17916 gene locus_tag LOCUS_16740 gene noc 17098 17916 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799028.1 protein_id gnl|my_center|LOCUS_16740 18203 20839 gene locus_tag LOCUS_16750 gene ppdK 18203 20839 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_16750 21260 20994 gene locus_tag LOCUS_16760 21260 20994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 21405 21824 gene locus_tag LOCUS_16770 21405 21824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 28437 21967 gene locus_tag LOCUS_16780 28437 21967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 28792 28640 gene locus_tag LOCUS_16790 28792 28640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 28873 28946 gene locus_tag LOCUS_t00240 28873 28946 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence30 1938 2546 gene locus_tag LOCUS_16800 1938 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 2571 3842 gene locus_tag LOCUS_16810 2571 3842 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_16810 4467 4084 gene locus_tag LOCUS_16820 4467 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16820 4913 4482 gene locus_tag LOCUS_16830 4913 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16830 6261 4915 gene locus_tag LOCUS_16840 6261 4915 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_16840 6679 6386 gene locus_tag LOCUS_16850 6679 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 6801 7304 gene locus_tag LOCUS_16860 6801 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 7304 7573 gene locus_tag LOCUS_16870 7304 7573 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398814.1 protein_id gnl|my_center|LOCUS_16870 7596 7778 gene locus_tag LOCUS_16880 7596 7778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 8899 7775 gene locus_tag LOCUS_16890 8899 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 9441 8890 gene locus_tag LOCUS_16900 9441 8890 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390032.1 protein_id gnl|my_center|LOCUS_16900 10375 9554 gene locus_tag LOCUS_16910 10375 9554 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242564.1 protein_id gnl|my_center|LOCUS_16910 10571 10855 gene locus_tag LOCUS_16920 10571 10855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 10955 11410 gene locus_tag LOCUS_16930 gene nrdR 10955 11410 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_16930 12022 11642 gene locus_tag LOCUS_16940 12022 11642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 12698 12024 gene locus_tag LOCUS_16950 12698 12024 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_16950 12837 13013 gene locus_tag LOCUS_16960 12837 13013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 13026 13523 gene locus_tag LOCUS_16970 gene ruvC 13026 13523 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_16970 13534 14133 gene locus_tag LOCUS_16980 gene ruvA 13534 14133 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_16980 14146 15192 gene locus_tag LOCUS_16990 gene ruvB 14146 15192 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_16990 15211 16569 gene locus_tag LOCUS_17000 gene glmM 15211 16569 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_17000 16834 17112 gene locus_tag LOCUS_17010 16834 17112 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391912.1 protein_id gnl|my_center|LOCUS_17010 18201 17209 gene locus_tag LOCUS_17020 18201 17209 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_17020 19293 18205 gene locus_tag LOCUS_17030 19293 18205 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_17030 20800 19286 gene locus_tag LOCUS_17040 20800 19286 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_17040 22353 21016 gene locus_tag LOCUS_17050 22353 21016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 22828 24102 gene locus_tag LOCUS_17060 22828 24102 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896806.1 protein_id gnl|my_center|LOCUS_17060 24237 25103 gene locus_tag LOCUS_17070 24237 25103 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_17070 25105 26052 gene locus_tag LOCUS_17080 25105 26052 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416574.1 protein_id gnl|my_center|LOCUS_17080 26106 27398 gene locus_tag LOCUS_17090 26106 27398 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288574.1 protein_id gnl|my_center|LOCUS_17090 28002 27742 gene locus_tag LOCUS_17100 28002 27742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence31 397 269 gene locus_tag LOCUS_17110 397 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1531 410 gene locus_tag LOCUS_17120 1531 410 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566189.1 protein_id gnl|my_center|LOCUS_17120 3087 1810 gene locus_tag LOCUS_17130 3087 1810 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943646.1 protein_id gnl|my_center|LOCUS_17130 3793 3074 gene locus_tag LOCUS_17140 3793 3074 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855103.1 protein_id gnl|my_center|LOCUS_17140 5589 3790 gene locus_tag LOCUS_17150 5589 3790 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015553.1 protein_id gnl|my_center|LOCUS_17150 7089 5809 gene locus_tag LOCUS_17160 7089 5809 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_17160 7471 7205 gene locus_tag LOCUS_17170 7471 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 9268 7472 gene locus_tag LOCUS_17180 gene pepF 9268 7472 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 protein_id gnl|my_center|LOCUS_17180 9429 10325 gene locus_tag LOCUS_17190 9429 10325 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_17190 12033 10633 gene locus_tag LOCUS_17200 12033 10633 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262174.1 protein_id gnl|my_center|LOCUS_17200 13996 12419 gene locus_tag LOCUS_17210 gene asnB 13996 12419 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_17210 14653 14480 gene locus_tag LOCUS_17220 14653 14480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 16799 14703 gene locus_tag LOCUS_17230 16799 14703 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_17230 17367 18575 gene locus_tag LOCUS_17240 gene glnA 17367 18575 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_17240 18609 19193 gene locus_tag LOCUS_17250 18609 19193 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392809.1 protein_id gnl|my_center|LOCUS_17250 19236 20843 gene locus_tag LOCUS_17260 19236 20843 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723607.1 protein_id gnl|my_center|LOCUS_17260 20877 22418 gene locus_tag LOCUS_17270 gene guaA 20877 22418 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679432.1 protein_id gnl|my_center|LOCUS_17270 23148 22594 gene locus_tag LOCUS_17280 23148 22594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 23313 23501 gene locus_tag LOCUS_17290 23313 23501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395994.1 protein_id gnl|my_center|LOCUS_17290 23515 24591 gene locus_tag LOCUS_17300 23515 24591 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_17300 24595 24915 gene locus_tag LOCUS_17310 24595 24915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 24919 26121 gene locus_tag LOCUS_17320 24919 26121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 26069 26260 gene locus_tag LOCUS_17330 26069 26260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 26511 27677 gene locus_tag LOCUS_17340 26511 27677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence32 828 97 gene locus_tag LOCUS_17350 828 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1336 818 gene locus_tag LOCUS_17360 1336 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 1656 1351 gene locus_tag LOCUS_17370 1656 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 1756 1613 gene locus_tag LOCUS_17380 1756 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 2369 1770 gene locus_tag LOCUS_17390 2369 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 2872 2363 gene locus_tag LOCUS_17400 2872 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 3559 2912 gene locus_tag LOCUS_17410 3559 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 3768 3541 gene locus_tag LOCUS_17420 3768 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 4495 3830 gene locus_tag LOCUS_17430 4495 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 4908 4833 gene locus_tag LOCUS_t00250 4908 4833 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4986 4912 gene locus_tag LOCUS_t00260 4986 4912 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5103 5027 gene locus_tag LOCUS_t00270 5103 5027 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5214 5138 gene locus_tag LOCUS_t00280 5214 5138 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5295 5221 gene locus_tag LOCUS_t00290 5295 5221 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6223 5348 gene locus_tag LOCUS_17440 6223 5348 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966103.1 protein_id gnl|my_center|LOCUS_17440 6367 7008 gene locus_tag LOCUS_17450 6367 7008 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420189.1 protein_id gnl|my_center|LOCUS_17450 7160 8485 gene locus_tag LOCUS_17460 7160 8485 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869009.1 protein_id gnl|my_center|LOCUS_17460 8716 10008 gene locus_tag LOCUS_17470 8716 10008 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641774.1 protein_id gnl|my_center|LOCUS_17470 10378 11793 gene locus_tag LOCUS_17480 gene pyk 10378 11793 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_17480 13691 12006 gene locus_tag LOCUS_17490 13691 12006 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_17490 14891 13794 gene locus_tag LOCUS_17500 14891 13794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462288.1 protein_id gnl|my_center|LOCUS_17500 15906 14914 gene locus_tag LOCUS_17510 gene argF 15906 14914 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_17510 17370 16147 gene locus_tag LOCUS_17520 gene arcA 17370 16147 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681549.1 protein_id gnl|my_center|LOCUS_17520 17562 17819 gene locus_tag LOCUS_17530 gene spoIIID 17562 17819 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_17530 17996 19084 gene locus_tag LOCUS_17540 gene serC 17996 19084 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_17540 19173 20084 gene locus_tag LOCUS_17550 19173 20084 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437082.1 protein_id gnl|my_center|LOCUS_17550 20206 21558 gene locus_tag LOCUS_17560 gene gdhA 20206 21558 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020063.1 protein_id gnl|my_center|LOCUS_17560 22159 21665 gene locus_tag LOCUS_17570 22159 21665 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_17570 23181 22159 gene locus_tag LOCUS_17580 23181 22159 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461701.1 protein_id gnl|my_center|LOCUS_17580 24760 23249 gene locus_tag LOCUS_17590 24760 23249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 25582 24818 gene locus_tag LOCUS_17600 25582 24818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 26342 25569 gene locus_tag LOCUS_17610 26342 25569 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430913.1 protein_id gnl|my_center|LOCUS_17610 26500 26584 gene locus_tag LOCUS_t00300 26500 26584 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence33 <1 1066 gene locus_tag LOCUS_17620 <1 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393297.1:site-specific integrase 1379 1699 gene locus_tag LOCUS_17630 1379 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 1809 2279 gene locus_tag LOCUS_17640 1809 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2305 4140 gene locus_tag LOCUS_17650 2305 4140 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_17650 4133 4792 gene locus_tag LOCUS_17660 4133 4792 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438070.1 protein_id gnl|my_center|LOCUS_17660 4806 6149 gene locus_tag LOCUS_17670 4806 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 6280 7278 gene locus_tag LOCUS_17680 6280 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 7340 8824 gene locus_tag LOCUS_17690 7340 8824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 8855 9277 gene locus_tag LOCUS_17700 8855 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 9719 9321 gene locus_tag LOCUS_17710 9719 9321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 11305 9716 gene locus_tag LOCUS_17720 11305 9716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 11759 11298 gene locus_tag LOCUS_17730 11759 11298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 11898 14108 gene locus_tag LOCUS_17740 11898 14108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 14105 15253 gene locus_tag LOCUS_17750 14105 15253 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038780.1 protein_id gnl|my_center|LOCUS_17750 15495 15289 gene locus_tag LOCUS_17760 15495 15289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 16319 15471 gene locus_tag LOCUS_17770 16319 15471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 16470 17189 gene locus_tag LOCUS_17780 16470 17189 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272779.1 protein_id gnl|my_center|LOCUS_17780 17195 17863 gene locus_tag LOCUS_17790 17195 17863 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812008.1 protein_id gnl|my_center|LOCUS_17790 17866 18408 gene locus_tag LOCUS_17800 17866 18408 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_17800 18424 19977 gene locus_tag LOCUS_17810 18424 19977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 19967 21187 gene locus_tag LOCUS_17820 19967 21187 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986881.1 protein_id gnl|my_center|LOCUS_17820 21633 24296 gene locus_tag LOCUS_17830 gene alaS 21633 24296 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986885.1 protein_id gnl|my_center|LOCUS_17830 24309 24647 gene locus_tag LOCUS_17840 24309 24647 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_17840 24787 25116 gene locus_tag LOCUS_17850 24787 25116 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047981.1 protein_id gnl|my_center|LOCUS_17850 26418 25177 gene locus_tag LOCUS_17860 26418 25177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 >Feature sequence34 1883 513 gene locus_tag LOCUS_17870 gene lpdA 1883 513 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797088.1 protein_id gnl|my_center|LOCUS_17870 2860 3084 gene locus_tag LOCUS_17880 2860 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 3151 3759 gene locus_tag LOCUS_17890 gene yedF 3151 3759 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681889.1 protein_id gnl|my_center|LOCUS_17890 3759 4001 gene locus_tag LOCUS_17900 3759 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 4066 5205 gene locus_tag LOCUS_17910 4066 5205 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811901.1 protein_id gnl|my_center|LOCUS_17910 6211 5582 gene locus_tag LOCUS_17920 6211 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 6400 7869 gene locus_tag LOCUS_17930 6400 7869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 7866 8528 gene locus_tag LOCUS_17940 7866 8528 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010777.1 protein_id gnl|my_center|LOCUS_17940 8779 10548 gene locus_tag LOCUS_17950 8779 10548 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_17950 10545 12368 gene locus_tag LOCUS_17960 10545 12368 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_17960 12596 13633 gene locus_tag LOCUS_17970 12596 13633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 13602 14309 gene locus_tag LOCUS_17980 13602 14309 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722035.1 protein_id gnl|my_center|LOCUS_17980 15966 14614 gene locus_tag LOCUS_17990 15966 14614 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_17990 16165 16608 gene locus_tag LOCUS_18000 16165 16608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 16877 17164 gene locus_tag LOCUS_18010 16877 17164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 17171 18328 gene locus_tag LOCUS_18020 17171 18328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 19026 18433 gene locus_tag LOCUS_18030 19026 18433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 19247 19597 gene locus_tag LOCUS_18040 19247 19597 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965771.1 protein_id gnl|my_center|LOCUS_18040 19652 20101 gene locus_tag LOCUS_18050 19652 20101 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861860.1 protein_id gnl|my_center|LOCUS_18050 20275 20439 gene locus_tag LOCUS_18060 20275 20439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 21065 20574 gene locus_tag LOCUS_18070 21065 20574 CDS product YfbM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681732.1 protein_id gnl|my_center|LOCUS_18070 21899 21099 gene locus_tag LOCUS_18080 21899 21099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 22379 21939 gene locus_tag LOCUS_18090 22379 21939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 22730 23143 gene locus_tag LOCUS_18100 22730 23143 CDS product cysteine-rich VLP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861105.1 protein_id gnl|my_center|LOCUS_18100 23255 23650 gene locus_tag LOCUS_18110 23255 23650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence35 1029 259 gene locus_tag LOCUS_18120 1029 259 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_18120 1973 1182 gene locus_tag LOCUS_18130 1973 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 2171 2884 gene locus_tag LOCUS_18140 2171 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 4797 3040 gene locus_tag LOCUS_18150 gene argS 4797 3040 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020254.1 protein_id gnl|my_center|LOCUS_18150 5398 4886 gene locus_tag LOCUS_18160 5398 4886 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946311.1 protein_id gnl|my_center|LOCUS_18160 5967 5395 gene locus_tag LOCUS_18170 5967 5395 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963791.1 protein_id gnl|my_center|LOCUS_18170 6130 6372 gene locus_tag LOCUS_18180 6130 6372 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388120.1 protein_id gnl|my_center|LOCUS_18180 6537 8060 gene locus_tag LOCUS_18190 6537 8060 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_18190 8060 8725 gene locus_tag LOCUS_18200 8060 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 9641 8949 gene locus_tag LOCUS_18210 9641 8949 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_18210 9785 11080 gene locus_tag LOCUS_18220 9785 11080 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582704.1 protein_id gnl|my_center|LOCUS_18220 11579 15151 gene locus_tag LOCUS_18230 gene smc 11579 15151 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361019.1 protein_id gnl|my_center|LOCUS_18230 15420 16310 gene locus_tag LOCUS_18240 15420 16310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 16322 16915 gene locus_tag LOCUS_18250 16322 16915 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174735.1 protein_id gnl|my_center|LOCUS_18250 16989 17447 gene locus_tag LOCUS_18260 16989 17447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 17452 18648 gene locus_tag LOCUS_18270 17452 18648 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679466.1 protein_id gnl|my_center|LOCUS_18270 18650 19990 gene locus_tag LOCUS_18280 18650 19990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 20008 20373 gene locus_tag LOCUS_18290 gene rsfS 20008 20373 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392104.1 protein_id gnl|my_center|LOCUS_18290 20715 23213 gene locus_tag LOCUS_18300 gene leuS 20715 23213 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830785.1 protein_id gnl|my_center|LOCUS_18300 23203 23388 gene locus_tag LOCUS_18310 23203 23388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 23381 23563 gene locus_tag LOCUS_18320 gene rpsU 23381 23563 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_18320 >Feature sequence36 1051 2016 gene locus_tag LOCUS_18330 gene dusB 1051 2016 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391694.1 protein_id gnl|my_center|LOCUS_18330 2021 2632 gene locus_tag LOCUS_18340 2021 2632 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_18340 2629 3261 gene locus_tag LOCUS_18350 2629 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 3361 4296 gene locus_tag LOCUS_18360 3361 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 5881 4553 gene locus_tag LOCUS_18370 5881 4553 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_18370 6330 5878 gene locus_tag LOCUS_18380 6330 5878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 7705 6467 gene locus_tag LOCUS_18390 7705 6467 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_18390 7864 8832 gene locus_tag LOCUS_18400 gene fba 7864 8832 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_18400 9290 9081 gene locus_tag LOCUS_18410 9290 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 9500 9312 gene locus_tag LOCUS_18420 9500 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 10352 9504 gene locus_tag LOCUS_18430 10352 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 10895 10647 gene locus_tag LOCUS_18440 10895 10647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 13484 10986 gene locus_tag LOCUS_18450 13484 10986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 13976 14587 gene locus_tag LOCUS_18460 13976 14587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 14775 14521 gene locus_tag LOCUS_18470 14775 14521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 15330 15485 gene locus_tag LOCUS_18480 15330 15485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 15843 15667 gene locus_tag LOCUS_18490 15843 15667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 16762 16082 gene locus_tag LOCUS_18500 16762 16082 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173766.1 protein_id gnl|my_center|LOCUS_18500 16947 17912 gene locus_tag LOCUS_18510 16947 17912 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271954.1 protein_id gnl|my_center|LOCUS_18510 17919 19148 gene locus_tag LOCUS_18520 17919 19148 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082016.1 protein_id gnl|my_center|LOCUS_18520 21206 19524 gene locus_tag LOCUS_18530 21206 19524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 21489 22142 gene locus_tag LOCUS_18540 21489 22142 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436912.1 protein_id gnl|my_center|LOCUS_18540 22139 23062 gene locus_tag LOCUS_18550 22139 23062 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436920.1 protein_id gnl|my_center|LOCUS_18550 23241 23750 gene locus_tag LOCUS_18560 23241 23750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence37 75 740 gene locus_tag LOCUS_18570 75 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 745 1821 gene locus_tag LOCUS_18580 745 1821 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_18580 1818 4391 gene locus_tag LOCUS_18590 1818 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 5253 4591 gene locus_tag LOCUS_18600 5253 4591 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964638.1 protein_id gnl|my_center|LOCUS_18600 5371 6657 gene locus_tag LOCUS_18610 5371 6657 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966034.1 protein_id gnl|my_center|LOCUS_18610 6716 7828 gene locus_tag LOCUS_18620 6716 7828 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_18620 8032 9261 gene locus_tag LOCUS_18630 8032 9261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 10395 9493 gene locus_tag LOCUS_18640 10395 9493 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_18640 10876 10385 gene locus_tag LOCUS_18650 gene lspA 10876 10385 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724127.1 protein_id gnl|my_center|LOCUS_18650 11448 10948 gene locus_tag LOCUS_18660 11448 10948 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965709.1 protein_id gnl|my_center|LOCUS_18660 12030 14837 gene locus_tag LOCUS_18670 gene ileS 12030 14837 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_18670 16076 14958 gene locus_tag LOCUS_18680 16076 14958 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_18680 17522 16161 gene locus_tag LOCUS_18690 gene mnmE 17522 16161 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549418.1 protein_id gnl|my_center|LOCUS_18690 18665 17574 gene locus_tag LOCUS_18700 gene alr 18665 17574 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048315.1 protein_id gnl|my_center|LOCUS_18700 19742 18678 gene locus_tag LOCUS_18710 19742 18678 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393885.1 protein_id gnl|my_center|LOCUS_18710 19902 21323 gene locus_tag LOCUS_18720 19902 21323 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_18720 21329 21823 gene locus_tag LOCUS_18730 21329 21823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 21813 22784 gene locus_tag LOCUS_18740 21813 22784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence38 194 796 gene locus_tag LOCUS_18750 194 796 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681184.1 protein_id gnl|my_center|LOCUS_18750 793 1491 gene locus_tag LOCUS_18760 793 1491 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681182.1 protein_id gnl|my_center|LOCUS_18760 1652 2410 gene locus_tag LOCUS_18770 1652 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 3179 2508 gene locus_tag LOCUS_18780 gene tsaA 3179 2508 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_18780 3294 3797 gene locus_tag LOCUS_18790 gene greA 3294 3797 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564597.1 protein_id gnl|my_center|LOCUS_18790 3766 3999 gene locus_tag LOCUS_18800 3766 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 5200 4106 gene locus_tag LOCUS_18810 5200 4106 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169508.1 protein_id gnl|my_center|LOCUS_18810 6972 5290 gene locus_tag LOCUS_18820 6972 5290 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_18820 7604 6969 gene locus_tag LOCUS_18830 gene pgmB 7604 6969 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965902.1 protein_id gnl|my_center|LOCUS_18830 9326 7692 gene locus_tag LOCUS_18840 9326 7692 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681065.1 protein_id gnl|my_center|LOCUS_18840 11160 9331 gene locus_tag LOCUS_18850 11160 9331 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681067.1 protein_id gnl|my_center|LOCUS_18850 12847 11414 gene locus_tag LOCUS_18860 12847 11414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681074.1 protein_id gnl|my_center|LOCUS_18860 13173 14192 gene locus_tag LOCUS_18870 13173 14192 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141290802.1 protein_id gnl|my_center|LOCUS_18870 14189 15910 gene locus_tag LOCUS_18880 14189 15910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 15888 16634 gene locus_tag LOCUS_18890 15888 16634 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917245.1 protein_id gnl|my_center|LOCUS_18890 17468 16737 gene locus_tag LOCUS_18900 17468 16737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 18468 17578 gene locus_tag LOCUS_18910 18468 17578 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251336.1 protein_id gnl|my_center|LOCUS_18910 >Feature sequence39 2542 503 gene locus_tag LOCUS_18920 2542 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 3500 2727 gene locus_tag LOCUS_18930 gene ymdB 3500 2727 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_18930 3664 4224 gene locus_tag LOCUS_18940 3664 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 4221 5510 gene locus_tag LOCUS_18950 4221 5510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 5913 7466 gene locus_tag LOCUS_18960 gene rny 5913 7466 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_18960 8843 7767 gene locus_tag LOCUS_18970 8843 7767 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 protein_id gnl|my_center|LOCUS_18970 10655 8919 gene locus_tag LOCUS_18980 gene ade 10655 8919 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_18980 10912 11457 gene locus_tag LOCUS_18990 10912 11457 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_18990 11729 11430 gene locus_tag LOCUS_19000 11729 11430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 11728 13101 gene locus_tag LOCUS_19010 11728 13101 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_19010 14051 13155 gene locus_tag LOCUS_19020 14051 13155 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681428.1 protein_id gnl|my_center|LOCUS_19020 15216 14041 gene locus_tag LOCUS_19030 15216 14041 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393701.1 protein_id gnl|my_center|LOCUS_19030 15485 16576 gene locus_tag LOCUS_19040 gene yedE 15485 16576 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680420.1 protein_id gnl|my_center|LOCUS_19040 16573 16779 gene locus_tag LOCUS_19050 16573 16779 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869002.1 protein_id gnl|my_center|LOCUS_19050 16781 17038 gene locus_tag LOCUS_19060 16781 17038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 17028 18065 gene locus_tag LOCUS_19070 gene selD 17028 18065 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957237.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence40 266 424 gene locus_tag LOCUS_19080 266 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 475 993 gene locus_tag LOCUS_19090 475 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19090 1123 1995 gene locus_tag LOCUS_19100 1123 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19100 2238 4073 gene locus_tag LOCUS_19110 2238 4073 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679271.1 protein_id gnl|my_center|LOCUS_19110 4067 5806 gene locus_tag LOCUS_19120 4067 5806 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671107.1 protein_id gnl|my_center|LOCUS_19120 7261 5921 gene locus_tag LOCUS_19130 7261 5921 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896540.1 protein_id gnl|my_center|LOCUS_19130 9701 7263 gene locus_tag LOCUS_19140 9701 7263 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_19140 10075 11094 gene locus_tag LOCUS_19150 10075 11094 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976055.1 protein_id gnl|my_center|LOCUS_19150 11165 12550 gene locus_tag LOCUS_19160 11165 12550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 12673 13623 gene locus_tag LOCUS_19170 12673 13623 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582885.1 protein_id gnl|my_center|LOCUS_19170 13638 14507 gene locus_tag LOCUS_19180 13638 14507 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289647.1 protein_id gnl|my_center|LOCUS_19180 15155 14862 gene locus_tag LOCUS_19190 15155 14862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 16459 15590 gene locus_tag LOCUS_19200 16459 15590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 16961 16452 gene locus_tag LOCUS_19210 16961 16452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence41 1960 119 gene locus_tag LOCUS_19220 gene recQ 1960 119 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272332.1 protein_id gnl|my_center|LOCUS_19220 2723 2028 gene locus_tag LOCUS_19230 2723 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 3494 2829 gene locus_tag LOCUS_19240 3494 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 4314 3451 gene locus_tag LOCUS_19250 4314 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056248.1 protein_id gnl|my_center|LOCUS_19250 5165 4437 gene locus_tag LOCUS_19260 5165 4437 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948000.1 protein_id gnl|my_center|LOCUS_19260 5986 5441 gene locus_tag LOCUS_19270 5986 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 6070 6852 gene locus_tag LOCUS_19280 6070 6852 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965964.1 protein_id gnl|my_center|LOCUS_19280 6979 8073 gene locus_tag LOCUS_19290 6979 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 8110 8799 gene locus_tag LOCUS_19300 gene ftsE 8110 8799 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022265.1 protein_id gnl|my_center|LOCUS_19300 8786 9673 gene locus_tag LOCUS_19310 gene ftsX 8786 9673 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968247.1 protein_id gnl|my_center|LOCUS_19310 9695 10981 gene locus_tag LOCUS_19320 9695 10981 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_19320 11072 12271 gene locus_tag LOCUS_19330 11072 12271 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080969.1 protein_id gnl|my_center|LOCUS_19330 12366 12839 gene locus_tag LOCUS_19340 gene greA 12366 12839 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence42 252 1031 gene locus_tag LOCUS_19350 252 1031 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_19350 1958 1080 gene locus_tag LOCUS_19360 gene hslO 1958 1080 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_19360 2709 1963 gene locus_tag LOCUS_19370 2709 1963 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873069.1 protein_id gnl|my_center|LOCUS_19370 3017 2706 gene locus_tag LOCUS_19380 3017 2706 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720075.1 protein_id gnl|my_center|LOCUS_19380 3234 4589 gene locus_tag LOCUS_19390 3234 4589 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_19390 4624 5739 gene locus_tag LOCUS_19400 4624 5739 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_19400 5853 7070 gene locus_tag LOCUS_19410 gene pepT 5853 7070 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764742.1 protein_id gnl|my_center|LOCUS_19410 8533 7223 gene locus_tag LOCUS_19420 8533 7223 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461660.1 protein_id gnl|my_center|LOCUS_19420 8802 8533 gene locus_tag LOCUS_19430 8802 8533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 8962 9420 gene locus_tag LOCUS_19440 gene smpB 8962 9420 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 protein_id gnl|my_center|LOCUS_19440 9423 9962 gene locus_tag LOCUS_19450 9423 9962 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_19450 10101 10449 gene locus_tag LOCUS_tm00010 10101 10449 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 10694 10984 gene locus_tag LOCUS_19460 10694 10984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 11035 13119 gene locus_tag LOCUS_19470 11035 13119 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963675.1 protein_id gnl|my_center|LOCUS_19470 13179 13874 gene locus_tag LOCUS_19480 13179 13874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 >Feature sequence43 391 143 gene locus_tag LOCUS_19490 391 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 771 3242 gene locus_tag LOCUS_19500 771 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 3262 4125 gene locus_tag LOCUS_19510 3262 4125 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_19510 4128 4982 gene locus_tag LOCUS_19520 4128 4982 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_19520 5000 5869 gene locus_tag LOCUS_19530 5000 5869 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_19530 5863 6666 gene locus_tag LOCUS_19540 5863 6666 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_19540 6688 7452 gene locus_tag LOCUS_19550 gene truA 6688 7452 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_19550 7442 8605 gene locus_tag LOCUS_19560 7442 8605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 8702 11050 gene locus_tag LOCUS_19570 8702 11050 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_19570 11201 11276 gene locus_tag LOCUS_t00310 11201 11276 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11588 12046 gene locus_tag LOCUS_19580 11588 12046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 12159 12959 gene locus_tag LOCUS_19590 12159 12959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 13703 13014 gene locus_tag LOCUS_19600 13703 13014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 >Feature sequence44 182 502 gene locus_tag LOCUS_19610 182 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 658 1620 gene locus_tag LOCUS_19620 658 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 1607 2908 gene locus_tag LOCUS_19630 1607 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 3029 3193 gene locus_tag LOCUS_19640 3029 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 3273 4781 gene locus_tag LOCUS_19650 3273 4781 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965259.1 protein_id gnl|my_center|LOCUS_19650 5338 4778 gene locus_tag LOCUS_19660 5338 4778 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392905.1 protein_id gnl|my_center|LOCUS_19660 5790 5338 gene locus_tag LOCUS_19670 5790 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 6086 6682 gene locus_tag LOCUS_19680 gene cwlD 6086 6682 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966373.1 protein_id gnl|my_center|LOCUS_19680 6705 8069 gene locus_tag LOCUS_19690 gene radA 6705 8069 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_19690 8470 9489 gene locus_tag LOCUS_19700 8470 9489 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_19700 10028 9522 gene locus_tag LOCUS_19710 10028 9522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 10173 10985 gene locus_tag LOCUS_19720 10173 10985 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_19720 10991 11923 gene locus_tag LOCUS_19730 10991 11923 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_19730 >Feature sequence45 2057 459 gene locus_tag LOCUS_19740 2057 459 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454209.1 protein_id gnl|my_center|LOCUS_19740 2722 2240 gene locus_tag LOCUS_19750 2722 2240 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_19750 3124 2765 gene locus_tag LOCUS_19760 3124 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 3249 3476 gene locus_tag LOCUS_19770 3249 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 5663 3360 gene locus_tag LOCUS_19780 5663 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 5862 6206 gene locus_tag LOCUS_19790 5862 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 6210 7577 gene locus_tag LOCUS_19800 gene ffh 6210 7577 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_19800 7648 7884 gene locus_tag LOCUS_19810 gene rpsP 7648 7884 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_19810 7903 8130 gene locus_tag LOCUS_19820 7903 8130 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392483.1 protein_id gnl|my_center|LOCUS_19820 >Feature sequence46 45 338 gene locus_tag LOCUS_19830 45 338 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986884.1 protein_id gnl|my_center|LOCUS_19830 1734 646 gene locus_tag LOCUS_19840 1734 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 2002 1718 gene locus_tag LOCUS_19850 2002 1718 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262697.1 protein_id gnl|my_center|LOCUS_19850 2233 3729 gene locus_tag LOCUS_19860 2233 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 3784 4521 gene locus_tag LOCUS_19870 3784 4521 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_19870 4574 4942 gene locus_tag LOCUS_19880 4574 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 4936 5316 gene locus_tag LOCUS_19890 4936 5316 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963569.1 protein_id gnl|my_center|LOCUS_19890 5924 5340 gene locus_tag LOCUS_19900 5924 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 6624 5962 gene locus_tag LOCUS_19910 6624 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 7055 6633 gene locus_tag LOCUS_19920 gene ruvX 7055 6633 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810863.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence47 736 113 gene locus_tag LOCUS_19930 736 113 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398264.1 protein_id gnl|my_center|LOCUS_19930 1398 739 gene locus_tag LOCUS_19940 1398 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 1632 2918 gene locus_tag LOCUS_19950 1632 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 3837 3043 gene locus_tag LOCUS_19960 3837 3043 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_19960 4807 3830 gene locus_tag LOCUS_19970 4807 3830 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 protein_id gnl|my_center|LOCUS_19970 5889 4840 gene locus_tag LOCUS_19980 5889 4840 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_19980 6666 6280 gene locus_tag LOCUS_19990 6666 6280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 >Feature sequence48 1301 264 gene locus_tag LOCUS_20000 gene tdh 1301 264 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707888.1 protein_id gnl|my_center|LOCUS_20000 2145 1426 gene locus_tag LOCUS_20010 gene frlR 2145 1426 CDS product DNA-binding transcriptional regulator FrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302327.1 protein_id gnl|my_center|LOCUS_20010 4266 2323 gene locus_tag LOCUS_20020 4266 2323 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_20020 5387 4359 gene locus_tag LOCUS_20030 5387 4359 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_20030 >Feature sequence49 172 85 gene locus_tag LOCUS_t00320 172 85 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 675 1262 gene locus_tag LOCUS_20040 675 1262 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390032.1 protein_id gnl|my_center|LOCUS_20040 1243 2367 gene locus_tag LOCUS_20050 1243 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 2531 3826 gene locus_tag LOCUS_20060 2531 3826 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_20060 3976 4052 gene locus_tag LOCUS_t00330 3976 4052 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4318 4166 gene locus_tag LOCUS_20070 4318 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 >Feature sequence50 1328 162 gene locus_tag LOCUS_20080 1328 162 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_20080 1481 2677 gene locus_tag LOCUS_20090 1481 2677 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_20090 4116 2743 gene locus_tag LOCUS_20100 gene hydA 4116 2743 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387141.1 protein_id gnl|my_center|LOCUS_20100 >Feature sequence51 467 324 gene locus_tag LOCUS_20110 467 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 507 680 gene locus_tag LOCUS_20120 507 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 1806 736 gene locus_tag LOCUS_20130 1806 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 1902 2078 gene locus_tag LOCUS_20140 1902 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 2155 2913 gene locus_tag LOCUS_20150 2155 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150