>Feature sequence001 99 353 gene locus_tag LOCUS_00010 99 353 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868899.1 protein_id gnl|my_center|LOCUS_00010 346 1404 gene locus_tag LOCUS_00020 gene hydE 346 1404 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_00020 1432 2853 gene locus_tag LOCUS_00030 gene hydG 1432 2853 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_00030 2854 4044 gene locus_tag LOCUS_00040 gene hydF 2854 4044 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798360.1 protein_id gnl|my_center|LOCUS_00040 4155 5276 gene locus_tag LOCUS_00050 4155 5276 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062822309.1 protein_id gnl|my_center|LOCUS_00050 5654 7072 gene locus_tag LOCUS_00060 5654 7072 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546599.1 protein_id gnl|my_center|LOCUS_00060 7139 8458 gene locus_tag LOCUS_00070 7139 8458 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963927.1 protein_id gnl|my_center|LOCUS_00070 8458 8871 gene locus_tag LOCUS_00080 8458 8871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9983 9093 gene locus_tag LOCUS_00090 9983 9093 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_00090 11839 10046 gene locus_tag LOCUS_00100 11839 10046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12014 13000 gene locus_tag LOCUS_00110 gene comGA 12014 13000 CDS product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697220.1 protein_id gnl|my_center|LOCUS_00110 12993 13994 gene locus_tag LOCUS_00120 12993 13994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14004 14306 gene locus_tag LOCUS_00130 gene comGC 14004 14306 CDS product comG operon protein ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230162.1 protein_id gnl|my_center|LOCUS_00130 14296 14703 gene locus_tag LOCUS_00140 14296 14703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14690 14911 gene locus_tag LOCUS_00150 14690 14911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 14863 15333 gene locus_tag LOCUS_00160 14863 15333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 15317 15691 gene locus_tag LOCUS_00170 15317 15691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 15768 16325 gene locus_tag LOCUS_00180 gene efp 15768 16325 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183306.1 protein_id gnl|my_center|LOCUS_00180 16428 16898 gene locus_tag LOCUS_00190 16428 16898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 16949 17287 gene locus_tag LOCUS_00200 16949 17287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 17379 17783 gene locus_tag LOCUS_00210 gene nusB 17379 17783 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699843.1 protein_id gnl|my_center|LOCUS_00210 17783 19099 gene locus_tag LOCUS_00220 gene xseA 17783 19099 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286928.1 protein_id gnl|my_center|LOCUS_00220 19109 19324 gene locus_tag LOCUS_00230 19109 19324 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226409.1 protein_id gnl|my_center|LOCUS_00230 19326 20174 gene locus_tag LOCUS_00240 19326 20174 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965380.1 protein_id gnl|my_center|LOCUS_00240 20174 22048 gene locus_tag LOCUS_00250 gene dxs 20174 22048 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366447.1 protein_id gnl|my_center|LOCUS_00250 22029 22829 gene locus_tag LOCUS_00260 22029 22829 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274739.1 protein_id gnl|my_center|LOCUS_00260 22838 24493 gene locus_tag LOCUS_00270 gene recN 22838 24493 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660689.1 protein_id gnl|my_center|LOCUS_00270 24552 25538 gene locus_tag LOCUS_00280 24552 25538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 25842 27044 gene locus_tag LOCUS_00290 25842 27044 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398755.1 protein_id gnl|my_center|LOCUS_00290 27095 27658 gene locus_tag LOCUS_00300 27095 27658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 27724 28632 gene locus_tag LOCUS_00310 gene xerD 27724 28632 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 protein_id gnl|my_center|LOCUS_00310 28642 29823 gene locus_tag LOCUS_00320 gene deoB 28642 29823 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046067.1 protein_id gnl|my_center|LOCUS_00320 29836 30105 gene locus_tag LOCUS_00330 29836 30105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 30605 30252 gene locus_tag LOCUS_00340 30605 30252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 31452 30706 gene locus_tag LOCUS_00350 31452 30706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 33291 31558 gene locus_tag LOCUS_00360 33291 31558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 34528 33299 gene locus_tag LOCUS_00370 34528 33299 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_00370 35934 34570 gene locus_tag LOCUS_00380 35934 34570 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_00380 36221 35949 gene locus_tag LOCUS_00390 36221 35949 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_00390 36675 36358 gene locus_tag LOCUS_00400 36675 36358 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990063.1 protein_id gnl|my_center|LOCUS_00400 37079 36765 gene locus_tag LOCUS_00410 37079 36765 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990063.1 protein_id gnl|my_center|LOCUS_00410 37667 37338 gene locus_tag LOCUS_00420 37667 37338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 40119 37783 gene locus_tag LOCUS_00430 40119 37783 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860926.1 protein_id gnl|my_center|LOCUS_00430 40812 40123 gene locus_tag LOCUS_00440 gene mtnN 40812 40123 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217037.1 protein_id gnl|my_center|LOCUS_00440 41534 40812 gene locus_tag LOCUS_00450 41534 40812 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356302.1 protein_id gnl|my_center|LOCUS_00450 41878 41534 gene locus_tag LOCUS_00460 gene rsfS 41878 41534 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033582077.1 protein_id gnl|my_center|LOCUS_00460 42971 41871 gene locus_tag LOCUS_00470 42971 41871 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166626.1 protein_id gnl|my_center|LOCUS_00470 43255 42968 gene locus_tag LOCUS_00480 gene yhbY 43255 42968 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941918.1 protein_id gnl|my_center|LOCUS_00480 44367 43270 gene locus_tag LOCUS_00490 gene yqeH 44367 43270 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229966.1 protein_id gnl|my_center|LOCUS_00490 44501 45187 gene locus_tag LOCUS_00500 gene sigK 44501 45187 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 protein_id gnl|my_center|LOCUS_00500 47747 45201 gene locus_tag LOCUS_00510 gene parC 47747 45201 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231550.1 protein_id gnl|my_center|LOCUS_00510 49687 47759 gene locus_tag LOCUS_00520 gene parE 49687 47759 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231552.1 protein_id gnl|my_center|LOCUS_00520 49854 50453 gene locus_tag LOCUS_00530 gene plsY 49854 50453 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972779.1 protein_id gnl|my_center|LOCUS_00530 52142 51720 gene locus_tag LOCUS_00540 52142 51720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 53291 52671 gene locus_tag LOCUS_00550 53291 52671 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256529.1 protein_id gnl|my_center|LOCUS_00550 53518 53315 gene locus_tag LOCUS_00560 53518 53315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 53902 53522 gene locus_tag LOCUS_00570 53902 53522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 55990 54014 gene locus_tag LOCUS_00580 gene tkt 55990 54014 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245397.1 protein_id gnl|my_center|LOCUS_00580 56307 56077 gene locus_tag LOCUS_00590 56307 56077 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231595.1 protein_id gnl|my_center|LOCUS_00590 57817 56537 gene locus_tag LOCUS_00600 57817 56537 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411976.1 protein_id gnl|my_center|LOCUS_00600 59079 57817 gene locus_tag LOCUS_00610 59079 57817 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772433.1 protein_id gnl|my_center|LOCUS_00610 61000 59189 gene locus_tag LOCUS_00620 gene lepA 61000 59189 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030950.1 protein_id gnl|my_center|LOCUS_00620 61394 61059 gene locus_tag LOCUS_00630 61394 61059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 61937 61605 gene locus_tag LOCUS_00640 gene acpS 61937 61605 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296554.1 protein_id gnl|my_center|LOCUS_00640 62671 61940 gene locus_tag LOCUS_00650 62671 61940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 63291 62692 gene locus_tag LOCUS_00660 63291 62692 CDS product DUF4479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989760.1 protein_id gnl|my_center|LOCUS_00660 63623 63303 gene locus_tag LOCUS_00670 63623 63303 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009915789.1 protein_id gnl|my_center|LOCUS_00670 64268 63624 gene locus_tag LOCUS_00680 gene trmB 64268 63624 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239380.1 protein_id gnl|my_center|LOCUS_00680 65020 64301 gene locus_tag LOCUS_00690 65020 64301 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860778.1 protein_id gnl|my_center|LOCUS_00690 65429 65004 gene locus_tag LOCUS_00700 65429 65004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 65764 65615 gene locus_tag LOCUS_00710 65764 65615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 66007 65828 gene locus_tag LOCUS_00720 66007 65828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 66917 66039 gene locus_tag LOCUS_00730 66917 66039 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127403.1 protein_id gnl|my_center|LOCUS_00730 67371 67027 gene locus_tag LOCUS_00740 gene rbfA 67371 67027 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097322.1 protein_id gnl|my_center|LOCUS_00740 69218 67380 gene locus_tag LOCUS_00750 gene infB 69218 67380 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036343.1 protein_id gnl|my_center|LOCUS_00750 69519 69223 gene locus_tag LOCUS_00760 69519 69223 CDS product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020853.1 protein_id gnl|my_center|LOCUS_00760 69769 69512 gene locus_tag LOCUS_00770 gene rulR 69769 69512 CDS product glucose-induced regulator RulR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967250.1 protein_id gnl|my_center|LOCUS_00770 71080 69782 gene locus_tag LOCUS_00780 gene nusA 71080 69782 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_00780 71560 71093 gene locus_tag LOCUS_00790 gene rimP 71560 71093 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231915.1 protein_id gnl|my_center|LOCUS_00790 <72385 71657 gene locus_tag LOCUS_00800 <72385 71657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_204669935.1:PolC-type DNA polymerase III >Feature sequence002 650 997 gene locus_tag LOCUS_00810 650 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00810 1240 3147 gene locus_tag LOCUS_00820 1240 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 3150 5138 gene locus_tag LOCUS_00830 3150 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 5451 11387 gene locus_tag LOCUS_00840 5451 11387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 12794 14890 gene locus_tag LOCUS_00850 12794 14890 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_00850 14905 16485 gene locus_tag LOCUS_00860 gene asnB 14905 16485 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_00860 16499 21001 gene locus_tag LOCUS_00870 gene gltB 16499 21001 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_00870 20994 22454 gene locus_tag LOCUS_00880 20994 22454 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_00880 22536 24056 gene locus_tag LOCUS_00890 22536 24056 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_00890 24067 24477 gene locus_tag LOCUS_00900 24067 24477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 24885 29864 gene locus_tag LOCUS_00910 24885 29864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 29986 30939 gene locus_tag LOCUS_00920 29986 30939 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964762.1 protein_id gnl|my_center|LOCUS_00920 30939 32246 gene locus_tag LOCUS_00930 30939 32246 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002907421.1 protein_id gnl|my_center|LOCUS_00930 32239 32913 gene locus_tag LOCUS_00940 32239 32913 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896732.1 protein_id gnl|my_center|LOCUS_00940 32906 34195 gene locus_tag LOCUS_00950 32906 34195 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964765.1 protein_id gnl|my_center|LOCUS_00950 34312 34734 gene locus_tag LOCUS_00960 34312 34734 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964766.1 protein_id gnl|my_center|LOCUS_00960 34750 35241 gene locus_tag LOCUS_00970 34750 35241 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263460.1 protein_id gnl|my_center|LOCUS_00970 35262 36113 gene locus_tag LOCUS_00980 35262 36113 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262152.1 protein_id gnl|my_center|LOCUS_00980 36115 36951 gene locus_tag LOCUS_00990 36115 36951 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262151.1 protein_id gnl|my_center|LOCUS_00990 36966 37235 gene locus_tag LOCUS_01000 36966 37235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 37283 38089 gene locus_tag LOCUS_01010 37283 38089 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251908.1 protein_id gnl|my_center|LOCUS_01010 38091 39797 gene locus_tag LOCUS_01020 38091 39797 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 protein_id gnl|my_center|LOCUS_01020 39968 40609 gene locus_tag LOCUS_01030 39968 40609 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287965.1 protein_id gnl|my_center|LOCUS_01030 40596 40913 gene locus_tag LOCUS_01040 40596 40913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 40925 41755 gene locus_tag LOCUS_01050 40925 41755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 41821 43191 gene locus_tag LOCUS_01060 41821 43191 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_01060 43279 44016 gene locus_tag LOCUS_01070 43279 44016 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583389.1 protein_id gnl|my_center|LOCUS_01070 44324 45073 gene locus_tag LOCUS_01080 44324 45073 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091542811.1 protein_id gnl|my_center|LOCUS_01080 45098 45526 gene locus_tag LOCUS_01090 45098 45526 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476578.1 protein_id gnl|my_center|LOCUS_01090 46469 45942 gene locus_tag LOCUS_01100 46469 45942 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262576.1 protein_id gnl|my_center|LOCUS_01100 47553 46597 gene locus_tag LOCUS_01110 47553 46597 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 protein_id gnl|my_center|LOCUS_01110 48556 47609 gene locus_tag LOCUS_01120 48556 47609 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384427.1 protein_id gnl|my_center|LOCUS_01120 50064 48709 gene locus_tag LOCUS_01130 50064 48709 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930806.1 protein_id gnl|my_center|LOCUS_01130 50900 50121 gene locus_tag LOCUS_01140 50900 50121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 51790 50960 gene locus_tag LOCUS_01150 51790 50960 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183854.1 protein_id gnl|my_center|LOCUS_01150 52336 53313 gene locus_tag LOCUS_01160 52336 53313 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945303.1 protein_id gnl|my_center|LOCUS_01160 53323 54192 gene locus_tag LOCUS_01170 53323 54192 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461074.1 protein_id gnl|my_center|LOCUS_01170 54195 54980 gene locus_tag LOCUS_01180 54195 54980 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039647756.1 protein_id gnl|my_center|LOCUS_01180 55422 56777 gene locus_tag LOCUS_01190 55422 56777 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966714.1 protein_id gnl|my_center|LOCUS_01190 56964 57422 gene locus_tag LOCUS_01200 gene bcp 56964 57422 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_01200 57474 58262 gene locus_tag LOCUS_01210 57474 58262 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963843.1 protein_id gnl|my_center|LOCUS_01210 58719 58561 gene locus_tag LOCUS_01220 58719 58561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 59486 58866 gene locus_tag LOCUS_01230 gene lexA 59486 58866 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930693.1 protein_id gnl|my_center|LOCUS_01230 59660 59782 gene locus_tag LOCUS_01240 59660 59782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 59782 59901 gene locus_tag LOCUS_01250 59782 59901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 59990 60607 gene locus_tag LOCUS_01260 59990 60607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 60576 60980 gene locus_tag LOCUS_01270 60576 60980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 61184 61840 gene locus_tag LOCUS_01280 61184 61840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01280 61976 62659 gene locus_tag LOCUS_01290 61976 62659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01290 63164 64129 gene locus_tag LOCUS_01300 63164 64129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 >Feature sequence003 1250 498 gene locus_tag LOCUS_01310 1250 498 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358533.1 protein_id gnl|my_center|LOCUS_01310 2055 1279 gene locus_tag LOCUS_01320 2055 1279 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957281.1 protein_id gnl|my_center|LOCUS_01320 2964 2068 gene locus_tag LOCUS_01330 2964 2068 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_01330 5227 2957 gene locus_tag LOCUS_01340 5227 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 5455 6369 gene locus_tag LOCUS_01350 gene trxB 5455 6369 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357780.1 protein_id gnl|my_center|LOCUS_01350 6529 7377 gene locus_tag LOCUS_01360 gene rapZ 6529 7377 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641036.1 protein_id gnl|my_center|LOCUS_01360 7386 8333 gene locus_tag LOCUS_01370 gene whiA 7386 8333 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006561.1 protein_id gnl|my_center|LOCUS_01370 8335 8547 gene locus_tag LOCUS_01380 8335 8547 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011182964.1 protein_id gnl|my_center|LOCUS_01380 8560 8835 gene locus_tag LOCUS_01390 8560 8835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 8926 9468 gene locus_tag LOCUS_01400 gene rnmV 8926 9468 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226752.1 protein_id gnl|my_center|LOCUS_01400 9468 10274 gene locus_tag LOCUS_01410 gene rsmA 9468 10274 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886500.1 protein_id gnl|my_center|LOCUS_01410 10301 11044 gene locus_tag LOCUS_01420 gene yabG 10301 11044 CDS product sporulation peptidase YabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458914.1 protein_id gnl|my_center|LOCUS_01420 11049 11897 gene locus_tag LOCUS_01430 gene ispE 11049 11897 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321008.1 protein_id gnl|my_center|LOCUS_01430 12069 13448 gene locus_tag LOCUS_01440 gene glmU 12069 13448 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071041.1 protein_id gnl|my_center|LOCUS_01440 13458 14414 gene locus_tag LOCUS_01450 13458 14414 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903312.1 protein_id gnl|my_center|LOCUS_01450 14687 15445 gene locus_tag LOCUS_01460 14687 15445 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895851.1 protein_id gnl|my_center|LOCUS_01460 15457 16386 gene locus_tag LOCUS_01470 15457 16386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 16510 16992 gene locus_tag LOCUS_01480 16510 16992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 17111 18973 gene locus_tag LOCUS_01490 gene mnmG 17111 18973 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000541039.1 protein_id gnl|my_center|LOCUS_01490 18977 19678 gene locus_tag LOCUS_01500 gene rsmG 18977 19678 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019621.1 protein_id gnl|my_center|LOCUS_01500 19687 20454 gene locus_tag LOCUS_01510 gene noc 19687 20454 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799016.1 protein_id gnl|my_center|LOCUS_01510 21404 20595 gene locus_tag LOCUS_01520 21404 20595 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986494.1 protein_id gnl|my_center|LOCUS_01520 21643 23382 gene locus_tag LOCUS_01530 21643 23382 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897981.1 protein_id gnl|my_center|LOCUS_01530 23366 25141 gene locus_tag LOCUS_01540 23366 25141 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426617.1 protein_id gnl|my_center|LOCUS_01540 25200 25580 gene locus_tag LOCUS_01550 25200 25580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 25522 25725 gene locus_tag LOCUS_01560 25522 25725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 26260 25748 gene locus_tag LOCUS_01570 26260 25748 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049186.1 protein_id gnl|my_center|LOCUS_01570 26369 27217 gene locus_tag LOCUS_01580 26369 27217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 27629 29788 gene locus_tag LOCUS_01590 gene nrdD 27629 29788 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095357.1 protein_id gnl|my_center|LOCUS_01590 29791 30303 gene locus_tag LOCUS_01600 gene nrdG 29791 30303 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_01600 30977 31591 gene locus_tag LOCUS_01610 30977 31591 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964116.1 protein_id gnl|my_center|LOCUS_01610 31588 32463 gene locus_tag LOCUS_01620 31588 32463 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964117.1 protein_id gnl|my_center|LOCUS_01620 32463 33233 gene locus_tag LOCUS_01630 32463 33233 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701079.1 protein_id gnl|my_center|LOCUS_01630 33223 34137 gene locus_tag LOCUS_01640 gene spo0J 33223 34137 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051832.1 protein_id gnl|my_center|LOCUS_01640 34353 34925 gene locus_tag LOCUS_01650 34353 34925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 34995 36956 gene locus_tag LOCUS_01660 gene gdpP 34995 36956 CDS product cyclic-di-AMP phosphodiesterase GdpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081640.1 protein_id gnl|my_center|LOCUS_01660 36956 37402 gene locus_tag LOCUS_01670 gene rplI 36956 37402 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831811.1 protein_id gnl|my_center|LOCUS_01670 37412 38788 gene locus_tag LOCUS_01680 gene dnaB 37412 38788 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286244.1 protein_id gnl|my_center|LOCUS_01680 38808 39428 gene locus_tag LOCUS_01690 38808 39428 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243018.1 protein_id gnl|my_center|LOCUS_01690 39637 40713 gene locus_tag LOCUS_01700 gene prfA 39637 40713 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183530.1 protein_id gnl|my_center|LOCUS_01700 40713 41570 gene locus_tag LOCUS_01710 gene prmC 40713 41570 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267061.1 protein_id gnl|my_center|LOCUS_01710 41813 42310 gene locus_tag LOCUS_01720 41813 42310 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885396.1 protein_id gnl|my_center|LOCUS_01720 42396 44600 gene locus_tag LOCUS_01730 gene spoIIE 42396 44600 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243026.1 protein_id gnl|my_center|LOCUS_01730 44684 45928 gene locus_tag LOCUS_01740 gene tilS 44684 45928 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166253.1 protein_id gnl|my_center|LOCUS_01740 45955 46485 gene locus_tag LOCUS_01750 gene hpt 45955 46485 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892185.1 protein_id gnl|my_center|LOCUS_01750 46495 48447 gene locus_tag LOCUS_01760 gene ftsH 46495 48447 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733155.1 protein_id gnl|my_center|LOCUS_01760 48589 49458 gene locus_tag LOCUS_01770 gene hslO 48589 49458 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656366.1 protein_id gnl|my_center|LOCUS_01770 49759 50739 gene locus_tag LOCUS_01780 gene dusB 49759 50739 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243741.1 protein_id gnl|my_center|LOCUS_01780 50807 51655 gene locus_tag LOCUS_01790 gene folD 50807 51655 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722487.1 protein_id gnl|my_center|LOCUS_01790 51657 51836 gene locus_tag LOCUS_01800 51657 51836 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704318.1 protein_id gnl|my_center|LOCUS_01800 52538 52047 gene locus_tag LOCUS_01810 52538 52047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 53468 52584 gene locus_tag LOCUS_01820 53468 52584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 53590 54333 gene locus_tag LOCUS_01830 53590 54333 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263557.1 protein_id gnl|my_center|LOCUS_01830 55434 54628 gene locus_tag LOCUS_01840 gene rlmA 55434 54628 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262328.1 protein_id gnl|my_center|LOCUS_01840 55554 56105 gene locus_tag LOCUS_01850 55554 56105 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_01850 56115 56384 gene locus_tag LOCUS_01860 56115 56384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 56374 57114 gene locus_tag LOCUS_01870 56374 57114 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898090.1 protein_id gnl|my_center|LOCUS_01870 57239 58105 gene locus_tag LOCUS_01880 gene fba 57239 58105 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_01880 58304 58501 gene locus_tag LOCUS_01890 58304 58501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 58697 58945 gene locus_tag LOCUS_01900 58697 58945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 59064 60227 gene locus_tag LOCUS_01910 59064 60227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 60593 60204 gene locus_tag LOCUS_01920 60593 60204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 61014 60481 gene locus_tag LOCUS_01930 61014 60481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 61598 62866 gene locus_tag LOCUS_01940 61598 62866 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227628.1 protein_id gnl|my_center|LOCUS_01940 62998 63519 gene locus_tag LOCUS_01950 62998 63519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 >Feature sequence004 2368 20 gene locus_tag LOCUS_01960 2368 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 2718 2852 gene locus_tag LOCUS_01970 2718 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 3222 3452 gene locus_tag LOCUS_01980 3222 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 8762 3813 gene locus_tag LOCUS_01990 8762 3813 CDS product beta-N-acetylglucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390210.1 protein_id gnl|my_center|LOCUS_01990 9980 9147 gene locus_tag LOCUS_02000 9980 9147 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432034.1 protein_id gnl|my_center|LOCUS_02000 12123 10639 gene locus_tag LOCUS_02010 gene nagE 12123 10639 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705424.1 protein_id gnl|my_center|LOCUS_02010 12315 12800 gene locus_tag LOCUS_02020 12315 12800 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964663.1 protein_id gnl|my_center|LOCUS_02020 13413 12817 gene locus_tag LOCUS_02030 13413 12817 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830164.1 protein_id gnl|my_center|LOCUS_02030 14051 13410 gene locus_tag LOCUS_02040 gene rpe 14051 13410 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014472.1 protein_id gnl|my_center|LOCUS_02040 14901 14044 gene locus_tag LOCUS_02050 gene rsgA 14901 14044 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232060.1 protein_id gnl|my_center|LOCUS_02050 16861 14912 gene locus_tag LOCUS_02060 gene pknB 16861 14912 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733096.1 protein_id gnl|my_center|LOCUS_02060 17600 16863 gene locus_tag LOCUS_02070 17600 16863 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254417.1 protein_id gnl|my_center|LOCUS_02070 18628 17600 gene locus_tag LOCUS_02080 gene rlmN 18628 17600 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830070.1 protein_id gnl|my_center|LOCUS_02080 19883 18630 gene locus_tag LOCUS_02090 gene rsmB 19883 18630 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249680.1 protein_id gnl|my_center|LOCUS_02090 22089 19900 gene locus_tag LOCUS_02100 gene priA 22089 19900 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666718.1 protein_id gnl|my_center|LOCUS_02100 22730 22158 gene locus_tag LOCUS_02110 22730 22158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 23203 22793 gene locus_tag LOCUS_02120 23203 22793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 23804 23232 gene locus_tag LOCUS_02130 gene gmk 23804 23232 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257738.1 protein_id gnl|my_center|LOCUS_02130 23926 25569 gene locus_tag LOCUS_02140 23926 25569 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863284.1 protein_id gnl|my_center|LOCUS_02140 25946 25590 gene locus_tag LOCUS_02150 25946 25590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 26024 26779 gene locus_tag LOCUS_02160 gene pgeF 26024 26779 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986855.1 protein_id gnl|my_center|LOCUS_02160 27170 26952 gene locus_tag LOCUS_02170 27170 26952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 27230 27745 gene locus_tag LOCUS_02180 27230 27745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 29511 28060 gene locus_tag LOCUS_02190 29511 28060 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963812.1 protein_id gnl|my_center|LOCUS_02190 31391 29943 gene locus_tag LOCUS_02200 31391 29943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 34851 31606 gene locus_tag LOCUS_02210 34851 31606 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964141.1 protein_id gnl|my_center|LOCUS_02210 35549 34845 gene locus_tag LOCUS_02220 35549 34845 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171779440.1 protein_id gnl|my_center|LOCUS_02220 35682 36164 gene locus_tag LOCUS_02230 35682 36164 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476166.1 protein_id gnl|my_center|LOCUS_02230 36566 36174 gene locus_tag LOCUS_02240 36566 36174 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068146.1 protein_id gnl|my_center|LOCUS_02240 37009 36650 gene locus_tag LOCUS_02250 gene rplT 37009 36650 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132352.1 protein_id gnl|my_center|LOCUS_02250 37226 37032 gene locus_tag LOCUS_02260 gene rpmI 37226 37032 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222418.1 protein_id gnl|my_center|LOCUS_02260 37798 37244 gene locus_tag LOCUS_02270 gene infC 37798 37244 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973214.1 protein_id gnl|my_center|LOCUS_02270 38957 38121 gene locus_tag LOCUS_02280 38957 38121 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 protein_id gnl|my_center|LOCUS_02280 40970 39021 gene locus_tag LOCUS_02290 40970 39021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 41348 41166 gene locus_tag LOCUS_02300 41348 41166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 43063 41477 gene locus_tag LOCUS_02310 43063 41477 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_02310 44406 43174 gene locus_tag LOCUS_02320 44406 43174 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459866.1 protein_id gnl|my_center|LOCUS_02320 44839 44417 gene locus_tag LOCUS_02330 44839 44417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 47137 44921 gene locus_tag LOCUS_02340 47137 44921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 47526 47182 gene locus_tag LOCUS_02350 47526 47182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 47615 48811 gene locus_tag LOCUS_02360 47615 48811 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654702.1 protein_id gnl|my_center|LOCUS_02360 49647 48808 gene locus_tag LOCUS_02370 49647 48808 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079134.1 protein_id gnl|my_center|LOCUS_02370 50422 49640 gene locus_tag LOCUS_02380 50422 49640 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106785139.1 protein_id gnl|my_center|LOCUS_02380 50476 51039 gene locus_tag LOCUS_02390 50476 51039 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922294.1 protein_id gnl|my_center|LOCUS_02390 51570 51124 gene locus_tag LOCUS_02400 gene spxA 51570 51124 CDS product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296384.1 protein_id gnl|my_center|LOCUS_02400 52253 51675 gene locus_tag LOCUS_02410 52253 51675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 52348 53193 gene locus_tag LOCUS_02420 52348 53193 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434794.1 protein_id gnl|my_center|LOCUS_02420 53619 53245 gene locus_tag LOCUS_02430 53619 53245 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869964.1 protein_id gnl|my_center|LOCUS_02430 53839 54348 gene locus_tag LOCUS_02440 53839 54348 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948594.1 protein_id gnl|my_center|LOCUS_02440 55733 54375 gene locus_tag LOCUS_02450 55733 54375 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_02450 57766 56339 gene locus_tag LOCUS_02460 57766 56339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 59054 57888 gene locus_tag LOCUS_02470 59054 57888 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_02470 60150 59065 gene locus_tag LOCUS_02480 gene serC 60150 59065 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_02480 61025 61585 gene locus_tag LOCUS_02490 61025 61585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 62551 61763 gene locus_tag LOCUS_02500 62551 61763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 >Feature sequence005 918 574 gene locus_tag LOCUS_02510 918 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 1540 1226 gene locus_tag LOCUS_02520 1540 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 2003 2311 gene locus_tag LOCUS_02530 gene rpsJ 2003 2311 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_02530 2333 3061 gene locus_tag LOCUS_02540 gene rplC 2333 3061 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399671.1 protein_id gnl|my_center|LOCUS_02540 3083 3706 gene locus_tag LOCUS_02550 gene rplD 3083 3706 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399658.1 protein_id gnl|my_center|LOCUS_02550 3706 3996 gene locus_tag LOCUS_02560 gene rplW 3706 3996 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829755.1 protein_id gnl|my_center|LOCUS_02560 4046 4879 gene locus_tag LOCUS_02570 gene rplB 4046 4879 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225795.1 protein_id gnl|my_center|LOCUS_02570 4898 5176 gene locus_tag LOCUS_02580 gene rpsS 4898 5176 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829710.1 protein_id gnl|my_center|LOCUS_02580 5196 5528 gene locus_tag LOCUS_02590 gene rplV 5196 5528 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567555.1 protein_id gnl|my_center|LOCUS_02590 5540 6193 gene locus_tag LOCUS_02600 gene rpsC 5540 6193 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235068.1 protein_id gnl|my_center|LOCUS_02600 6196 6606 gene locus_tag LOCUS_02610 gene rplP 6196 6606 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166906.1 protein_id gnl|my_center|LOCUS_02610 6609 6803 gene locus_tag LOCUS_02620 gene rpmC 6609 6803 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701313.1 protein_id gnl|my_center|LOCUS_02620 6815 7075 gene locus_tag LOCUS_02630 gene rpsQ 6815 7075 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004106.1 protein_id gnl|my_center|LOCUS_02630 7107 7475 gene locus_tag LOCUS_02640 gene rplN 7107 7475 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723686.1 protein_id gnl|my_center|LOCUS_02640 7488 7823 gene locus_tag LOCUS_02650 gene rplX 7488 7823 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547687.1 protein_id gnl|my_center|LOCUS_02650 7835 8374 gene locus_tag LOCUS_02660 gene rplE 7835 8374 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701318.1 protein_id gnl|my_center|LOCUS_02660 8391 8576 gene locus_tag LOCUS_02670 8391 8576 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140799.1 protein_id gnl|my_center|LOCUS_02670 8610 9005 gene locus_tag LOCUS_02680 gene rpsH 8610 9005 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241998.1 protein_id gnl|my_center|LOCUS_02680 9036 9581 gene locus_tag LOCUS_02690 gene rplF 9036 9581 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399690.1 protein_id gnl|my_center|LOCUS_02690 9603 9959 gene locus_tag LOCUS_02700 gene rplR 9603 9959 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356218.1 protein_id gnl|my_center|LOCUS_02700 9972 10535 gene locus_tag LOCUS_02710 gene rpsE 9972 10535 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113851.1 protein_id gnl|my_center|LOCUS_02710 10549 10731 gene locus_tag LOCUS_02720 10549 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 10745 11185 gene locus_tag LOCUS_02730 gene rplO 10745 11185 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936637.1 protein_id gnl|my_center|LOCUS_02730 11187 12488 gene locus_tag LOCUS_02740 gene secY 11187 12488 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490114.1 protein_id gnl|my_center|LOCUS_02740 12512 13159 gene locus_tag LOCUS_02750 12512 13159 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399686.1 protein_id gnl|my_center|LOCUS_02750 13159 13905 gene locus_tag LOCUS_02760 gene map 13159 13905 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_02760 13925 14146 gene locus_tag LOCUS_02770 gene infA 13925 14146 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689399.1 protein_id gnl|my_center|LOCUS_02770 14318 14683 gene locus_tag LOCUS_02780 gene rpsM 14318 14683 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090788.1 protein_id gnl|my_center|LOCUS_02780 14704 15096 gene locus_tag LOCUS_02790 gene rpsK 14704 15096 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101625.1 protein_id gnl|my_center|LOCUS_02790 15142 16086 gene locus_tag LOCUS_02800 15142 16086 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427733.1 protein_id gnl|my_center|LOCUS_02800 16119 16481 gene locus_tag LOCUS_02810 gene rplQ 16119 16481 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331497.1 protein_id gnl|my_center|LOCUS_02810 16574 17404 gene locus_tag LOCUS_02820 16574 17404 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399689.1 protein_id gnl|my_center|LOCUS_02820 17380 18231 gene locus_tag LOCUS_02830 17380 18231 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476334.1 protein_id gnl|my_center|LOCUS_02830 18224 19024 gene locus_tag LOCUS_02840 18224 19024 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186526.1 protein_id gnl|my_center|LOCUS_02840 19024 19755 gene locus_tag LOCUS_02850 gene truA 19024 19755 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477893.1 protein_id gnl|my_center|LOCUS_02850 19948 21150 gene locus_tag LOCUS_02860 19948 21150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 21143 22051 gene locus_tag LOCUS_02870 21143 22051 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922651.1 protein_id gnl|my_center|LOCUS_02870 22084 22914 gene locus_tag LOCUS_02880 22084 22914 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047704.1 protein_id gnl|my_center|LOCUS_02880 22925 23956 gene locus_tag LOCUS_02890 22925 23956 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986709.1 protein_id gnl|my_center|LOCUS_02890 24025 24300 gene locus_tag LOCUS_02900 gene hupB 24025 24300 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081127.1 protein_id gnl|my_center|LOCUS_02900 24944 24309 gene locus_tag LOCUS_02910 24944 24309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 25587 25015 gene locus_tag LOCUS_02920 25587 25015 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865105.1 protein_id gnl|my_center|LOCUS_02920 25788 26615 gene locus_tag LOCUS_02930 gene cdaA 25788 26615 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829928.1 protein_id gnl|my_center|LOCUS_02930 26599 28014 gene locus_tag LOCUS_02940 26599 28014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 28027 29376 gene locus_tag LOCUS_02950 gene glmM 28027 29376 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 protein_id gnl|my_center|LOCUS_02950 29477 30130 gene locus_tag LOCUS_02960 29477 30130 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948085.1 protein_id gnl|my_center|LOCUS_02960 30130 31446 gene locus_tag LOCUS_02970 gene cssS 30130 31446 CDS product secretion stress-responsive two-component system sensor histidine kinase CssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228527.1 protein_id gnl|my_center|LOCUS_02970 31952 33319 gene locus_tag LOCUS_02980 31952 33319 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_02980 33487 34149 gene locus_tag LOCUS_02990 33487 34149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 34403 34648 gene locus_tag LOCUS_03000 34403 34648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 34758 36743 gene locus_tag LOCUS_03010 34758 36743 CDS product bacteriocin-associated integral membrane family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870829.1 protein_id gnl|my_center|LOCUS_03010 36746 37375 gene locus_tag LOCUS_03020 36746 37375 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435768.1 protein_id gnl|my_center|LOCUS_03020 37520 37912 gene locus_tag LOCUS_03030 37520 37912 CDS product Zn-finger containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964917.1 protein_id gnl|my_center|LOCUS_03030 37914 38747 gene locus_tag LOCUS_03040 37914 38747 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_03040 38747 39355 gene locus_tag LOCUS_03050 38747 39355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 39372 41132 gene locus_tag LOCUS_03060 gene dnaK 39372 41132 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_03060 41223 41708 gene locus_tag LOCUS_03070 41223 41708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 41824 42735 gene locus_tag LOCUS_03080 gene nadA 41824 42735 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454668.1 protein_id gnl|my_center|LOCUS_03080 42749 44050 gene locus_tag LOCUS_03090 42749 44050 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430790.1 protein_id gnl|my_center|LOCUS_03090 44028 44882 gene locus_tag LOCUS_03100 gene nadC 44028 44882 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360683.1 protein_id gnl|my_center|LOCUS_03100 44938 46299 gene locus_tag LOCUS_03110 44938 46299 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965885.1 protein_id gnl|my_center|LOCUS_03110 46943 46311 gene locus_tag LOCUS_03120 46943 46311 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_03120 48012 46987 gene locus_tag LOCUS_03130 gene queA 48012 46987 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354028.1 protein_id gnl|my_center|LOCUS_03130 49150 48014 gene locus_tag LOCUS_03140 gene tgt 49150 48014 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112045.1 protein_id gnl|my_center|LOCUS_03140 50000 49212 gene locus_tag LOCUS_03150 50000 49212 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965542.1 protein_id gnl|my_center|LOCUS_03150 50700 50011 gene locus_tag LOCUS_03160 50700 50011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 50850 51698 gene locus_tag LOCUS_03170 50850 51698 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048249.1 protein_id gnl|my_center|LOCUS_03170 51698 53086 gene locus_tag LOCUS_03180 gene gltA 51698 53086 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_03180 53778 53254 gene locus_tag LOCUS_03190 53778 53254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 54845 53775 gene locus_tag LOCUS_03200 54845 53775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 55492 54842 gene locus_tag LOCUS_03210 55492 54842 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719652.1 protein_id gnl|my_center|LOCUS_03210 55799 55476 gene locus_tag LOCUS_03220 55799 55476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 55919 56227 gene locus_tag LOCUS_03230 55919 56227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03230 56267 56503 gene locus_tag LOCUS_03240 56267 56503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 56591 57256 gene locus_tag LOCUS_03250 56591 57256 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773720.1 protein_id gnl|my_center|LOCUS_03250 57266 58906 gene locus_tag LOCUS_03260 57266 58906 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_03260 58908 59174 gene locus_tag LOCUS_03270 58908 59174 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194330.1 protein_id gnl|my_center|LOCUS_03270 60001 59201 gene locus_tag LOCUS_03280 60001 59201 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_227020148.1 protein_id gnl|my_center|LOCUS_03280 60887 59994 gene locus_tag LOCUS_03290 60887 59994 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626612.1 protein_id gnl|my_center|LOCUS_03290 61025 62392 gene locus_tag LOCUS_03300 61025 62392 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_03300 >Feature sequence006 868 419 gene locus_tag LOCUS_03310 868 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 972 2018 gene locus_tag LOCUS_03320 972 2018 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895264.1 protein_id gnl|my_center|LOCUS_03320 2031 2306 gene locus_tag LOCUS_03330 2031 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 2612 4282 gene locus_tag LOCUS_03340 2612 4282 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809743.1 protein_id gnl|my_center|LOCUS_03340 4319 4807 gene locus_tag LOCUS_03350 gene purE 4319 4807 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425290.1 protein_id gnl|my_center|LOCUS_03350 4824 5525 gene locus_tag LOCUS_03360 4824 5525 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420966.1 protein_id gnl|my_center|LOCUS_03360 5544 6569 gene locus_tag LOCUS_03370 gene purM 5544 6569 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081095.1 protein_id gnl|my_center|LOCUS_03370 6563 7156 gene locus_tag LOCUS_03380 gene purN 6563 7156 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436064.1 protein_id gnl|my_center|LOCUS_03380 7157 8680 gene locus_tag LOCUS_03390 gene purH 7157 8680 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436063.1 protein_id gnl|my_center|LOCUS_03390 8698 9948 gene locus_tag LOCUS_03400 gene purD 8698 9948 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436062.1 protein_id gnl|my_center|LOCUS_03400 9959 13720 gene locus_tag LOCUS_03410 9959 13720 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_03410 13722 15107 gene locus_tag LOCUS_03420 gene purB 13722 15107 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423489.1 protein_id gnl|my_center|LOCUS_03420 16354 15347 gene locus_tag LOCUS_03430 gene asnA 16354 15347 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476128.1 protein_id gnl|my_center|LOCUS_03430 16497 17765 gene locus_tag LOCUS_03440 16497 17765 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_03440 17844 18983 gene locus_tag LOCUS_03450 gene proB 17844 18983 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546492.1 protein_id gnl|my_center|LOCUS_03450 18976 20202 gene locus_tag LOCUS_03460 18976 20202 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966528.1 protein_id gnl|my_center|LOCUS_03460 20281 20700 gene locus_tag LOCUS_03470 20281 20700 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 protein_id gnl|my_center|LOCUS_03470 20846 21304 gene locus_tag LOCUS_03480 20846 21304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 21298 23526 gene locus_tag LOCUS_03490 21298 23526 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 protein_id gnl|my_center|LOCUS_03490 23519 25372 gene locus_tag LOCUS_03500 23519 25372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986472.1 protein_id gnl|my_center|LOCUS_03500 25953 26294 gene locus_tag LOCUS_03510 25953 26294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 26522 26683 gene locus_tag LOCUS_03520 26522 26683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03520 26923 27123 gene locus_tag LOCUS_03530 26923 27123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 27499 27338 gene locus_tag LOCUS_03540 27499 27338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 27750 28409 gene locus_tag LOCUS_03550 27750 28409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 28882 29202 gene locus_tag LOCUS_03560 28882 29202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 29403 31544 gene locus_tag LOCUS_03570 29403 31544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 31546 33330 gene locus_tag LOCUS_03580 31546 33330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 33754 34593 gene locus_tag LOCUS_03590 33754 34593 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183854.1 protein_id gnl|my_center|LOCUS_03590 34917 35315 gene locus_tag LOCUS_03600 34917 35315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 35429 35710 gene locus_tag LOCUS_03610 35429 35710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 35862 36134 gene locus_tag LOCUS_03620 gene rpsP 35862 36134 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699989.1 protein_id gnl|my_center|LOCUS_03620 36137 36385 gene locus_tag LOCUS_03630 36137 36385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 36432 37016 gene locus_tag LOCUS_03640 gene rimM 36432 37016 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455620.1 protein_id gnl|my_center|LOCUS_03640 37006 37725 gene locus_tag LOCUS_03650 gene trmD 37006 37725 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_03650 37832 38182 gene locus_tag LOCUS_03660 gene rplS 37832 38182 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 protein_id gnl|my_center|LOCUS_03660 38291 38836 gene locus_tag LOCUS_03670 gene lepB 38291 38836 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711853.1 protein_id gnl|my_center|LOCUS_03670 38849 39715 gene locus_tag LOCUS_03680 gene ylqF 38849 39715 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236706.1 protein_id gnl|my_center|LOCUS_03680 39702 40322 gene locus_tag LOCUS_03690 gene rnhB 39702 40322 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174721.1 protein_id gnl|my_center|LOCUS_03690 40389 41141 gene locus_tag LOCUS_03700 40389 41141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 41219 43291 gene locus_tag LOCUS_03710 gene topA 41219 43291 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047858.1 protein_id gnl|my_center|LOCUS_03710 43350 44654 gene locus_tag LOCUS_03720 gene trmFO 43350 44654 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001991958.1 protein_id gnl|my_center|LOCUS_03720 44641 45537 gene locus_tag LOCUS_03730 gene xerC 44641 45537 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101227.1 protein_id gnl|my_center|LOCUS_03730 45689 46552 gene locus_tag LOCUS_03740 gene rpsB 45689 46552 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111485.1 protein_id gnl|my_center|LOCUS_03740 46619 47506 gene locus_tag LOCUS_03750 gene tsf 46619 47506 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439509.1 protein_id gnl|my_center|LOCUS_03750 47701 48417 gene locus_tag LOCUS_03760 gene pyrH 47701 48417 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565806.1 protein_id gnl|my_center|LOCUS_03760 48420 48965 gene locus_tag LOCUS_03770 gene frr 48420 48965 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_03770 49053 49808 gene locus_tag LOCUS_03780 49053 49808 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473699.1 protein_id gnl|my_center|LOCUS_03780 49808 50590 gene locus_tag LOCUS_03790 gene cdsA 49808 50590 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813592.1 protein_id gnl|my_center|LOCUS_03790 50592 51743 gene locus_tag LOCUS_03800 gene dxr 50592 51743 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790356.1 protein_id gnl|my_center|LOCUS_03800 51743 52822 gene locus_tag LOCUS_03810 gene rseP 51743 52822 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583162.1 protein_id gnl|my_center|LOCUS_03810 >Feature sequence007 1195 500 gene locus_tag LOCUS_03820 gene sigE 1195 500 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_03820 1932 1195 gene locus_tag LOCUS_03830 1932 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 2781 2005 gene locus_tag LOCUS_03840 gene proC 2781 2005 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898446.1 protein_id gnl|my_center|LOCUS_03840 3923 2826 gene locus_tag LOCUS_03850 gene ftsZ 3923 2826 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166766.1 protein_id gnl|my_center|LOCUS_03850 5209 3950 gene locus_tag LOCUS_03860 gene ftsA 5209 3950 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087558.1 protein_id gnl|my_center|LOCUS_03860 6044 5283 gene locus_tag LOCUS_03870 6044 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 6962 6048 gene locus_tag LOCUS_03880 gene murB 6962 6048 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437038.1 protein_id gnl|my_center|LOCUS_03880 8049 6964 gene locus_tag LOCUS_03890 gene murG 8049 6964 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476139.1 protein_id gnl|my_center|LOCUS_03890 9785 8178 gene locus_tag LOCUS_03900 gene tndX 9785 8178 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_03900 9930 9775 gene locus_tag LOCUS_03910 9930 9775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 10508 9984 gene locus_tag LOCUS_03920 10508 9984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 12147 10501 gene locus_tag LOCUS_03930 12147 10501 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_03930 13502 12378 gene locus_tag LOCUS_03940 13502 12378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 15396 13495 gene locus_tag LOCUS_03950 15396 13495 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963670.1 protein_id gnl|my_center|LOCUS_03950 16596 15466 gene locus_tag LOCUS_03960 16596 15466 CDS product AbiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207803.1 protein_id gnl|my_center|LOCUS_03960 16973 18157 gene locus_tag LOCUS_03970 16973 18157 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542320.1 protein_id gnl|my_center|LOCUS_03970 18664 18425 gene locus_tag LOCUS_03980 18664 18425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 18953 18756 gene locus_tag LOCUS_03990 18953 18756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 19064 19393 gene locus_tag LOCUS_04000 19064 19393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 19380 19802 gene locus_tag LOCUS_04010 19380 19802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 21966 20449 gene locus_tag LOCUS_04020 21966 20449 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101306.1 protein_id gnl|my_center|LOCUS_04020 23019 22048 gene locus_tag LOCUS_04030 23019 22048 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020709.1 protein_id gnl|my_center|LOCUS_04030 23905 23012 gene locus_tag LOCUS_04040 23905 23012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 24946 23915 gene locus_tag LOCUS_04050 24946 23915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 26405 25092 gene locus_tag LOCUS_04060 26405 25092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 27501 26410 gene locus_tag LOCUS_04070 27501 26410 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_04070 28558 27518 gene locus_tag LOCUS_04080 28558 27518 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101653.1 protein_id gnl|my_center|LOCUS_04080 29634 28555 gene locus_tag LOCUS_04090 29634 28555 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476099.1 protein_id gnl|my_center|LOCUS_04090 30251 29634 gene locus_tag LOCUS_04100 30251 29634 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700389.1 protein_id gnl|my_center|LOCUS_04100 30855 30241 gene locus_tag LOCUS_04110 30855 30241 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476100.1 protein_id gnl|my_center|LOCUS_04110 32081 30855 gene locus_tag LOCUS_04120 32081 30855 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476101.1 protein_id gnl|my_center|LOCUS_04120 32782 32291 gene locus_tag LOCUS_04130 32782 32291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 33150 33419 gene locus_tag LOCUS_04140 33150 33419 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719221.1 protein_id gnl|my_center|LOCUS_04140 33515 34504 gene locus_tag LOCUS_04150 gene mraY 33515 34504 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_04150 34506 35864 gene locus_tag LOCUS_04160 gene murD 34506 35864 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860120.1 protein_id gnl|my_center|LOCUS_04160 35928 36941 gene locus_tag LOCUS_04170 gene spoVE 35928 36941 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753520.1 protein_id gnl|my_center|LOCUS_04170 38636 37080 gene locus_tag LOCUS_04180 38636 37080 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_04180 39227 38745 gene locus_tag LOCUS_04190 39227 38745 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853175.1 protein_id gnl|my_center|LOCUS_04190 40022 39231 gene locus_tag LOCUS_04200 gene trpC 40022 39231 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_04200 40217 40468 gene locus_tag LOCUS_04210 40217 40468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 42430 40553 gene locus_tag LOCUS_04220 42430 40553 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861796.1 protein_id gnl|my_center|LOCUS_04220 43188 42427 gene locus_tag LOCUS_04230 43188 42427 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431374.1 protein_id gnl|my_center|LOCUS_04230 44274 43291 gene locus_tag LOCUS_04240 44274 43291 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439911.1 protein_id gnl|my_center|LOCUS_04240 44948 44271 gene locus_tag LOCUS_04250 gene virR 44948 44271 CDS product two-component system response regulator VirR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722222.1 protein_id gnl|my_center|LOCUS_04250 45581 45066 gene locus_tag LOCUS_04260 45581 45066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 46600 45581 gene locus_tag LOCUS_04270 gene ytvI 46600 45581 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902953.1 protein_id gnl|my_center|LOCUS_04270 48048 46654 gene locus_tag LOCUS_04280 48048 46654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 49859 48105 gene locus_tag LOCUS_04290 49859 48105 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948795.1 protein_id gnl|my_center|LOCUS_04290 51646 50090 gene locus_tag LOCUS_04300 51646 50090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 51884 51696 gene locus_tag LOCUS_04310 51884 51696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 52669 51968 gene locus_tag LOCUS_04320 52669 51968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 53371 52922 gene locus_tag LOCUS_04330 53371 52922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 54733 53615 gene locus_tag LOCUS_04340 54733 53615 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812397.1 protein_id gnl|my_center|LOCUS_04340 55177 54845 gene locus_tag LOCUS_04350 55177 54845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 >Feature sequence008 1091 99 gene locus_tag LOCUS_04360 1091 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458925.1 protein_id gnl|my_center|LOCUS_04360 1208 1426 gene locus_tag LOCUS_04370 1208 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 1842 1363 gene locus_tag LOCUS_04380 1842 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 2031 3131 gene locus_tag LOCUS_04390 gene ychF 2031 3131 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242727.1 protein_id gnl|my_center|LOCUS_04390 3131 3937 gene locus_tag LOCUS_04400 gene srtB 3131 3937 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086126.1 protein_id gnl|my_center|LOCUS_04400 3938 4111 gene locus_tag LOCUS_04410 3938 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 4198 5691 gene locus_tag LOCUS_04420 4198 5691 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837625.1 protein_id gnl|my_center|LOCUS_04420 5769 7139 gene locus_tag LOCUS_04430 5769 7139 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048107.1 protein_id gnl|my_center|LOCUS_04430 7236 7667 gene locus_tag LOCUS_04440 7236 7667 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_04440 7676 11902 gene locus_tag LOCUS_04450 7676 11902 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965697.1 protein_id gnl|my_center|LOCUS_04450 12003 13085 gene locus_tag LOCUS_04460 12003 13085 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966309.1 protein_id gnl|my_center|LOCUS_04460 13934 13101 gene locus_tag LOCUS_04470 gene map 13934 13101 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761263.1 protein_id gnl|my_center|LOCUS_04470 14082 15008 gene locus_tag LOCUS_04480 14082 15008 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966232.1 protein_id gnl|my_center|LOCUS_04480 15090 16217 gene locus_tag LOCUS_04490 15090 16217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 16227 17579 gene locus_tag LOCUS_04500 16227 17579 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_04500 17576 18616 gene locus_tag LOCUS_04510 17576 18616 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_04510 19115 20788 gene locus_tag LOCUS_04520 gene leuA 19115 20788 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963596.1 protein_id gnl|my_center|LOCUS_04520 20806 21318 gene locus_tag LOCUS_04530 gene ilvN 20806 21318 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_04530 21336 22352 gene locus_tag LOCUS_04540 gene ilvC 21336 22352 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081338.1 protein_id gnl|my_center|LOCUS_04540 22451 23725 gene locus_tag LOCUS_04550 gene leuC 22451 23725 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_04550 23725 24204 gene locus_tag LOCUS_04560 gene leuD 23725 24204 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_04560 24210 25292 gene locus_tag LOCUS_04570 gene leuB 24210 25292 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_04570 25304 26980 gene locus_tag LOCUS_04580 gene ilvD 25304 26980 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_04580 26992 28671 gene locus_tag LOCUS_04590 gene ilvB 26992 28671 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_04590 29148 30002 gene locus_tag LOCUS_04600 29148 30002 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723662.1 protein_id gnl|my_center|LOCUS_04600 30372 30061 gene locus_tag LOCUS_04610 30372 30061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 30457 31641 gene locus_tag LOCUS_04620 30457 31641 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295135.1 protein_id gnl|my_center|LOCUS_04620 31657 32400 gene locus_tag LOCUS_04630 gene tpiA 31657 32400 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643975.1 protein_id gnl|my_center|LOCUS_04630 32561 32944 gene locus_tag LOCUS_04640 32561 32944 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_04640 33173 33586 gene locus_tag LOCUS_04650 gene rplK 33173 33586 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183506.1 protein_id gnl|my_center|LOCUS_04650 33655 34341 gene locus_tag LOCUS_04660 gene rplA 33655 34341 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235040.1 protein_id gnl|my_center|LOCUS_04660 34514 35089 gene locus_tag LOCUS_04670 gene rplJ 34514 35089 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732833.1 protein_id gnl|my_center|LOCUS_04670 35121 35492 gene locus_tag LOCUS_04680 gene rplL 35121 35492 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900419.1 protein_id gnl|my_center|LOCUS_04680 35546 36139 gene locus_tag LOCUS_04690 35546 36139 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061759014.1 protein_id gnl|my_center|LOCUS_04690 36340 40014 gene locus_tag LOCUS_04700 gene rpoB 36340 40014 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147554.1 protein_id gnl|my_center|LOCUS_04700 40026 43691 gene locus_tag LOCUS_04710 gene rpoC 40026 43691 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567936.1 protein_id gnl|my_center|LOCUS_04710 44695 45108 gene locus_tag LOCUS_04720 gene rpsL 44695 45108 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142340.1 protein_id gnl|my_center|LOCUS_04720 45134 45604 gene locus_tag LOCUS_04730 gene rpsG 45134 45604 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225784.1 protein_id gnl|my_center|LOCUS_04730 45638 47713 gene locus_tag LOCUS_04740 gene fusA 45638 47713 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235056.1 protein_id gnl|my_center|LOCUS_04740 47798 48982 gene locus_tag LOCUS_04750 gene tuf 47798 48982 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235058.1 protein_id gnl|my_center|LOCUS_04750 49426 49734 gene locus_tag LOCUS_04760 49426 49734 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989050.1 protein_id gnl|my_center|LOCUS_04760 >Feature sequence009 105 4925 gene locus_tag LOCUS_04770 105 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 5106 7100 gene locus_tag LOCUS_04780 gene ligA 5106 7100 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_04780 7145 8218 gene locus_tag LOCUS_04790 7145 8218 CDS product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242795.1 protein_id gnl|my_center|LOCUS_04790 8228 8518 gene locus_tag LOCUS_04800 8228 8518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 8518 9966 gene locus_tag LOCUS_04810 gene gatA 8518 9966 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288475.1 protein_id gnl|my_center|LOCUS_04810 9972 11405 gene locus_tag LOCUS_04820 gene gatB 9972 11405 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288473.1 protein_id gnl|my_center|LOCUS_04820 11455 12135 gene locus_tag LOCUS_04830 11455 12135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 12168 13517 gene locus_tag LOCUS_04840 gene rlmD 12168 13517 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 protein_id gnl|my_center|LOCUS_04840 14227 14000 gene locus_tag LOCUS_04850 14227 14000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 15337 14234 gene locus_tag LOCUS_04860 15337 14234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 15714 15346 gene locus_tag LOCUS_04870 15714 15346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 15992 16555 gene locus_tag LOCUS_04880 15992 16555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 16610 17023 gene locus_tag LOCUS_04890 16610 17023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 17037 17249 gene locus_tag LOCUS_04900 17037 17249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 17536 18120 gene locus_tag LOCUS_04910 17536 18120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04910 18138 18497 gene locus_tag LOCUS_04920 18138 18497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04920 18499 19206 gene locus_tag LOCUS_04930 18499 19206 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484976.1 protein_id gnl|my_center|LOCUS_04930 19249 20577 gene locus_tag LOCUS_04940 19249 20577 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816666.1 protein_id gnl|my_center|LOCUS_04940 20588 20998 gene locus_tag LOCUS_04950 20588 20998 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705736.1 protein_id gnl|my_center|LOCUS_04950 21199 21717 gene locus_tag LOCUS_04960 21199 21717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 22411 21734 gene locus_tag LOCUS_04970 22411 21734 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436876.1 protein_id gnl|my_center|LOCUS_04970 23628 22438 gene locus_tag LOCUS_04980 gene ackA 23628 22438 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034578.1 protein_id gnl|my_center|LOCUS_04980 23915 24442 gene locus_tag LOCUS_04990 23915 24442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 24560 25096 gene locus_tag LOCUS_05000 24560 25096 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223272.1 protein_id gnl|my_center|LOCUS_05000 25105 25554 gene locus_tag LOCUS_05010 gene tsaE 25105 25554 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 protein_id gnl|my_center|LOCUS_05010 25551 26153 gene locus_tag LOCUS_05020 gene tsaB 25551 26153 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183392.1 protein_id gnl|my_center|LOCUS_05020 26147 26593 gene locus_tag LOCUS_05030 gene rimI 26147 26593 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243019.1 protein_id gnl|my_center|LOCUS_05030 26594 27628 gene locus_tag LOCUS_05040 gene tsaD 26594 27628 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414606.1 protein_id gnl|my_center|LOCUS_05040 27621 28250 gene locus_tag LOCUS_05050 27621 28250 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549143.1 protein_id gnl|my_center|LOCUS_05050 28307 29692 gene locus_tag LOCUS_05060 gene asnS 28307 29692 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432161.1 protein_id gnl|my_center|LOCUS_05060 29754 31217 gene locus_tag LOCUS_05070 29754 31217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 31227 32612 gene locus_tag LOCUS_05080 31227 32612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 32596 32763 gene locus_tag LOCUS_05090 32596 32763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 33125 34498 gene locus_tag LOCUS_05100 33125 34498 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_05100 34913 35350 gene locus_tag LOCUS_05110 34913 35350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 36239 35730 gene locus_tag LOCUS_05120 gene spmB 36239 35730 CDS product spore maturation protein SpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029514.1 protein_id gnl|my_center|LOCUS_05120 36804 36232 gene locus_tag LOCUS_05130 36804 36232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 37813 36797 gene locus_tag LOCUS_05140 37813 36797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 39498 37975 gene locus_tag LOCUS_05150 39498 37975 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_05150 39660 40385 gene locus_tag LOCUS_05160 39660 40385 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830978.1 protein_id gnl|my_center|LOCUS_05160 40452 40688 gene locus_tag LOCUS_05170 40452 40688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 40962 41486 gene locus_tag LOCUS_05180 40962 41486 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902046.1 protein_id gnl|my_center|LOCUS_05180 41483 43216 gene locus_tag LOCUS_05190 gene thrS 41483 43216 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000663074.1 protein_id gnl|my_center|LOCUS_05190 44013 43336 gene locus_tag LOCUS_05200 44013 43336 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359485.1 protein_id gnl|my_center|LOCUS_05200 44232 44585 gene locus_tag LOCUS_05210 44232 44585 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435155.1 protein_id gnl|my_center|LOCUS_05210 44651 45538 gene locus_tag LOCUS_05220 44651 45538 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183318.1 protein_id gnl|my_center|LOCUS_05220 45538 46008 gene locus_tag LOCUS_05230 gene folA 45538 46008 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502023.1 protein_id gnl|my_center|LOCUS_05230 46011 46733 gene locus_tag LOCUS_05240 46011 46733 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964283.1 protein_id gnl|my_center|LOCUS_05240 47246 46806 gene locus_tag LOCUS_05250 47246 46806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 48565 47243 gene locus_tag LOCUS_05260 48565 47243 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_05260 48825 48616 gene locus_tag LOCUS_05270 48825 48616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 49046 49132 gene locus_tag LOCUS_t00010 49046 49132 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 49915 49499 gene locus_tag LOCUS_05280 49915 49499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 >Feature sequence010 1728 301 gene locus_tag LOCUS_05290 1728 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 3181 1721 gene locus_tag LOCUS_05300 3181 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 4122 3178 gene locus_tag LOCUS_05310 4122 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 5339 4215 gene locus_tag LOCUS_05320 gene dnaJ 5339 4215 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990134.1 protein_id gnl|my_center|LOCUS_05320 7203 5395 gene locus_tag LOCUS_05330 gene dnaK 7203 5395 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034700.1 protein_id gnl|my_center|LOCUS_05330 7756 7220 gene locus_tag LOCUS_05340 gene grpE 7756 7220 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392710.1 protein_id gnl|my_center|LOCUS_05340 8808 7768 gene locus_tag LOCUS_05350 gene hrcA 8808 7768 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726026.1 protein_id gnl|my_center|LOCUS_05350 10004 8940 gene locus_tag LOCUS_05360 gene hemW 10004 8940 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181861.1 protein_id gnl|my_center|LOCUS_05360 11235 10021 gene locus_tag LOCUS_05370 11235 10021 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470187.1 protein_id gnl|my_center|LOCUS_05370 12194 11244 gene locus_tag LOCUS_05380 gene holA 12194 11244 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282560.1 protein_id gnl|my_center|LOCUS_05380 14130 12238 gene locus_tag LOCUS_05390 14130 12238 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990137.1 protein_id gnl|my_center|LOCUS_05390 14684 14226 gene locus_tag LOCUS_05400 14684 14226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 15707 14715 gene locus_tag LOCUS_05410 gene ruvB 15707 14715 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344450.1 protein_id gnl|my_center|LOCUS_05410 16278 15718 gene locus_tag LOCUS_05420 gene ruvA 16278 15718 CDS product Holliday junction DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464511.1 protein_id gnl|my_center|LOCUS_05420 17682 16399 gene locus_tag LOCUS_05430 gene obgE 17682 16399 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 protein_id gnl|my_center|LOCUS_05430 18019 17735 gene locus_tag LOCUS_05440 gene rpmA 18019 17735 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944958.1 protein_id gnl|my_center|LOCUS_05440 18346 18023 gene locus_tag LOCUS_05450 18346 18023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 18654 18346 gene locus_tag LOCUS_05460 gene rplU 18654 18346 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289450.1 protein_id gnl|my_center|LOCUS_05460 19524 18781 gene locus_tag LOCUS_05470 19524 18781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 20065 19499 gene locus_tag LOCUS_05480 20065 19499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 20893 20114 gene locus_tag LOCUS_05490 gene minD 20893 20114 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360024.1 protein_id gnl|my_center|LOCUS_05490 21461 20886 gene locus_tag LOCUS_05500 21461 20886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 21969 21436 gene locus_tag LOCUS_05510 21969 21436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 22816 21962 gene locus_tag LOCUS_05520 gene mreC 22816 21962 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725674.1 protein_id gnl|my_center|LOCUS_05520 23552 22875 gene locus_tag LOCUS_05530 gene radC 23552 22875 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246034.1 protein_id gnl|my_center|LOCUS_05530 23935 23549 gene locus_tag LOCUS_05540 23935 23549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 24144 24001 gene locus_tag LOCUS_05550 24144 24001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 24304 24146 gene locus_tag LOCUS_05560 24304 24146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 27060 24439 gene locus_tag LOCUS_05570 gene valS 27060 24439 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072244.1 protein_id gnl|my_center|LOCUS_05570 28246 27326 gene locus_tag LOCUS_05580 28246 27326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 29015 28233 gene locus_tag LOCUS_05590 29015 28233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 29678 29079 gene locus_tag LOCUS_05600 gene yihA 29678 29079 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422605.1 protein_id gnl|my_center|LOCUS_05600 32056 29735 gene locus_tag LOCUS_05610 gene lon 32056 29735 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097289.1 protein_id gnl|my_center|LOCUS_05610 33392 32109 gene locus_tag LOCUS_05620 gene tig 33392 32109 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_05620 34410 33487 gene locus_tag LOCUS_05630 34410 33487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 34566 34432 gene locus_tag LOCUS_05640 34566 34432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 35539 34640 gene locus_tag LOCUS_05650 35539 34640 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 protein_id gnl|my_center|LOCUS_05650 35627 36631 gene locus_tag LOCUS_05660 35627 36631 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262368.1 protein_id gnl|my_center|LOCUS_05660 36769 36693 gene locus_tag LOCUS_t00020 36769 36693 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 37141 37065 gene locus_tag LOCUS_t00030 37141 37065 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 37662 37198 gene locus_tag LOCUS_05670 37662 37198 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645497.1 protein_id gnl|my_center|LOCUS_05670 38616 37708 gene locus_tag LOCUS_05680 gene gerM 38616 37708 CDS product spore germination protein GerM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126748.1 protein_id gnl|my_center|LOCUS_05680 39477 38692 gene locus_tag LOCUS_05690 gene murI 39477 38692 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_05690 40657 39482 gene locus_tag LOCUS_05700 40657 39482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 40922 40719 gene locus_tag LOCUS_05710 gene gerE 40922 40719 CDS product spore germination transcription factor GerE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003184172.1 protein_id gnl|my_center|LOCUS_05710 42731 40965 gene locus_tag LOCUS_05720 gene uvrC 42731 40965 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246045.1 protein_id gnl|my_center|LOCUS_05720 45043 42731 gene locus_tag LOCUS_05730 45043 42731 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 protein_id gnl|my_center|LOCUS_05730 45855 45046 gene locus_tag LOCUS_05740 45855 45046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 45962 46747 gene locus_tag LOCUS_05750 45962 46747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 47338 47120 gene locus_tag LOCUS_05760 47338 47120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 >Feature sequence011 94 969 gene locus_tag LOCUS_05770 94 969 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435316.1 protein_id gnl|my_center|LOCUS_05770 2051 993 gene locus_tag LOCUS_05780 2051 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 2175 2642 gene locus_tag LOCUS_05790 2175 2642 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_05790 4069 2672 gene locus_tag LOCUS_05800 gene ffh 4069 2672 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830113.1 protein_id gnl|my_center|LOCUS_05800 4411 4082 gene locus_tag LOCUS_05810 4411 4082 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531320.1 protein_id gnl|my_center|LOCUS_05810 5396 4413 gene locus_tag LOCUS_05820 gene ftsY 5396 4413 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007650.1 protein_id gnl|my_center|LOCUS_05820 8353 5408 gene locus_tag LOCUS_05830 8353 5408 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166660.1 protein_id gnl|my_center|LOCUS_05830 8942 8370 gene locus_tag LOCUS_05840 8942 8370 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948791.1 protein_id gnl|my_center|LOCUS_05840 10337 8946 gene locus_tag LOCUS_05850 10337 8946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 11008 10337 gene locus_tag LOCUS_05860 11008 10337 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781961.1 protein_id gnl|my_center|LOCUS_05860 12762 11104 gene locus_tag LOCUS_05870 12762 11104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807777.1 protein_id gnl|my_center|LOCUS_05870 13693 12746 gene locus_tag LOCUS_05880 13693 12746 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545136.1 protein_id gnl|my_center|LOCUS_05880 14990 13797 gene locus_tag LOCUS_05890 14990 13797 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223511.1 protein_id gnl|my_center|LOCUS_05890 15428 15718 gene locus_tag LOCUS_05900 15428 15718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05900 15977 15762 gene locus_tag LOCUS_05910 gene sspB 15977 15762 CDS product beta type acid-soluble spore protein SspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233287.1 protein_id gnl|my_center|LOCUS_05910 16313 16095 gene locus_tag LOCUS_05920 gene sasP 16313 16095 CDS product small acid-soluble spore protein, SasP family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284598.1 protein_id gnl|my_center|LOCUS_05920 17570 16374 gene locus_tag LOCUS_05930 gene thiI 17570 16374 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922339.1 protein_id gnl|my_center|LOCUS_05930 18710 17574 gene locus_tag LOCUS_05940 18710 17574 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638992.1 protein_id gnl|my_center|LOCUS_05940 20493 18754 gene locus_tag LOCUS_05950 gene ezrA 20493 18754 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377294.1 protein_id gnl|my_center|LOCUS_05950 20626 21285 gene locus_tag LOCUS_05960 20626 21285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 21282 22145 gene locus_tag LOCUS_05970 21282 22145 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966614.1 protein_id gnl|my_center|LOCUS_05970 22993 22142 gene locus_tag LOCUS_05980 22993 22142 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627801.1 protein_id gnl|my_center|LOCUS_05980 23949 23023 gene locus_tag LOCUS_05990 gene ribF 23949 23023 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766706.1 protein_id gnl|my_center|LOCUS_05990 24791 23949 gene locus_tag LOCUS_06000 gene truB 24791 23949 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399352.1 protein_id gnl|my_center|LOCUS_06000 24887 25627 gene locus_tag LOCUS_06010 24887 25627 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_06010 27476 26250 gene locus_tag LOCUS_06020 gene tyrS 27476 26250 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727370.1 protein_id gnl|my_center|LOCUS_06020 28225 27770 gene locus_tag LOCUS_06030 28225 27770 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902308.1 protein_id gnl|my_center|LOCUS_06030 28959 28318 gene locus_tag LOCUS_06040 28959 28318 CDS product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459533.1 protein_id gnl|my_center|LOCUS_06040 30102 29098 gene locus_tag LOCUS_06050 gene ccpA 30102 29098 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830844.1 protein_id gnl|my_center|LOCUS_06050 30578 30102 gene locus_tag LOCUS_06060 30578 30102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 30884 30594 gene locus_tag LOCUS_06070 30884 30594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 32243 30933 gene locus_tag LOCUS_06080 gene murC 32243 30933 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565897.1 protein_id gnl|my_center|LOCUS_06080 33350 32277 gene locus_tag LOCUS_06090 33350 32277 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426912.1 protein_id gnl|my_center|LOCUS_06090 35094 33343 gene locus_tag LOCUS_06100 gene aspS 35094 33343 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840895.1 protein_id gnl|my_center|LOCUS_06100 36364 35087 gene locus_tag LOCUS_06110 gene hisS 36364 35087 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229755.1 protein_id gnl|my_center|LOCUS_06110 39367 37145 gene locus_tag LOCUS_06120 gene relA 39367 37145 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229747.1 protein_id gnl|my_center|LOCUS_06120 39919 39401 gene locus_tag LOCUS_06130 39919 39401 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902332.1 protein_id gnl|my_center|LOCUS_06130 41618 39981 gene locus_tag LOCUS_06140 41618 39981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 41951 41661 gene locus_tag LOCUS_06150 41951 41661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 42018 43325 gene locus_tag LOCUS_06160 42018 43325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 43700 43341 gene locus_tag LOCUS_06170 43700 43341 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964778.1 protein_id gnl|my_center|LOCUS_06170 45209 43917 gene locus_tag LOCUS_06180 gene eno 45209 43917 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103955.1 protein_id gnl|my_center|LOCUS_06180 45524 46216 gene locus_tag LOCUS_06190 45524 46216 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_06190 >Feature sequence012 5534 5899 gene locus_tag LOCUS_06200 5534 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 5914 6339 gene locus_tag LOCUS_06210 5914 6339 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080739.1 protein_id gnl|my_center|LOCUS_06210 6353 7267 gene locus_tag LOCUS_06220 6353 7267 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_06220 7364 9178 gene locus_tag LOCUS_06230 gene asnB 7364 9178 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233080.1 protein_id gnl|my_center|LOCUS_06230 9564 9187 gene locus_tag LOCUS_06240 9564 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 10391 9630 gene locus_tag LOCUS_06250 gene aroD 10391 9630 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897376.1 protein_id gnl|my_center|LOCUS_06250 11393 10515 gene locus_tag LOCUS_06260 11393 10515 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721732.1 protein_id gnl|my_center|LOCUS_06260 12394 11477 gene locus_tag LOCUS_06270 12394 11477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 13310 12375 gene locus_tag LOCUS_06280 13310 12375 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582702.1 protein_id gnl|my_center|LOCUS_06280 16353 13294 gene locus_tag LOCUS_06290 16353 13294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 16555 16986 gene locus_tag LOCUS_06300 16555 16986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 17631 17023 gene locus_tag LOCUS_06310 17631 17023 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_06310 19073 17634 gene locus_tag LOCUS_06320 19073 17634 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869268.1 protein_id gnl|my_center|LOCUS_06320 20838 19087 gene locus_tag LOCUS_06330 20838 19087 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_06330 21450 20854 gene locus_tag LOCUS_06340 21450 20854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 21771 21463 gene locus_tag LOCUS_06350 21771 21463 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_06350 22222 21791 gene locus_tag LOCUS_06360 22222 21791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 24135 22243 gene locus_tag LOCUS_06370 24135 22243 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_06370 25509 24148 gene locus_tag LOCUS_06380 25509 24148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 26554 25523 gene locus_tag LOCUS_06390 26554 25523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 26875 26567 gene locus_tag LOCUS_06400 26875 26567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 27238 28983 gene locus_tag LOCUS_06410 27238 28983 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897431.1 protein_id gnl|my_center|LOCUS_06410 29148 29008 gene locus_tag LOCUS_06420 29148 29008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06420 29509 29213 gene locus_tag LOCUS_06430 29509 29213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06430 31740 29512 gene locus_tag LOCUS_06440 31740 29512 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459055.1 protein_id gnl|my_center|LOCUS_06440 33488 31854 gene locus_tag LOCUS_06450 33488 31854 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860933.1 protein_id gnl|my_center|LOCUS_06450 34783 33536 gene locus_tag LOCUS_06460 34783 33536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 35355 34801 gene locus_tag LOCUS_06470 35355 34801 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_06470 36194 35352 gene locus_tag LOCUS_06480 36194 35352 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671202.1 protein_id gnl|my_center|LOCUS_06480 36534 36208 gene locus_tag LOCUS_06490 36534 36208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 36968 36510 gene locus_tag LOCUS_06500 36968 36510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 38377 37397 gene locus_tag LOCUS_06510 38377 37397 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948854.1 protein_id gnl|my_center|LOCUS_06510 38823 38563 gene locus_tag LOCUS_06520 38823 38563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 38891 39127 gene locus_tag LOCUS_06530 38891 39127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 42896 39807 gene locus_tag LOCUS_06540 42896 39807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 44183 43146 gene locus_tag LOCUS_06550 44183 43146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 44980 44897 gene locus_tag LOCUS_t00040 44980 44897 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 45064 44989 gene locus_tag LOCUS_t00050 45064 44989 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence013 292 1887 gene locus_tag LOCUS_06560 292 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 2695 2048 gene locus_tag LOCUS_06570 2695 2048 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963740.1 protein_id gnl|my_center|LOCUS_06570 3251 2706 gene locus_tag LOCUS_06580 3251 2706 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_06580 3370 3684 gene locus_tag LOCUS_06590 3370 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 4054 3767 gene locus_tag LOCUS_06600 4054 3767 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_06600 4739 4044 gene locus_tag LOCUS_06610 4739 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 5741 5127 gene locus_tag LOCUS_06620 5741 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 6262 5921 gene locus_tag LOCUS_06630 6262 5921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 6615 6304 gene locus_tag LOCUS_06640 6615 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 6885 7205 gene locus_tag LOCUS_06650 6885 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 7211 7486 gene locus_tag LOCUS_06660 7211 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 9112 7559 gene locus_tag LOCUS_06670 9112 7559 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902156.1 protein_id gnl|my_center|LOCUS_06670 9810 9136 gene locus_tag LOCUS_06680 9810 9136 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_06680 11250 10063 gene locus_tag LOCUS_06690 11250 10063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 13219 11429 gene locus_tag LOCUS_06700 13219 11429 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193735789.1 protein_id gnl|my_center|LOCUS_06700 13974 13387 gene locus_tag LOCUS_06710 13974 13387 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_06710 14136 15131 gene locus_tag LOCUS_06720 14136 15131 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815048.1 protein_id gnl|my_center|LOCUS_06720 15131 16072 gene locus_tag LOCUS_06730 15131 16072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 17257 16088 gene locus_tag LOCUS_06740 17257 16088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 18860 18988 gene locus_tag LOCUS_06750 18860 18988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 19495 19070 gene locus_tag LOCUS_06760 gene fabZ 19495 19070 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931959.1 protein_id gnl|my_center|LOCUS_06760 20740 19499 gene locus_tag LOCUS_06770 gene fabF 20740 19499 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_06770 21504 20752 gene locus_tag LOCUS_06780 gene fabG 21504 20752 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_06780 22438 21506 gene locus_tag LOCUS_06790 gene fabD 22438 21506 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048428.1 protein_id gnl|my_center|LOCUS_06790 23502 22438 gene locus_tag LOCUS_06800 23502 22438 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048432.1 protein_id gnl|my_center|LOCUS_06800 24437 23505 gene locus_tag LOCUS_06810 24437 23505 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931899.1 protein_id gnl|my_center|LOCUS_06810 25382 24441 gene locus_tag LOCUS_06820 25382 24441 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_06820 25852 25391 gene locus_tag LOCUS_06830 25852 25391 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966842.1 protein_id gnl|my_center|LOCUS_06830 26795 25845 gene locus_tag LOCUS_06840 26795 25845 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889903.1 protein_id gnl|my_center|LOCUS_06840 27667 26795 gene locus_tag LOCUS_06850 gene accD 27667 26795 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966832.1 protein_id gnl|my_center|LOCUS_06850 29023 27671 gene locus_tag LOCUS_06860 29023 27671 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048423.1 protein_id gnl|my_center|LOCUS_06860 29474 29025 gene locus_tag LOCUS_06870 gene accB 29474 29025 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545496.1 protein_id gnl|my_center|LOCUS_06870 29825 29592 gene locus_tag LOCUS_06880 gene acpP 29825 29592 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583309.1 protein_id gnl|my_center|LOCUS_06880 30750 30043 gene locus_tag LOCUS_06890 30750 30043 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_06890 30956 31450 gene locus_tag LOCUS_06900 30956 31450 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966038.1 protein_id gnl|my_center|LOCUS_06900 31520 31969 gene locus_tag LOCUS_06910 31520 31969 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809539.1 protein_id gnl|my_center|LOCUS_06910 32996 31971 gene locus_tag LOCUS_06920 32996 31971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 33153 34355 gene locus_tag LOCUS_06930 33153 34355 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963631.1 protein_id gnl|my_center|LOCUS_06930 34459 35775 gene locus_tag LOCUS_06940 34459 35775 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722638.1 protein_id gnl|my_center|LOCUS_06940 35865 36227 gene locus_tag LOCUS_06950 35865 36227 CDS product CidA/LrgA family holin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968420.1 protein_id gnl|my_center|LOCUS_06950 36220 36912 gene locus_tag LOCUS_06960 36220 36912 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990639.1 protein_id gnl|my_center|LOCUS_06960 38021 37005 gene locus_tag LOCUS_06970 gene gap 38021 37005 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_06970 38317 38889 gene locus_tag LOCUS_06980 gene clpP 38317 38889 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049162.1 protein_id gnl|my_center|LOCUS_06980 39338 38919 gene locus_tag LOCUS_06990 39338 38919 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890791.1 protein_id gnl|my_center|LOCUS_06990 40399 40055 gene locus_tag LOCUS_07000 40399 40055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 42073 40412 gene locus_tag LOCUS_07010 gene argS 42073 40412 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 protein_id gnl|my_center|LOCUS_07010 43693 42173 gene locus_tag LOCUS_07020 gene cls 43693 42173 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461555.1 protein_id gnl|my_center|LOCUS_07020 44154 43777 gene locus_tag LOCUS_07030 44154 43777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 >Feature sequence014 542 96 gene locus_tag LOCUS_07040 542 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 1104 589 gene locus_tag LOCUS_07050 gene lepB 1104 589 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425127.1 protein_id gnl|my_center|LOCUS_07050 1857 1138 gene locus_tag LOCUS_07060 gene sigF 1857 1138 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_07060 2284 1850 gene locus_tag LOCUS_07070 gene spoIIAB 2284 1850 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357714.1 protein_id gnl|my_center|LOCUS_07070 2607 2284 gene locus_tag LOCUS_07080 gene spoIIAA 2607 2284 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_07080 2797 2612 gene locus_tag LOCUS_07090 2797 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 2763 3905 gene locus_tag LOCUS_07100 gene dacF 2763 3905 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_07100 4508 4134 gene locus_tag LOCUS_07110 4508 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 5048 4512 gene locus_tag LOCUS_07120 5048 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 6370 5114 gene locus_tag LOCUS_07130 6370 5114 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289207.1 protein_id gnl|my_center|LOCUS_07130 7369 6416 gene locus_tag LOCUS_07140 gene fmt 7369 6416 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439455.1 protein_id gnl|my_center|LOCUS_07140 7672 7385 gene locus_tag LOCUS_07150 7672 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 8406 7669 gene locus_tag LOCUS_07160 8406 7669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 9432 8458 gene locus_tag LOCUS_07170 gene gpr 9432 8458 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662627.1 protein_id gnl|my_center|LOCUS_07170 9561 9821 gene locus_tag LOCUS_07180 gene rpsT 9561 9821 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 protein_id gnl|my_center|LOCUS_07180 9859 11634 gene locus_tag LOCUS_07190 gene pepF 9859 11634 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453998.1 protein_id gnl|my_center|LOCUS_07190 11945 11733 gene locus_tag LOCUS_07200 11945 11733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 13682 12276 gene locus_tag LOCUS_07210 13682 12276 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052123.1 protein_id gnl|my_center|LOCUS_07210 13837 14892 gene locus_tag LOCUS_07220 gene ispG 13837 14892 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194540.1 protein_id gnl|my_center|LOCUS_07220 14947 15204 gene locus_tag LOCUS_07230 14947 15204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 16037 15177 gene locus_tag LOCUS_07240 16037 15177 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924220.1 protein_id gnl|my_center|LOCUS_07240 17407 16037 gene locus_tag LOCUS_07250 17407 16037 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379408.1 protein_id gnl|my_center|LOCUS_07250 17534 17869 gene locus_tag LOCUS_07260 17534 17869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 17885 18796 gene locus_tag LOCUS_07270 17885 18796 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990127.1 protein_id gnl|my_center|LOCUS_07270 22012 18896 gene locus_tag LOCUS_07280 22012 18896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 23042 22293 gene locus_tag LOCUS_07290 23042 22293 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964615.1 protein_id gnl|my_center|LOCUS_07290 23721 23029 gene locus_tag LOCUS_07300 23721 23029 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006542.1 protein_id gnl|my_center|LOCUS_07300 24970 23723 gene locus_tag LOCUS_07310 24970 23723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 26725 24974 gene locus_tag LOCUS_07320 gene dnaG 26725 24974 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230066.1 protein_id gnl|my_center|LOCUS_07320 28108 26735 gene locus_tag LOCUS_07330 28108 26735 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_07330 29146 28253 gene locus_tag LOCUS_07340 29146 28253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 30987 29152 gene locus_tag LOCUS_07350 30987 29152 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_07350 31833 31087 gene locus_tag LOCUS_07360 gene recO 31833 31087 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047994.1 protein_id gnl|my_center|LOCUS_07360 32713 31823 gene locus_tag LOCUS_07370 gene era 32713 31823 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080230.1 protein_id gnl|my_center|LOCUS_07370 33108 32692 gene locus_tag LOCUS_07380 gene cdd 33108 32692 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121875.1 protein_id gnl|my_center|LOCUS_07380 33568 33110 gene locus_tag LOCUS_07390 gene ybeY 33568 33110 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054692.1 protein_id gnl|my_center|LOCUS_07390 35623 33578 gene locus_tag LOCUS_07400 35623 33578 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890758.1 protein_id gnl|my_center|LOCUS_07400 36221 35673 gene locus_tag LOCUS_07410 36221 35673 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_07410 36775 36218 gene locus_tag LOCUS_07420 36775 36218 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_07420 38003 36816 gene locus_tag LOCUS_07430 38003 36816 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 protein_id gnl|my_center|LOCUS_07430 39138 38005 gene locus_tag LOCUS_07440 39138 38005 CDS product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891676.1 protein_id gnl|my_center|LOCUS_07440 39852 39148 gene locus_tag LOCUS_07450 gene dapD 39852 39148 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386624.1 protein_id gnl|my_center|LOCUS_07450 40700 39867 gene locus_tag LOCUS_07460 gene dapF 40700 39867 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157609.1 protein_id gnl|my_center|LOCUS_07460 40956 41234 gene locus_tag LOCUS_07470 40956 41234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 >Feature sequence015 <1 567 gene locus_tag LOCUS_07480 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002362481.1:rhomboid family intramembrane serine protease 706 1524 gene locus_tag LOCUS_07490 706 1524 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108784.1 protein_id gnl|my_center|LOCUS_07490 1524 1703 gene locus_tag LOCUS_07500 1524 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 1783 2985 gene locus_tag LOCUS_07510 gene ilvA 1783 2985 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_07510 3766 3161 gene locus_tag LOCUS_07520 3766 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 4515 4048 gene locus_tag LOCUS_07530 4515 4048 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948074.1 protein_id gnl|my_center|LOCUS_07530 4786 8007 gene locus_tag LOCUS_07540 gene carB 4786 8007 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_07540 8636 8154 gene locus_tag LOCUS_07550 8636 8154 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476359.1 protein_id gnl|my_center|LOCUS_07550 9344 9820 gene locus_tag LOCUS_07560 gene agaV 9344 9820 CDS product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387360.1 protein_id gnl|my_center|LOCUS_07560 9863 10684 gene locus_tag LOCUS_07570 gene agaW 9863 10684 CDS product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369554.1 protein_id gnl|my_center|LOCUS_07570 10674 11588 gene locus_tag LOCUS_07580 10674 11588 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167627999.1 protein_id gnl|my_center|LOCUS_07580 11677 12345 gene locus_tag LOCUS_07590 11677 12345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 12347 13000 gene locus_tag LOCUS_07600 12347 13000 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987124.1 protein_id gnl|my_center|LOCUS_07600 13451 13167 gene locus_tag LOCUS_07610 13451 13167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 13889 13455 gene locus_tag LOCUS_07620 gene agaF 13889 13455 CDS product PTS galactosamine/N-acetylgalactosamine transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263813.1 protein_id gnl|my_center|LOCUS_07620 15082 13895 gene locus_tag LOCUS_07630 15082 13895 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074782808.1 protein_id gnl|my_center|LOCUS_07630 15310 16461 gene locus_tag LOCUS_07640 gene nagA 15310 16461 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386286.1 protein_id gnl|my_center|LOCUS_07640 16448 16990 gene locus_tag LOCUS_07650 16448 16990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 18540 17218 gene locus_tag LOCUS_07660 gene kbaZ 18540 17218 CDS product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263816.1 protein_id gnl|my_center|LOCUS_07660 18724 19572 gene locus_tag LOCUS_07670 18724 19572 CDS product tagatose-bisphosphate aldolase subunit GatY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861804.1 protein_id gnl|my_center|LOCUS_07670 19852 20016 gene locus_tag LOCUS_07680 19852 20016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 20033 20269 gene locus_tag LOCUS_07690 20033 20269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 20302 20553 gene locus_tag LOCUS_07700 20302 20553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 22237 21071 gene locus_tag LOCUS_07710 22237 21071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 23007 22339 gene locus_tag LOCUS_07720 23007 22339 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_07720 24050 23004 gene locus_tag LOCUS_07730 gene pgl 24050 23004 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244689.1 protein_id gnl|my_center|LOCUS_07730 24317 24808 gene locus_tag LOCUS_07740 24317 24808 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_07740 24805 25977 gene locus_tag LOCUS_07750 24805 25977 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808507.1 protein_id gnl|my_center|LOCUS_07750 26312 26944 gene locus_tag LOCUS_07760 26312 26944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 26955 27950 gene locus_tag LOCUS_07770 26955 27950 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124128.1 protein_id gnl|my_center|LOCUS_07770 28074 28916 gene locus_tag LOCUS_07780 28074 28916 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_07780 28926 29858 gene locus_tag LOCUS_07790 gene pstC 28926 29858 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_07790 29851 30717 gene locus_tag LOCUS_07800 gene pstA 29851 30717 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432350.1 protein_id gnl|my_center|LOCUS_07800 30719 31474 gene locus_tag LOCUS_07810 gene pstB 30719 31474 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_07810 31484 32143 gene locus_tag LOCUS_07820 gene phoU 31484 32143 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965016.1 protein_id gnl|my_center|LOCUS_07820 32155 32838 gene locus_tag LOCUS_07830 gene phoP 32155 32838 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065226.1 protein_id gnl|my_center|LOCUS_07830 32831 34513 gene locus_tag LOCUS_07840 32831 34513 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986853.1 protein_id gnl|my_center|LOCUS_07840 34609 35502 gene locus_tag LOCUS_07850 34609 35502 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583216.1 protein_id gnl|my_center|LOCUS_07850 37657 35573 gene locus_tag LOCUS_07860 37657 35573 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861604.1 protein_id gnl|my_center|LOCUS_07860 38366 37650 gene locus_tag LOCUS_07870 38366 37650 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861605.1 protein_id gnl|my_center|LOCUS_07870 39108 38443 gene locus_tag LOCUS_07880 39108 38443 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956859.1 protein_id gnl|my_center|LOCUS_07880 40245 39211 gene locus_tag LOCUS_07890 40245 39211 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129416.1 protein_id gnl|my_center|LOCUS_07890 <41347 40250 gene locus_tag LOCUS_07900 <41347 40250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975324.1:aspartate kinase >Feature sequence016 2076 256 gene locus_tag LOCUS_07910 2076 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 2655 2239 gene locus_tag LOCUS_07920 2655 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07920 3361 2588 gene locus_tag LOCUS_07930 3361 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 4020 3622 gene locus_tag LOCUS_07940 4020 3622 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699947.1 protein_id gnl|my_center|LOCUS_07940 5419 4013 gene locus_tag LOCUS_07950 gene atpD 5419 4013 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_07950 6288 5431 gene locus_tag LOCUS_07960 gene atpG 6288 5431 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167039.1 protein_id gnl|my_center|LOCUS_07960 7818 6295 gene locus_tag LOCUS_07970 gene atpA 7818 6295 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183010.1 protein_id gnl|my_center|LOCUS_07970 8361 7828 gene locus_tag LOCUS_07980 8361 7828 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425856.1 protein_id gnl|my_center|LOCUS_07980 8861 8361 gene locus_tag LOCUS_07990 gene atpF 8861 8361 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393859.1 protein_id gnl|my_center|LOCUS_07990 9106 8879 gene locus_tag LOCUS_08000 gene atpE 9106 8879 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421370.1 protein_id gnl|my_center|LOCUS_08000 9839 9180 gene locus_tag LOCUS_08010 gene atpB 9839 9180 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_08010 10209 9853 gene locus_tag LOCUS_08020 10209 9853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 11000 10377 gene locus_tag LOCUS_08030 gene upp 11000 10377 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294095.1 protein_id gnl|my_center|LOCUS_08030 12252 11014 gene locus_tag LOCUS_08040 gene glyA 12252 11014 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227669.1 protein_id gnl|my_center|LOCUS_08040 12696 12253 gene locus_tag LOCUS_08050 gene rpiB 12696 12253 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221910.1 protein_id gnl|my_center|LOCUS_08050 13298 12696 gene locus_tag LOCUS_08060 13298 12696 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_08060 13561 14004 gene locus_tag LOCUS_08070 13561 14004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 16121 14631 gene locus_tag LOCUS_08080 16121 14631 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680980.1 protein_id gnl|my_center|LOCUS_08080 17452 16292 gene locus_tag LOCUS_08090 17452 16292 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922115.1 protein_id gnl|my_center|LOCUS_08090 18219 17509 gene locus_tag LOCUS_08100 18219 17509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 19137 18289 gene locus_tag LOCUS_08110 gene pglE 19137 18289 CDS product (galactosaminyl)2-N,N'-diacetylbacillosaminyl-alpha1-diphospho-di-trans,octa-cis-undecaprenol synthase PglE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704837.1 protein_id gnl|my_center|LOCUS_08110 20090 19140 gene locus_tag LOCUS_08120 20090 19140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 21064 20105 gene locus_tag LOCUS_08130 21064 20105 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963750.1 protein_id gnl|my_center|LOCUS_08130 21546 22163 gene locus_tag LOCUS_08140 21546 22163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 23646 22804 gene locus_tag LOCUS_08150 gene rfbD 23646 22804 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_08150 25823 23661 gene locus_tag LOCUS_08160 25823 23661 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378512.1 protein_id gnl|my_center|LOCUS_08160 26613 25840 gene locus_tag LOCUS_08170 26613 25840 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021200.1 protein_id gnl|my_center|LOCUS_08170 27754 26624 gene locus_tag LOCUS_08180 27754 26624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 28261 28007 gene locus_tag LOCUS_08190 28261 28007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 28509 28309 gene locus_tag LOCUS_08200 28509 28309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 30553 28628 gene locus_tag LOCUS_08210 30553 28628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 32273 31149 gene locus_tag LOCUS_08220 32273 31149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 33691 32273 gene locus_tag LOCUS_08230 33691 32273 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476415.1 protein_id gnl|my_center|LOCUS_08230 34685 33693 gene locus_tag LOCUS_08240 34685 33693 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963750.1 protein_id gnl|my_center|LOCUS_08240 35035 34688 gene locus_tag LOCUS_08250 35035 34688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 35724 35053 gene locus_tag LOCUS_08260 35724 35053 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985169.1 protein_id gnl|my_center|LOCUS_08260 36685 35762 gene locus_tag LOCUS_08270 36685 35762 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261031.1 protein_id gnl|my_center|LOCUS_08270 37572 36703 gene locus_tag LOCUS_08280 37572 36703 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108519.1 protein_id gnl|my_center|LOCUS_08280 38962 37598 gene locus_tag LOCUS_08290 38962 37598 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097853.1 protein_id gnl|my_center|LOCUS_08290 39151 39633 gene locus_tag LOCUS_08300 39151 39633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 39927 39703 gene locus_tag LOCUS_08310 39927 39703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 40044 40304 gene locus_tag LOCUS_08320 40044 40304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 >Feature sequence017 3399 217 gene locus_tag LOCUS_08330 gene carB 3399 217 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126101.1 protein_id gnl|my_center|LOCUS_08330 4480 3392 gene locus_tag LOCUS_08340 gene carA 4480 3392 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016378.1 protein_id gnl|my_center|LOCUS_08340 5909 4491 gene locus_tag LOCUS_08350 gene purF 5909 4491 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 protein_id gnl|my_center|LOCUS_08350 7519 5909 gene locus_tag LOCUS_08360 7519 5909 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_08360 8219 7653 gene locus_tag LOCUS_08370 8219 7653 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807769.1 protein_id gnl|my_center|LOCUS_08370 9480 8239 gene locus_tag LOCUS_08380 gene glnA 9480 8239 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_08380 9729 10547 gene locus_tag LOCUS_08390 9729 10547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 10582 11043 gene locus_tag LOCUS_08400 10582 11043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 11418 12005 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttacatttcatataatgatcagattataaac 12753 12175 gene locus_tag LOCUS_08410 12753 12175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 12902 13582 gene locus_tag LOCUS_08420 12902 13582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 15836 14877 gene locus_tag LOCUS_08430 15836 14877 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547856.1 protein_id gnl|my_center|LOCUS_08430 16224 15823 gene locus_tag LOCUS_08440 16224 15823 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476244.1 protein_id gnl|my_center|LOCUS_08440 18628 16196 gene locus_tag LOCUS_08450 18628 16196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 19885 18869 gene locus_tag LOCUS_08460 19885 18869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 21165 20155 gene locus_tag LOCUS_08470 21165 20155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 22124 21162 gene locus_tag LOCUS_08480 22124 21162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 22788 22114 gene locus_tag LOCUS_08490 22788 22114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 24086 23187 gene locus_tag LOCUS_08500 gene trxB 24086 23187 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948886.1 protein_id gnl|my_center|LOCUS_08500 24599 24219 gene locus_tag LOCUS_08510 24599 24219 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287076.1 protein_id gnl|my_center|LOCUS_08510 25483 24602 gene locus_tag LOCUS_08520 gene rfbD 25483 24602 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946494.1 protein_id gnl|my_center|LOCUS_08520 26416 25484 gene locus_tag LOCUS_08530 gene manA 26416 25484 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 protein_id gnl|my_center|LOCUS_08530 27102 26413 gene locus_tag LOCUS_08540 gene deoC 27102 26413 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254138.1 protein_id gnl|my_center|LOCUS_08540 27272 27988 gene locus_tag LOCUS_08550 27272 27988 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254139.1 protein_id gnl|my_center|LOCUS_08550 28776 28018 gene locus_tag LOCUS_08560 28776 28018 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963877.1 protein_id gnl|my_center|LOCUS_08560 28911 29428 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttacatttcatataatgattagattataaac 29870 29592 gene locus_tag LOCUS_08570 gene cas2 29870 29592 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903132.1 protein_id gnl|my_center|LOCUS_08570 30864 29872 gene locus_tag LOCUS_08580 gene cas1b 30864 29872 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896423.1 protein_id gnl|my_center|LOCUS_08580 31352 30867 gene locus_tag LOCUS_08590 gene cas4 31352 30867 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016964.1 protein_id gnl|my_center|LOCUS_08590 33542 31368 gene locus_tag LOCUS_08600 33542 31368 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861769.1 protein_id gnl|my_center|LOCUS_08600 34307 33588 gene locus_tag LOCUS_08610 gene cas5 34307 33588 CDS product CRISPR-associated protein Cas5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546885.1 protein_id gnl|my_center|LOCUS_08610 35172 34300 gene locus_tag LOCUS_08620 gene cas7i 35172 34300 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861770.1 protein_id gnl|my_center|LOCUS_08620 36817 35162 gene locus_tag LOCUS_08630 36817 35162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 37557 36841 gene locus_tag LOCUS_08640 37557 36841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence018 258 611 gene locus_tag LOCUS_08650 258 611 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903515.1 protein_id gnl|my_center|LOCUS_08650 731 1018 gene locus_tag LOCUS_08660 731 1018 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922237.1 protein_id gnl|my_center|LOCUS_08660 1167 3488 gene locus_tag LOCUS_08670 1167 3488 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109494.1 protein_id gnl|my_center|LOCUS_08670 3675 4523 gene locus_tag LOCUS_08680 3675 4523 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476336.1 protein_id gnl|my_center|LOCUS_08680 4648 5553 gene locus_tag LOCUS_08690 gene pfkB 4648 5553 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_08690 5803 6258 gene locus_tag LOCUS_08700 5803 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08700 6261 7037 gene locus_tag LOCUS_08710 6261 7037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08710 7045 7710 gene locus_tag LOCUS_08720 gene rpiA 7045 7710 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964740.1 protein_id gnl|my_center|LOCUS_08720 7726 8697 gene locus_tag LOCUS_08730 7726 8697 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966670.1 protein_id gnl|my_center|LOCUS_08730 8699 9472 gene locus_tag LOCUS_08740 8699 9472 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965719.1 protein_id gnl|my_center|LOCUS_08740 9868 10305 gene locus_tag LOCUS_08750 9868 10305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 10320 10625 gene locus_tag LOCUS_08760 10320 10625 CDS product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722977.1 protein_id gnl|my_center|LOCUS_08760 10671 11714 gene locus_tag LOCUS_08770 10671 11714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08770 12090 14063 gene locus_tag LOCUS_08780 12090 14063 CDS product transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861840.1 protein_id gnl|my_center|LOCUS_08780 14170 15798 gene locus_tag LOCUS_08790 14170 15798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 15800 17569 gene locus_tag LOCUS_08800 15800 17569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 19144 25311 gene locus_tag LOCUS_08810 19144 25311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 25514 25858 gene locus_tag LOCUS_08820 25514 25858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 25852 26130 gene locus_tag LOCUS_08830 25852 26130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 26254 26454 gene locus_tag LOCUS_08840 26254 26454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 26545 26898 gene locus_tag LOCUS_08850 26545 26898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 28956 26995 gene locus_tag LOCUS_08860 28956 26995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 29678 28962 gene locus_tag LOCUS_08870 29678 28962 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439430.1 protein_id gnl|my_center|LOCUS_08870 30418 29798 gene locus_tag LOCUS_08880 30418 29798 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896752.1 protein_id gnl|my_center|LOCUS_08880 32488 30431 gene locus_tag LOCUS_08890 gene kdpB 32488 30431 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430007.1 protein_id gnl|my_center|LOCUS_08890 34242 32500 gene locus_tag LOCUS_08900 gene kdpA 34242 32500 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161471071.1 protein_id gnl|my_center|LOCUS_08900 34664 34275 gene locus_tag LOCUS_08910 34664 34275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 35069 36967 gene locus_tag LOCUS_08920 35069 36967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 >Feature sequence019 391 1962 gene locus_tag LOCUS_08930 391 1962 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568253.1 protein_id gnl|my_center|LOCUS_08930 1962 2699 gene locus_tag LOCUS_08940 1962 2699 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459577.1 protein_id gnl|my_center|LOCUS_08940 2722 4119 gene locus_tag LOCUS_08950 2722 4119 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_08950 4171 6726 gene locus_tag LOCUS_08960 4171 6726 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_08960 6736 7101 gene locus_tag LOCUS_08970 6736 7101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 8549 7119 gene locus_tag LOCUS_08980 gene gltX 8549 7119 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_08980 8603 8678 gene locus_tag LOCUS_t00060 8603 8678 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 8893 9093 gene locus_tag LOCUS_08990 8893 9093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 9187 10203 gene locus_tag LOCUS_09000 9187 10203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 10227 12101 gene locus_tag LOCUS_09010 10227 12101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 12212 12805 gene locus_tag LOCUS_09020 12212 12805 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_09020 12908 14095 gene locus_tag LOCUS_09030 12908 14095 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273809.1 protein_id gnl|my_center|LOCUS_09030 14156 14560 gene locus_tag LOCUS_09040 14156 14560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 15040 14594 gene locus_tag LOCUS_09050 15040 14594 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268542.1 protein_id gnl|my_center|LOCUS_09050 15135 15677 gene locus_tag LOCUS_09060 15135 15677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 17018 15708 gene locus_tag LOCUS_09070 17018 15708 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705259.1 protein_id gnl|my_center|LOCUS_09070 19372 17039 gene locus_tag LOCUS_09080 19372 17039 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_09080 19764 21104 gene locus_tag LOCUS_09090 19764 21104 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_09090 22213 21149 gene locus_tag LOCUS_09100 22213 21149 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_09100 22801 22283 gene locus_tag LOCUS_09110 22801 22283 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002785057.1 protein_id gnl|my_center|LOCUS_09110 22971 23771 gene locus_tag LOCUS_09120 22971 23771 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458995.1 protein_id gnl|my_center|LOCUS_09120 23783 24019 gene locus_tag LOCUS_09130 23783 24019 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_09130 24006 26024 gene locus_tag LOCUS_09140 gene feoB 24006 26024 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_09140 26072 26713 gene locus_tag LOCUS_09150 26072 26713 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964931.1 protein_id gnl|my_center|LOCUS_09150 26715 28142 gene locus_tag LOCUS_09160 gene malQ 26715 28142 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003028948.1 protein_id gnl|my_center|LOCUS_09160 28132 28641 gene locus_tag LOCUS_09170 28132 28641 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_09170 28694 29392 gene locus_tag LOCUS_09180 28694 29392 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391764.1 protein_id gnl|my_center|LOCUS_09180 30218 29445 gene locus_tag LOCUS_09190 30218 29445 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814936.1 protein_id gnl|my_center|LOCUS_09190 31399 30218 gene locus_tag LOCUS_09200 gene coaBC 31399 30218 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047883.1 protein_id gnl|my_center|LOCUS_09200 32014 31406 gene locus_tag LOCUS_09210 32014 31406 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287046.1 protein_id gnl|my_center|LOCUS_09210 32216 32770 gene locus_tag LOCUS_09220 32216 32770 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987052.1 protein_id gnl|my_center|LOCUS_09220 33072 34610 gene locus_tag LOCUS_09230 33072 34610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 35358 34834 gene locus_tag LOCUS_09240 35358 34834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 35460 35777 gene locus_tag LOCUS_09250 35460 35777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 35837 36586 gene locus_tag LOCUS_09260 35837 36586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence020 716 315 gene locus_tag LOCUS_09270 716 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 1557 2915 gene locus_tag LOCUS_09280 gene trkA 1557 2915 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_09280 2899 4395 gene locus_tag LOCUS_09290 2899 4395 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_09290 5686 4589 gene locus_tag LOCUS_09300 gene brnQ 5686 4589 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964918.1 protein_id gnl|my_center|LOCUS_09300 6289 7347 gene locus_tag LOCUS_09310 6289 7347 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793731.1 protein_id gnl|my_center|LOCUS_09310 10114 7448 gene locus_tag LOCUS_09320 10114 7448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 11073 10108 gene locus_tag LOCUS_09330 11073 10108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09330 12371 11070 gene locus_tag LOCUS_09340 12371 11070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09340 13492 12797 gene locus_tag LOCUS_09350 13492 12797 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566878.1 protein_id gnl|my_center|LOCUS_09350 17670 13843 gene locus_tag LOCUS_09360 17670 13843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 18237 17746 gene locus_tag LOCUS_09370 18237 17746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 18881 19285 gene locus_tag LOCUS_09380 18881 19285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09380 19334 19732 gene locus_tag LOCUS_09390 19334 19732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09390 21033 19783 gene locus_tag LOCUS_09400 21033 19783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 25022 21030 gene locus_tag LOCUS_09410 25022 21030 CDS product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459216.1 protein_id gnl|my_center|LOCUS_09410 26139 25024 gene locus_tag LOCUS_09420 26139 25024 CDS product TIGR02678 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068556302.1 protein_id gnl|my_center|LOCUS_09420 27619 26129 gene locus_tag LOCUS_09430 27619 26129 CDS product TIGR02677 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459214.1 protein_id gnl|my_center|LOCUS_09430 27878 29137 gene locus_tag LOCUS_09440 27878 29137 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000652047.1 protein_id gnl|my_center|LOCUS_09440 29277 29435 gene locus_tag LOCUS_09450 gene scfA 29277 29435 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_09450 29502 30887 gene locus_tag LOCUS_09460 gene scfB 29502 30887 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_09460 30887 32218 gene locus_tag LOCUS_09470 30887 32218 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243352.1 protein_id gnl|my_center|LOCUS_09470 33102 32356 gene locus_tag LOCUS_09480 gene fabG 33102 32356 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_09480 33680 33123 gene locus_tag LOCUS_09490 gene efp 33680 33123 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626507.1 protein_id gnl|my_center|LOCUS_09490 34627 33938 gene locus_tag LOCUS_09500 34627 33938 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861304.1 protein_id gnl|my_center|LOCUS_09500 35112 34630 gene locus_tag LOCUS_09510 35112 34630 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965709.1 protein_id gnl|my_center|LOCUS_09510 >Feature sequence021 189 449 gene locus_tag LOCUS_09520 189 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 665 814 gene locus_tag LOCUS_09530 665 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1074 2957 gene locus_tag LOCUS_09540 gene glgB 1074 2957 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111383.1 protein_id gnl|my_center|LOCUS_09540 2959 5355 gene locus_tag LOCUS_09550 2959 5355 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964971.1 protein_id gnl|my_center|LOCUS_09550 5682 5846 gene locus_tag LOCUS_09560 5682 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 6392 12553 gene locus_tag LOCUS_09570 6392 12553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 12847 14910 gene locus_tag LOCUS_09580 gene pulA 12847 14910 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921725.1 protein_id gnl|my_center|LOCUS_09580 14922 15476 gene locus_tag LOCUS_09590 gene pth 14922 15476 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 protein_id gnl|my_center|LOCUS_09590 15485 18910 gene locus_tag LOCUS_09600 gene mfd 15485 18910 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579713.1 protein_id gnl|my_center|LOCUS_09600 20176 19109 gene locus_tag LOCUS_09610 20176 19109 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387217.1 protein_id gnl|my_center|LOCUS_09610 20624 20163 gene locus_tag LOCUS_09620 20624 20163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 21323 20865 gene locus_tag LOCUS_09630 21323 20865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 21975 21376 gene locus_tag LOCUS_09640 21975 21376 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 protein_id gnl|my_center|LOCUS_09640 22071 22952 gene locus_tag LOCUS_09650 22071 22952 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811761.1 protein_id gnl|my_center|LOCUS_09650 22940 23386 gene locus_tag LOCUS_09660 22940 23386 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656744.1 protein_id gnl|my_center|LOCUS_09660 25414 23858 gene locus_tag LOCUS_09670 25414 23858 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033562369.1 protein_id gnl|my_center|LOCUS_09670 26266 25670 gene locus_tag LOCUS_09680 26266 25670 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837399.1 protein_id gnl|my_center|LOCUS_09680 27369 26263 gene locus_tag LOCUS_09690 27369 26263 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546538.1 protein_id gnl|my_center|LOCUS_09690 27638 27835 gene locus_tag LOCUS_09700 gene cspC 27638 27835 CDS product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001990088.1 protein_id gnl|my_center|LOCUS_09700 28258 30891 gene locus_tag LOCUS_09710 gene secA 28258 30891 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228033.1 protein_id gnl|my_center|LOCUS_09710 30891 31994 gene locus_tag LOCUS_09720 gene prfB 30891 31994 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_09720 31996 32871 gene locus_tag LOCUS_09730 31996 32871 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356230.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence022 732 388 gene locus_tag LOCUS_09740 732 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1208 762 gene locus_tag LOCUS_09750 1208 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 4265 2121 gene locus_tag LOCUS_09760 gene pcrA 4265 2121 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457083.1 protein_id gnl|my_center|LOCUS_09760 5278 4361 gene locus_tag LOCUS_09770 gene pyrD 5278 4361 CDS product dihydroorotate oxidase B catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081057.1 protein_id gnl|my_center|LOCUS_09770 6026 5271 gene locus_tag LOCUS_09780 6026 5271 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_09780 7306 6038 gene locus_tag LOCUS_09790 gene pyrC 7306 6038 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108367.1 protein_id gnl|my_center|LOCUS_09790 8174 7299 gene locus_tag LOCUS_09800 gene pyrB 8174 7299 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018849.1 protein_id gnl|my_center|LOCUS_09800 8794 8315 gene locus_tag LOCUS_09810 gene coaD 8794 8315 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728846.1 protein_id gnl|my_center|LOCUS_09810 9347 8799 gene locus_tag LOCUS_09820 gene rsmD 9347 8799 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706551.1 protein_id gnl|my_center|LOCUS_09820 9709 9356 gene locus_tag LOCUS_09830 9709 9356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 9889 9710 gene locus_tag LOCUS_09840 9889 9710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 10184 9882 gene locus_tag LOCUS_09850 10184 9882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 11485 10211 gene locus_tag LOCUS_09860 gene ftsW 11485 10211 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832779.1 protein_id gnl|my_center|LOCUS_09860 11753 11487 gene locus_tag LOCUS_09870 11753 11487 CDS product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456562.1 protein_id gnl|my_center|LOCUS_09870 11867 12073 gene locus_tag LOCUS_09880 11867 12073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 12133 12702 gene locus_tag LOCUS_09890 gene def 12133 12702 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957048.1 protein_id gnl|my_center|LOCUS_09890 13318 12749 gene locus_tag LOCUS_09900 13318 12749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 13910 13302 gene locus_tag LOCUS_09910 13910 13302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 15275 13989 gene locus_tag LOCUS_09920 15275 13989 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101818.1 protein_id gnl|my_center|LOCUS_09920 15792 15370 gene locus_tag LOCUS_09930 15792 15370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 15893 16558 gene locus_tag LOCUS_09940 15893 16558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 16614 17852 gene locus_tag LOCUS_09950 16614 17852 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891452.1 protein_id gnl|my_center|LOCUS_09950 19194 17878 gene locus_tag LOCUS_09960 19194 17878 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234223.1 protein_id gnl|my_center|LOCUS_09960 19326 20240 gene locus_tag LOCUS_09970 gene cysK 19326 20240 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965533.1 protein_id gnl|my_center|LOCUS_09970 20685 20248 gene locus_tag LOCUS_09980 20685 20248 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_09980 21476 20745 gene locus_tag LOCUS_09990 21476 20745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 23632 21488 gene locus_tag LOCUS_10000 23632 21488 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426223.1 protein_id gnl|my_center|LOCUS_10000 24759 24334 gene locus_tag LOCUS_10010 24759 24334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 24858 26225 gene locus_tag LOCUS_10020 gene pepV 24858 26225 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732537.1 protein_id gnl|my_center|LOCUS_10020 26274 26360 gene locus_tag LOCUS_t00070 26274 26360 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27544 27332 gene locus_tag LOCUS_10030 27544 27332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 27900 27556 gene locus_tag LOCUS_10040 27900 27556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 29222 28278 gene locus_tag LOCUS_10050 gene metA 29222 28278 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_10050 30522 29278 gene locus_tag LOCUS_10060 30522 29278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence023 116 1174 gene locus_tag LOCUS_10070 gene aroB 116 1174 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893310.1 protein_id gnl|my_center|LOCUS_10070 1176 2456 gene locus_tag LOCUS_10080 gene aroA 1176 2456 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861345.1 protein_id gnl|my_center|LOCUS_10080 2434 3501 gene locus_tag LOCUS_10090 gene aroC 2434 3501 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_10090 3504 4622 gene locus_tag LOCUS_10100 gene pheA 3504 4622 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_10100 4629 5132 gene locus_tag LOCUS_10110 4629 5132 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964216.1 protein_id gnl|my_center|LOCUS_10110 5655 6278 gene locus_tag LOCUS_10120 5655 6278 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930809.1 protein_id gnl|my_center|LOCUS_10120 6421 7569 gene locus_tag LOCUS_10130 6421 7569 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869908.1 protein_id gnl|my_center|LOCUS_10130 7566 8321 gene locus_tag LOCUS_10140 7566 8321 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861832.1 protein_id gnl|my_center|LOCUS_10140 8326 9066 gene locus_tag LOCUS_10150 gene yaaA 8326 9066 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458998.1 protein_id gnl|my_center|LOCUS_10150 9184 9450 gene locus_tag LOCUS_10160 gene rpsO 9184 9450 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701713.1 protein_id gnl|my_center|LOCUS_10160 10365 9544 gene locus_tag LOCUS_10170 10365 9544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 11035 10367 gene locus_tag LOCUS_10180 11035 10367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 11592 11035 gene locus_tag LOCUS_10190 11592 11035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 12705 11686 gene locus_tag LOCUS_10200 12705 11686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 13440 12712 gene locus_tag LOCUS_10210 13440 12712 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986981.1 protein_id gnl|my_center|LOCUS_10210 14202 13441 gene locus_tag LOCUS_10220 14202 13441 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966326.1 protein_id gnl|my_center|LOCUS_10220 14888 14202 gene locus_tag LOCUS_10230 14888 14202 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338484.1 protein_id gnl|my_center|LOCUS_10230 15135 17030 gene locus_tag LOCUS_10240 15135 17030 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_10240 17105 18244 gene locus_tag LOCUS_10250 gene rlmD 17105 18244 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861959.1 protein_id gnl|my_center|LOCUS_10250 18885 18577 gene locus_tag LOCUS_10260 18885 18577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 19165 19638 gene locus_tag LOCUS_10270 19165 19638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10270 19604 20140 gene locus_tag LOCUS_10280 19604 20140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10280 20140 20601 gene locus_tag LOCUS_10290 20140 20601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10290 20638 21846 gene locus_tag LOCUS_10300 20638 21846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10300 21868 22422 gene locus_tag LOCUS_10310 21868 22422 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922263.1 protein_id gnl|my_center|LOCUS_10310 22587 22514 gene locus_tag LOCUS_t00080 22587 22514 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 22748 22879 gene locus_tag LOCUS_10320 22748 22879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 22876 23154 gene locus_tag LOCUS_10330 22876 23154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 23118 23324 gene locus_tag LOCUS_10340 23118 23324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 24884 23352 gene locus_tag LOCUS_10350 24884 23352 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861147.1 protein_id gnl|my_center|LOCUS_10350 25134 25826 gene locus_tag LOCUS_10360 gene rgbR 25134 25826 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_10360 25972 26109 gene locus_tag LOCUS_10370 25972 26109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 26492 26118 gene locus_tag LOCUS_10380 26492 26118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 26638 26805 gene locus_tag LOCUS_10390 26638 26805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 26826 27095 gene locus_tag LOCUS_10400 26826 27095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 27188 27352 gene locus_tag LOCUS_10410 27188 27352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 27339 27557 gene locus_tag LOCUS_10420 27339 27557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 27576 28277 gene locus_tag LOCUS_10430 27576 28277 CDS product ORF6C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905684.1 protein_id gnl|my_center|LOCUS_10430 28303 28485 gene locus_tag LOCUS_10440 28303 28485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 28755 28543 gene locus_tag LOCUS_10450 28755 28543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 28844 29686 gene locus_tag LOCUS_10460 28844 29686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 29691 30569 gene locus_tag LOCUS_10470 29691 30569 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764673.1 protein_id gnl|my_center|LOCUS_10470 30581 30733 gene locus_tag LOCUS_10480 30581 30733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 30746 30892 gene locus_tag LOCUS_10490 30746 30892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 30889 31095 gene locus_tag LOCUS_10500 30889 31095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence024 <1 1818 gene locus_tag LOCUS_10510 <1 1818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000372988.1:PBP1A family penicillin-binding protein 3046 1820 gene locus_tag LOCUS_10520 3046 1820 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262734.1 protein_id gnl|my_center|LOCUS_10520 3827 3144 gene locus_tag LOCUS_10530 3827 3144 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_10530 4826 3831 gene locus_tag LOCUS_10540 4826 3831 CDS product isocitrate dehydrogenase (NAD(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964290.1 protein_id gnl|my_center|LOCUS_10540 6751 4826 gene locus_tag LOCUS_10550 6751 4826 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948184.1 protein_id gnl|my_center|LOCUS_10550 7968 6928 gene locus_tag LOCUS_10560 7968 6928 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433978.1 protein_id gnl|my_center|LOCUS_10560 8978 7989 gene locus_tag LOCUS_10570 8978 7989 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_10570 9979 8978 gene locus_tag LOCUS_10580 9979 8978 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861634.1 protein_id gnl|my_center|LOCUS_10580 10857 9991 gene locus_tag LOCUS_10590 10857 9991 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867268.1 protein_id gnl|my_center|LOCUS_10590 11794 10859 gene locus_tag LOCUS_10600 11794 10859 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928488.1 protein_id gnl|my_center|LOCUS_10600 13473 11887 gene locus_tag LOCUS_10610 13473 11887 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_10610 13864 15723 gene locus_tag LOCUS_10620 13864 15723 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048250.1 protein_id gnl|my_center|LOCUS_10620 15956 15726 gene locus_tag LOCUS_10630 15956 15726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 16156 15971 gene locus_tag LOCUS_10640 16156 15971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 16978 17157 gene locus_tag LOCUS_10650 16978 17157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 18885 17512 gene locus_tag LOCUS_10660 18885 17512 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705185.1 protein_id gnl|my_center|LOCUS_10660 19139 19636 gene locus_tag LOCUS_10670 19139 19636 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986971.1 protein_id gnl|my_center|LOCUS_10670 19922 19626 gene locus_tag LOCUS_10680 19922 19626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 20385 19909 gene locus_tag LOCUS_10690 20385 19909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 22551 20473 gene locus_tag LOCUS_10700 22551 20473 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_10700 23269 22718 gene locus_tag LOCUS_10710 gene yfcE 23269 22718 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_10710 23884 23270 gene locus_tag LOCUS_10720 23884 23270 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016144.1 protein_id gnl|my_center|LOCUS_10720 24243 23983 gene locus_tag LOCUS_10730 24243 23983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 24730 24248 gene locus_tag LOCUS_10740 24730 24248 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_10740 25009 24731 gene locus_tag LOCUS_10750 25009 24731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 25500 25021 gene locus_tag LOCUS_10760 gene rlmH 25500 25021 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355021.1 protein_id gnl|my_center|LOCUS_10760 26239 25490 gene locus_tag LOCUS_10770 26239 25490 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088649.1 protein_id gnl|my_center|LOCUS_10770 26556 26353 gene locus_tag LOCUS_10780 gene rpmE 26556 26353 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_10780 27523 26693 gene locus_tag LOCUS_10790 27523 26693 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964664.1 protein_id gnl|my_center|LOCUS_10790 29612 27516 gene locus_tag LOCUS_10800 29612 27516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 30044 29835 gene locus_tag LOCUS_10810 30044 29835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 >Feature sequence025 433 68 gene locus_tag LOCUS_10820 433 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 939 745 gene locus_tag LOCUS_10830 939 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 2872 1325 gene locus_tag LOCUS_10840 gene guaA 2872 1325 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_10840 4162 2885 gene locus_tag LOCUS_10850 gene purA 4162 2885 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243325.1 protein_id gnl|my_center|LOCUS_10850 5183 4323 gene locus_tag LOCUS_10860 5183 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 5271 5798 gene locus_tag LOCUS_10870 5271 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 5845 5919 gene locus_tag LOCUS_t00090 5845 5919 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6238 6038 gene locus_tag LOCUS_10880 6238 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 6331 6999 gene locus_tag LOCUS_10890 6331 6999 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_10890 6996 7988 gene locus_tag LOCUS_10900 6996 7988 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_10900 8084 8851 gene locus_tag LOCUS_10910 8084 8851 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_10910 8841 10859 gene locus_tag LOCUS_10920 8841 10859 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986650.1 protein_id gnl|my_center|LOCUS_10920 12280 11453 gene locus_tag LOCUS_10930 12280 11453 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 protein_id gnl|my_center|LOCUS_10930 12856 12320 gene locus_tag LOCUS_10940 12856 12320 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680597.1 protein_id gnl|my_center|LOCUS_10940 14148 12931 gene locus_tag LOCUS_10950 14148 12931 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_10950 15138 14218 gene locus_tag LOCUS_10960 15138 14218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 16626 15451 gene locus_tag LOCUS_10970 16626 15451 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963530.1 protein_id gnl|my_center|LOCUS_10970 18949 16691 gene locus_tag LOCUS_10980 18949 16691 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963529.1 protein_id gnl|my_center|LOCUS_10980 19432 19923 gene locus_tag LOCUS_10990 gene nuoE 19432 19923 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766748.1 protein_id gnl|my_center|LOCUS_10990 19917 20270 gene locus_tag LOCUS_11000 19917 20270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 20267 20677 gene locus_tag LOCUS_11010 20267 20677 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869443.1 protein_id gnl|my_center|LOCUS_11010 20674 21834 gene locus_tag LOCUS_11020 20674 21834 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_11020 21839 22165 gene locus_tag LOCUS_11030 21839 22165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583278.1 protein_id gnl|my_center|LOCUS_11030 22167 22868 gene locus_tag LOCUS_11040 22167 22868 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_11040 22870 23403 gene locus_tag LOCUS_11050 22870 23403 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_11050 23400 23768 gene locus_tag LOCUS_11060 23400 23768 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_11060 23780 25579 gene locus_tag LOCUS_11070 gene nuoF 23780 25579 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_11070 25589 27337 gene locus_tag LOCUS_11080 25589 27337 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_11080 27852 28379 gene locus_tag LOCUS_11090 27852 28379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 <29761 28445 gene locus_tag LOCUS_11100 <29761 28445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_163066848.1:recombinase family protein >Feature sequence026 1046 192 gene locus_tag LOCUS_11110 gene rsmI 1046 192 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700659.1 protein_id gnl|my_center|LOCUS_11110 1773 1039 gene locus_tag LOCUS_11120 1773 1039 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166255.1 protein_id gnl|my_center|LOCUS_11120 2584 1766 gene locus_tag LOCUS_11130 2584 1766 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134194.1 protein_id gnl|my_center|LOCUS_11130 3538 2597 gene locus_tag LOCUS_11140 gene holB 3538 2597 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169561.1 protein_id gnl|my_center|LOCUS_11140 4155 3535 gene locus_tag LOCUS_11150 gene tmk 4155 3535 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243137.1 protein_id gnl|my_center|LOCUS_11150 4555 4394 gene locus_tag LOCUS_11160 4555 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 5181 4588 gene locus_tag LOCUS_11170 gene recR 5181 4588 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722062.1 protein_id gnl|my_center|LOCUS_11170 6944 5193 gene locus_tag LOCUS_11180 gene dnaX 6944 5193 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476228.1 protein_id gnl|my_center|LOCUS_11180 7488 7018 gene locus_tag LOCUS_11190 gene tadA 7488 7018 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439010.1 protein_id gnl|my_center|LOCUS_11190 7688 7924 gene locus_tag LOCUS_11200 7688 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 8963 8460 gene locus_tag LOCUS_11210 8963 8460 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895379.1 protein_id gnl|my_center|LOCUS_11210 10016 9198 gene locus_tag LOCUS_11220 10016 9198 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014584372.1 protein_id gnl|my_center|LOCUS_11220 11314 10031 gene locus_tag LOCUS_11230 gene serS 11314 10031 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_11230 13930 11468 gene locus_tag LOCUS_11240 gene gyrA 13930 11468 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 protein_id gnl|my_center|LOCUS_11240 15871 13946 gene locus_tag LOCUS_11250 gene gyrB 15871 13946 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_11250 16968 15871 gene locus_tag LOCUS_11260 gene recF 16968 15871 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243515.1 protein_id gnl|my_center|LOCUS_11260 17174 16968 gene locus_tag LOCUS_11270 gene yaaA 17174 16968 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420479.1 protein_id gnl|my_center|LOCUS_11270 18493 17384 gene locus_tag LOCUS_11280 gene dnaN 18493 17384 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725616.1 protein_id gnl|my_center|LOCUS_11280 19994 18648 gene locus_tag LOCUS_11290 gene dnaA 19994 18648 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545093.1 protein_id gnl|my_center|LOCUS_11290 20514 20648 gene locus_tag LOCUS_11300 20514 20648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 20687 21025 gene locus_tag LOCUS_11310 gene rnpA 20687 21025 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183578.1 protein_id gnl|my_center|LOCUS_11310 21026 21895 gene locus_tag LOCUS_11320 gene yidC 21026 21895 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641627.1 protein_id gnl|my_center|LOCUS_11320 21932 22534 gene locus_tag LOCUS_11330 21932 22534 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243764.1 protein_id gnl|my_center|LOCUS_11330 22587 23771 gene locus_tag LOCUS_11340 22587 23771 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476412.1 protein_id gnl|my_center|LOCUS_11340 24788 23808 gene locus_tag LOCUS_11350 24788 23808 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762189.1 protein_id gnl|my_center|LOCUS_11350 24961 26295 gene locus_tag LOCUS_11360 gene mnmE 24961 26295 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131240.1 protein_id gnl|my_center|LOCUS_11360 26297 26524 gene locus_tag LOCUS_11370 26297 26524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 26533 27384 gene locus_tag LOCUS_11380 26533 27384 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_11380 28739 27396 gene locus_tag LOCUS_11390 28739 27396 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence027 59 1597 gene locus_tag LOCUS_11400 gene lysS 59 1597 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242743.1 protein_id gnl|my_center|LOCUS_11400 1884 2045 gene locus_tag LOCUS_11410 1884 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 3573 8132 gene locus_tag LOCUS_11420 3573 8132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 8293 9258 gene locus_tag LOCUS_11430 gene manA 8293 9258 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 protein_id gnl|my_center|LOCUS_11430 9416 9883 gene locus_tag LOCUS_11440 9416 9883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 10170 10841 gene locus_tag LOCUS_11450 10170 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 10841 11704 gene locus_tag LOCUS_11460 10841 11704 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_11460 11691 13238 gene locus_tag LOCUS_11470 11691 13238 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225543.1 protein_id gnl|my_center|LOCUS_11470 13231 13944 gene locus_tag LOCUS_11480 13231 13944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 13941 16142 gene locus_tag LOCUS_11490 13941 16142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 17086 16175 gene locus_tag LOCUS_11500 17086 16175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 18170 17103 gene locus_tag LOCUS_11510 18170 17103 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201892.1 protein_id gnl|my_center|LOCUS_11510 20226 18196 gene locus_tag LOCUS_11520 20226 18196 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421678.1 protein_id gnl|my_center|LOCUS_11520 20517 25457 gene locus_tag LOCUS_11530 20517 25457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 26847 25597 gene locus_tag LOCUS_11540 gene uraA 26847 25597 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667891.1 protein_id gnl|my_center|LOCUS_11540 26978 27463 gene locus_tag LOCUS_11550 26978 27463 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890795.1 protein_id gnl|my_center|LOCUS_11550 27531 28304 gene locus_tag LOCUS_11560 27531 28304 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_11560 28389 28562 gene locus_tag LOCUS_11570 28389 28562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 28632 28805 gene locus_tag LOCUS_11580 28632 28805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence028 99 1799 gene locus_tag LOCUS_11590 99 1799 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965199.1 protein_id gnl|my_center|LOCUS_11590 1813 3051 gene locus_tag LOCUS_11600 1813 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 3048 3185 gene locus_tag LOCUS_11610 3048 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 3253 3891 gene locus_tag LOCUS_11620 3253 3891 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905713.1 protein_id gnl|my_center|LOCUS_11620 3908 5131 gene locus_tag LOCUS_11630 3908 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 5165 5497 gene locus_tag LOCUS_11640 5165 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 5509 6174 gene locus_tag LOCUS_11650 5509 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 6189 6386 gene locus_tag LOCUS_11660 6189 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 6411 7238 gene locus_tag LOCUS_11670 6411 7238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 7255 7761 gene locus_tag LOCUS_11680 7255 7761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 7777 8007 gene locus_tag LOCUS_11690 7777 8007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 8011 8355 gene locus_tag LOCUS_11700 8011 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 8348 8755 gene locus_tag LOCUS_11710 8348 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 8752 9102 gene locus_tag LOCUS_11720 8752 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 9104 9766 gene locus_tag LOCUS_11730 9104 9766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 9769 10131 gene locus_tag LOCUS_11740 9769 10131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 10182 10355 gene locus_tag LOCUS_11750 10182 10355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 10373 13630 gene locus_tag LOCUS_11760 10373 13630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 13634 14482 gene locus_tag LOCUS_11770 13634 14482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 14484 15536 gene locus_tag LOCUS_11780 14484 15536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 15539 16669 gene locus_tag LOCUS_11790 15539 16669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 17006 16785 gene locus_tag LOCUS_11800 17006 16785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 17352 17726 gene locus_tag LOCUS_11810 17352 17726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 17760 18680 gene locus_tag LOCUS_11820 17760 18680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 18838 19146 gene locus_tag LOCUS_11830 18838 19146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 19242 19559 gene locus_tag LOCUS_11840 19242 19559 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_11840 19562 20257 gene locus_tag LOCUS_11850 19562 20257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 20283 20987 gene locus_tag LOCUS_11860 20283 20987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 20987 21166 gene locus_tag LOCUS_11870 20987 21166 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023998.1 protein_id gnl|my_center|LOCUS_11870 21303 22898 gene locus_tag LOCUS_11880 21303 22898 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633861.1 protein_id gnl|my_center|LOCUS_11880 23109 24455 gene locus_tag LOCUS_11890 gene csm6 23109 24455 CDS product type III-A CRISPR-associated CARF protein Csm6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899494.1 protein_id gnl|my_center|LOCUS_11890 24464 26812 gene locus_tag LOCUS_11900 gene cas10 24464 26812 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261170.1 protein_id gnl|my_center|LOCUS_11900 26813 27226 gene locus_tag LOCUS_11910 26813 27226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 27244 27873 gene locus_tag LOCUS_11920 gene csm3 27244 27873 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082356.1 protein_id gnl|my_center|LOCUS_11920 27875 28264 gene locus_tag LOCUS_11930 27875 28264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence029 625 176 gene locus_tag LOCUS_11940 gene dtd 625 176 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547036.1 protein_id gnl|my_center|LOCUS_11940 701 1963 gene locus_tag LOCUS_11950 701 1963 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812943.1 protein_id gnl|my_center|LOCUS_11950 2921 1995 gene locus_tag LOCUS_11960 gene miaA 2921 1995 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504940.1 protein_id gnl|my_center|LOCUS_11960 4726 2921 gene locus_tag LOCUS_11970 gene mutL 4726 2921 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732291.1 protein_id gnl|my_center|LOCUS_11970 7245 4732 gene locus_tag LOCUS_11980 gene mutS 7245 4732 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990113.1 protein_id gnl|my_center|LOCUS_11980 7810 7316 gene locus_tag LOCUS_11990 gene cotE 7810 7316 CDS product outer spore coat protein CotE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288800.1 protein_id gnl|my_center|LOCUS_11990 9564 8050 gene locus_tag LOCUS_12000 9564 8050 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272361.1 protein_id gnl|my_center|LOCUS_12000 9966 9637 gene locus_tag LOCUS_12010 9966 9637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 11401 9956 gene locus_tag LOCUS_12020 gene miaB 11401 9956 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244831.1 protein_id gnl|my_center|LOCUS_12020 11833 11573 gene locus_tag LOCUS_12030 gene spoVS 11833 11573 CDS product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154135.1 protein_id gnl|my_center|LOCUS_12030 12658 11879 gene locus_tag LOCUS_12040 12658 11879 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832548.1 protein_id gnl|my_center|LOCUS_12040 14258 12702 gene locus_tag LOCUS_12050 gene rny 14258 12702 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204912.1 protein_id gnl|my_center|LOCUS_12050 15620 14577 gene locus_tag LOCUS_12060 gene recA 15620 14577 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287328.1 protein_id gnl|my_center|LOCUS_12060 16116 15658 gene locus_tag LOCUS_12070 16116 15658 CDS product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013447851.1 protein_id gnl|my_center|LOCUS_12070 16709 16116 gene locus_tag LOCUS_12080 gene pgsA 16709 16116 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296025.1 protein_id gnl|my_center|LOCUS_12080 17692 16709 gene locus_tag LOCUS_12090 17692 16709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 19037 17892 gene locus_tag LOCUS_12100 gene fucO 19037 17892 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288246.1 protein_id gnl|my_center|LOCUS_12100 19354 19157 gene locus_tag LOCUS_12110 19354 19157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 21083 19482 gene locus_tag LOCUS_12120 21083 19482 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810050.1 protein_id gnl|my_center|LOCUS_12120 21646 21083 gene locus_tag LOCUS_12130 gene ahpC 21646 21083 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817384.1 protein_id gnl|my_center|LOCUS_12130 22461 21910 gene locus_tag LOCUS_12140 22461 21910 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816608.1 protein_id gnl|my_center|LOCUS_12140 23453 23118 gene locus_tag LOCUS_12150 gene gpsB 23453 23118 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622430.1 protein_id gnl|my_center|LOCUS_12150 23624 24223 gene locus_tag LOCUS_12160 gene recU 23624 24223 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155594.1 protein_id gnl|my_center|LOCUS_12160 24213 26921 gene locus_tag LOCUS_12170 24213 26921 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398589.1 protein_id gnl|my_center|LOCUS_12170 27874 27191 gene locus_tag LOCUS_12180 27874 27191 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068494.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence030 864 259 gene locus_tag LOCUS_12190 864 259 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263264.1 protein_id gnl|my_center|LOCUS_12190 2609 1392 gene locus_tag LOCUS_12200 2609 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 3406 3005 gene locus_tag LOCUS_12210 3406 3005 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358748.1 protein_id gnl|my_center|LOCUS_12210 4768 3407 gene locus_tag LOCUS_12220 4768 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 5761 5285 gene locus_tag LOCUS_12230 5761 5285 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068146.1 protein_id gnl|my_center|LOCUS_12230 6039 5782 gene locus_tag LOCUS_12240 6039 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 6598 6350 gene locus_tag LOCUS_12250 6598 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 7424 6705 gene locus_tag LOCUS_12260 7424 6705 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963651.1 protein_id gnl|my_center|LOCUS_12260 10618 7424 gene locus_tag LOCUS_12270 10618 7424 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 protein_id gnl|my_center|LOCUS_12270 10858 10673 gene locus_tag LOCUS_12280 10858 10673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 11054 10869 gene locus_tag LOCUS_12290 11054 10869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 12308 11055 gene locus_tag LOCUS_12300 12308 11055 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027693.1 protein_id gnl|my_center|LOCUS_12300 12876 12292 gene locus_tag LOCUS_12310 12876 12292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 13793 12879 gene locus_tag LOCUS_12320 13793 12879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 15334 13805 gene locus_tag LOCUS_12330 15334 13805 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_12330 15921 15331 gene locus_tag LOCUS_12340 15921 15331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 17404 16406 gene locus_tag LOCUS_12350 17404 16406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 19375 17585 gene locus_tag LOCUS_12360 19375 17585 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080566.1 protein_id gnl|my_center|LOCUS_12360 20202 19582 gene locus_tag LOCUS_12370 20202 19582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 22385 20325 gene locus_tag LOCUS_12380 22385 20325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 23559 22375 gene locus_tag LOCUS_12390 23559 22375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 23963 24439 gene locus_tag LOCUS_12400 23963 24439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 25397 24798 gene locus_tag LOCUS_12410 25397 24798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 25798 25400 gene locus_tag LOCUS_12420 25798 25400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence031 1603 437 gene locus_tag LOCUS_12430 1603 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 2475 1600 gene locus_tag LOCUS_12440 2475 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 3460 2942 gene locus_tag LOCUS_12450 3460 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 4037 3447 gene locus_tag LOCUS_12460 gene scpB 4037 3447 CDS product segregation/condensation protein ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376225.1 protein_id gnl|my_center|LOCUS_12460 4765 4037 gene locus_tag LOCUS_12470 4765 4037 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723598.1 protein_id gnl|my_center|LOCUS_12470 6235 4847 gene locus_tag LOCUS_12480 6235 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 7694 6417 gene locus_tag LOCUS_12490 gene spoVAF 7694 6417 CDS product spore germination protein SpoVAF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230471.1 protein_id gnl|my_center|LOCUS_12490 8044 7694 gene locus_tag LOCUS_12500 gene spoVAE 8044 7694 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230467.1 protein_id gnl|my_center|LOCUS_12500 9048 8044 gene locus_tag LOCUS_12510 gene spoVAD 9048 8044 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230465.1 protein_id gnl|my_center|LOCUS_12510 9469 9026 gene locus_tag LOCUS_12520 gene spoVAC 9469 9026 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223947.1 protein_id gnl|my_center|LOCUS_12520 10334 9540 gene locus_tag LOCUS_12530 10334 9540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 12075 10516 gene locus_tag LOCUS_12540 12075 10516 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723235.1 protein_id gnl|my_center|LOCUS_12540 12455 12129 gene locus_tag LOCUS_12550 12455 12129 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722052.1 protein_id gnl|my_center|LOCUS_12550 13252 12590 gene locus_tag LOCUS_12560 13252 12590 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773049.1 protein_id gnl|my_center|LOCUS_12560 14691 13288 gene locus_tag LOCUS_12570 14691 13288 CDS product Trk family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888508.1 protein_id gnl|my_center|LOCUS_12570 15266 14709 gene locus_tag LOCUS_12580 15266 14709 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_12580 16838 15270 gene locus_tag LOCUS_12590 16838 15270 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_12590 17949 16840 gene locus_tag LOCUS_12600 17949 16840 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966853.1 protein_id gnl|my_center|LOCUS_12600 18098 18832 gene locus_tag LOCUS_12610 18098 18832 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073261.1 protein_id gnl|my_center|LOCUS_12610 18859 19524 gene locus_tag LOCUS_12620 18859 19524 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815292.1 protein_id gnl|my_center|LOCUS_12620 19527 19940 gene locus_tag LOCUS_12630 19527 19940 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289317.1 protein_id gnl|my_center|LOCUS_12630 22199 20052 gene locus_tag LOCUS_12640 22199 20052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 22602 22186 gene locus_tag LOCUS_12650 22602 22186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 23260 22715 gene locus_tag LOCUS_12660 23260 22715 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041381.1 protein_id gnl|my_center|LOCUS_12660 23846 23451 gene locus_tag LOCUS_12670 23846 23451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 25590 23908 gene locus_tag LOCUS_12680 25590 23908 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence032 1358 216 gene locus_tag LOCUS_12690 1358 216 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101803.1 protein_id gnl|my_center|LOCUS_12690 3012 1582 gene locus_tag LOCUS_12700 3012 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 3969 3115 gene locus_tag LOCUS_12710 3969 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 4265 3996 gene locus_tag LOCUS_12720 4265 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 4719 4270 gene locus_tag LOCUS_12730 4719 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 4870 5067 gene locus_tag LOCUS_12740 4870 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 5336 5533 gene locus_tag LOCUS_12750 5336 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 5626 5961 gene locus_tag LOCUS_12760 5626 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 5948 6172 gene locus_tag LOCUS_12770 5948 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 6175 7488 gene locus_tag LOCUS_12780 6175 7488 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922059.1 protein_id gnl|my_center|LOCUS_12780 7488 8543 gene locus_tag LOCUS_12790 7488 8543 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922060.1 protein_id gnl|my_center|LOCUS_12790 8556 9023 gene locus_tag LOCUS_12800 8556 9023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 9023 10630 gene locus_tag LOCUS_12810 9023 10630 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922064.1 protein_id gnl|my_center|LOCUS_12810 10633 12837 gene locus_tag LOCUS_12820 10633 12837 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922066.1 protein_id gnl|my_center|LOCUS_12820 13085 13351 gene locus_tag LOCUS_12830 13085 13351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 13335 13736 gene locus_tag LOCUS_12840 13335 13736 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922068.1 protein_id gnl|my_center|LOCUS_12840 13748 13927 gene locus_tag LOCUS_12850 13748 13927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 13899 14096 gene locus_tag LOCUS_12860 13899 14096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 14089 14586 gene locus_tag LOCUS_12870 14089 14586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 14622 14831 gene locus_tag LOCUS_12880 14622 14831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 14831 15190 gene locus_tag LOCUS_12890 14831 15190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 15376 16506 gene locus_tag LOCUS_12900 15376 16506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 16685 16804 gene locus_tag LOCUS_12910 16685 16804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 16823 17248 gene locus_tag LOCUS_12920 16823 17248 CDS product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905043.1 protein_id gnl|my_center|LOCUS_12920 17241 18518 gene locus_tag LOCUS_12930 17241 18518 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047636.1 protein_id gnl|my_center|LOCUS_12930 18531 19934 gene locus_tag LOCUS_12940 18531 19934 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674652.1 protein_id gnl|my_center|LOCUS_12940 19982 21019 gene locus_tag LOCUS_12950 19982 21019 CDS product minor capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928179.1 protein_id gnl|my_center|LOCUS_12950 21083 21298 gene locus_tag LOCUS_12960 21083 21298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 21305 21460 gene locus_tag LOCUS_12970 21305 21460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 21548 22177 gene locus_tag LOCUS_12980 21548 22177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 22194 23048 gene locus_tag LOCUS_12990 22194 23048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889358.1 protein_id gnl|my_center|LOCUS_12990 23064 23369 gene locus_tag LOCUS_13000 23064 23369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 23372 23686 gene locus_tag LOCUS_13010 23372 23686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 23667 23978 gene locus_tag LOCUS_13020 23667 23978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 23975 24508 gene locus_tag LOCUS_13030 23975 24508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 24505 24864 gene locus_tag LOCUS_13040 24505 24864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 24882 25304 gene locus_tag LOCUS_13050 24882 25304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 25314 25466 gene locus_tag LOCUS_13060 25314 25466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence033 11 86 gene locus_tag LOCUS_t00100 11 86 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 113 188 gene locus_tag LOCUS_t00110 113 188 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 243 638 gene locus_tag LOCUS_13070 243 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 2015 672 gene locus_tag LOCUS_13080 gene gdhA 2015 672 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020063.1 protein_id gnl|my_center|LOCUS_13080 2309 7447 gene locus_tag LOCUS_13090 2309 7447 CDS product beta-N-acetylglucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390210.1 protein_id gnl|my_center|LOCUS_13090 7727 8704 gene locus_tag LOCUS_13100 7727 8704 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129881652.1 protein_id gnl|my_center|LOCUS_13100 8697 9323 gene locus_tag LOCUS_13110 gene hisG 8697 9323 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131107.1 protein_id gnl|my_center|LOCUS_13110 9326 10624 gene locus_tag LOCUS_13120 gene hisD 9326 10624 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038603405.1 protein_id gnl|my_center|LOCUS_13120 10626 11213 gene locus_tag LOCUS_13130 gene hisB 10626 11213 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436680.1 protein_id gnl|my_center|LOCUS_13130 11235 11843 gene locus_tag LOCUS_13140 gene hisH 11235 11843 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905832.1 protein_id gnl|my_center|LOCUS_13140 11837 12562 gene locus_tag LOCUS_13150 gene hisA 11837 12562 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012897810.1 protein_id gnl|my_center|LOCUS_13150 12544 13308 gene locus_tag LOCUS_13160 gene hisF 12544 13308 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017864484.1 protein_id gnl|my_center|LOCUS_13160 13308 13946 gene locus_tag LOCUS_13170 gene hisIE 13308 13946 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131119.1 protein_id gnl|my_center|LOCUS_13170 13948 14736 gene locus_tag LOCUS_13180 13948 14736 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131121.1 protein_id gnl|my_center|LOCUS_13180 14736 15179 gene locus_tag LOCUS_13190 14736 15179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 15326 15715 gene locus_tag LOCUS_13200 15326 15715 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477396.1 protein_id gnl|my_center|LOCUS_13200 16397 15771 gene locus_tag LOCUS_13210 16397 15771 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052627.1 protein_id gnl|my_center|LOCUS_13210 17964 16633 gene locus_tag LOCUS_13220 17964 16633 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861931.1 protein_id gnl|my_center|LOCUS_13220 18045 18857 gene locus_tag LOCUS_13230 18045 18857 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895974.1 protein_id gnl|my_center|LOCUS_13230 20053 19133 gene locus_tag LOCUS_13240 20053 19133 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965842.1 protein_id gnl|my_center|LOCUS_13240 20184 20933 gene locus_tag LOCUS_13250 20184 20933 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132534.1 protein_id gnl|my_center|LOCUS_13250 21835 20939 gene locus_tag LOCUS_13260 21835 20939 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_13260 22017 24428 gene locus_tag LOCUS_13270 22017 24428 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922724.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence034 3800 3024 gene locus_tag LOCUS_13280 3800 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 3889 5070 gene locus_tag LOCUS_13290 3889 5070 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948530.1 protein_id gnl|my_center|LOCUS_13290 6122 5097 gene locus_tag LOCUS_13300 gene rfbB 6122 5097 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_13300 6698 6123 gene locus_tag LOCUS_13310 gene rfbC 6698 6123 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286442.1 protein_id gnl|my_center|LOCUS_13310 7593 6712 gene locus_tag LOCUS_13320 gene rfbA 7593 6712 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857520.1 protein_id gnl|my_center|LOCUS_13320 7730 8584 gene locus_tag LOCUS_13330 7730 8584 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935357.1 protein_id gnl|my_center|LOCUS_13330 10373 8937 gene locus_tag LOCUS_13340 10373 8937 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898068.1 protein_id gnl|my_center|LOCUS_13340 12070 10562 gene locus_tag LOCUS_13350 12070 10562 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064987.1 protein_id gnl|my_center|LOCUS_13350 14241 12736 gene locus_tag LOCUS_13360 14241 12736 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064987.1 protein_id gnl|my_center|LOCUS_13360 14525 15340 gene locus_tag LOCUS_13370 gene spo0A 14525 15340 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110369.1 protein_id gnl|my_center|LOCUS_13370 16672 15932 gene locus_tag LOCUS_13380 gene spo0A 16672 15932 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358896.1 protein_id gnl|my_center|LOCUS_13380 17633 16986 gene locus_tag LOCUS_13390 17633 16986 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016483.1 protein_id gnl|my_center|LOCUS_13390 17802 18407 gene locus_tag LOCUS_13400 17802 18407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 20400 18466 gene locus_tag LOCUS_13410 gene metG 20400 18466 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_13410 <24099 22824 gene locus_tag LOCUS_13420 <24099 22824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003733946.1:peptidoglycan N-acetylglucosamine deacetylase PgdA >Feature sequence035 105 401 gene locus_tag LOCUS_13430 105 401 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963363.1 protein_id gnl|my_center|LOCUS_13430 388 1989 gene locus_tag LOCUS_13440 388 1989 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051558.1 protein_id gnl|my_center|LOCUS_13440 2009 3175 gene locus_tag LOCUS_13450 2009 3175 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957226.1 protein_id gnl|my_center|LOCUS_13450 5200 3383 gene locus_tag LOCUS_13460 gene glmS 5200 3383 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_13460 6403 5603 gene locus_tag LOCUS_13470 6403 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056248.1 protein_id gnl|my_center|LOCUS_13470 6826 6554 gene locus_tag LOCUS_13480 6826 6554 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_13480 7036 8301 gene locus_tag LOCUS_13490 7036 8301 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_13490 9621 8518 gene locus_tag LOCUS_13500 9621 8518 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359094.1 protein_id gnl|my_center|LOCUS_13500 10280 9675 gene locus_tag LOCUS_13510 10280 9675 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831017.1 protein_id gnl|my_center|LOCUS_13510 10794 10252 gene locus_tag LOCUS_13520 gene cysE 10794 10252 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285050.1 protein_id gnl|my_center|LOCUS_13520 11218 11505 gene locus_tag LOCUS_13530 11218 11505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 12745 11531 gene locus_tag LOCUS_13540 12745 11531 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272771.1 protein_id gnl|my_center|LOCUS_13540 13989 12757 gene locus_tag LOCUS_13550 13989 12757 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_13550 15707 14043 gene locus_tag LOCUS_13560 15707 14043 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913630.1 protein_id gnl|my_center|LOCUS_13560 16699 15725 gene locus_tag LOCUS_13570 16699 15725 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519085.1 protein_id gnl|my_center|LOCUS_13570 17713 16703 gene locus_tag LOCUS_13580 17713 16703 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966904.1 protein_id gnl|my_center|LOCUS_13580 18664 17729 gene locus_tag LOCUS_13590 18664 17729 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966900.1 protein_id gnl|my_center|LOCUS_13590 19593 18676 gene locus_tag LOCUS_13600 19593 18676 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_13600 20352 19819 gene locus_tag LOCUS_13610 20352 19819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 20932 20345 gene locus_tag LOCUS_13620 20932 20345 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889235.1 protein_id gnl|my_center|LOCUS_13620 21121 22329 gene locus_tag LOCUS_13630 gene pepT 21121 22329 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_13630 22334 23230 gene locus_tag LOCUS_13640 22334 23230 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977671.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence036 <1 1117 gene locus_tag LOCUS_13650 <1 1117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002262240.1:AI-2E family transporter 1244 1957 gene locus_tag LOCUS_13660 1244 1957 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889773.1 protein_id gnl|my_center|LOCUS_13660 1950 3551 gene locus_tag LOCUS_13670 1950 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 3926 4963 gene locus_tag LOCUS_13680 gene argC 3926 4963 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851634.1 protein_id gnl|my_center|LOCUS_13680 4975 6198 gene locus_tag LOCUS_13690 gene argJ 4975 6198 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965687.1 protein_id gnl|my_center|LOCUS_13690 6213 7076 gene locus_tag LOCUS_13700 gene argB 6213 7076 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864194.1 protein_id gnl|my_center|LOCUS_13700 7937 7119 gene locus_tag LOCUS_13710 7937 7119 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026257.1 protein_id gnl|my_center|LOCUS_13710 9706 7934 gene locus_tag LOCUS_13720 gene rnjA 9706 7934 CDS product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670368.1 protein_id gnl|my_center|LOCUS_13720 10649 9783 gene locus_tag LOCUS_13730 gene fakB2 10649 9783 CDS product fatty acid kinase binding subunit FakB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166063.1 protein_id gnl|my_center|LOCUS_13730 10827 11192 gene locus_tag LOCUS_13740 gene ytrA 10827 11192 CDS product GntR family transcriptional regulator YtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229121.1 protein_id gnl|my_center|LOCUS_13740 11192 12094 gene locus_tag LOCUS_13750 11192 12094 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_13750 12069 13916 gene locus_tag LOCUS_13760 12069 13916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 13918 15402 gene locus_tag LOCUS_13770 13918 15402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 15450 15755 gene locus_tag LOCUS_13780 gene trxA 15450 15755 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453775.1 protein_id gnl|my_center|LOCUS_13780 15860 16477 gene locus_tag LOCUS_13790 15860 16477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 16634 17938 gene locus_tag LOCUS_13800 16634 17938 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_13800 18333 18001 gene locus_tag LOCUS_13810 18333 18001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 18481 19662 gene locus_tag LOCUS_13820 18481 19662 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392901.1 protein_id gnl|my_center|LOCUS_13820 19743 21191 gene locus_tag LOCUS_13830 19743 21191 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964065.1 protein_id gnl|my_center|LOCUS_13830 21399 22082 gene locus_tag LOCUS_13840 21399 22082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence037 314 120 gene locus_tag LOCUS_13850 314 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 492 1175 gene locus_tag LOCUS_13860 gene ftsE 492 1175 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292768.1 protein_id gnl|my_center|LOCUS_13860 1175 2086 gene locus_tag LOCUS_13870 gene ftsX 1175 2086 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732506.1 protein_id gnl|my_center|LOCUS_13870 2141 2815 gene locus_tag LOCUS_13880 2141 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 2827 4185 gene locus_tag LOCUS_13890 2827 4185 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382305.1 protein_id gnl|my_center|LOCUS_13890 5967 4192 gene locus_tag LOCUS_13900 5967 4192 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861202.1 protein_id gnl|my_center|LOCUS_13900 6097 6375 gene locus_tag LOCUS_13910 6097 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 6644 7054 gene locus_tag LOCUS_13920 6644 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 7058 8188 gene locus_tag LOCUS_13930 7058 8188 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706825.1 protein_id gnl|my_center|LOCUS_13930 8175 11201 gene locus_tag LOCUS_13940 8175 11201 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247465.1 protein_id gnl|my_center|LOCUS_13940 11255 12694 gene locus_tag LOCUS_13950 gene proS 11255 12694 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040960.1 protein_id gnl|my_center|LOCUS_13950 12877 14229 gene locus_tag LOCUS_13960 12877 14229 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948764.1 protein_id gnl|my_center|LOCUS_13960 14845 14246 gene locus_tag LOCUS_13970 14845 14246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 14987 15805 gene locus_tag LOCUS_13980 14987 15805 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428191.1 protein_id gnl|my_center|LOCUS_13980 15819 16463 gene locus_tag LOCUS_13990 15819 16463 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_13990 16520 17254 gene locus_tag LOCUS_14000 16520 17254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 17303 17707 gene locus_tag LOCUS_14010 17303 17707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 17781 19097 gene locus_tag LOCUS_14020 17781 19097 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902205.1 protein_id gnl|my_center|LOCUS_14020 19579 19118 gene locus_tag LOCUS_14030 19579 19118 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890655.1 protein_id gnl|my_center|LOCUS_14030 19693 20451 gene locus_tag LOCUS_14040 19693 20451 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_14040 <21094 20509 gene locus_tag LOCUS_14050 <21094 20509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009930606.1:sodium-dependent transporter >Feature sequence038 21 96 gene locus_tag LOCUS_t00120 21 96 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 154 227 gene locus_tag LOCUS_t00130 154 227 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1518 592 gene locus_tag LOCUS_14060 1518 592 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810429.1 protein_id gnl|my_center|LOCUS_14060 2702 2334 gene locus_tag LOCUS_14070 2702 2334 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256528.1 protein_id gnl|my_center|LOCUS_14070 3594 2758 gene locus_tag LOCUS_14080 3594 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 4226 3579 gene locus_tag LOCUS_14090 4226 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 5721 4312 gene locus_tag LOCUS_14100 5721 4312 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091276.1 protein_id gnl|my_center|LOCUS_14100 6298 5765 gene locus_tag LOCUS_14110 6298 5765 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_14110 7697 6291 gene locus_tag LOCUS_14120 gene sufB 7697 6291 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484542.1 protein_id gnl|my_center|LOCUS_14120 8136 7708 gene locus_tag LOCUS_14130 gene sufU 8136 7708 CDS product iron-sulfur cluster assembly scaffold protein SufU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009523.1 protein_id gnl|my_center|LOCUS_14130 9346 8120 gene locus_tag LOCUS_14140 9346 8120 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824500.1 protein_id gnl|my_center|LOCUS_14140 10239 9346 gene locus_tag LOCUS_14150 10239 9346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 11054 10239 gene locus_tag LOCUS_14160 gene sufC 11054 10239 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929158.1 protein_id gnl|my_center|LOCUS_14160 11220 12299 gene locus_tag LOCUS_14170 11220 12299 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627795.1 protein_id gnl|my_center|LOCUS_14170 12645 13640 gene locus_tag LOCUS_14180 12645 13640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 13640 14497 gene locus_tag LOCUS_14190 13640 14497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 14571 14975 gene locus_tag LOCUS_14200 14571 14975 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254651.1 protein_id gnl|my_center|LOCUS_14200 16125 15181 gene locus_tag LOCUS_14210 gene yhaM 16125 15181 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456351.1 protein_id gnl|my_center|LOCUS_14210 18106 16118 gene locus_tag LOCUS_14220 18106 16118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 19139 18117 gene locus_tag LOCUS_14230 19139 18117 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966298.1 protein_id gnl|my_center|LOCUS_14230 20158 19151 gene locus_tag LOCUS_14240 gene bgsA 20158 19151 CDS product cell wall glycolipid biosynthesis glucosyltransferase BgsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359375.1 protein_id gnl|my_center|LOCUS_14240 >Feature sequence039 761 117 gene locus_tag LOCUS_14250 761 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1752 763 gene locus_tag LOCUS_14260 1752 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 2749 1769 gene locus_tag LOCUS_14270 gene ansB 2749 1769 CDS product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652322.1 protein_id gnl|my_center|LOCUS_14270 5499 2833 gene locus_tag LOCUS_14280 gene ppdK 5499 2833 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_14280 7317 5719 gene locus_tag LOCUS_14290 7317 5719 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987080.1 protein_id gnl|my_center|LOCUS_14290 7790 7512 gene locus_tag LOCUS_14300 7790 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14300 8050 7754 gene locus_tag LOCUS_14310 8050 7754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14310 9074 8247 gene locus_tag LOCUS_14320 9074 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 9876 9091 gene locus_tag LOCUS_14330 9876 9091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 12662 9936 gene locus_tag LOCUS_14340 12662 9936 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808733.1 protein_id gnl|my_center|LOCUS_14340 12835 13221 gene locus_tag LOCUS_14350 gene mutT 12835 13221 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_14350 13224 16085 gene locus_tag LOCUS_14360 13224 16085 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948376.1 protein_id gnl|my_center|LOCUS_14360 16578 16117 gene locus_tag LOCUS_14370 16578 16117 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068139.1 protein_id gnl|my_center|LOCUS_14370 16690 17073 gene locus_tag LOCUS_14380 16690 17073 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812273.1 protein_id gnl|my_center|LOCUS_14380 17124 18671 gene locus_tag LOCUS_14390 17124 18671 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861711.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence040 <1 585 gene locus_tag LOCUS_14400 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003733946.1:peptidoglycan N-acetylglucosamine deacetylase PgdA 2083 635 gene locus_tag LOCUS_14410 2083 635 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002037436.1 protein_id gnl|my_center|LOCUS_14410 2976 2143 gene locus_tag LOCUS_14420 2976 2143 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134266418.1 protein_id gnl|my_center|LOCUS_14420 4052 3087 gene locus_tag LOCUS_14430 4052 3087 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715345.1 protein_id gnl|my_center|LOCUS_14430 4973 4152 gene locus_tag LOCUS_14440 4973 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 5337 5098 gene locus_tag LOCUS_14450 5337 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 11930 5466 gene locus_tag LOCUS_14460 11930 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 18892 13670 gene locus_tag LOCUS_14470 18892 13670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence041 1869 451 gene locus_tag LOCUS_14480 1869 451 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461659.1 protein_id gnl|my_center|LOCUS_14480 2107 3513 gene locus_tag LOCUS_14490 2107 3513 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356603.1 protein_id gnl|my_center|LOCUS_14490 3871 3599 gene locus_tag LOCUS_14500 3871 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 4308 4078 gene locus_tag LOCUS_14510 gene rpsR 4308 4078 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831354.1 protein_id gnl|my_center|LOCUS_14510 4793 4326 gene locus_tag LOCUS_14520 gene ssb 4793 4326 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934799.1 protein_id gnl|my_center|LOCUS_14520 5090 4809 gene locus_tag LOCUS_14530 gene rpsF 5090 4809 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233779.1 protein_id gnl|my_center|LOCUS_14530 5872 5237 gene locus_tag LOCUS_14540 gene ispD 5872 5237 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 protein_id gnl|my_center|LOCUS_14540 6043 6906 gene locus_tag LOCUS_14550 6043 6906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 9061 7070 gene locus_tag LOCUS_14560 9061 7070 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172629.1 protein_id gnl|my_center|LOCUS_14560 9529 9167 gene locus_tag LOCUS_14570 9529 9167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 9601 10290 gene locus_tag LOCUS_14580 9601 10290 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186843528.1 protein_id gnl|my_center|LOCUS_14580 10863 10732 gene locus_tag LOCUS_14590 10863 10732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 11407 10847 gene locus_tag LOCUS_14600 11407 10847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 12707 11481 gene locus_tag LOCUS_14610 12707 11481 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185847435.1 protein_id gnl|my_center|LOCUS_14610 13399 12704 gene locus_tag LOCUS_14620 13399 12704 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_14620 14799 13492 gene locus_tag LOCUS_14630 gene lysA 14799 13492 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398851.1 protein_id gnl|my_center|LOCUS_14630 15562 14819 gene locus_tag LOCUS_14640 gene dapB 15562 14819 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438808.1 protein_id gnl|my_center|LOCUS_14640 16614 15721 gene locus_tag LOCUS_14650 gene dapA 16614 15721 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880718.1 protein_id gnl|my_center|LOCUS_14650 17094 16624 gene locus_tag LOCUS_14660 17094 16624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 17872 17702 gene locus_tag LOCUS_14670 17872 17702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 18845 17886 gene locus_tag LOCUS_14680 18845 17886 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895213.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence042 273 348 gene locus_tag LOCUS_t00140 273 348 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 405 872 gene locus_tag LOCUS_14690 405 872 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869083.1 protein_id gnl|my_center|LOCUS_14690 976 4170 gene locus_tag LOCUS_14700 976 4170 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016952.1 protein_id gnl|my_center|LOCUS_14700 5193 4198 gene locus_tag LOCUS_14710 5193 4198 CDS product PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903941.1 protein_id gnl|my_center|LOCUS_14710 5334 5259 gene locus_tag LOCUS_t00150 5334 5259 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5428 5352 gene locus_tag LOCUS_t00160 5428 5352 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 6933 6214 gene locus_tag LOCUS_14720 6933 6214 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458906.1 protein_id gnl|my_center|LOCUS_14720 8330 6978 gene locus_tag LOCUS_14730 8330 6978 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021210.1 protein_id gnl|my_center|LOCUS_14730 9017 8391 gene locus_tag LOCUS_14740 9017 8391 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548076.1 protein_id gnl|my_center|LOCUS_14740 9558 9031 gene locus_tag LOCUS_14750 9558 9031 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108270.1 protein_id gnl|my_center|LOCUS_14750 10195 9638 gene locus_tag LOCUS_14760 10195 9638 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583215.1 protein_id gnl|my_center|LOCUS_14760 11252 10767 gene locus_tag LOCUS_14770 11252 10767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 11726 11472 gene locus_tag LOCUS_14780 11726 11472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14780 12242 11850 gene locus_tag LOCUS_14790 gene rpsI 12242 11850 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_14790 12697 12260 gene locus_tag LOCUS_14800 gene rplM 12697 12260 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906417.1 protein_id gnl|my_center|LOCUS_14800 13593 12853 gene locus_tag LOCUS_14810 13593 12853 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966927.1 protein_id gnl|my_center|LOCUS_14810 13835 13593 gene locus_tag LOCUS_14820 13835 13593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 14521 13835 gene locus_tag LOCUS_14830 14521 13835 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_14830 14650 14883 gene locus_tag LOCUS_14840 14650 14883 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_14840 15810 14917 gene locus_tag LOCUS_14850 gene thrB 15810 14917 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986279.1 protein_id gnl|my_center|LOCUS_14850 17303 15819 gene locus_tag LOCUS_14860 gene thrC 17303 15819 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434031.1 protein_id gnl|my_center|LOCUS_14860 17634 18788 gene locus_tag LOCUS_14870 17634 18788 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence043 3425 4252 gene locus_tag LOCUS_14880 3425 4252 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453971.1 protein_id gnl|my_center|LOCUS_14880 4334 5923 gene locus_tag LOCUS_14890 4334 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 11358 6070 gene locus_tag LOCUS_14900 11358 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 16542 11797 gene locus_tag LOCUS_14910 16542 11797 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390216.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence044 912 1457 gene locus_tag LOCUS_14920 912 1457 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_14920 2302 1517 gene locus_tag LOCUS_14930 gene thiD 2302 1517 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_14930 2578 2745 gene locus_tag LOCUS_14940 2578 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 3874 3224 gene locus_tag LOCUS_14950 3874 3224 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_14950 4509 3871 gene locus_tag LOCUS_14960 gene thiE 4509 3871 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_14960 5317 4496 gene locus_tag LOCUS_14970 gene thiM 5317 4496 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_14970 5667 8231 gene locus_tag LOCUS_14980 gene clpB 5667 8231 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_14980 8321 9139 gene locus_tag LOCUS_14990 8321 9139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 9221 9961 gene locus_tag LOCUS_15000 9221 9961 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190167.1 protein_id gnl|my_center|LOCUS_15000 9958 10725 gene locus_tag LOCUS_15010 9958 10725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 10734 12020 gene locus_tag LOCUS_15020 gene mtaB 10734 12020 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230017.1 protein_id gnl|my_center|LOCUS_15020 12020 13474 gene locus_tag LOCUS_15030 12020 13474 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245326.1 protein_id gnl|my_center|LOCUS_15030 14270 13572 gene locus_tag LOCUS_15040 14270 13572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 14720 16972 gene locus_tag LOCUS_15050 gene pflB 14720 16972 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_15050 17062 17811 gene locus_tag LOCUS_15060 gene pflA 17062 17811 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357530.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence045 199 111 gene locus_tag LOCUS_t00170 199 111 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 280 206 gene locus_tag LOCUS_t00180 280 206 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2316 466 gene locus_tag LOCUS_15070 2316 466 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948299.1 protein_id gnl|my_center|LOCUS_15070 3151 2294 gene locus_tag LOCUS_15080 3151 2294 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808911.1 protein_id gnl|my_center|LOCUS_15080 4194 3151 gene locus_tag LOCUS_15090 4194 3151 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_15090 4736 4203 gene locus_tag LOCUS_15100 4736 4203 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_15100 5909 5073 gene locus_tag LOCUS_15110 5909 5073 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_15110 6299 5919 gene locus_tag LOCUS_15120 6299 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 7780 6320 gene locus_tag LOCUS_15130 7780 6320 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965086.1 protein_id gnl|my_center|LOCUS_15130 8143 7844 gene locus_tag LOCUS_15140 8143 7844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 8497 8336 gene locus_tag LOCUS_15150 8497 8336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 9641 8544 gene locus_tag LOCUS_15160 9641 8544 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905635.1 protein_id gnl|my_center|LOCUS_15160 10832 9654 gene locus_tag LOCUS_15170 10832 9654 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905634.1 protein_id gnl|my_center|LOCUS_15170 13083 10867 gene locus_tag LOCUS_15180 13083 10867 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195718935.1 protein_id gnl|my_center|LOCUS_15180 13470 13084 gene locus_tag LOCUS_15190 gene tagD 13470 13084 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227921.1 protein_id gnl|my_center|LOCUS_15190 14307 13480 gene locus_tag LOCUS_15200 gene tagH 14307 13480 CDS product teichoic acids export ABC transporter ATP-binding subunit TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722702.1 protein_id gnl|my_center|LOCUS_15200 15138 14317 gene locus_tag LOCUS_15210 gene tagG 15138 14317 CDS product teichoic acids export ABC transporter permease subunit TagG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227928.1 protein_id gnl|my_center|LOCUS_15210 16086 15454 gene locus_tag LOCUS_15220 gene pyrE 16086 15454 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232105.1 protein_id gnl|my_center|LOCUS_15220 16806 16099 gene locus_tag LOCUS_15230 gene pyrF 16806 16099 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083500.1 protein_id gnl|my_center|LOCUS_15230 17553 16948 gene locus_tag LOCUS_15240 gene rpsD 17553 16948 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229304.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence046 121 681 gene locus_tag LOCUS_15250 121 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 719 2509 gene locus_tag LOCUS_15260 719 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 2511 3656 gene locus_tag LOCUS_15270 2511 3656 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242735.1 protein_id gnl|my_center|LOCUS_15270 3718 4914 gene locus_tag LOCUS_15280 3718 4914 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107242.1 protein_id gnl|my_center|LOCUS_15280 4917 6101 gene locus_tag LOCUS_15290 4917 6101 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203512.1 protein_id gnl|my_center|LOCUS_15290 6121 7293 gene locus_tag LOCUS_15300 6121 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 7286 8473 gene locus_tag LOCUS_15310 7286 8473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 8483 9613 gene locus_tag LOCUS_15320 8483 9613 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203004.1 protein_id gnl|my_center|LOCUS_15320 9613 11148 gene locus_tag LOCUS_15330 9613 11148 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101306.1 protein_id gnl|my_center|LOCUS_15330 11163 12164 gene locus_tag LOCUS_15340 11163 12164 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020707.1 protein_id gnl|my_center|LOCUS_15340 12168 13214 gene locus_tag LOCUS_15350 12168 13214 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107231.1 protein_id gnl|my_center|LOCUS_15350 13214 14410 gene locus_tag LOCUS_15360 13214 14410 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107232.1 protein_id gnl|my_center|LOCUS_15360 14416 15600 gene locus_tag LOCUS_15370 14416 15600 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107233.1 protein_id gnl|my_center|LOCUS_15370 15774 16199 gene locus_tag LOCUS_15380 15774 16199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15380 16463 16948 gene locus_tag LOCUS_15390 16463 16948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence047 105 359 gene locus_tag LOCUS_15400 105 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 374 742 gene locus_tag LOCUS_15410 374 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1009 3393 gene locus_tag LOCUS_15420 1009 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 3406 3771 gene locus_tag LOCUS_15430 3406 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 3774 5642 gene locus_tag LOCUS_15440 3774 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 5632 7395 gene locus_tag LOCUS_15450 5632 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 7403 10084 gene locus_tag LOCUS_15460 7403 10084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 10154 10792 gene locus_tag LOCUS_15470 10154 10792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 10785 11216 gene locus_tag LOCUS_15480 10785 11216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 11287 11508 gene locus_tag LOCUS_15490 11287 11508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 11512 11802 gene locus_tag LOCUS_15500 11512 11802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 11804 12067 gene locus_tag LOCUS_15510 11804 12067 CDS product DUF6275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386748.1 protein_id gnl|my_center|LOCUS_15510 12078 12293 gene locus_tag LOCUS_15520 12078 12293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 12296 12598 gene locus_tag LOCUS_15530 12296 12598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 12615 13712 gene locus_tag LOCUS_15540 12615 13712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 13712 13990 gene locus_tag LOCUS_15550 13712 13990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 15280 14024 gene locus_tag LOCUS_15560 15280 14024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 15374 15562 gene locus_tag LOCUS_15570 15374 15562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 16324 16414 gene locus_tag LOCUS_t00190 16324 16414 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 16422 16498 gene locus_tag LOCUS_t00200 16422 16498 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 17088 16555 gene locus_tag LOCUS_15580 gene nudF 17088 16555 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398600.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence048 <1 709 gene locus_tag LOCUS_15590 <1 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549276.1:branched-chain amino acid ABC transporter permease 702 1496 gene locus_tag LOCUS_15600 702 1496 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157662.1 protein_id gnl|my_center|LOCUS_15600 2145 1513 gene locus_tag LOCUS_15610 2145 1513 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233805.1 protein_id gnl|my_center|LOCUS_15610 2195 2554 gene locus_tag LOCUS_15620 2195 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 3076 2591 gene locus_tag LOCUS_15630 gene greA 3076 2591 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431312.1 protein_id gnl|my_center|LOCUS_15630 4425 3184 gene locus_tag LOCUS_15640 4425 3184 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229802.1 protein_id gnl|my_center|LOCUS_15640 5344 4409 gene locus_tag LOCUS_15650 5344 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 5952 5344 gene locus_tag LOCUS_15660 5952 5344 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389102.1 protein_id gnl|my_center|LOCUS_15660 7034 5943 gene locus_tag LOCUS_15670 gene mltG 7034 5943 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230083.1 protein_id gnl|my_center|LOCUS_15670 8524 7244 gene locus_tag LOCUS_15680 8524 7244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 9192 8731 gene locus_tag LOCUS_15690 9192 8731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15690 9908 9129 gene locus_tag LOCUS_15700 9908 9129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15700 10269 9949 gene locus_tag LOCUS_15710 10269 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 10576 10238 gene locus_tag LOCUS_15720 10576 10238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 10869 10696 gene locus_tag LOCUS_15730 10869 10696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 11360 11145 gene locus_tag LOCUS_15740 11360 11145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15740 11849 11412 gene locus_tag LOCUS_15750 11849 11412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15750 12162 11803 gene locus_tag LOCUS_15760 12162 11803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 12436 12164 gene locus_tag LOCUS_15770 12436 12164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 13336 12899 gene locus_tag LOCUS_15780 13336 12899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 13768 13349 gene locus_tag LOCUS_15790 gene ruvX 13768 13349 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939059.1 protein_id gnl|my_center|LOCUS_15790 14021 13770 gene locus_tag LOCUS_15800 14021 13770 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225903.1 protein_id gnl|my_center|LOCUS_15800 16691 14082 gene locus_tag LOCUS_15810 gene alaS 16691 14082 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130876.1 protein_id gnl|my_center|LOCUS_15810 >Feature sequence049 2290 1826 gene locus_tag LOCUS_15820 2290 1826 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434060.1 protein_id gnl|my_center|LOCUS_15820 3083 2280 gene locus_tag LOCUS_15830 3083 2280 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434058.1 protein_id gnl|my_center|LOCUS_15830 4490 3087 gene locus_tag LOCUS_15840 4490 3087 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869179.1 protein_id gnl|my_center|LOCUS_15840 5262 4501 gene locus_tag LOCUS_15850 5262 4501 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901765.1 protein_id gnl|my_center|LOCUS_15850 6254 5259 gene locus_tag LOCUS_15860 6254 5259 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024407.1 protein_id gnl|my_center|LOCUS_15860 7269 6256 gene locus_tag LOCUS_15870 7269 6256 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459528.1 protein_id gnl|my_center|LOCUS_15870 7795 7262 gene locus_tag LOCUS_15880 7795 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 8185 7883 gene locus_tag LOCUS_15890 8185 7883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 9174 8224 gene locus_tag LOCUS_15900 9174 8224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 9758 9372 gene locus_tag LOCUS_15910 9758 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 11166 9838 gene locus_tag LOCUS_15920 11166 9838 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_15920 11284 11793 gene locus_tag LOCUS_15930 11284 11793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 12775 11819 gene locus_tag LOCUS_15940 12775 11819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 13552 12902 gene locus_tag LOCUS_15950 13552 12902 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459560.1 protein_id gnl|my_center|LOCUS_15950 14399 13524 gene locus_tag LOCUS_15960 14399 13524 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_15960 14773 14402 gene locus_tag LOCUS_15970 14773 14402 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047976.1 protein_id gnl|my_center|LOCUS_15970 15167 14916 gene locus_tag LOCUS_15980 15167 14916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 16797 15442 gene locus_tag LOCUS_15990 16797 15442 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence050 1394 285 gene locus_tag LOCUS_16000 1394 285 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948743.1 protein_id gnl|my_center|LOCUS_16000 2122 1394 gene locus_tag LOCUS_16010 2122 1394 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016658.1 protein_id gnl|my_center|LOCUS_16010 2735 2115 gene locus_tag LOCUS_16020 2735 2115 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888558.1 protein_id gnl|my_center|LOCUS_16020 3590 2817 gene locus_tag LOCUS_16030 3590 2817 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261968.1 protein_id gnl|my_center|LOCUS_16030 4147 3899 gene locus_tag LOCUS_16040 4147 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 4260 5528 gene locus_tag LOCUS_16050 gene eno 4260 5528 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357098.1 protein_id gnl|my_center|LOCUS_16050 6375 5536 gene locus_tag LOCUS_16060 6375 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 7232 6381 gene locus_tag LOCUS_16070 7232 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 8956 7280 gene locus_tag LOCUS_16080 8956 7280 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390379.1 protein_id gnl|my_center|LOCUS_16080 11526 8989 gene locus_tag LOCUS_16090 11526 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 11897 12643 gene locus_tag LOCUS_16100 11897 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 12647 13993 gene locus_tag LOCUS_16110 12647 13993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 15748 14015 gene locus_tag LOCUS_16120 15748 14015 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129119821.1 protein_id gnl|my_center|LOCUS_16120 16173 16307 gene locus_tag LOCUS_16130 16173 16307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16130 16382 16978 gene locus_tag LOCUS_16140 16382 16978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence051 174 506 gene locus_tag LOCUS_16150 174 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16150 648 974 gene locus_tag LOCUS_16160 648 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16160 1869 1009 gene locus_tag LOCUS_16170 1869 1009 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722640.1 protein_id gnl|my_center|LOCUS_16170 3118 2150 gene locus_tag LOCUS_16180 3118 2150 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_16180 3308 3805 gene locus_tag LOCUS_16190 3308 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 3805 4302 gene locus_tag LOCUS_16200 3805 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 4454 5680 gene locus_tag LOCUS_16210 4454 5680 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476101.1 protein_id gnl|my_center|LOCUS_16210 5680 6306 gene locus_tag LOCUS_16220 5680 6306 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476100.1 protein_id gnl|my_center|LOCUS_16220 6309 7271 gene locus_tag LOCUS_16230 6309 7271 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_16230 7275 8486 gene locus_tag LOCUS_16240 7275 8486 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704930.1 protein_id gnl|my_center|LOCUS_16240 8488 9618 gene locus_tag LOCUS_16250 8488 9618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 9629 10165 gene locus_tag LOCUS_16260 9629 10165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 10162 11043 gene locus_tag LOCUS_16270 10162 11043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 11044 12261 gene locus_tag LOCUS_16280 11044 12261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 12264 13472 gene locus_tag LOCUS_16290 12264 13472 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203512.1 protein_id gnl|my_center|LOCUS_16290 13508 14422 gene locus_tag LOCUS_16300 13508 14422 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050431.1 protein_id gnl|my_center|LOCUS_16300 14419 15648 gene locus_tag LOCUS_16310 14419 15648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 15727 16854 gene locus_tag LOCUS_16320 15727 16854 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203004.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence052 1293 742 gene locus_tag LOCUS_16330 gene cobB2 1293 742 CDS product NAD-dependent protein deacylase Cob2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877626.1 protein_id gnl|my_center|LOCUS_16330 1443 1718 gene locus_tag LOCUS_16340 1443 1718 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461958.1 protein_id gnl|my_center|LOCUS_16340 1803 2807 gene locus_tag LOCUS_16350 1803 2807 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462034.1 protein_id gnl|my_center|LOCUS_16350 2980 3306 gene locus_tag LOCUS_16360 2980 3306 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272757.1 protein_id gnl|my_center|LOCUS_16360 3314 3703 gene locus_tag LOCUS_16370 3314 3703 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462027.1 protein_id gnl|my_center|LOCUS_16370 4102 3743 gene locus_tag LOCUS_16380 4102 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 4244 5050 gene locus_tag LOCUS_16390 4244 5050 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594617.1 protein_id gnl|my_center|LOCUS_16390 5931 5053 gene locus_tag LOCUS_16400 5931 5053 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680498.1 protein_id gnl|my_center|LOCUS_16400 6112 6879 gene locus_tag LOCUS_16410 6112 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 8816 7140 gene locus_tag LOCUS_16420 8816 7140 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861230.1 protein_id gnl|my_center|LOCUS_16420 9231 8800 gene locus_tag LOCUS_16430 9231 8800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 9496 9233 gene locus_tag LOCUS_16440 9496 9233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 10208 9486 gene locus_tag LOCUS_16450 10208 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 11385 10201 gene locus_tag LOCUS_16460 11385 10201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 14131 11441 gene locus_tag LOCUS_16470 14131 11441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 14393 14142 gene locus_tag LOCUS_16480 14393 14142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 14545 14396 gene locus_tag LOCUS_16490 14545 14396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 15056 16303 gene locus_tag LOCUS_16500 15056 16303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 16910 16587 gene locus_tag LOCUS_16510 16910 16587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16510 >Feature sequence053 100 510 gene locus_tag LOCUS_16520 100 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16520 501 1526 gene locus_tag LOCUS_16530 501 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16530 1544 2542 gene locus_tag LOCUS_16540 1544 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16540 3246 2572 gene locus_tag LOCUS_16550 3246 2572 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_16550 4033 3449 gene locus_tag LOCUS_16560 4033 3449 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550094.1 protein_id gnl|my_center|LOCUS_16560 4427 5542 gene locus_tag LOCUS_16570 4427 5542 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 protein_id gnl|my_center|LOCUS_16570 6208 5678 gene locus_tag LOCUS_16580 6208 5678 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355209.1 protein_id gnl|my_center|LOCUS_16580 6557 7972 gene locus_tag LOCUS_16590 6557 7972 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234506.1 protein_id gnl|my_center|LOCUS_16590 7974 8645 gene locus_tag LOCUS_16600 7974 8645 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933367.1 protein_id gnl|my_center|LOCUS_16600 8784 8993 gene locus_tag LOCUS_16610 8784 8993 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419939.1 protein_id gnl|my_center|LOCUS_16610 9022 9249 gene locus_tag LOCUS_16620 9022 9249 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427474.1 protein_id gnl|my_center|LOCUS_16620 9263 11443 gene locus_tag LOCUS_16630 gene feoB 9263 11443 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460242.1 protein_id gnl|my_center|LOCUS_16630 11483 11674 gene locus_tag LOCUS_16640 11483 11674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 11784 11948 gene locus_tag LOCUS_16650 11784 11948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 12039 12215 gene locus_tag LOCUS_16660 12039 12215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 12310 13143 gene locus_tag LOCUS_16670 12310 13143 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723815.1 protein_id gnl|my_center|LOCUS_16670 13480 15369 gene locus_tag LOCUS_16680 gene htpG 13480 15369 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243561.1 protein_id gnl|my_center|LOCUS_16680 15422 15958 gene locus_tag LOCUS_16690 15422 15958 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583273.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence054 398 733 gene locus_tag LOCUS_16700 398 733 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_16700 1945 1301 gene locus_tag LOCUS_16710 gene nth 1945 1301 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933034.1 protein_id gnl|my_center|LOCUS_16710 2531 1938 gene locus_tag LOCUS_16720 gene dnaD 2531 1938 CDS product DNA replication protein DnaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728542.1 protein_id gnl|my_center|LOCUS_16720 2950 2537 gene locus_tag LOCUS_16730 2950 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 3845 3138 gene locus_tag LOCUS_16740 3845 3138 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047881.1 protein_id gnl|my_center|LOCUS_16740 4592 4320 gene locus_tag LOCUS_16750 4592 4320 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640587.1 protein_id gnl|my_center|LOCUS_16750 6132 4657 gene locus_tag LOCUS_16760 gene spoIVA 6132 4657 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416519.1 protein_id gnl|my_center|LOCUS_16760 6271 7431 gene locus_tag LOCUS_16770 6271 7431 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222697.1 protein_id gnl|my_center|LOCUS_16770 8978 7548 gene locus_tag LOCUS_16780 gene pyk 8978 7548 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830831.1 protein_id gnl|my_center|LOCUS_16780 9886 9431 gene locus_tag LOCUS_16790 9886 9431 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949083.1 protein_id gnl|my_center|LOCUS_16790 9994 10743 gene locus_tag LOCUS_16800 9994 10743 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_16800 10745 11200 gene locus_tag LOCUS_16810 10745 11200 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965564.1 protein_id gnl|my_center|LOCUS_16810 11197 12336 gene locus_tag LOCUS_16820 11197 12336 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244707.1 protein_id gnl|my_center|LOCUS_16820 14892 12502 gene locus_tag LOCUS_16830 gene pheT 14892 12502 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498183.1 protein_id gnl|my_center|LOCUS_16830 15934 14897 gene locus_tag LOCUS_16840 gene pheS 15934 14897 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398818.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence055 2462 588 gene locus_tag LOCUS_16850 2462 588 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860670.1 protein_id gnl|my_center|LOCUS_16850 7214 2586 gene locus_tag LOCUS_16860 7214 2586 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390216.1 protein_id gnl|my_center|LOCUS_16860 8490 7627 gene locus_tag LOCUS_16870 8490 7627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 9014 8499 gene locus_tag LOCUS_16880 9014 8499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 10531 9014 gene locus_tag LOCUS_16890 gene gpmI 10531 9014 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228330.1 protein_id gnl|my_center|LOCUS_16890 10814 10629 gene locus_tag LOCUS_16900 10814 10629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 11202 10864 gene locus_tag LOCUS_16910 11202 10864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 11806 11222 gene locus_tag LOCUS_16920 11806 11222 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294657.1 protein_id gnl|my_center|LOCUS_16920 12270 11839 gene locus_tag LOCUS_16930 12270 11839 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261614.1 protein_id gnl|my_center|LOCUS_16930 12372 12530 gene locus_tag LOCUS_16940 12372 12530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 13996 12788 gene locus_tag LOCUS_16950 13996 12788 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964048.1 protein_id gnl|my_center|LOCUS_16950 14750 14013 gene locus_tag LOCUS_16960 14750 14013 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674428.1 protein_id gnl|my_center|LOCUS_16960 15223 15299 gene locus_tag LOCUS_t00210 15223 15299 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15915 15496 gene locus_tag LOCUS_16970 15915 15496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence056 94 681 gene locus_tag LOCUS_16980 94 681 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886588.1 protein_id gnl|my_center|LOCUS_16980 681 1190 gene locus_tag LOCUS_16990 gene trmL 681 1190 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538147.1 protein_id gnl|my_center|LOCUS_16990 1180 1830 gene locus_tag LOCUS_17000 1180 1830 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437518.1 protein_id gnl|my_center|LOCUS_17000 2515 1820 gene locus_tag LOCUS_17010 2515 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 2924 3331 gene locus_tag LOCUS_17020 2924 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111796.1 protein_id gnl|my_center|LOCUS_17020 3477 3896 gene locus_tag LOCUS_17030 3477 3896 CDS product DUF2871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111798.1 protein_id gnl|my_center|LOCUS_17030 4718 4134 gene locus_tag LOCUS_17040 4718 4134 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397458.1 protein_id gnl|my_center|LOCUS_17040 5121 4720 gene locus_tag LOCUS_17050 5121 4720 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_17050 6117 5203 gene locus_tag LOCUS_17060 gene ylbJ 6117 5203 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273082.1 protein_id gnl|my_center|LOCUS_17060 6175 7401 gene locus_tag LOCUS_17070 gene hflX 6175 7401 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393283.1 protein_id gnl|my_center|LOCUS_17070 7415 7600 gene locus_tag LOCUS_17080 7415 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 7651 8640 gene locus_tag LOCUS_17090 gene argF 7651 8640 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861433.1 protein_id gnl|my_center|LOCUS_17090 8735 9481 gene locus_tag LOCUS_17100 8735 9481 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821961.1 protein_id gnl|my_center|LOCUS_17100 10171 9503 gene locus_tag LOCUS_17110 10171 9503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 10790 10284 gene locus_tag LOCUS_17120 10790 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 11976 10891 gene locus_tag LOCUS_17130 11976 10891 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021367800.1 protein_id gnl|my_center|LOCUS_17130 12658 11969 gene locus_tag LOCUS_17140 gene vanR 12658 11969 CDS product vancomycin resistance response regulator transcriptoin factor VanR-G-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436401.1 protein_id gnl|my_center|LOCUS_17140 14146 12755 gene locus_tag LOCUS_17150 gene argH 14146 12755 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_17150 15391 14177 gene locus_tag LOCUS_17160 15391 14177 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_17160 >Feature sequence057 90 3116 gene locus_tag LOCUS_17170 90 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17170 3252 5771 gene locus_tag LOCUS_17180 3252 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17180 5995 7767 gene locus_tag LOCUS_17190 5995 7767 CDS product mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861961.1 protein_id gnl|my_center|LOCUS_17190 7962 9422 gene locus_tag LOCUS_17200 7962 9422 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918342.1 protein_id gnl|my_center|LOCUS_17200 9673 10872 gene locus_tag LOCUS_17210 9673 10872 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_17210 10862 11614 gene locus_tag LOCUS_17220 10862 11614 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 protein_id gnl|my_center|LOCUS_17220 11615 12820 gene locus_tag LOCUS_17230 11615 12820 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529926.1 protein_id gnl|my_center|LOCUS_17230 15008 13161 gene locus_tag LOCUS_17240 15008 13161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence058 405 136 gene locus_tag LOCUS_17250 405 136 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831726.1 protein_id gnl|my_center|LOCUS_17250 1222 566 gene locus_tag LOCUS_17260 1222 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2739 1219 gene locus_tag LOCUS_17270 2739 1219 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225543.1 protein_id gnl|my_center|LOCUS_17270 3520 2732 gene locus_tag LOCUS_17280 3520 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 4776 3733 gene locus_tag LOCUS_17290 4776 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 6202 4781 gene locus_tag LOCUS_17300 6202 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 6559 6344 gene locus_tag LOCUS_17310 6559 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 8539 6722 gene locus_tag LOCUS_17320 gene typA 8539 6722 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232278.1 protein_id gnl|my_center|LOCUS_17320 9224 8610 gene locus_tag LOCUS_17330 9224 8610 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687254.1 protein_id gnl|my_center|LOCUS_17330 11273 9294 gene locus_tag LOCUS_17340 11273 9294 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986650.1 protein_id gnl|my_center|LOCUS_17340 12027 11260 gene locus_tag LOCUS_17350 12027 11260 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_17350 13105 12101 gene locus_tag LOCUS_17360 13105 12101 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_17360 13785 13102 gene locus_tag LOCUS_17370 13785 13102 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_17370 14437 13778 gene locus_tag LOCUS_17380 14437 13778 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922292.1 protein_id gnl|my_center|LOCUS_17380 14924 14508 gene locus_tag LOCUS_17390 14924 14508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence059 30 230 gene locus_tag LOCUS_17400 30 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 682 245 gene locus_tag LOCUS_17410 682 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 1520 675 gene locus_tag LOCUS_17420 1520 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 3109 1673 gene locus_tag LOCUS_17430 gene pyk 3109 1673 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714110.1 protein_id gnl|my_center|LOCUS_17430 4106 3147 gene locus_tag LOCUS_17440 gene pfkA 4106 3147 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706225.1 protein_id gnl|my_center|LOCUS_17440 5119 4214 gene locus_tag LOCUS_17450 gene dnaI 5119 4214 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355760.1 protein_id gnl|my_center|LOCUS_17450 6373 5129 gene locus_tag LOCUS_17460 6373 5129 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415039.1 protein_id gnl|my_center|LOCUS_17460 6945 6376 gene locus_tag LOCUS_17470 gene coaE 6945 6376 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_17470 7895 6945 gene locus_tag LOCUS_17480 7895 6945 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_17480 8708 7896 gene locus_tag LOCUS_17490 gene mutM 8708 7896 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246122.1 protein_id gnl|my_center|LOCUS_17490 11329 8717 gene locus_tag LOCUS_17500 gene polA 11329 8717 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 protein_id gnl|my_center|LOCUS_17500 14394 11341 gene locus_tag LOCUS_17510 gene dnaE 14394 11341 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673740.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence060 183 617 gene locus_tag LOCUS_17520 gene sepF 183 617 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244791.1 protein_id gnl|my_center|LOCUS_17520 646 1404 gene locus_tag LOCUS_17530 646 1404 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731984.1 protein_id gnl|my_center|LOCUS_17530 1416 1847 gene locus_tag LOCUS_17540 1416 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 2080 4809 gene locus_tag LOCUS_17550 gene ileS2 2080 4809 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455930.1 protein_id gnl|my_center|LOCUS_17550 4999 5136 gene locus_tag LOCUS_17560 4999 5136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 5399 6295 gene locus_tag LOCUS_17570 5399 6295 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920615.1 protein_id gnl|my_center|LOCUS_17570 6288 7535 gene locus_tag LOCUS_17580 6288 7535 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454794.1 protein_id gnl|my_center|LOCUS_17580 10444 8006 gene locus_tag LOCUS_17590 10444 8006 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883425.1 protein_id gnl|my_center|LOCUS_17590 10664 11110 gene locus_tag LOCUS_17600 10664 11110 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239964.1 protein_id gnl|my_center|LOCUS_17600 11162 11815 gene locus_tag LOCUS_17610 11162 11815 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_17610 11799 12239 gene locus_tag LOCUS_17620 11799 12239 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392153.1 protein_id gnl|my_center|LOCUS_17620 12309 13430 gene locus_tag LOCUS_17630 12309 13430 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963887.1 protein_id gnl|my_center|LOCUS_17630 13442 13810 gene locus_tag LOCUS_17640 13442 13810 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767940.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence061 252 917 gene locus_tag LOCUS_17650 252 917 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_17650 911 1591 gene locus_tag LOCUS_17660 911 1591 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435276.1 protein_id gnl|my_center|LOCUS_17660 1742 4411 gene locus_tag LOCUS_17670 1742 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 4473 5615 gene locus_tag LOCUS_17680 4473 5615 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963530.1 protein_id gnl|my_center|LOCUS_17680 5787 6656 gene locus_tag LOCUS_17690 5787 6656 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785992.1 protein_id gnl|my_center|LOCUS_17690 6658 6801 gene locus_tag LOCUS_17700 6658 6801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 7424 10741 gene locus_tag LOCUS_17710 7424 10741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 10846 11739 gene locus_tag LOCUS_17720 gene cas1 10846 11739 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 protein_id gnl|my_center|LOCUS_17720 11729 12052 gene locus_tag LOCUS_17730 gene cas2 11729 12052 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040666777.1 protein_id gnl|my_center|LOCUS_17730 12049 12480 gene locus_tag LOCUS_17740 12049 12480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 12496 12894 gene locus_tag LOCUS_17750 12496 12894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 12943 13507 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttgttaccatatggatttttgctagaataagac >Feature sequence062 286 211 gene locus_tag LOCUS_t00220 286 211 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 784 443 gene locus_tag LOCUS_17760 784 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 1084 1287 gene locus_tag LOCUS_17770 1084 1287 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563620.1 protein_id gnl|my_center|LOCUS_17770 1496 4387 gene locus_tag LOCUS_17780 gene addB 1496 4387 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861078.1 protein_id gnl|my_center|LOCUS_17780 4377 8081 gene locus_tag LOCUS_17790 gene addA 4377 8081 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861079.1 protein_id gnl|my_center|LOCUS_17790 9109 8102 gene locus_tag LOCUS_17800 9109 8102 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387246.1 protein_id gnl|my_center|LOCUS_17800 9195 9920 gene locus_tag LOCUS_17810 gene yaaA 9195 9920 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476537.1 protein_id gnl|my_center|LOCUS_17810 10993 9932 gene locus_tag LOCUS_17820 gene hisC 10993 9932 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905826.1 protein_id gnl|my_center|LOCUS_17820 11332 11673 gene locus_tag LOCUS_17830 11332 11673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 12969 11989 gene locus_tag LOCUS_17840 12969 11989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence063 53 1438 gene locus_tag LOCUS_17850 gene cysS 53 1438 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966454.1 protein_id gnl|my_center|LOCUS_17850 1438 1815 gene locus_tag LOCUS_17860 1438 1815 CDS product ribonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860630.1 protein_id gnl|my_center|LOCUS_17860 1852 2577 gene locus_tag LOCUS_17870 gene rlmB 1852 2577 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724085.1 protein_id gnl|my_center|LOCUS_17870 2596 3213 gene locus_tag LOCUS_17880 2596 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 3262 3411 gene locus_tag LOCUS_17890 gene rpmG 3262 3411 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700682.1 protein_id gnl|my_center|LOCUS_17890 3423 3611 gene locus_tag LOCUS_17900 3423 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 3613 4170 gene locus_tag LOCUS_17910 gene nusG 3613 4170 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225764.1 protein_id gnl|my_center|LOCUS_17910 4739 5215 gene locus_tag LOCUS_17920 4739 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 5304 5924 gene locus_tag LOCUS_17930 5304 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 6170 7585 gene locus_tag LOCUS_17940 6170 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 7687 8160 gene locus_tag LOCUS_17950 7687 8160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 8213 9004 gene locus_tag LOCUS_17960 8213 9004 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965719.1 protein_id gnl|my_center|LOCUS_17960 9275 9964 gene locus_tag LOCUS_17970 9275 9964 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963752.1 protein_id gnl|my_center|LOCUS_17970 10143 12791 gene locus_tag LOCUS_17980 gene adhE 10143 12791 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836312.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence064 8337 4405 gene locus_tag LOCUS_17990 8337 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 9655 8636 gene locus_tag LOCUS_18000 9655 8636 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433354.1 protein_id gnl|my_center|LOCUS_18000 10115 9702 gene locus_tag LOCUS_18010 10115 9702 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546565.1 protein_id gnl|my_center|LOCUS_18010 10756 10115 gene locus_tag LOCUS_18020 gene pcp 10756 10115 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681058.1 protein_id gnl|my_center|LOCUS_18020 10946 10731 gene locus_tag LOCUS_18030 10946 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 11366 12685 gene locus_tag LOCUS_18040 11366 12685 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence065 762 2171 gene locus_tag LOCUS_18050 762 2171 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_18050 2214 2570 gene locus_tag LOCUS_18060 gene crcB 2214 2570 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387989.1 protein_id gnl|my_center|LOCUS_18060 2637 4637 gene locus_tag LOCUS_18070 2637 4637 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966944.1 protein_id gnl|my_center|LOCUS_18070 4945 6018 gene locus_tag LOCUS_18080 gene trpS 4945 6018 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_18080 6093 7169 gene locus_tag LOCUS_18090 6093 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 7186 8634 gene locus_tag LOCUS_18100 7186 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence066 427 2454 gene locus_tag LOCUS_18110 427 2454 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860670.1 protein_id gnl|my_center|LOCUS_18110 2458 2907 gene locus_tag LOCUS_18120 2458 2907 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870439.1 protein_id gnl|my_center|LOCUS_18120 2969 4030 gene locus_tag LOCUS_18130 2969 4030 CDS product PTS fructose transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895303.1 protein_id gnl|my_center|LOCUS_18130 4061 4369 gene locus_tag LOCUS_18140 4061 4369 CDS product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435043.1 protein_id gnl|my_center|LOCUS_18140 10328 4731 gene locus_tag LOCUS_18150 10328 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 11851 10517 gene locus_tag LOCUS_18160 11851 10517 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence067 791 201 gene locus_tag LOCUS_18170 791 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1790 975 gene locus_tag LOCUS_18180 gene lgt 1790 975 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513305.1 protein_id gnl|my_center|LOCUS_18180 2729 1794 gene locus_tag LOCUS_18190 gene hprK 2729 1794 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289568.1 protein_id gnl|my_center|LOCUS_18190 5564 2742 gene locus_tag LOCUS_18200 gene uvrA 5564 2742 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045563.1 protein_id gnl|my_center|LOCUS_18200 6923 5568 gene locus_tag LOCUS_18210 6923 5568 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207256.1 protein_id gnl|my_center|LOCUS_18210 8886 6913 gene locus_tag LOCUS_18220 gene uvrB 8886 6913 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_18220 9375 8995 gene locus_tag LOCUS_18230 9375 8995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 9697 9377 gene locus_tag LOCUS_18240 9697 9377 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263753.1 protein_id gnl|my_center|LOCUS_18240 11355 9697 gene locus_tag LOCUS_18250 gene cydC 11355 9697 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667625.1 protein_id gnl|my_center|LOCUS_18250 >Feature sequence068 188 919 gene locus_tag LOCUS_18260 188 919 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966816.1 protein_id gnl|my_center|LOCUS_18260 912 2084 gene locus_tag LOCUS_18270 912 2084 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966815.1 protein_id gnl|my_center|LOCUS_18270 3307 2141 gene locus_tag LOCUS_18280 3307 2141 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_18280 3656 3309 gene locus_tag LOCUS_18290 3656 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 4328 3717 gene locus_tag LOCUS_18300 4328 3717 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871221.1 protein_id gnl|my_center|LOCUS_18300 4517 4368 gene locus_tag LOCUS_18310 gene rpmG 4517 4368 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831295.1 protein_id gnl|my_center|LOCUS_18310 6682 4589 gene locus_tag LOCUS_18320 6682 4589 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038974.1 protein_id gnl|my_center|LOCUS_18320 9050 6807 gene locus_tag LOCUS_18330 9050 6807 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118785.1 protein_id gnl|my_center|LOCUS_18330 10833 9139 gene locus_tag LOCUS_18340 10833 9139 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721939.1 protein_id gnl|my_center|LOCUS_18340 11385 10984 gene locus_tag LOCUS_18350 11385 10984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 >Feature sequence069 375 133 gene locus_tag LOCUS_18360 375 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 1419 415 gene locus_tag LOCUS_18370 gene gpsA 1419 415 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161776.1 protein_id gnl|my_center|LOCUS_18370 2775 1471 gene locus_tag LOCUS_18380 gene engA 2775 1471 CDS product ribosome-associated GTPase EngA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125893.1 protein_id gnl|my_center|LOCUS_18380 3445 2777 gene locus_tag LOCUS_18390 gene cmk 3445 2777 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361264.1 protein_id gnl|my_center|LOCUS_18390 4372 3491 gene locus_tag LOCUS_18400 4372 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 4489 4665 gene locus_tag LOCUS_18410 4489 4665 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080635.1 protein_id gnl|my_center|LOCUS_18410 5066 4704 gene locus_tag LOCUS_18420 5066 4704 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392789.1 protein_id gnl|my_center|LOCUS_18420 6949 5477 gene locus_tag LOCUS_18430 6949 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 8275 7052 gene locus_tag LOCUS_18440 8275 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 8942 8268 gene locus_tag LOCUS_18450 8942 8268 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416112.1 protein_id gnl|my_center|LOCUS_18450 9891 8935 gene locus_tag LOCUS_18460 9891 8935 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230035.1 protein_id gnl|my_center|LOCUS_18460 10812 9892 gene locus_tag LOCUS_18470 10812 9892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 11000 10809 gene locus_tag LOCUS_18480 11000 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 11278 11096 gene locus_tag LOCUS_18490 gene rpsU 11278 11096 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565673.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence070 10577 4977 gene locus_tag LOCUS_18500 10577 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 >Feature sequence071 1409 687 gene locus_tag LOCUS_18510 1409 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 1976 7783 gene locus_tag LOCUS_18520 1976 7783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 8250 9044 gene locus_tag LOCUS_18530 8250 9044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 9810 9172 gene locus_tag LOCUS_18540 9810 9172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 9926 9750 gene locus_tag LOCUS_18550 9926 9750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 10069 9941 gene locus_tag LOCUS_18560 10069 9941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 10408 10118 gene locus_tag LOCUS_18570 10408 10118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 10339 10866 gene locus_tag LOCUS_18580 10339 10866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence072 207 1028 gene locus_tag LOCUS_18590 207 1028 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476364.1 protein_id gnl|my_center|LOCUS_18590 1028 1858 gene locus_tag LOCUS_18600 1028 1858 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476364.1 protein_id gnl|my_center|LOCUS_18600 1848 2507 gene locus_tag LOCUS_18610 1848 2507 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016997.1 protein_id gnl|my_center|LOCUS_18610 2500 3660 gene locus_tag LOCUS_18620 gene folC 2500 3660 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582053.1 protein_id gnl|my_center|LOCUS_18620 3671 4126 gene locus_tag LOCUS_18630 3671 4126 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948661.1 protein_id gnl|my_center|LOCUS_18630 4152 4427 gene locus_tag LOCUS_18640 4152 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 4826 4494 gene locus_tag LOCUS_18650 4826 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 5285 4863 gene locus_tag LOCUS_18660 gene cwlJ 5285 4863 CDS product cell wall hydrolase CwlJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246500.1 protein_id gnl|my_center|LOCUS_18660 5494 6618 gene locus_tag LOCUS_18670 5494 6618 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922500.1 protein_id gnl|my_center|LOCUS_18670 6633 7742 gene locus_tag LOCUS_18680 gene glgD 6633 7742 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_18680 7742 9172 gene locus_tag LOCUS_18690 gene glgA 7742 9172 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262948.1 protein_id gnl|my_center|LOCUS_18690 9216 9995 gene locus_tag LOCUS_18700 9216 9995 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785293.1 protein_id gnl|my_center|LOCUS_18700 10071 10586 gene locus_tag LOCUS_18710 10071 10586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence073 <1 627 gene locus_tag LOCUS_18720 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861247.1:DUF1836 domain-containing protein 688 1578 gene locus_tag LOCUS_18730 gene metF 688 1578 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_18730 1571 2203 gene locus_tag LOCUS_18740 1571 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 2185 4542 gene locus_tag LOCUS_18750 2185 4542 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_18750 4850 4569 gene locus_tag LOCUS_18760 4850 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 6214 4850 gene locus_tag LOCUS_18770 6214 4850 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_18770 6760 6329 gene locus_tag LOCUS_18780 6760 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 7239 6763 gene locus_tag LOCUS_18790 7239 6763 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902394.1 protein_id gnl|my_center|LOCUS_18790 9935 7335 gene locus_tag LOCUS_18800 9935 7335 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949094.1 protein_id gnl|my_center|LOCUS_18800 >Feature sequence074 21 96 gene locus_tag LOCUS_t00230 21 96 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 540 145 gene locus_tag LOCUS_18810 540 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 613 813 gene locus_tag LOCUS_18820 613 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 858 1778 gene locus_tag LOCUS_18830 gene spoIID 858 1778 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672663.1 protein_id gnl|my_center|LOCUS_18830 1823 2464 gene locus_tag LOCUS_18840 1823 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 2579 3568 gene locus_tag LOCUS_18850 2579 3568 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457984.1 protein_id gnl|my_center|LOCUS_18850 3797 5473 gene locus_tag LOCUS_18860 3797 5473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 5657 5887 gene locus_tag LOCUS_18870 5657 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 5937 8201 gene locus_tag LOCUS_18880 gene rnr 5937 8201 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228386.1 protein_id gnl|my_center|LOCUS_18880 8226 8672 gene locus_tag LOCUS_18890 gene smpB 8226 8672 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 protein_id gnl|my_center|LOCUS_18890 8677 9028 gene locus_tag LOCUS_tm00010 8677 9028 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 9095 10219 gene locus_tag LOCUS_18900 9095 10219 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460692.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence075 99 24 gene locus_tag LOCUS_t00240 99 24 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 190 115 gene locus_tag LOCUS_t00250 190 115 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1571 291 gene locus_tag LOCUS_18910 1571 291 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435635.1 protein_id gnl|my_center|LOCUS_18910 1950 1573 gene locus_tag LOCUS_18920 gene yugI 1950 1573 CDS product S1 domain-containing post-transcriptional regulator GSP13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722395.1 protein_id gnl|my_center|LOCUS_18920 2216 2467 gene locus_tag LOCUS_18930 2216 2467 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431159.1 protein_id gnl|my_center|LOCUS_18930 2639 2776 gene locus_tag LOCUS_18940 2639 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 2931 4073 gene locus_tag LOCUS_18950 gene metK 2931 4073 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166676.1 protein_id gnl|my_center|LOCUS_18950 4200 4727 gene locus_tag LOCUS_18960 gene raiA 4200 4727 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357293.1 protein_id gnl|my_center|LOCUS_18960 5722 4781 gene locus_tag LOCUS_18970 5722 4781 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861205.1 protein_id gnl|my_center|LOCUS_18970 5761 7596 gene locus_tag LOCUS_18980 5761 7596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 7602 9473 gene locus_tag LOCUS_18990 7602 9473 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989556.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence076 98 23 gene locus_tag LOCUS_t00260 98 23 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 434 2485 gene locus_tag LOCUS_19000 gene fusA 434 2485 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048368.1 protein_id gnl|my_center|LOCUS_19000 2592 3590 gene locus_tag LOCUS_19010 gene galE 2592 3590 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694325.1 protein_id gnl|my_center|LOCUS_19010 3743 4162 gene locus_tag LOCUS_19020 3743 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 5331 4258 gene locus_tag LOCUS_19030 gene alr 5331 4258 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475712.1 protein_id gnl|my_center|LOCUS_19030 6407 5421 gene locus_tag LOCUS_19040 6407 5421 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025388382.1 protein_id gnl|my_center|LOCUS_19040 6501 6701 gene locus_tag LOCUS_19050 6501 6701 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220771.1 protein_id gnl|my_center|LOCUS_19050 7336 6713 gene locus_tag LOCUS_19060 7336 6713 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861058.1 protein_id gnl|my_center|LOCUS_19060 8037 7336 gene locus_tag LOCUS_19070 gene deoD 8037 7336 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843292.1 protein_id gnl|my_center|LOCUS_19070 8506 8039 gene locus_tag LOCUS_19080 8506 8039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 <9284 8619 gene locus_tag LOCUS_19090 <9284 8619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390329.1:S8 family serine peptidase >Feature sequence077 1588 785 gene locus_tag LOCUS_19100 1588 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 2774 1590 gene locus_tag LOCUS_19110 2774 1590 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107233.1 protein_id gnl|my_center|LOCUS_19110 4115 2970 gene locus_tag LOCUS_19120 4115 2970 CDS product capsular polysaccharide biosynthesis protein CapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202261.1 protein_id gnl|my_center|LOCUS_19120 5160 4117 gene locus_tag LOCUS_19130 5160 4117 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107231.1 protein_id gnl|my_center|LOCUS_19130 6342 5176 gene locus_tag LOCUS_19140 gene ugd 6342 5176 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704802.1 protein_id gnl|my_center|LOCUS_19140 7901 6387 gene locus_tag LOCUS_19150 7901 6387 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101306.1 protein_id gnl|my_center|LOCUS_19150 9035 7908 gene locus_tag LOCUS_19160 9035 7908 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039964.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence078 959 1918 gene locus_tag LOCUS_19170 959 1918 CDS product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922474.1 protein_id gnl|my_center|LOCUS_19170 1932 2249 gene locus_tag LOCUS_19180 1932 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 2467 2925 gene locus_tag LOCUS_19190 2467 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 3041 3421 gene locus_tag LOCUS_19200 3041 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 3423 3884 gene locus_tag LOCUS_19210 gene ssb 3423 3884 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722552.1 protein_id gnl|my_center|LOCUS_19210 4017 4829 gene locus_tag LOCUS_19220 4017 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 4804 5283 gene locus_tag LOCUS_19230 4804 5283 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861737.1 protein_id gnl|my_center|LOCUS_19230 5298 5705 gene locus_tag LOCUS_19240 5298 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 5712 6377 gene locus_tag LOCUS_19250 5712 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 6346 7164 gene locus_tag LOCUS_19260 6346 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 7161 7775 gene locus_tag LOCUS_19270 7161 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 7779 7994 gene locus_tag LOCUS_19280 7779 7994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 7996 8217 gene locus_tag LOCUS_19290 7996 8217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 8322 8456 gene locus_tag LOCUS_19300 8322 8456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence079 184 498 gene locus_tag LOCUS_19310 184 498 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174964.1 protein_id gnl|my_center|LOCUS_19310 741 2753 gene locus_tag LOCUS_19320 gene recG 741 2753 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370092.1 protein_id gnl|my_center|LOCUS_19320 2768 3742 gene locus_tag LOCUS_19330 gene plsX 2768 3742 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905085.1 protein_id gnl|my_center|LOCUS_19330 3744 4424 gene locus_tag LOCUS_19340 gene rnc 3744 4424 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262927.1 protein_id gnl|my_center|LOCUS_19340 4503 4838 gene locus_tag LOCUS_19350 4503 4838 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989608.1 protein_id gnl|my_center|LOCUS_19350 4890 5741 gene locus_tag LOCUS_19360 4890 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 5754 6488 gene locus_tag LOCUS_19370 5754 6488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 7032 6514 gene locus_tag LOCUS_19380 7032 6514 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_19380 8533 7010 gene locus_tag LOCUS_19390 8533 7010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 >Feature sequence080 450 205 gene locus_tag LOCUS_19400 450 205 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788104.1 protein_id gnl|my_center|LOCUS_19400 1784 483 gene locus_tag LOCUS_19410 gene rlmD 1784 483 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233644.1 protein_id gnl|my_center|LOCUS_19410 3794 1893 gene locus_tag LOCUS_19420 3794 1893 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266234.1 protein_id gnl|my_center|LOCUS_19420 5974 3839 gene locus_tag LOCUS_19430 gene pbpB 5974 3839 CDS product penicillin-binding protein 2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968930.1 protein_id gnl|my_center|LOCUS_19430 6273 5974 gene locus_tag LOCUS_19440 6273 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 7209 6280 gene locus_tag LOCUS_19450 gene rsmH 7209 6280 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472508.1 protein_id gnl|my_center|LOCUS_19450 7683 7219 gene locus_tag LOCUS_19460 gene mraZ 7683 7219 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700457.1 protein_id gnl|my_center|LOCUS_19460 7992 7825 gene locus_tag LOCUS_19470 gene rpmF 7992 7825 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984764.1 protein_id gnl|my_center|LOCUS_19470 8512 8009 gene locus_tag LOCUS_19480 8512 8009 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989883.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence081 225 563 gene locus_tag LOCUS_19490 225 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 673 1842 gene locus_tag LOCUS_19500 673 1842 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_19500 2372 5434 gene locus_tag LOCUS_19510 2372 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 5679 6071 gene locus_tag LOCUS_19520 5679 6071 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243451.1 protein_id gnl|my_center|LOCUS_19520 6651 6812 gene locus_tag LOCUS_19530 6651 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 6847 7119 gene locus_tag LOCUS_19540 6847 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 8329 7331 gene locus_tag LOCUS_19550 8329 7331 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_19550 >Feature sequence082 <1 2357 gene locus_tag LOCUS_19560 <1 2357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000873616.1:LTA synthase family protein 2382 3512 gene locus_tag LOCUS_19570 2382 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 3523 5400 gene locus_tag LOCUS_19580 3523 5400 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289076.1 protein_id gnl|my_center|LOCUS_19580 5449 5718 gene locus_tag LOCUS_19590 5449 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 5730 6803 gene locus_tag LOCUS_19600 5730 6803 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948167.1 protein_id gnl|my_center|LOCUS_19600 6790 7347 gene locus_tag LOCUS_19610 6790 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 7344 7691 gene locus_tag LOCUS_19620 7344 7691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 >Feature sequence083 1543 1998 gene locus_tag LOCUS_19630 1543 1998 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674985.1 protein_id gnl|my_center|LOCUS_19630 2015 3340 gene locus_tag LOCUS_19640 2015 3340 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674984.1 protein_id gnl|my_center|LOCUS_19640 3359 3649 gene locus_tag LOCUS_19650 3359 3649 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567994.1 protein_id gnl|my_center|LOCUS_19650 3651 4163 gene locus_tag LOCUS_19660 3651 4163 CDS product YjbQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576695.1 protein_id gnl|my_center|LOCUS_19660 4166 4762 gene locus_tag LOCUS_19670 4166 4762 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733192.1 protein_id gnl|my_center|LOCUS_19670 4822 5481 gene locus_tag LOCUS_19680 gene rpe 4822 5481 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354925.1 protein_id gnl|my_center|LOCUS_19680 5494 7425 gene locus_tag LOCUS_19690 5494 7425 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861602.1 protein_id gnl|my_center|LOCUS_19690 >Feature sequence084 6663 3913 gene locus_tag LOCUS_19700 gene ygjK 6663 3913 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387456.1 protein_id gnl|my_center|LOCUS_19700 <7620 7045 gene locus_tag LOCUS_19710 <7620 7045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025189858.1:glycoside hydrolase family 31 protein >Feature sequence085 712 434 gene locus_tag LOCUS_19720 712 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19720 982 725 gene locus_tag LOCUS_19730 982 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19730 3114 982 gene locus_tag LOCUS_19740 gene pnp 3114 982 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722460.1 protein_id gnl|my_center|LOCUS_19740 3238 4494 gene locus_tag LOCUS_19750 3238 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 4923 4540 gene locus_tag LOCUS_19760 4923 4540 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870072.1 protein_id gnl|my_center|LOCUS_19760 5106 5900 gene locus_tag LOCUS_19770 5106 5900 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_19770 6261 7250 gene locus_tag LOCUS_19780 6261 7250 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_19780 >Feature sequence086 762 905 gene locus_tag LOCUS_19790 762 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 1081 1323 gene locus_tag LOCUS_19800 1081 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 1814 2599 gene locus_tag LOCUS_19810 gene speD 1814 2599 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965890.1 protein_id gnl|my_center|LOCUS_19810 2609 4066 gene locus_tag LOCUS_19820 2609 4066 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808143.1 protein_id gnl|my_center|LOCUS_19820 4066 4917 gene locus_tag LOCUS_19830 gene speE 4066 4917 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_19830 4907 5767 gene locus_tag LOCUS_19840 gene speB 4907 5767 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 protein_id gnl|my_center|LOCUS_19840 5768 6970 gene locus_tag LOCUS_19850 5768 6970 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence087 2189 1056 gene locus_tag LOCUS_19860 2189 1056 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963483.1 protein_id gnl|my_center|LOCUS_19860 3024 2191 gene locus_tag LOCUS_19870 3024 2191 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368464.1 protein_id gnl|my_center|LOCUS_19870 3778 3026 gene locus_tag LOCUS_19880 3778 3026 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425166.1 protein_id gnl|my_center|LOCUS_19880 4267 3791 gene locus_tag LOCUS_19890 4267 3791 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425168.1 protein_id gnl|my_center|LOCUS_19890 4687 4286 gene locus_tag LOCUS_19900 4687 4286 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860837.1 protein_id gnl|my_center|LOCUS_19900 4998 6899 gene locus_tag LOCUS_19910 4998 6899 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048538587.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence088 1220 237 gene locus_tag LOCUS_19920 1220 237 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964851.1 protein_id gnl|my_center|LOCUS_19920 1506 2477 gene locus_tag LOCUS_19930 1506 2477 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_19930 2670 3233 gene locus_tag LOCUS_19940 2670 3233 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818015.1 protein_id gnl|my_center|LOCUS_19940 4040 3264 gene locus_tag LOCUS_19950 4040 3264 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965719.1 protein_id gnl|my_center|LOCUS_19950 4877 4059 gene locus_tag LOCUS_19960 4877 4059 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287678.1 protein_id gnl|my_center|LOCUS_19960 5548 4883 gene locus_tag LOCUS_19970 5548 4883 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359401.1 protein_id gnl|my_center|LOCUS_19970 6553 5549 gene locus_tag LOCUS_19980 6553 5549 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722447.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence089 1271 114 gene locus_tag LOCUS_19990 1271 114 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835622.1 protein_id gnl|my_center|LOCUS_19990 1336 2271 gene locus_tag LOCUS_20000 1336 2271 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059329.1 protein_id gnl|my_center|LOCUS_20000 2346 4064 gene locus_tag LOCUS_20010 2346 4064 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364705.1 protein_id gnl|my_center|LOCUS_20010 4054 5790 gene locus_tag LOCUS_20020 4054 5790 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_20020 5956 6111 gene locus_tag LOCUS_20030 5956 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20030 6139 6423 gene locus_tag LOCUS_20040 6139 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20040 >Feature sequence090 557 2209 gene locus_tag LOCUS_20050 557 2209 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_20050 2309 3073 gene locus_tag LOCUS_20060 2309 3073 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047741.1 protein_id gnl|my_center|LOCUS_20060 3437 5071 gene locus_tag LOCUS_20070 3437 5071 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002396652.1 protein_id gnl|my_center|LOCUS_20070 5586 5326 gene locus_tag LOCUS_20080 5586 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 5913 5728 gene locus_tag LOCUS_20090 5913 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence091 96 467 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attagttattgttcttataaaggattaacgc 599 1360 gene locus_tag LOCUS_20100 599 1360 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459709.1 protein_id gnl|my_center|LOCUS_20100 1442 1870 gene locus_tag LOCUS_20110 1442 1870 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009913969.1 protein_id gnl|my_center|LOCUS_20110 1926 3659 gene locus_tag LOCUS_20120 1926 3659 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_20120 3652 5514 gene locus_tag LOCUS_20130 3652 5514 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_20130 5970 5560 gene locus_tag LOCUS_20140 5970 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 >Feature sequence092 <1 1276 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcgttaatcctttataagaacaataactaat 1691 1431 gene locus_tag LOCUS_20150 gene cas2 1691 1431 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546411.1 protein_id gnl|my_center|LOCUS_20150 2682 1693 gene locus_tag LOCUS_20160 gene cas1b 2682 1693 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545370.1 protein_id gnl|my_center|LOCUS_20160 3394 2657 gene locus_tag LOCUS_20170 3394 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 4100 3366 gene locus_tag LOCUS_20180 4100 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 5265 4078 gene locus_tag LOCUS_20190 gene csm5 5265 4078 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496894.1 protein_id gnl|my_center|LOCUS_20190 5564 5277 gene locus_tag LOCUS_20200 5564 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 >Feature sequence093 2484 292 gene locus_tag LOCUS_20210 2484 292 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528070.1 protein_id gnl|my_center|LOCUS_20210 3617 2484 gene locus_tag LOCUS_20220 gene mnmA 3617 2484 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038006.1 protein_id gnl|my_center|LOCUS_20220 4604 3684 gene locus_tag LOCUS_20230 4604 3684 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949138.1 protein_id gnl|my_center|LOCUS_20230 5652 4651 gene locus_tag LOCUS_20240 5652 4651 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_20240 >Feature sequence094 56 583 gene locus_tag LOCUS_20250 gene ybaK 56 583 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437064.1 protein_id gnl|my_center|LOCUS_20250 586 1083 gene locus_tag LOCUS_20260 gene cobO 586 1083 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867207.1 protein_id gnl|my_center|LOCUS_20260 1179 2873 gene locus_tag LOCUS_20270 1179 2873 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104191.1 protein_id gnl|my_center|LOCUS_20270 3222 3356 gene locus_tag LOCUS_20280 3222 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 3647 3928 gene locus_tag LOCUS_20290 3647 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 3945 4406 gene locus_tag LOCUS_20300 3945 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 4498 5010 gene locus_tag LOCUS_20310 4498 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 5067 5237 gene locus_tag LOCUS_20320 5067 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427864.1 protein_id gnl|my_center|LOCUS_20320 >Feature sequence095 112 3666 gene locus_tag LOCUS_20330 112 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 3759 5486 gene locus_tag LOCUS_20340 3759 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence096 3832 314 gene locus_tag LOCUS_20350 gene nifJ 3832 314 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016958.1 protein_id gnl|my_center|LOCUS_20350 4472 4005 gene locus_tag LOCUS_20360 4472 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 5371 4472 gene locus_tag LOCUS_20370 gene galU 5371 4472 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890959.1 protein_id gnl|my_center|LOCUS_20370 >Feature sequence097 639 58 gene locus_tag LOCUS_20380 639 58 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765867.1 protein_id gnl|my_center|LOCUS_20380 1625 1059 gene locus_tag LOCUS_20390 1625 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002938103.1 protein_id gnl|my_center|LOCUS_20390 2021 1872 gene locus_tag LOCUS_20400 2021 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 4575 2584 gene locus_tag LOCUS_20410 4575 2584 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459160.1 protein_id gnl|my_center|LOCUS_20410 <5226 4568 gene locus_tag LOCUS_20420 <5226 4568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000173372.1:ABC transporter ATP-binding protein >Feature sequence098 2074 182 gene locus_tag LOCUS_20430 2074 182 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860670.1 protein_id gnl|my_center|LOCUS_20430 3280 2225 gene locus_tag LOCUS_20440 3280 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20440 3606 3292 gene locus_tag LOCUS_20450 3606 3292 CDS product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161265.1 protein_id gnl|my_center|LOCUS_20450 4080 3619 gene locus_tag LOCUS_20460 4080 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 <4932 4092 gene locus_tag LOCUS_20470 <4932 4092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009924577.1:class II D-tagatose-bisphosphate aldolase, non-catalytic subunit >Feature sequence099 416 2812 gene locus_tag LOCUS_20480 gene leuS 416 2812 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009461.1 protein_id gnl|my_center|LOCUS_20480 3067 3258 gene locus_tag LOCUS_20490 3067 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 4010 3426 gene locus_tag LOCUS_20500 4010 3426 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426696.1 protein_id gnl|my_center|LOCUS_20500 4458 4066 gene locus_tag LOCUS_20510 4458 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence100 3992 3564 gene locus_tag LOCUS_20520 3992 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20520 4226 3993 gene locus_tag LOCUS_20530 4226 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence101 3466 4182 gene locus_tag LOCUS_20540 3466 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence102 410 48 gene locus_tag LOCUS_20550 410 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 1257 568 gene locus_tag LOCUS_20560 1257 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 1767 1258 gene locus_tag LOCUS_20570 1767 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 2271 1792 gene locus_tag LOCUS_20580 2271 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 3235 2279 gene locus_tag LOCUS_20590 3235 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 3561 3250 gene locus_tag LOCUS_20600 3561 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 3866 3564 gene locus_tag LOCUS_20610 3866 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 4337 4011 gene locus_tag LOCUS_20620 4337 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence103 1708 269 gene locus_tag LOCUS_20630 gene gltX 1708 269 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399675.1 protein_id gnl|my_center|LOCUS_20630 2192 1710 gene locus_tag LOCUS_20640 gene ispF 2192 1710 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459082.1 protein_id gnl|my_center|LOCUS_20640 2772 3179 gene locus_tag LOCUS_20650 2772 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 3290 3580 gene locus_tag LOCUS_20660 3290 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 3568 4167 gene locus_tag LOCUS_20670 3568 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20670 >Feature sequence104 59 820 gene locus_tag LOCUS_20680 59 820 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434038.1 protein_id gnl|my_center|LOCUS_20680 927 3281 gene locus_tag LOCUS_20690 927 3281 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184871.1 protein_id gnl|my_center|LOCUS_20690 3268 4185 gene locus_tag LOCUS_20700 3268 4185 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence105 375 881 gene locus_tag LOCUS_20710 375 881 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578443.1 protein_id gnl|my_center|LOCUS_20710 878 1585 gene locus_tag LOCUS_20720 878 1585 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612460.1 protein_id gnl|my_center|LOCUS_20720 1591 2685 gene locus_tag LOCUS_20730 1591 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 2937 3137 gene locus_tag LOCUS_20740 2937 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 3130 4116 gene locus_tag LOCUS_20750 3130 4116 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908873.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence106 2038 281 gene locus_tag LOCUS_20760 2038 281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461398.1 protein_id gnl|my_center|LOCUS_20760 3203 2148 gene locus_tag LOCUS_20770 3203 2148 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_20770 3870 3190 gene locus_tag LOCUS_20780 3870 3190 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044826408.1 protein_id gnl|my_center|LOCUS_20780 >Feature sequence107 >Feature sequence108 >Feature sequence109 136 558 gene locus_tag LOCUS_20790 136 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 562 1563 gene locus_tag LOCUS_20800 562 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 1597 2013 gene locus_tag LOCUS_20810 1597 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 2075 2275 gene locus_tag LOCUS_20820 2075 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 2304 3833 gene locus_tag LOCUS_20830 2304 3833 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861147.1 protein_id gnl|my_center|LOCUS_20830 >Feature sequence110 3033 2551 gene locus_tag LOCUS_20840 3033 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 3643 3164 gene locus_tag LOCUS_20850 3643 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence111 >Feature sequence112 1743 85 gene locus_tag LOCUS_20860 1743 85 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245033.1 protein_id gnl|my_center|LOCUS_20860 2112 1756 gene locus_tag LOCUS_20870 2112 1756 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021109.1 protein_id gnl|my_center|LOCUS_20870 2330 2515 gene locus_tag LOCUS_20880 gene rpmB 2330 2515 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183124.1 protein_id gnl|my_center|LOCUS_20880 >Feature sequence113 289 672 gene locus_tag LOCUS_20890 289 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 801 1508 gene locus_tag LOCUS_20900 801 1508 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861605.1 protein_id gnl|my_center|LOCUS_20900 1513 3615 gene locus_tag LOCUS_20910 1513 3615 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861604.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence114 833 582 gene locus_tag LOCUS_20920 833 582 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966918.1 protein_id gnl|my_center|LOCUS_20920 3261 826 gene locus_tag LOCUS_20930 3261 826 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948919.1 protein_id gnl|my_center|LOCUS_20930 3671 3456 gene locus_tag LOCUS_20940 3671 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 >Feature sequence115 497 1093 gene locus_tag LOCUS_20950 497 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 1068 1448 gene locus_tag LOCUS_20960 1068 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 1464 2258 gene locus_tag LOCUS_20970 gene ucpA 1464 2258 CDS product SDR family oxidoreductase UcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517460.1 protein_id gnl|my_center|LOCUS_20970 >Feature sequence116 213 734 gene locus_tag LOCUS_20980 213 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 875 965 gene locus_tag LOCUS_t00270 875 965 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1058 1570 gene locus_tag LOCUS_20990 1058 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 1567 2346 gene locus_tag LOCUS_21000 1567 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2336 2800 gene locus_tag LOCUS_21010 2336 2800 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385866.1 protein_id gnl|my_center|LOCUS_21010 2851 3342 gene locus_tag LOCUS_21020 2851 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence117 >Feature sequence118 2138 429 gene locus_tag LOCUS_21030 gene ptsP 2138 429 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040051.1 protein_id gnl|my_center|LOCUS_21030 2343 3074 gene locus_tag LOCUS_21040 gene nagB 2343 3074 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166981.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence119 625 1032 gene locus_tag LOCUS_21050 625 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 1295 1432 gene locus_tag LOCUS_21060 1295 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 1434 1607 gene locus_tag LOCUS_21070 1434 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 1760 1978 gene locus_tag LOCUS_21080 1760 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 1996 2715 gene locus_tag LOCUS_21090 1996 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949428.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence120 3056 72 gene locus_tag LOCUS_21100 3056 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 >Feature sequence121 1180 179 gene locus_tag LOCUS_21110 1180 179 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_21110 1621 1181 gene locus_tag LOCUS_21120 1621 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 2737 1628 gene locus_tag LOCUS_21130 2737 1628 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986574.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence122 90 308 gene locus_tag LOCUS_21140 90 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21140 323 2191 gene locus_tag LOCUS_21150 323 2191 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21150 2896 2264 gene locus_tag LOCUS_21160 2896 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816577.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence123 384 803 gene locus_tag LOCUS_21170 384 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21170 1210 1509 gene locus_tag LOCUS_21180 1210 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 1889 2173 gene locus_tag LOCUS_21190 1889 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 2251 3027 gene locus_tag LOCUS_21200 2251 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence124 888 130 gene locus_tag LOCUS_21210 888 130 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964820.1 protein_id gnl|my_center|LOCUS_21210 1084 2988 gene locus_tag LOCUS_21220 1084 2988 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948279.1 protein_id gnl|my_center|LOCUS_21220 >Feature sequence125 574 1308 gene locus_tag LOCUS_21230 574 1308 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821961.1 protein_id gnl|my_center|LOCUS_21230 1308 2060 gene locus_tag LOCUS_21240 1308 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 2929 2114 gene locus_tag LOCUS_21250 gene yidA 2929 2114 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963948.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence126 >Feature sequence127 677 213 gene locus_tag LOCUS_21260 677 213 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_21260 1590 670 gene locus_tag LOCUS_21270 1590 670 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_21270 2107 1577 gene locus_tag LOCUS_21280 gene lspA 2107 1577 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989666.1 protein_id gnl|my_center|LOCUS_21280 2770 2117 gene locus_tag LOCUS_21290 2770 2117 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436685.1 protein_id gnl|my_center|LOCUS_21290 >Feature sequence128 1014 754 gene locus_tag LOCUS_21300 1014 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21300 <2736 1542 gene locus_tag LOCUS_21310 <2736 1542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965664.1:Ig-like domain-containing protein >Feature sequence129 309 1355 gene locus_tag LOCUS_21320 309 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107078.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence130 <1 652 gene locus_tag LOCUS_21330 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048412.1:[FeFe] hydrogenase H-cluster radical SAM maturase HydE 1680 1856 gene locus_tag LOCUS_21340 1680 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 2237 2515 gene locus_tag LOCUS_21350 2237 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 >Feature sequence131 789 484 gene locus_tag LOCUS_21360 789 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 1226 1050 gene locus_tag LOCUS_21370 1226 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 2472 1408 gene locus_tag LOCUS_21380 2472 1408 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432374.1 protein_id gnl|my_center|LOCUS_21380 >Feature sequence132 403 1506 gene locus_tag LOCUS_21390 403 1506 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_21390 1499 2389 gene locus_tag LOCUS_21400 1499 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400