>Feature sequence01 706 386 gene locus_tag LOCUS_00010 706 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1126 779 gene locus_tag LOCUS_00020 1126 779 CDS product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286736.1 protein_id gnl|my_center|LOCUS_00020 2336 1191 gene locus_tag LOCUS_00030 2336 1191 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295158.1 protein_id gnl|my_center|LOCUS_00030 3367 2396 gene locus_tag LOCUS_00040 3367 2396 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286741.1 protein_id gnl|my_center|LOCUS_00040 4054 3503 gene locus_tag LOCUS_00050 4054 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4156 6063 gene locus_tag LOCUS_00060 4156 6063 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286747.1 protein_id gnl|my_center|LOCUS_00060 7096 6260 gene locus_tag LOCUS_00070 7096 6260 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643078.1 protein_id gnl|my_center|LOCUS_00070 7818 7189 gene locus_tag LOCUS_00080 7818 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289315.1 protein_id gnl|my_center|LOCUS_00080 9961 7841 gene locus_tag LOCUS_00090 9961 7841 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329693.1 protein_id gnl|my_center|LOCUS_00090 11316 9988 gene locus_tag LOCUS_00100 11316 9988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329694.1 protein_id gnl|my_center|LOCUS_00100 12764 11460 gene locus_tag LOCUS_00110 12764 11460 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704390.1 protein_id gnl|my_center|LOCUS_00110 13654 12803 gene locus_tag LOCUS_00120 gene aroE 13654 12803 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989932.1 protein_id gnl|my_center|LOCUS_00120 14526 13672 gene locus_tag LOCUS_00130 14526 13672 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723365.1 protein_id gnl|my_center|LOCUS_00130 14804 15706 gene locus_tag LOCUS_00140 14804 15706 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989930.1 protein_id gnl|my_center|LOCUS_00140 16556 15855 gene locus_tag LOCUS_00150 16556 15855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 17254 16595 gene locus_tag LOCUS_00160 17254 16595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 17570 18100 gene locus_tag LOCUS_00170 17570 18100 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289509.1 protein_id gnl|my_center|LOCUS_00170 18420 19319 gene locus_tag LOCUS_00180 18420 19319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290034.1 protein_id gnl|my_center|LOCUS_00180 19911 20120 gene locus_tag LOCUS_00190 19911 20120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 20132 20344 gene locus_tag LOCUS_00200 20132 20344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20444 20797 gene locus_tag LOCUS_00210 20444 20797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 20843 21463 gene locus_tag LOCUS_00220 20843 21463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22326 21769 gene locus_tag LOCUS_00230 22326 21769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 23286 22339 gene locus_tag LOCUS_00240 23286 22339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 23666 24112 gene locus_tag LOCUS_00250 23666 24112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 24889 24302 gene locus_tag LOCUS_00260 24889 24302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 25468 24917 gene locus_tag LOCUS_00270 25468 24917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 25932 26004 gene locus_tag LOCUS_t00010 25932 26004 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 26016 26105 gene locus_tag LOCUS_t00020 26016 26105 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 26111 26200 gene locus_tag LOCUS_t00030 26111 26200 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 27112 26258 gene locus_tag LOCUS_00280 27112 26258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095041.1 protein_id gnl|my_center|LOCUS_00280 28161 27109 gene locus_tag LOCUS_00290 28161 27109 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386658.1 protein_id gnl|my_center|LOCUS_00290 28525 28199 gene locus_tag LOCUS_00300 28525 28199 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931180.1 protein_id gnl|my_center|LOCUS_00300 29980 28538 gene locus_tag LOCUS_00310 29980 28538 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905175.1 protein_id gnl|my_center|LOCUS_00310 31520 30078 gene locus_tag LOCUS_00320 31520 30078 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095039.1 protein_id gnl|my_center|LOCUS_00320 31856 31524 gene locus_tag LOCUS_00330 31856 31524 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722125.1 protein_id gnl|my_center|LOCUS_00330 32136 32849 gene locus_tag LOCUS_00340 32136 32849 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363775.1 protein_id gnl|my_center|LOCUS_00340 33033 33227 gene locus_tag LOCUS_00350 33033 33227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355314.1 protein_id gnl|my_center|LOCUS_00350 35407 33521 gene locus_tag LOCUS_00360 35407 33521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 36416 35853 gene locus_tag LOCUS_00370 gene efp 36416 35853 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289434.1 protein_id gnl|my_center|LOCUS_00370 37221 36589 gene locus_tag LOCUS_00380 37221 36589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 38086 37589 gene locus_tag LOCUS_00390 38086 37589 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356666.1 protein_id gnl|my_center|LOCUS_00390 38978 38217 gene locus_tag LOCUS_00400 38978 38217 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299518.1 protein_id gnl|my_center|LOCUS_00400 39118 39390 gene locus_tag LOCUS_00410 39118 39390 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289551.1 protein_id gnl|my_center|LOCUS_00410 39495 40430 gene locus_tag LOCUS_00420 gene yidC 39495 40430 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304673.1 protein_id gnl|my_center|LOCUS_00420 40665 40850 gene locus_tag LOCUS_00430 40665 40850 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669524.1 protein_id gnl|my_center|LOCUS_00430 40903 41289 gene locus_tag LOCUS_00440 40903 41289 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_00440 42589 41390 gene locus_tag LOCUS_00450 42589 41390 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387329.1 protein_id gnl|my_center|LOCUS_00450 43272 42586 gene locus_tag LOCUS_00460 43272 42586 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365285.1 protein_id gnl|my_center|LOCUS_00460 44487 43273 gene locus_tag LOCUS_00470 44487 43273 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903136.1 protein_id gnl|my_center|LOCUS_00470 44964 44491 gene locus_tag LOCUS_00480 44964 44491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 45667 45332 gene locus_tag LOCUS_00490 45667 45332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 46065 45992 gene locus_tag LOCUS_t00040 46065 45992 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 46306 46935 gene locus_tag LOCUS_00500 46306 46935 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355926.1 protein_id gnl|my_center|LOCUS_00500 46947 47759 gene locus_tag LOCUS_00510 46947 47759 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836893.1 protein_id gnl|my_center|LOCUS_00510 47828 49762 gene locus_tag LOCUS_00520 47828 49762 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836894.1 protein_id gnl|my_center|LOCUS_00520 49899 50840 gene locus_tag LOCUS_00530 49899 50840 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578002.1 protein_id gnl|my_center|LOCUS_00530 52972 50894 gene locus_tag LOCUS_00540 gene glyS 52972 50894 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288758.1 protein_id gnl|my_center|LOCUS_00540 53861 52974 gene locus_tag LOCUS_00550 gene glyQ 53861 52974 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706545.1 protein_id gnl|my_center|LOCUS_00550 55263 54436 gene locus_tag LOCUS_00560 55263 54436 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_00560 55914 55279 gene locus_tag LOCUS_00570 gene hisIE 55914 55279 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_00570 56780 56022 gene locus_tag LOCUS_00580 gene hisF 56780 56022 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_00580 57496 56777 gene locus_tag LOCUS_00590 gene hisA 57496 56777 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949114.1 protein_id gnl|my_center|LOCUS_00590 58119 57493 gene locus_tag LOCUS_00600 gene hisH 58119 57493 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436678.1 protein_id gnl|my_center|LOCUS_00600 58726 58133 gene locus_tag LOCUS_00610 gene hisB 58726 58133 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_00610 59781 58723 gene locus_tag LOCUS_00620 gene hisC 59781 58723 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088965.1 protein_id gnl|my_center|LOCUS_00620 61058 59778 gene locus_tag LOCUS_00630 gene hisD 61058 59778 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964255.1 protein_id gnl|my_center|LOCUS_00630 62614 61055 gene locus_tag LOCUS_00640 62614 61055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 64508 63732 gene locus_tag LOCUS_00650 gene recO 64508 63732 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359746.1 protein_id gnl|my_center|LOCUS_00650 65480 64581 gene locus_tag LOCUS_00660 gene era 65480 64581 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359745.1 protein_id gnl|my_center|LOCUS_00660 65912 65517 gene locus_tag LOCUS_00670 65912 65517 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002330764.1 protein_id gnl|my_center|LOCUS_00670 66363 65890 gene locus_tag LOCUS_00680 gene ybeY 66363 65890 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288749.1 protein_id gnl|my_center|LOCUS_00680 68567 66363 gene locus_tag LOCUS_00690 68567 66363 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288747.1 protein_id gnl|my_center|LOCUS_00690 69566 68583 gene locus_tag LOCUS_00700 69566 68583 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288745.1 protein_id gnl|my_center|LOCUS_00700 70161 69715 gene locus_tag LOCUS_00710 70161 69715 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356741.1 protein_id gnl|my_center|LOCUS_00710 70359 70183 gene locus_tag LOCUS_00720 70359 70183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 70935 70498 gene locus_tag LOCUS_00730 70935 70498 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287322.1 protein_id gnl|my_center|LOCUS_00730 71021 71875 gene locus_tag LOCUS_00740 71021 71875 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002326754.1 protein_id gnl|my_center|LOCUS_00740 72807 71878 gene locus_tag LOCUS_00750 gene metA 72807 71878 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398721.1 protein_id gnl|my_center|LOCUS_00750 74082 72811 gene locus_tag LOCUS_00760 74082 72811 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761151.1 protein_id gnl|my_center|LOCUS_00760 75451 74588 gene locus_tag LOCUS_00770 gene thrB 75451 74588 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387081.1 protein_id gnl|my_center|LOCUS_00770 76506 75448 gene locus_tag LOCUS_00780 gene thrC 76506 75448 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356733.1 protein_id gnl|my_center|LOCUS_00780 77798 76509 gene locus_tag LOCUS_00790 77798 76509 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359742.1 protein_id gnl|my_center|LOCUS_00790 78213 77926 gene locus_tag LOCUS_00800 78213 77926 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391570.1 protein_id gnl|my_center|LOCUS_00800 79956 78232 gene locus_tag LOCUS_00810 79956 78232 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706546.1 protein_id gnl|my_center|LOCUS_00810 81016 80102 gene locus_tag LOCUS_00820 gene trxB 81016 80102 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289179.1 protein_id gnl|my_center|LOCUS_00820 81466 81248 gene locus_tag LOCUS_00830 81466 81248 CDS product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294955.1 protein_id gnl|my_center|LOCUS_00830 81766 82575 gene locus_tag LOCUS_00840 gene proB 81766 82575 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389550.1 protein_id gnl|my_center|LOCUS_00840 82568 83818 gene locus_tag LOCUS_00850 82568 83818 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287452.1 protein_id gnl|my_center|LOCUS_00850 84765 83875 gene locus_tag LOCUS_00860 84765 83875 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357396.1 protein_id gnl|my_center|LOCUS_00860 85694 84789 gene locus_tag LOCUS_00870 85694 84789 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027102.1 protein_id gnl|my_center|LOCUS_00870 87052 85790 gene locus_tag LOCUS_00880 gene tyrS 87052 85790 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357324.1 protein_id gnl|my_center|LOCUS_00880 87386 89773 gene locus_tag LOCUS_00890 87386 89773 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289443.1 protein_id gnl|my_center|LOCUS_00890 89908 90129 gene locus_tag LOCUS_00900 89908 90129 CDS product DUF2829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290506.1 protein_id gnl|my_center|LOCUS_00900 90126 90878 gene locus_tag LOCUS_00910 90126 90878 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297149.1 protein_id gnl|my_center|LOCUS_00910 90996 91502 gene locus_tag LOCUS_00920 90996 91502 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297147.1 protein_id gnl|my_center|LOCUS_00920 93158 91536 gene locus_tag LOCUS_00930 gene treC 93158 91536 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921814.1 protein_id gnl|my_center|LOCUS_00930 95120 93174 gene locus_tag LOCUS_00940 gene treP 95120 93174 CDS product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921815.1 protein_id gnl|my_center|LOCUS_00940 95496 96218 gene locus_tag LOCUS_00950 gene treR 95496 96218 CDS product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774930.1 protein_id gnl|my_center|LOCUS_00950 97269 96265 gene locus_tag LOCUS_00960 gene ccpA 97269 96265 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291653.1 protein_id gnl|my_center|LOCUS_00960 97463 98563 gene locus_tag LOCUS_00970 97463 98563 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304593.1 protein_id gnl|my_center|LOCUS_00970 99119 98874 gene locus_tag LOCUS_00980 99119 98874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 99797 99231 gene locus_tag LOCUS_00990 99797 99231 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381831.1 protein_id gnl|my_center|LOCUS_00990 100237 99800 gene locus_tag LOCUS_01000 100237 99800 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289575.1 protein_id gnl|my_center|LOCUS_01000 100916 100356 gene locus_tag LOCUS_01010 100916 100356 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890713.1 protein_id gnl|my_center|LOCUS_01010 101976 101083 gene locus_tag LOCUS_01020 gene galU 101976 101083 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357314.1 protein_id gnl|my_center|LOCUS_01020 103016 101997 gene locus_tag LOCUS_01030 103016 101997 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357312.1 protein_id gnl|my_center|LOCUS_01030 103981 103151 gene locus_tag LOCUS_01040 gene lgt 103981 103151 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289570.1 protein_id gnl|my_center|LOCUS_01040 104918 103983 gene locus_tag LOCUS_01050 gene hprK 104918 103983 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289568.1 protein_id gnl|my_center|LOCUS_01050 105487 105125 gene locus_tag LOCUS_01060 105487 105125 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357307.1 protein_id gnl|my_center|LOCUS_01060 105804 105487 gene locus_tag LOCUS_01070 105804 105487 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294972.1 protein_id gnl|my_center|LOCUS_01070 107380 105830 gene locus_tag LOCUS_01080 gene liaX 107380 105830 CDS product daptomycin-sensing surface protein LiaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002330768.1 protein_id gnl|my_center|LOCUS_01080 108240 107563 gene locus_tag LOCUS_01090 gene phoU 108240 107563 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357304.1 protein_id gnl|my_center|LOCUS_01090 109124 108369 gene locus_tag LOCUS_01100 gene pstB 109124 108369 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289489.1 protein_id gnl|my_center|LOCUS_01100 109942 109142 gene locus_tag LOCUS_01110 gene pstB 109942 109142 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289486.1 protein_id gnl|my_center|LOCUS_01110 110885 109998 gene locus_tag LOCUS_01120 gene pstA 110885 109998 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292759.1 protein_id gnl|my_center|LOCUS_01120 111810 110878 gene locus_tag LOCUS_01130 gene pstC 111810 110878 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357299.1 protein_id gnl|my_center|LOCUS_01130 112722 112330 gene locus_tag LOCUS_01140 112722 112330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 113565 112789 gene locus_tag LOCUS_01150 113565 112789 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896869.1 protein_id gnl|my_center|LOCUS_01150 114500 113652 gene locus_tag LOCUS_01160 114500 113652 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292763.1 protein_id gnl|my_center|LOCUS_01160 116092 114644 gene locus_tag LOCUS_01170 gene cls 116092 114644 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304589.1 protein_id gnl|my_center|LOCUS_01170 116590 116153 gene locus_tag LOCUS_01180 116590 116153 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287432.1 protein_id gnl|my_center|LOCUS_01180 116953 116633 gene locus_tag LOCUS_01190 116953 116633 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287086.1 protein_id gnl|my_center|LOCUS_01190 118126 117239 gene locus_tag LOCUS_01200 gene ftsX 118126 117239 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317241.1 protein_id gnl|my_center|LOCUS_01200 118805 118116 gene locus_tag LOCUS_01210 gene ftsE 118805 118116 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292768.1 protein_id gnl|my_center|LOCUS_01210 119895 118903 gene locus_tag LOCUS_01220 gene prfB 119895 118903 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096948712.1 protein_id gnl|my_center|LOCUS_01220 122752 120221 gene locus_tag LOCUS_01230 gene secA 122752 120221 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289770.1 protein_id gnl|my_center|LOCUS_01230 123569 123021 gene locus_tag LOCUS_01240 gene raiA 123569 123021 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289771.1 protein_id gnl|my_center|LOCUS_01240 124375 123710 gene locus_tag LOCUS_01250 124375 123710 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369291.1 protein_id gnl|my_center|LOCUS_01250 125669 124365 gene locus_tag LOCUS_01260 125669 124365 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290048.1 protein_id gnl|my_center|LOCUS_01260 126079 125792 gene locus_tag LOCUS_01270 126079 125792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357286.1 protein_id gnl|my_center|LOCUS_01270 126190 126831 gene locus_tag LOCUS_01280 126190 126831 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303217.1 protein_id gnl|my_center|LOCUS_01280 127545 126841 gene locus_tag LOCUS_01290 127545 126841 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292782.1 protein_id gnl|my_center|LOCUS_01290 131933 127692 gene locus_tag LOCUS_01300 131933 127692 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382252.1 protein_id gnl|my_center|LOCUS_01300 132109 132717 gene locus_tag LOCUS_01310 132109 132717 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357803.1 protein_id gnl|my_center|LOCUS_01310 132927 132757 gene locus_tag LOCUS_01320 132927 132757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 133214 134089 gene locus_tag LOCUS_01330 133214 134089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 134252 134179 gene locus_tag LOCUS_t00050 134252 134179 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 134336 134253 gene locus_tag LOCUS_t00060 134336 134253 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 134648 134418 gene locus_tag LOCUS_01340 134648 134418 CDS product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002316425.1 protein_id gnl|my_center|LOCUS_01340 135368 134724 gene locus_tag LOCUS_01350 135368 134724 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922763.1 protein_id gnl|my_center|LOCUS_01350 136073 135372 gene locus_tag LOCUS_01360 136073 135372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894681.1 protein_id gnl|my_center|LOCUS_01360 136849 136073 gene locus_tag LOCUS_01370 136849 136073 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262678.1 protein_id gnl|my_center|LOCUS_01370 137813 136830 gene locus_tag LOCUS_01380 137813 136830 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837312.1 protein_id gnl|my_center|LOCUS_01380 138692 137814 gene locus_tag LOCUS_01390 138692 137814 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897070.1 protein_id gnl|my_center|LOCUS_01390 139973 138810 gene locus_tag LOCUS_01400 139973 138810 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262675.1 protein_id gnl|my_center|LOCUS_01400 140721 140434 gene locus_tag LOCUS_01410 gene yidD 140721 140434 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289000.1 protein_id gnl|my_center|LOCUS_01410 141071 140895 gene locus_tag LOCUS_01420 141071 140895 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289019.1 protein_id gnl|my_center|LOCUS_01420 142384 141083 gene locus_tag LOCUS_01430 gene murA 142384 141083 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289003.1 protein_id gnl|my_center|LOCUS_01430 142663 142430 gene locus_tag LOCUS_01440 142663 142430 CDS product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289004.1 protein_id gnl|my_center|LOCUS_01440 143410 142976 gene locus_tag LOCUS_01450 143410 142976 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289005.1 protein_id gnl|my_center|LOCUS_01450 144824 143424 gene locus_tag LOCUS_01460 gene atpD 144824 143424 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289006.1 protein_id gnl|my_center|LOCUS_01460 145749 144847 gene locus_tag LOCUS_01470 145749 144847 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289007.1 protein_id gnl|my_center|LOCUS_01470 147294 145768 gene locus_tag LOCUS_01480 gene atpA 147294 145768 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289008.1 protein_id gnl|my_center|LOCUS_01480 147859 147314 gene locus_tag LOCUS_01490 147859 147314 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289009.1 protein_id gnl|my_center|LOCUS_01490 148370 147849 gene locus_tag LOCUS_01500 gene atpF 148370 147849 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289010.1 protein_id gnl|my_center|LOCUS_01500 148681 148466 gene locus_tag LOCUS_01510 gene atpE 148681 148466 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289011.1 protein_id gnl|my_center|LOCUS_01510 149430 148717 gene locus_tag LOCUS_01520 gene atpB 149430 148717 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002300474.1 protein_id gnl|my_center|LOCUS_01520 150183 149719 gene locus_tag LOCUS_01530 gene smpB 150183 149719 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356550.1 protein_id gnl|my_center|LOCUS_01530 152557 150185 gene locus_tag LOCUS_01540 gene rnr 152557 150185 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289014.1 protein_id gnl|my_center|LOCUS_01540 153302 152538 gene locus_tag LOCUS_01550 153302 152538 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002300470.1 protein_id gnl|my_center|LOCUS_01550 153742 153506 gene locus_tag LOCUS_01560 gene secG 153742 153506 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356546.1 protein_id gnl|my_center|LOCUS_01560 154097 153822 gene locus_tag LOCUS_01570 154097 153822 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356545.1 protein_id gnl|my_center|LOCUS_01570 154388 154122 gene locus_tag LOCUS_01580 154388 154122 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356543.1 protein_id gnl|my_center|LOCUS_01580 154771 154451 gene locus_tag LOCUS_01590 154771 154451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 155288 154776 gene locus_tag LOCUS_01600 155288 154776 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289401.1 protein_id gnl|my_center|LOCUS_01600 157210 155450 gene locus_tag LOCUS_01610 gene efrB 157210 155450 CDS product multidrug efflux ABC transporter subunit EfrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289400.1 protein_id gnl|my_center|LOCUS_01610 158937 157207 gene locus_tag LOCUS_01620 gene efrA 158937 157207 CDS product multidrug efflux ABC transporter subunit EfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748727.1 protein_id gnl|my_center|LOCUS_01620 159286 159498 gene locus_tag LOCUS_01630 159286 159498 CDS product DNA-directed RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287947.1 protein_id gnl|my_center|LOCUS_01630 159500 161176 gene locus_tag LOCUS_01640 159500 161176 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287948.1 protein_id gnl|my_center|LOCUS_01640 161421 161930 gene locus_tag LOCUS_01650 161421 161930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 162222 162022 gene locus_tag LOCUS_01660 162222 162022 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294067.1 protein_id gnl|my_center|LOCUS_01660 163063 162374 gene locus_tag LOCUS_01670 gene radC 163063 162374 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706793.1 protein_id gnl|my_center|LOCUS_01670 163772 163113 gene locus_tag LOCUS_01680 163772 163113 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287951.1 protein_id gnl|my_center|LOCUS_01680 165072 163759 gene locus_tag LOCUS_01690 165072 163759 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355117.1 protein_id gnl|my_center|LOCUS_01690 167894 165255 gene locus_tag LOCUS_01700 167894 165255 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387315.1 protein_id gnl|my_center|LOCUS_01700 167866 168042 gene locus_tag LOCUS_01710 167866 168042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 168891 168256 gene locus_tag LOCUS_01720 168891 168256 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365189.1 protein_id gnl|my_center|LOCUS_01720 170293 169085 gene locus_tag LOCUS_01730 gene thiI 170293 169085 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287955.1 protein_id gnl|my_center|LOCUS_01730 171476 170334 gene locus_tag LOCUS_01740 171476 170334 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358363.1 protein_id gnl|my_center|LOCUS_01740 173353 171632 gene locus_tag LOCUS_01750 173353 171632 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287957.1 protein_id gnl|my_center|LOCUS_01750 173669 175021 gene locus_tag LOCUS_01760 173669 175021 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391510.1 protein_id gnl|my_center|LOCUS_01760 175583 175074 gene locus_tag LOCUS_01770 175583 175074 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355230.1 protein_id gnl|my_center|LOCUS_01770 176477 175641 gene locus_tag LOCUS_01780 176477 175641 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287959.1 protein_id gnl|my_center|LOCUS_01780 177321 176491 gene locus_tag LOCUS_01790 177321 176491 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287960.1 protein_id gnl|my_center|LOCUS_01790 177411 178385 gene locus_tag LOCUS_01800 177411 178385 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287961.1 protein_id gnl|my_center|LOCUS_01800 179168 178431 gene locus_tag LOCUS_01810 179168 178431 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287962.1 protein_id gnl|my_center|LOCUS_01810 180002 179169 gene locus_tag LOCUS_01820 180002 179169 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287963.1 protein_id gnl|my_center|LOCUS_01820 180801 180016 gene locus_tag LOCUS_01830 180801 180016 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706768.1 protein_id gnl|my_center|LOCUS_01830 182261 180933 gene locus_tag LOCUS_01840 182261 180933 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287964.1 protein_id gnl|my_center|LOCUS_01840 183289 182318 gene locus_tag LOCUS_01850 183289 182318 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989636.1 protein_id gnl|my_center|LOCUS_01850 183544 183469 gene locus_tag LOCUS_t00070 183544 183469 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 183676 184839 gene locus_tag LOCUS_01860 183676 184839 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386952.1 protein_id gnl|my_center|LOCUS_01860 184955 185027 gene locus_tag LOCUS_t00080 184955 185027 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 185188 185421 gene locus_tag LOCUS_01870 185188 185421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 185426 185860 gene locus_tag LOCUS_01880 185426 185860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 186075 187247 gene locus_tag LOCUS_01890 186075 187247 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969590.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01890 187269 187673 gene locus_tag LOCUS_01900 187269 187673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434963.1 protein_id gnl|my_center|LOCUS_01900 187670 187975 gene locus_tag LOCUS_01910 187670 187975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 187977 188567 gene locus_tag LOCUS_01920 187977 188567 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071130048.1 protein_id gnl|my_center|LOCUS_01920 188582 188794 gene locus_tag LOCUS_01930 188582 188794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 188821 189108 gene locus_tag LOCUS_01940 188821 189108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289767.1 protein_id gnl|my_center|LOCUS_01940 189306 190304 gene locus_tag LOCUS_01950 189306 190304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 190897 191424 gene locus_tag LOCUS_01960 190897 191424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 192598 191591 gene locus_tag LOCUS_01970 192598 191591 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286484.1 protein_id gnl|my_center|LOCUS_01970 192806 192609 gene locus_tag LOCUS_01980 192806 192609 CDS product phage holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379919.1 protein_id gnl|my_center|LOCUS_01980 193060 192818 gene locus_tag LOCUS_01990 193060 192818 CDS product hemolysin XhlA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379918.1 protein_id gnl|my_center|LOCUS_01990 193241 193116 gene locus_tag LOCUS_02000 193241 193116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 193743 193393 gene locus_tag LOCUS_02010 193743 193393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 195641 193755 gene locus_tag LOCUS_02020 195641 193755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 196433 195654 gene locus_tag LOCUS_02030 196433 195654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 197494 196445 gene locus_tag LOCUS_02040 197494 196445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 198369 197491 gene locus_tag LOCUS_02050 198369 197491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 204871 198371 gene locus_tag LOCUS_02060 204871 198371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 205162 204899 gene locus_tag LOCUS_02070 205162 204899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 205794 205216 gene locus_tag LOCUS_02080 205794 205216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 206669 205851 gene locus_tag LOCUS_02090 206669 205851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 206923 206669 gene locus_tag LOCUS_02100 206923 206669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 207289 206936 gene locus_tag LOCUS_02110 207289 206936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 207729 207304 gene locus_tag LOCUS_02120 207729 207304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 208090 207731 gene locus_tag LOCUS_02130 208090 207731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 208487 208080 gene locus_tag LOCUS_02140 208487 208080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 208817 208497 gene locus_tag LOCUS_02150 208817 208497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 209781 208831 gene locus_tag LOCUS_02160 209781 208831 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229922.1 protein_id gnl|my_center|LOCUS_02160 210863 209781 gene locus_tag LOCUS_02170 210863 209781 CDS product XkdF-like putative serine protease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229921.1 protein_id gnl|my_center|LOCUS_02170 211080 210907 gene locus_tag LOCUS_02180 211080 210907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 211960 211094 gene locus_tag LOCUS_02190 211960 211094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 213485 211962 gene locus_tag LOCUS_02200 213485 211962 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398894.1 protein_id gnl|my_center|LOCUS_02200 214944 213496 gene locus_tag LOCUS_02210 gene terL 214944 213496 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399999.1 protein_id gnl|my_center|LOCUS_02210 215350 214928 gene locus_tag LOCUS_02220 215350 214928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 216207 215416 gene locus_tag LOCUS_02230 216207 215416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 217140 216724 gene locus_tag LOCUS_02240 217140 216724 CDS product autolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706497.1 protein_id gnl|my_center|LOCUS_02240 217518 217330 gene locus_tag LOCUS_02250 217518 217330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 217697 217515 gene locus_tag LOCUS_02260 217697 217515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 217961 217698 gene locus_tag LOCUS_02270 217961 217698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 218365 217958 gene locus_tag LOCUS_02280 218365 217958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 218898 218368 gene locus_tag LOCUS_02290 218898 218368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 219140 218901 gene locus_tag LOCUS_02300 219140 218901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 219829 219164 gene locus_tag LOCUS_02310 219829 219164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 220009 219830 gene locus_tag LOCUS_02320 220009 219830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 >Feature sequence02 534 220 gene locus_tag LOCUS_02330 534 220 CDS product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387034.1 protein_id gnl|my_center|LOCUS_02330 620 1180 gene locus_tag LOCUS_02340 620 1180 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223119.1 protein_id gnl|my_center|LOCUS_02340 2497 1232 gene locus_tag LOCUS_02350 gene dltD 2497 1232 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288094.1 protein_id gnl|my_center|LOCUS_02350 2730 2497 gene locus_tag LOCUS_02360 gene dltC 2730 2497 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356389.1 protein_id gnl|my_center|LOCUS_02360 4150 2930 gene locus_tag LOCUS_02370 gene dltB 4150 2930 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288090.1 protein_id gnl|my_center|LOCUS_02370 5661 4150 gene locus_tag LOCUS_02380 gene dltA 5661 4150 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356385.1 protein_id gnl|my_center|LOCUS_02380 5847 5698 gene locus_tag LOCUS_02390 5847 5698 CDS product teichoic acid D-Ala incorporation-associated protein DltX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288113.1 protein_id gnl|my_center|LOCUS_02390 8035 6023 gene locus_tag LOCUS_02400 8035 6023 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387200.1 protein_id gnl|my_center|LOCUS_02400 8792 8025 gene locus_tag LOCUS_02410 8792 8025 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288085.1 protein_id gnl|my_center|LOCUS_02410 9180 11369 gene locus_tag LOCUS_02420 gene nrdD 9180 11369 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288083.1 protein_id gnl|my_center|LOCUS_02420 11451 12053 gene locus_tag LOCUS_02430 gene nrdG 11451 12053 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288081.1 protein_id gnl|my_center|LOCUS_02430 13166 12045 gene locus_tag LOCUS_02440 gene dinB 13166 12045 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294035.1 protein_id gnl|my_center|LOCUS_02440 13998 13468 gene locus_tag LOCUS_02450 13998 13468 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294835.1 protein_id gnl|my_center|LOCUS_02450 15206 14178 gene locus_tag LOCUS_02460 15206 14178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 17432 15315 gene locus_tag LOCUS_02470 gene copB 17432 15315 CDS product copper/silver-translocating P-type ATPase CopB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296533.1 protein_id gnl|my_center|LOCUS_02470 19619 17445 gene locus_tag LOCUS_02480 19619 17445 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289041.1 protein_id gnl|my_center|LOCUS_02480 19829 19620 gene locus_tag LOCUS_02490 gene copZ 19829 19620 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289040.1 protein_id gnl|my_center|LOCUS_02490 20296 19856 gene locus_tag LOCUS_02500 20296 19856 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289038.1 protein_id gnl|my_center|LOCUS_02500 22511 20454 gene locus_tag LOCUS_02510 22511 20454 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002327795.1 protein_id gnl|my_center|LOCUS_02510 22759 23397 gene locus_tag LOCUS_02520 22759 23397 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220164.1 protein_id gnl|my_center|LOCUS_02520 23472 23723 gene locus_tag LOCUS_02530 23472 23723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 23762 23962 gene locus_tag LOCUS_02540 23762 23962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 25310 24012 gene locus_tag LOCUS_02550 gene asnS 25310 24012 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288767.1 protein_id gnl|my_center|LOCUS_02550 26537 25350 gene locus_tag LOCUS_02560 26537 25350 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296294.1 protein_id gnl|my_center|LOCUS_02560 27068 26565 gene locus_tag LOCUS_02570 27068 26565 CDS product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321579.1 protein_id gnl|my_center|LOCUS_02570 29876 27123 gene locus_tag LOCUS_02580 29876 27123 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288763.1 protein_id gnl|my_center|LOCUS_02580 30348 30148 gene locus_tag LOCUS_02590 30348 30148 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288762.1 protein_id gnl|my_center|LOCUS_02590 31643 30540 gene locus_tag LOCUS_02600 31643 30540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288760.1 protein_id gnl|my_center|LOCUS_02600 32235 32774 gene locus_tag LOCUS_02610 32235 32774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 33154 32810 gene locus_tag LOCUS_02620 33154 32810 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461711.1 protein_id gnl|my_center|LOCUS_02620 34389 33175 gene locus_tag LOCUS_02630 34389 33175 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906047.1 protein_id gnl|my_center|LOCUS_02630 35395 34541 gene locus_tag LOCUS_02640 gene rsmI 35395 34541 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288078.1 protein_id gnl|my_center|LOCUS_02640 35898 35548 gene locus_tag LOCUS_02650 35898 35548 CDS product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288076.1 protein_id gnl|my_center|LOCUS_02650 36707 35895 gene locus_tag LOCUS_02660 36707 35895 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356371.1 protein_id gnl|my_center|LOCUS_02660 37672 36734 gene locus_tag LOCUS_02670 gene holB 37672 36734 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288071.1 protein_id gnl|my_center|LOCUS_02670 38003 37674 gene locus_tag LOCUS_02680 38003 37674 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356367.1 protein_id gnl|my_center|LOCUS_02680 38660 38016 gene locus_tag LOCUS_02690 gene tmk 38660 38016 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294039.1 protein_id gnl|my_center|LOCUS_02690 39320 38724 gene locus_tag LOCUS_02700 gene recR 39320 38724 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296223.1 protein_id gnl|my_center|LOCUS_02700 39663 39349 gene locus_tag LOCUS_02710 39663 39349 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384048.1 protein_id gnl|my_center|LOCUS_02710 41500 39755 gene locus_tag LOCUS_02720 gene dnaX 41500 39755 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294042.1 protein_id gnl|my_center|LOCUS_02720 41683 42918 gene locus_tag LOCUS_02730 41683 42918 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356656.1 protein_id gnl|my_center|LOCUS_02730 42949 44022 gene locus_tag LOCUS_02740 42949 44022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379688.1 protein_id gnl|my_center|LOCUS_02740 44019 44813 gene locus_tag LOCUS_02750 44019 44813 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289232.1 protein_id gnl|my_center|LOCUS_02750 44957 46249 gene locus_tag LOCUS_02760 44957 46249 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299522.1 protein_id gnl|my_center|LOCUS_02760 46820 46335 gene locus_tag LOCUS_02770 46820 46335 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905253.1 protein_id gnl|my_center|LOCUS_02770 47281 48219 gene locus_tag LOCUS_02780 47281 48219 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289548.1 protein_id gnl|my_center|LOCUS_02780 50611 48263 gene locus_tag LOCUS_02790 50611 48263 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286325.1 protein_id gnl|my_center|LOCUS_02790 50742 51416 gene locus_tag LOCUS_02800 50742 51416 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286323.1 protein_id gnl|my_center|LOCUS_02800 51413 52462 gene locus_tag LOCUS_02810 51413 52462 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296820.1 protein_id gnl|my_center|LOCUS_02810 52550 52858 gene locus_tag LOCUS_02820 52550 52858 CDS product phenylalanyl-tRNA synthetase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287909.1 protein_id gnl|my_center|LOCUS_02820 53208 52891 gene locus_tag LOCUS_02830 53208 52891 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295896.1 protein_id gnl|my_center|LOCUS_02830 53956 53201 gene locus_tag LOCUS_02840 53956 53201 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295898.1 protein_id gnl|my_center|LOCUS_02840 54417 55106 gene locus_tag LOCUS_02850 54417 55106 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286265.1 protein_id gnl|my_center|LOCUS_02850 55700 55185 gene locus_tag LOCUS_02860 gene vanZ1 55700 55185 CDS product glycopeptide resistance protein VanZ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889012.1 protein_id gnl|my_center|LOCUS_02860 56543 55728 gene locus_tag LOCUS_02870 56543 55728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 57581 56631 gene locus_tag LOCUS_02880 57581 56631 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360063.1 protein_id gnl|my_center|LOCUS_02880 57750 58211 gene locus_tag LOCUS_02890 57750 58211 CDS product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565333.1 protein_id gnl|my_center|LOCUS_02890 58327 60069 gene locus_tag LOCUS_02900 58327 60069 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296551.1 protein_id gnl|my_center|LOCUS_02900 60333 60908 gene locus_tag LOCUS_02910 gene amaP 60333 60908 CDS product alkaline shock response membrane anchor protein AmaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296677.1 protein_id gnl|my_center|LOCUS_02910 60920 61108 gene locus_tag LOCUS_02920 60920 61108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 61184 61720 gene locus_tag LOCUS_02930 61184 61720 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356090.1 protein_id gnl|my_center|LOCUS_02930 62770 61808 gene locus_tag LOCUS_02940 62770 61808 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_02940 63852 62848 gene locus_tag LOCUS_02950 63852 62848 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294378.1 protein_id gnl|my_center|LOCUS_02950 64626 63955 gene locus_tag LOCUS_02960 64626 63955 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286060.1 protein_id gnl|my_center|LOCUS_02960 65698 64628 gene locus_tag LOCUS_02970 65698 64628 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286061.1 protein_id gnl|my_center|LOCUS_02970 65812 66402 gene locus_tag LOCUS_02980 65812 66402 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286057.1 protein_id gnl|my_center|LOCUS_02980 68398 66491 gene locus_tag LOCUS_02990 gene thrS 68398 66491 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243399.1 protein_id gnl|my_center|LOCUS_02990 71451 68770 gene locus_tag LOCUS_03000 71451 68770 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286287.1 protein_id gnl|my_center|LOCUS_03000 72929 71586 gene locus_tag LOCUS_03010 72929 71586 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_03010 73211 72942 gene locus_tag LOCUS_03020 73211 72942 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721327.1 protein_id gnl|my_center|LOCUS_03020 73731 74462 gene locus_tag LOCUS_03030 gene nfsA 73731 74462 CDS product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129881459.1 protein_id gnl|my_center|LOCUS_03030 75224 74481 gene locus_tag LOCUS_03040 75224 74481 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485222.1 protein_id gnl|my_center|LOCUS_03040 76291 75353 gene locus_tag LOCUS_03050 76291 75353 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002415541.1 protein_id gnl|my_center|LOCUS_03050 76717 76355 gene locus_tag LOCUS_03060 76717 76355 CDS product YbgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990406.1 protein_id gnl|my_center|LOCUS_03060 77576 76896 gene locus_tag LOCUS_03070 77576 76896 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101847.1 protein_id gnl|my_center|LOCUS_03070 78690 77734 gene locus_tag LOCUS_03080 78690 77734 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101846.1 protein_id gnl|my_center|LOCUS_03080 78910 79386 gene locus_tag LOCUS_03090 78910 79386 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_03090 80064 79414 gene locus_tag LOCUS_03100 80064 79414 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439746.1 protein_id gnl|my_center|LOCUS_03100 80223 80906 gene locus_tag LOCUS_03110 80223 80906 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287133.1 protein_id gnl|my_center|LOCUS_03110 81015 82040 gene locus_tag LOCUS_03120 81015 82040 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622700.1 protein_id gnl|my_center|LOCUS_03120 83642 82083 gene locus_tag LOCUS_03130 83642 82083 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773841.1 protein_id gnl|my_center|LOCUS_03130 84385 83798 gene locus_tag LOCUS_03140 84385 83798 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721539.1 protein_id gnl|my_center|LOCUS_03140 84904 86337 gene locus_tag LOCUS_03150 84904 86337 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476248.1 protein_id gnl|my_center|LOCUS_03150 86521 87201 gene locus_tag LOCUS_03160 86521 87201 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567846.1 protein_id gnl|my_center|LOCUS_03160 87674 87249 gene locus_tag LOCUS_03170 87674 87249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 87905 89347 gene locus_tag LOCUS_03180 87905 89347 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288779.1 protein_id gnl|my_center|LOCUS_03180 89487 90227 gene locus_tag LOCUS_03190 89487 90227 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386601.1 protein_id gnl|my_center|LOCUS_03190 90247 91320 gene locus_tag LOCUS_03200 gene pepA 90247 91320 CDS product glutamyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355013.1 protein_id gnl|my_center|LOCUS_03200 91686 94355 gene locus_tag LOCUS_03210 91686 94355 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294372.1 protein_id gnl|my_center|LOCUS_03210 95134 94403 gene locus_tag LOCUS_03220 95134 94403 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701034.1 protein_id gnl|my_center|LOCUS_03220 95799 95146 gene locus_tag LOCUS_03230 95799 95146 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642440.1 protein_id gnl|my_center|LOCUS_03230 96591 95818 gene locus_tag LOCUS_03240 96591 95818 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966597.1 protein_id gnl|my_center|LOCUS_03240 97773 96613 gene locus_tag LOCUS_03250 97773 96613 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289438.1 protein_id gnl|my_center|LOCUS_03250 99016 98216 gene locus_tag LOCUS_03260 gene dapB 99016 98216 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948499.1 protein_id gnl|my_center|LOCUS_03260 100186 99131 gene locus_tag LOCUS_03270 100186 99131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 101012 100365 gene locus_tag LOCUS_03280 101012 100365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 101241 101462 gene locus_tag LOCUS_03290 101241 101462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 102130 101495 gene locus_tag LOCUS_03300 102130 101495 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566214.1 protein_id gnl|my_center|LOCUS_03300 103746 102136 gene locus_tag LOCUS_03310 103746 102136 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674618.1 protein_id gnl|my_center|LOCUS_03310 104653 103736 gene locus_tag LOCUS_03320 104653 103736 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570727.1 protein_id gnl|my_center|LOCUS_03320 104859 105500 gene locus_tag LOCUS_03330 104859 105500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 106296 105532 gene locus_tag LOCUS_03340 106296 105532 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454389.1 protein_id gnl|my_center|LOCUS_03340 107462 106284 gene locus_tag LOCUS_03350 107462 106284 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298064.1 protein_id gnl|my_center|LOCUS_03350 108753 108100 gene locus_tag LOCUS_03360 108753 108100 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362617.1 protein_id gnl|my_center|LOCUS_03360 109320 108898 gene locus_tag LOCUS_03370 109320 108898 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889078.1 protein_id gnl|my_center|LOCUS_03370 110122 109322 gene locus_tag LOCUS_03380 110122 109322 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811658.1 protein_id gnl|my_center|LOCUS_03380 110249 110977 gene locus_tag LOCUS_03390 110249 110977 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836425.1 protein_id gnl|my_center|LOCUS_03390 112708 111023 gene locus_tag LOCUS_03400 112708 111023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 113385 113155 gene locus_tag LOCUS_03410 113385 113155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 114017 113403 gene locus_tag LOCUS_03420 114017 113403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 114572 114045 gene locus_tag LOCUS_03430 114572 114045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 116792 114582 gene locus_tag LOCUS_03440 116792 114582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 118058 117234 gene locus_tag LOCUS_03450 118058 117234 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860817.1 protein_id gnl|my_center|LOCUS_03450 120060 118063 gene locus_tag LOCUS_03460 120060 118063 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860818.1 protein_id gnl|my_center|LOCUS_03460 120422 120192 gene locus_tag LOCUS_03470 120422 120192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 121025 120438 gene locus_tag LOCUS_03480 121025 120438 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948871.1 protein_id gnl|my_center|LOCUS_03480 121872 121177 gene locus_tag LOCUS_03490 121872 121177 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358533.1 protein_id gnl|my_center|LOCUS_03490 122702 122031 gene locus_tag LOCUS_03500 122702 122031 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989496.1 protein_id gnl|my_center|LOCUS_03500 123617 122742 gene locus_tag LOCUS_03510 123617 122742 CDS product ketose 1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128442.1 protein_id gnl|my_center|LOCUS_03510 124354 123635 gene locus_tag LOCUS_03520 124354 123635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 125545 124511 gene locus_tag LOCUS_03530 125545 124511 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680926.1 protein_id gnl|my_center|LOCUS_03530 126905 125976 gene locus_tag LOCUS_03540 126905 125976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 127866 126934 gene locus_tag LOCUS_03550 127866 126934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 129081 128044 gene locus_tag LOCUS_03560 129081 128044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 130224 129397 gene locus_tag LOCUS_03570 130224 129397 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066547.1 protein_id gnl|my_center|LOCUS_03570 131246 130224 gene locus_tag LOCUS_03580 131246 130224 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001304165.1 protein_id gnl|my_center|LOCUS_03580 132875 131271 gene locus_tag LOCUS_03590 132875 131271 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_03590 133971 132988 gene locus_tag LOCUS_03600 gene appF 133971 132988 CDS product oligopeptide ABC transporter ATP-binding protein AppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232964.1 protein_id gnl|my_center|LOCUS_03600 134964 133972 gene locus_tag LOCUS_03610 134964 133972 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_03610 135792 135358 gene locus_tag LOCUS_03620 135792 135358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 136719 135982 gene locus_tag LOCUS_03630 136719 135982 CDS product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378063.1 protein_id gnl|my_center|LOCUS_03630 137823 136720 gene locus_tag LOCUS_03640 137823 136720 CDS product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706694.1 protein_id gnl|my_center|LOCUS_03640 138919 137813 gene locus_tag LOCUS_03650 138919 137813 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288305.1 protein_id gnl|my_center|LOCUS_03650 139627 138935 gene locus_tag LOCUS_03660 139627 138935 CDS product DUF4310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288307.1 protein_id gnl|my_center|LOCUS_03660 140547 139768 gene locus_tag LOCUS_03670 140547 139768 CDS product DUF4311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288309.1 protein_id gnl|my_center|LOCUS_03670 140940 140590 gene locus_tag LOCUS_03680 140940 140590 CDS product DUF4312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288312.1 protein_id gnl|my_center|LOCUS_03680 141306 140953 gene locus_tag LOCUS_03690 141306 140953 CDS product glycine-rich SFCGS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355707.1 protein_id gnl|my_center|LOCUS_03690 141656 141324 gene locus_tag LOCUS_03700 141656 141324 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291790.1 protein_id gnl|my_center|LOCUS_03700 143518 141674 gene locus_tag LOCUS_03710 143518 141674 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297183.1 protein_id gnl|my_center|LOCUS_03710 144179 143946 gene locus_tag LOCUS_03720 144179 143946 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812819.1 protein_id gnl|my_center|LOCUS_03720 145169 144264 gene locus_tag LOCUS_03730 145169 144264 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721353.1 protein_id gnl|my_center|LOCUS_03730 145974 145654 gene locus_tag LOCUS_03740 145974 145654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 146620 146021 gene locus_tag LOCUS_03750 146620 146021 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288276.1 protein_id gnl|my_center|LOCUS_03750 150666 146692 gene locus_tag LOCUS_03760 150666 146692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 151539 150721 gene locus_tag LOCUS_03770 151539 150721 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828081.1 protein_id gnl|my_center|LOCUS_03770 153323 151686 gene locus_tag LOCUS_03780 153323 151686 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674873.1 protein_id gnl|my_center|LOCUS_03780 154411 154058 gene locus_tag LOCUS_03790 154411 154058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03790 154774 154424 gene locus_tag LOCUS_03800 154774 154424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03800 155687 154896 gene locus_tag LOCUS_03810 155687 154896 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338484.1 protein_id gnl|my_center|LOCUS_03810 156545 155700 gene locus_tag LOCUS_03820 156545 155700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 157243 156560 gene locus_tag LOCUS_03830 157243 156560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 157436 157236 gene locus_tag LOCUS_03840 157436 157236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 158456 157893 gene locus_tag LOCUS_03850 158456 157893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 159419 158589 gene locus_tag LOCUS_03860 159419 158589 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390188.1 protein_id gnl|my_center|LOCUS_03860 160374 159883 gene locus_tag LOCUS_03870 160374 159883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 161796 160375 gene locus_tag LOCUS_03880 161796 160375 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476415.1 protein_id gnl|my_center|LOCUS_03880 163167 161968 gene locus_tag LOCUS_03890 163167 161968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 164207 163185 gene locus_tag LOCUS_03900 164207 163185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 165300 164200 gene locus_tag LOCUS_03910 165300 164200 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141777.1 protein_id gnl|my_center|LOCUS_03910 166058 165297 gene locus_tag LOCUS_03920 166058 165297 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612460.1 protein_id gnl|my_center|LOCUS_03920 166624 166055 gene locus_tag LOCUS_03930 166624 166055 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963385.1 protein_id gnl|my_center|LOCUS_03930 167132 166638 gene locus_tag LOCUS_03940 167132 166638 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578443.1 protein_id gnl|my_center|LOCUS_03940 167581 167132 gene locus_tag LOCUS_03950 167581 167132 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_03950 168316 167600 gene locus_tag LOCUS_03960 168316 167600 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338481.1 protein_id gnl|my_center|LOCUS_03960 169105 168362 gene locus_tag LOCUS_03970 169105 168362 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338482.1 protein_id gnl|my_center|LOCUS_03970 169875 169117 gene locus_tag LOCUS_03980 169875 169117 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338483.1 protein_id gnl|my_center|LOCUS_03980 170677 169889 gene locus_tag LOCUS_03990 170677 169889 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338484.1 protein_id gnl|my_center|LOCUS_03990 171537 170692 gene locus_tag LOCUS_04000 171537 170692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 172200 171553 gene locus_tag LOCUS_04010 172200 171553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 172840 172229 gene locus_tag LOCUS_04020 172840 172229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 174700 173705 gene locus_tag LOCUS_04030 174700 173705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 175000 175563 gene locus_tag LOCUS_04040 gene ahpC 175000 175563 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288178.1 protein_id gnl|my_center|LOCUS_04040 175663 177195 gene locus_tag LOCUS_04050 gene ahpF 175663 177195 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296277.1 protein_id gnl|my_center|LOCUS_04050 177592 177263 gene locus_tag LOCUS_04060 177592 177263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 179106 178174 gene locus_tag LOCUS_04070 179106 178174 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948563.1 protein_id gnl|my_center|LOCUS_04070 179223 179852 gene locus_tag LOCUS_04080 179223 179852 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231388.1 protein_id gnl|my_center|LOCUS_04080 181256 180060 gene locus_tag LOCUS_04090 181256 180060 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355830.1 protein_id gnl|my_center|LOCUS_04090 182231 181452 gene locus_tag LOCUS_04100 182231 181452 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387023.1 protein_id gnl|my_center|LOCUS_04100 183290 182322 gene locus_tag LOCUS_04110 183290 182322 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002269117.1 protein_id gnl|my_center|LOCUS_04110 184130 183312 gene locus_tag LOCUS_04120 184130 183312 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905879.1 protein_id gnl|my_center|LOCUS_04120 184507 186027 gene locus_tag LOCUS_04130 184507 186027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 186198 187922 gene locus_tag LOCUS_04140 186198 187922 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294013.1 protein_id gnl|my_center|LOCUS_04140 187919 189676 gene locus_tag LOCUS_04150 187919 189676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289511.1 protein_id gnl|my_center|LOCUS_04150 190516 189956 gene locus_tag LOCUS_04160 190516 189956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 191933 191061 gene locus_tag LOCUS_04170 191933 191061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 192522 191962 gene locus_tag LOCUS_04180 192522 191962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 192728 192522 gene locus_tag LOCUS_04190 192728 192522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 193029 193385 gene locus_tag LOCUS_04200 193029 193385 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286580.1 protein_id gnl|my_center|LOCUS_04200 194746 194153 gene locus_tag LOCUS_04210 194746 194153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 195414 194758 gene locus_tag LOCUS_04220 195414 194758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 197092 195872 gene locus_tag LOCUS_04230 197092 195872 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461501.1 protein_id gnl|my_center|LOCUS_04230 198375 197203 gene locus_tag LOCUS_04240 198375 197203 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476434.1 protein_id gnl|my_center|LOCUS_04240 >Feature sequence03 250 1497 gene locus_tag LOCUS_04250 250 1497 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296026.1 protein_id gnl|my_center|LOCUS_04250 1621 2670 gene locus_tag LOCUS_04260 gene recA 1621 2670 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287328.1 protein_id gnl|my_center|LOCUS_04260 2914 4470 gene locus_tag LOCUS_04270 gene rny 2914 4470 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354863.1 protein_id gnl|my_center|LOCUS_04270 4628 7189 gene locus_tag LOCUS_04280 gene mprF 4628 7189 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287340.1 protein_id gnl|my_center|LOCUS_04280 7671 7267 gene locus_tag LOCUS_04290 7671 7267 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245063.1 protein_id gnl|my_center|LOCUS_04290 7872 8723 gene locus_tag LOCUS_04300 gene ispE 7872 8723 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321008.1 protein_id gnl|my_center|LOCUS_04300 8966 9934 gene locus_tag LOCUS_04310 8966 9934 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385462.1 protein_id gnl|my_center|LOCUS_04310 9966 10646 gene locus_tag LOCUS_04320 9966 10646 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356064.1 protein_id gnl|my_center|LOCUS_04320 10619 11449 gene locus_tag LOCUS_04330 10619 11449 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287344.1 protein_id gnl|my_center|LOCUS_04330 11691 12509 gene locus_tag LOCUS_04340 gene purR 11691 12509 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381336.1 protein_id gnl|my_center|LOCUS_04340 12845 14212 gene locus_tag LOCUS_04350 gene glmU 12845 14212 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287346.1 protein_id gnl|my_center|LOCUS_04350 14310 15281 gene locus_tag LOCUS_04360 14310 15281 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387396.1 protein_id gnl|my_center|LOCUS_04360 15431 17494 gene locus_tag LOCUS_04370 15431 17494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04370 17458 17847 gene locus_tag LOCUS_04380 17458 17847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 17854 18573 gene locus_tag LOCUS_04390 17854 18573 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048159.1 protein_id gnl|my_center|LOCUS_04390 20862 19360 gene locus_tag LOCUS_04400 20862 19360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 21033 21638 gene locus_tag LOCUS_04410 21033 21638 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297079.1 protein_id gnl|my_center|LOCUS_04410 22404 21661 gene locus_tag LOCUS_04420 22404 21661 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356242.1 protein_id gnl|my_center|LOCUS_04420 24067 22469 gene locus_tag LOCUS_04430 24067 22469 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297081.1 protein_id gnl|my_center|LOCUS_04430 24729 26759 gene locus_tag LOCUS_04440 24729 26759 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387321.1 protein_id gnl|my_center|LOCUS_04440 26759 27043 gene locus_tag LOCUS_04450 26759 27043 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912475.1 protein_id gnl|my_center|LOCUS_04450 27134 28498 gene locus_tag LOCUS_04460 27134 28498 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677358.1 protein_id gnl|my_center|LOCUS_04460 28514 29356 gene locus_tag LOCUS_04470 28514 29356 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203489.1 protein_id gnl|my_center|LOCUS_04470 29360 30310 gene locus_tag LOCUS_04480 29360 30310 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098117.1 protein_id gnl|my_center|LOCUS_04480 30396 31094 gene locus_tag LOCUS_04490 30396 31094 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297083.1 protein_id gnl|my_center|LOCUS_04490 31169 32002 gene locus_tag LOCUS_04500 31169 32002 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294234.1 protein_id gnl|my_center|LOCUS_04500 32004 32531 gene locus_tag LOCUS_04510 32004 32531 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294232.1 protein_id gnl|my_center|LOCUS_04510 33107 32544 gene locus_tag LOCUS_04520 gene def 33107 32544 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289284.1 protein_id gnl|my_center|LOCUS_04520 33374 33643 gene locus_tag LOCUS_04530 gene rpsO 33374 33643 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289282.1 protein_id gnl|my_center|LOCUS_04530 34255 36384 gene locus_tag LOCUS_04540 gene pnp 34255 36384 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378800.1 protein_id gnl|my_center|LOCUS_04540 36811 38808 gene locus_tag LOCUS_04550 36811 38808 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321207.1 protein_id gnl|my_center|LOCUS_04550 38956 39489 gene locus_tag LOCUS_04560 38956 39489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 40934 39561 gene locus_tag LOCUS_04570 40934 39561 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_04570 41381 41058 gene locus_tag LOCUS_04580 41381 41058 CDS product DUF960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289744.1 protein_id gnl|my_center|LOCUS_04580 42210 41593 gene locus_tag LOCUS_04590 42210 41593 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289745.1 protein_id gnl|my_center|LOCUS_04590 42699 43415 gene locus_tag LOCUS_04600 42699 43415 CDS product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289747.1 protein_id gnl|my_center|LOCUS_04600 43427 44113 gene locus_tag LOCUS_04610 43427 44113 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289749.1 protein_id gnl|my_center|LOCUS_04610 44184 44810 gene locus_tag LOCUS_04620 gene udk 44184 44810 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289751.1 protein_id gnl|my_center|LOCUS_04620 44945 44860 gene locus_tag LOCUS_t00090 44945 44860 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 45736 45050 gene locus_tag LOCUS_04630 gene gpmA 45736 45050 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294321.1 protein_id gnl|my_center|LOCUS_04630 46547 45867 gene locus_tag LOCUS_04640 gene rpiA 46547 45867 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363468.1 protein_id gnl|my_center|LOCUS_04640 46948 47361 gene locus_tag LOCUS_04650 gene rpsL 46948 47361 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356190.1 protein_id gnl|my_center|LOCUS_04650 47407 47877 gene locus_tag LOCUS_04660 gene rpsG 47407 47877 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356191.1 protein_id gnl|my_center|LOCUS_04660 47958 50042 gene locus_tag LOCUS_04670 gene fusA 47958 50042 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356192.1 protein_id gnl|my_center|LOCUS_04670 50207 51394 gene locus_tag LOCUS_04680 gene tuf 50207 51394 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290442.1 protein_id gnl|my_center|LOCUS_04680 51837 52145 gene locus_tag LOCUS_04690 gene rpsJ 51837 52145 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290443.1 protein_id gnl|my_center|LOCUS_04690 52168 52797 gene locus_tag LOCUS_04700 gene rplC 52168 52797 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290445.1 protein_id gnl|my_center|LOCUS_04700 52826 53449 gene locus_tag LOCUS_04710 gene rplD 52826 53449 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290446.1 protein_id gnl|my_center|LOCUS_04710 53449 53736 gene locus_tag LOCUS_04720 gene rplW 53449 53736 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290449.1 protein_id gnl|my_center|LOCUS_04720 53776 54609 gene locus_tag LOCUS_04730 gene rplB 53776 54609 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290451.1 protein_id gnl|my_center|LOCUS_04730 54652 54930 gene locus_tag LOCUS_04740 gene rpsS 54652 54930 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356205.1 protein_id gnl|my_center|LOCUS_04740 54952 55299 gene locus_tag LOCUS_04750 gene rplV 54952 55299 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288657.1 protein_id gnl|my_center|LOCUS_04750 55313 55969 gene locus_tag LOCUS_04760 gene rpsC 55313 55969 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356207.1 protein_id gnl|my_center|LOCUS_04760 55972 56406 gene locus_tag LOCUS_04770 gene rplP 55972 56406 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288661.1 protein_id gnl|my_center|LOCUS_04770 56396 56587 gene locus_tag LOCUS_04780 gene rpmC 56396 56587 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288664.1 protein_id gnl|my_center|LOCUS_04780 56609 56875 gene locus_tag LOCUS_04790 gene rpsQ 56609 56875 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359348.1 protein_id gnl|my_center|LOCUS_04790 56931 57299 gene locus_tag LOCUS_04800 gene rplN 56931 57299 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288669.1 protein_id gnl|my_center|LOCUS_04800 57335 57646 gene locus_tag LOCUS_04810 gene rplX 57335 57646 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356212.1 protein_id gnl|my_center|LOCUS_04810 57673 58212 gene locus_tag LOCUS_04820 gene rplE 57673 58212 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288671.1 protein_id gnl|my_center|LOCUS_04820 58230 58415 gene locus_tag LOCUS_04830 58230 58415 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356214.1 protein_id gnl|my_center|LOCUS_04830 58448 58846 gene locus_tag LOCUS_04840 gene rpsH 58448 58846 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356215.1 protein_id gnl|my_center|LOCUS_04840 58878 59414 gene locus_tag LOCUS_04850 gene rplF 58878 59414 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288677.1 protein_id gnl|my_center|LOCUS_04850 59467 59823 gene locus_tag LOCUS_04860 gene rplR 59467 59823 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356218.1 protein_id gnl|my_center|LOCUS_04860 59844 60344 gene locus_tag LOCUS_04870 gene rpsE 59844 60344 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356219.1 protein_id gnl|my_center|LOCUS_04870 60359 60538 gene locus_tag LOCUS_04880 gene rpmD 60359 60538 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288686.1 protein_id gnl|my_center|LOCUS_04880 60579 61019 gene locus_tag LOCUS_04890 gene rplO 60579 61019 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288687.1 protein_id gnl|my_center|LOCUS_04890 61019 62320 gene locus_tag LOCUS_04900 gene secY 61019 62320 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288688.1 protein_id gnl|my_center|LOCUS_04900 62382 63029 gene locus_tag LOCUS_04910 62382 63029 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288690.1 protein_id gnl|my_center|LOCUS_04910 63205 63423 gene locus_tag LOCUS_04920 gene infA 63205 63423 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356224.1 protein_id gnl|my_center|LOCUS_04920 63592 63957 gene locus_tag LOCUS_04930 gene rpsM 63592 63957 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288713.1 protein_id gnl|my_center|LOCUS_04930 63982 64371 gene locus_tag LOCUS_04940 gene rpsK 63982 64371 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288714.1 protein_id gnl|my_center|LOCUS_04940 64451 65389 gene locus_tag LOCUS_04950 64451 65389 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774253.1 protein_id gnl|my_center|LOCUS_04950 65417 65797 gene locus_tag LOCUS_04960 gene rplQ 65417 65797 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288716.1 protein_id gnl|my_center|LOCUS_04960 66051 66887 gene locus_tag LOCUS_04970 66051 66887 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359354.1 protein_id gnl|my_center|LOCUS_04970 66863 67732 gene locus_tag LOCUS_04980 66863 67732 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288722.1 protein_id gnl|my_center|LOCUS_04980 67722 68519 gene locus_tag LOCUS_04990 67722 68519 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288724.1 protein_id gnl|my_center|LOCUS_04990 68720 69187 gene locus_tag LOCUS_05000 68720 69187 CDS product DUF6434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247875.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05000 69285 70031 gene locus_tag LOCUS_05010 gene truA 69285 70031 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288727.1 protein_id gnl|my_center|LOCUS_05010 72685 70088 gene locus_tag LOCUS_05020 72685 70088 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288728.1 protein_id gnl|my_center|LOCUS_05020 73120 72932 gene locus_tag LOCUS_05030 gene rpmB 73120 72932 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290463.1 protein_id gnl|my_center|LOCUS_05030 73443 73805 gene locus_tag LOCUS_05040 73443 73805 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294298.1 protein_id gnl|my_center|LOCUS_05040 73835 75517 gene locus_tag LOCUS_05050 73835 75517 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289723.1 protein_id gnl|my_center|LOCUS_05050 75699 77732 gene locus_tag LOCUS_05060 gene recG 75699 77732 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370092.1 protein_id gnl|my_center|LOCUS_05060 77847 78848 gene locus_tag LOCUS_05070 gene plsX 77847 78848 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387382.1 protein_id gnl|my_center|LOCUS_05070 78966 79211 gene locus_tag LOCUS_05080 gene acpP 78966 79211 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354939.1 protein_id gnl|my_center|LOCUS_05080 79379 80074 gene locus_tag LOCUS_05090 gene rnc 79379 80074 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287896.1 protein_id gnl|my_center|LOCUS_05090 80238 83831 gene locus_tag LOCUS_05100 gene smc 80238 83831 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287897.1 protein_id gnl|my_center|LOCUS_05100 83828 84646 gene locus_tag LOCUS_05110 83828 84646 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359053.1 protein_id gnl|my_center|LOCUS_05110 84668 86029 gene locus_tag LOCUS_05120 gene ftsY 84668 86029 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387379.1 protein_id gnl|my_center|LOCUS_05120 86429 88690 gene locus_tag LOCUS_05130 gene gshAB 86429 88690 CDS product bifunctional glutamate--cysteine ligase/glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399785.1 protein_id gnl|my_center|LOCUS_05130 89268 88711 gene locus_tag LOCUS_05140 89268 88711 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705809.1 protein_id gnl|my_center|LOCUS_05140 89669 89268 gene locus_tag LOCUS_05150 89669 89268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 89803 90702 gene locus_tag LOCUS_05160 89803 90702 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287911.1 protein_id gnl|my_center|LOCUS_05160 90719 92065 gene locus_tag LOCUS_05170 90719 92065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296549.1 protein_id gnl|my_center|LOCUS_05170 92049 92498 gene locus_tag LOCUS_05180 92049 92498 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379156.1 protein_id gnl|my_center|LOCUS_05180 92599 93663 gene locus_tag LOCUS_05190 92599 93663 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293424.1 protein_id gnl|my_center|LOCUS_05190 93828 95183 gene locus_tag LOCUS_05200 93828 95183 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311357.1 protein_id gnl|my_center|LOCUS_05200 95514 97064 gene locus_tag LOCUS_05210 95514 97064 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355724.1 protein_id gnl|my_center|LOCUS_05210 97213 97563 gene locus_tag LOCUS_05220 gene acpS 97213 97563 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296554.1 protein_id gnl|my_center|LOCUS_05220 97583 98710 gene locus_tag LOCUS_05230 gene alr 97583 98710 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296555.1 protein_id gnl|my_center|LOCUS_05230 98777 99148 gene locus_tag LOCUS_05240 98777 99148 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289874.1 protein_id gnl|my_center|LOCUS_05240 99365 99667 gene locus_tag LOCUS_05250 99365 99667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 99648 99860 gene locus_tag LOCUS_05260 99648 99860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 100904 99888 gene locus_tag LOCUS_05270 100904 99888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 101148 102602 gene locus_tag LOCUS_05280 101148 102602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 102687 104339 gene locus_tag LOCUS_05290 102687 104339 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287495.1 protein_id gnl|my_center|LOCUS_05290 104487 106226 gene locus_tag LOCUS_05300 104487 106226 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_05300 106300 108096 gene locus_tag LOCUS_05310 106300 108096 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_05310 108207 108653 gene locus_tag LOCUS_05320 108207 108653 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627840.1 protein_id gnl|my_center|LOCUS_05320 108672 109604 gene locus_tag LOCUS_05330 108672 109604 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294206.1 protein_id gnl|my_center|LOCUS_05330 109606 109923 gene locus_tag LOCUS_05340 109606 109923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 110078 112813 gene locus_tag LOCUS_05350 110078 112813 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296556.1 protein_id gnl|my_center|LOCUS_05350 112990 114813 gene locus_tag LOCUS_05360 112990 114813 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294202.1 protein_id gnl|my_center|LOCUS_05360 115049 115495 gene locus_tag LOCUS_05370 115049 115495 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811587.1 protein_id gnl|my_center|LOCUS_05370 115495 117876 gene locus_tag LOCUS_05380 115495 117876 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 protein_id gnl|my_center|LOCUS_05380 117892 119736 gene locus_tag LOCUS_05390 117892 119736 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_05390 120380 119787 gene locus_tag LOCUS_05400 120380 119787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 121374 120370 gene locus_tag LOCUS_05410 121374 120370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 122198 121536 gene locus_tag LOCUS_05420 122198 121536 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302663.1 protein_id gnl|my_center|LOCUS_05420 123121 122204 gene locus_tag LOCUS_05430 123121 122204 CDS product osmoprotectant ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355743.1 protein_id gnl|my_center|LOCUS_05430 123760 123125 gene locus_tag LOCUS_05440 123760 123125 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355744.1 protein_id gnl|my_center|LOCUS_05440 124935 123763 gene locus_tag LOCUS_05450 124935 123763 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294192.1 protein_id gnl|my_center|LOCUS_05450 125367 126398 gene locus_tag LOCUS_05460 gene queA 125367 126398 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296565.1 protein_id gnl|my_center|LOCUS_05460 126992 129634 gene locus_tag LOCUS_05470 126992 129634 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355749.1 protein_id gnl|my_center|LOCUS_05470 129833 130978 gene locus_tag LOCUS_05480 gene tgt 129833 130978 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748618.1 protein_id gnl|my_center|LOCUS_05480 131064 131432 gene locus_tag LOCUS_05490 131064 131432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 131697 133289 gene locus_tag LOCUS_05500 131697 133289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 133568 136168 gene locus_tag LOCUS_05510 gene adhE 133568 136168 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296567.1 protein_id gnl|my_center|LOCUS_05510 136206 136403 gene locus_tag LOCUS_05520 136206 136403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 136448 136921 gene locus_tag LOCUS_05530 136448 136921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 137056 138282 gene locus_tag LOCUS_05540 137056 138282 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989624.1 protein_id gnl|my_center|LOCUS_05540 138197 138838 gene locus_tag LOCUS_05550 138197 138838 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728586.1 protein_id gnl|my_center|LOCUS_05550 139900 138857 gene locus_tag LOCUS_05560 gene fni 139900 138857 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288234.1 protein_id gnl|my_center|LOCUS_05560 140978 139890 gene locus_tag LOCUS_05570 140978 139890 CDS product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355777.1 protein_id gnl|my_center|LOCUS_05570 141974 140979 gene locus_tag LOCUS_05580 gene mvaD 141974 140979 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109469.1 protein_id gnl|my_center|LOCUS_05580 142902 141961 gene locus_tag LOCUS_05590 gene mvk 142902 141961 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288231.1 protein_id gnl|my_center|LOCUS_05590 143190 143942 gene locus_tag LOCUS_05600 143190 143942 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294164.1 protein_id gnl|my_center|LOCUS_05600 145590 143968 gene locus_tag LOCUS_05610 145590 143968 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382266.1 protein_id gnl|my_center|LOCUS_05610 147218 145593 gene locus_tag LOCUS_05620 147218 145593 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329642.1 protein_id gnl|my_center|LOCUS_05620 149030 147264 gene locus_tag LOCUS_05630 149030 147264 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379398.1 protein_id gnl|my_center|LOCUS_05630 150148 149045 gene locus_tag LOCUS_05640 gene ugpC 150148 149045 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922688.1 protein_id gnl|my_center|LOCUS_05640 150480 151736 gene locus_tag LOCUS_05650 150480 151736 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262976.1 protein_id gnl|my_center|LOCUS_05650 151832 153193 gene locus_tag LOCUS_05660 151832 153193 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262977.1 protein_id gnl|my_center|LOCUS_05660 153190 154032 gene locus_tag LOCUS_05670 153190 154032 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035401.1 protein_id gnl|my_center|LOCUS_05670 154187 155092 gene locus_tag LOCUS_05680 154187 155092 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294163.1 protein_id gnl|my_center|LOCUS_05680 155939 155130 gene locus_tag LOCUS_05690 155939 155130 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101369.1 protein_id gnl|my_center|LOCUS_05690 157055 156018 gene locus_tag LOCUS_05700 157055 156018 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354721.1 protein_id gnl|my_center|LOCUS_05700 157344 157868 gene locus_tag LOCUS_05710 gene infC 157344 157868 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355797.1 protein_id gnl|my_center|LOCUS_05710 157942 158142 gene locus_tag LOCUS_05720 gene rpmI 157942 158142 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355798.1 protein_id gnl|my_center|LOCUS_05720 158204 158563 gene locus_tag LOCUS_05730 gene rplT 158204 158563 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289310.1 protein_id gnl|my_center|LOCUS_05730 159812 158601 gene locus_tag LOCUS_05740 159812 158601 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101803.1 protein_id gnl|my_center|LOCUS_05740 160629 159907 gene locus_tag LOCUS_05750 160629 159907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 160842 161030 gene locus_tag LOCUS_05760 160842 161030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 161034 161462 gene locus_tag LOCUS_05770 161034 161462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05770 161404 161706 gene locus_tag LOCUS_05780 161404 161706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05780 161719 162012 gene locus_tag LOCUS_05790 161719 162012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 162213 162809 gene locus_tag LOCUS_05800 162213 162809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 162951 163127 gene locus_tag LOCUS_05810 162951 163127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 163127 163420 gene locus_tag LOCUS_05820 163127 163420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 163413 163583 gene locus_tag LOCUS_05830 163413 163583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 163580 163810 gene locus_tag LOCUS_05840 163580 163810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 163807 164697 gene locus_tag LOCUS_05850 163807 164697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 164705 166291 gene locus_tag LOCUS_05860 164705 166291 CDS product DNA primase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476496.1 protein_id gnl|my_center|LOCUS_05860 166548 166724 gene locus_tag LOCUS_05870 166548 166724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 166726 167046 gene locus_tag LOCUS_05880 166726 167046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 167095 167577 gene locus_tag LOCUS_05890 167095 167577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 167771 168394 gene locus_tag LOCUS_05900 167771 168394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 168613 169143 gene locus_tag LOCUS_05910 168613 169143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 169485 170150 gene locus_tag LOCUS_05920 169485 170150 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948799.1 protein_id gnl|my_center|LOCUS_05920 170162 170893 gene locus_tag LOCUS_05930 170162 170893 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964197.1 protein_id gnl|my_center|LOCUS_05930 170907 171752 gene locus_tag LOCUS_05940 170907 171752 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948800.1 protein_id gnl|my_center|LOCUS_05940 171809 172165 gene locus_tag LOCUS_05950 171809 172165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 172918 174270 gene locus_tag LOCUS_05960 gene brnQ 172918 174270 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294246.1 protein_id gnl|my_center|LOCUS_05960 174355 174627 gene locus_tag LOCUS_05970 174355 174627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 175740 176264 gene locus_tag LOCUS_05980 175740 176264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 176380 176568 gene locus_tag LOCUS_05990 176380 176568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 176919 177047 gene locus_tag LOCUS_06000 176919 177047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003681696.1 protein_id gnl|my_center|LOCUS_06000 177202 179754 gene locus_tag LOCUS_06010 177202 179754 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387348.1 protein_id gnl|my_center|LOCUS_06010 181212 179764 gene locus_tag LOCUS_06020 181212 179764 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189887.1 protein_id gnl|my_center|LOCUS_06020 181376 182302 gene locus_tag LOCUS_06030 181376 182302 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642346.1 protein_id gnl|my_center|LOCUS_06030 182731 186216 gene locus_tag LOCUS_06040 182731 186216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 186678 186262 gene locus_tag LOCUS_06050 186678 186262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 186847 187155 gene locus_tag LOCUS_06060 186847 187155 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116156.1 protein_id gnl|my_center|LOCUS_06060 188327 187275 gene locus_tag LOCUS_06070 188327 187275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 189148 190353 gene locus_tag LOCUS_06080 189148 190353 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289186.1 protein_id gnl|my_center|LOCUS_06080 190394 191395 gene locus_tag LOCUS_06090 190394 191395 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289187.1 protein_id gnl|my_center|LOCUS_06090 191640 192989 gene locus_tag LOCUS_06100 191640 192989 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296108.1 protein_id gnl|my_center|LOCUS_06100 193186 194619 gene locus_tag LOCUS_06110 193186 194619 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262788.1 protein_id gnl|my_center|LOCUS_06110 194679 194996 gene locus_tag LOCUS_06120 194679 194996 CDS product PTS cellobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029637.1 protein_id gnl|my_center|LOCUS_06120 195009 197027 gene locus_tag LOCUS_06130 195009 197027 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922395.1 protein_id gnl|my_center|LOCUS_06130 197040 197357 gene locus_tag LOCUS_06140 197040 197357 CDS product PTS cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262791.1 protein_id gnl|my_center|LOCUS_06140 >Feature sequence04 1168 215 gene locus_tag LOCUS_06150 gene glcK 1168 215 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_06150 2079 1168 gene locus_tag LOCUS_06160 2079 1168 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_06160 3150 2095 gene locus_tag LOCUS_06170 3150 2095 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 protein_id gnl|my_center|LOCUS_06170 3560 3171 gene locus_tag LOCUS_06180 3560 3171 CDS product DUF6379 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705011.1 protein_id gnl|my_center|LOCUS_06180 4584 3574 gene locus_tag LOCUS_06190 4584 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 5754 4660 gene locus_tag LOCUS_06200 5754 4660 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705009.1 protein_id gnl|my_center|LOCUS_06200 7339 5945 gene locus_tag LOCUS_06210 7339 5945 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032496674.1 protein_id gnl|my_center|LOCUS_06210 9931 7502 gene locus_tag LOCUS_06220 9931 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 10332 10111 gene locus_tag LOCUS_06230 10332 10111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 12377 10944 gene locus_tag LOCUS_06240 12377 10944 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440025.1 protein_id gnl|my_center|LOCUS_06240 14253 12388 gene locus_tag LOCUS_06250 14253 12388 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861829.1 protein_id gnl|my_center|LOCUS_06250 15095 14250 gene locus_tag LOCUS_06260 15095 14250 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891460.1 protein_id gnl|my_center|LOCUS_06260 16365 15484 gene locus_tag LOCUS_06270 16365 15484 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002312639.1 protein_id gnl|my_center|LOCUS_06270 17529 16411 gene locus_tag LOCUS_06280 17529 16411 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 protein_id gnl|my_center|LOCUS_06280 19613 17526 gene locus_tag LOCUS_06290 19613 17526 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287021.1 protein_id gnl|my_center|LOCUS_06290 20482 19661 gene locus_tag LOCUS_06300 20482 19661 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287022.1 protein_id gnl|my_center|LOCUS_06300 21291 20479 gene locus_tag LOCUS_06310 21291 20479 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287024.1 protein_id gnl|my_center|LOCUS_06310 21807 21313 gene locus_tag LOCUS_06320 21807 21313 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287026.1 protein_id gnl|my_center|LOCUS_06320 22241 21819 gene locus_tag LOCUS_06330 22241 21819 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287029.1 protein_id gnl|my_center|LOCUS_06330 25000 22385 gene locus_tag LOCUS_06340 25000 22385 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304269.1 protein_id gnl|my_center|LOCUS_06340 25804 25160 gene locus_tag LOCUS_06350 gene pcp 25804 25160 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287081.1 protein_id gnl|my_center|LOCUS_06350 26774 25830 gene locus_tag LOCUS_06360 26774 25830 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287082.1 protein_id gnl|my_center|LOCUS_06360 27467 26787 gene locus_tag LOCUS_06370 27467 26787 CDS product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287083.1 protein_id gnl|my_center|LOCUS_06370 30722 27483 gene locus_tag LOCUS_06380 30722 27483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 31513 30737 gene locus_tag LOCUS_06390 gene proB 31513 30737 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287451.1 protein_id gnl|my_center|LOCUS_06390 31834 31685 gene locus_tag LOCUS_06400 31834 31685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 32246 31965 gene locus_tag LOCUS_06410 gene eutM 32246 31965 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358305.1 protein_id gnl|my_center|LOCUS_06410 32900 32265 gene locus_tag LOCUS_06420 32900 32265 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986618.1 protein_id gnl|my_center|LOCUS_06420 34481 32937 gene locus_tag LOCUS_06430 34481 32937 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986619.1 protein_id gnl|my_center|LOCUS_06430 35209 34553 gene locus_tag LOCUS_06440 35209 34553 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986620.1 protein_id gnl|my_center|LOCUS_06440 35858 35253 gene locus_tag LOCUS_06450 35858 35253 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986621.1 protein_id gnl|my_center|LOCUS_06450 36137 35874 gene locus_tag LOCUS_06460 36137 35874 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361873.1 protein_id gnl|my_center|LOCUS_06460 36430 36131 gene locus_tag LOCUS_06470 36430 36131 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815265.1 protein_id gnl|my_center|LOCUS_06470 37367 36528 gene locus_tag LOCUS_06480 gene eutJ 37367 36528 CDS product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986622.1 protein_id gnl|my_center|LOCUS_06480 37963 37397 gene locus_tag LOCUS_06490 37963 37397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 39102 37963 gene locus_tag LOCUS_06500 39102 37963 CDS product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861386.1 protein_id gnl|my_center|LOCUS_06500 39499 39089 gene locus_tag LOCUS_06510 39499 39089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 39879 39535 gene locus_tag LOCUS_06520 39879 39535 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358362.1 protein_id gnl|my_center|LOCUS_06520 40842 39892 gene locus_tag LOCUS_06530 gene cutD 40842 39892 CDS product choline TMA-lyase-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986624.1 protein_id gnl|my_center|LOCUS_06530 43407 40867 gene locus_tag LOCUS_06540 gene cutC 43407 40867 CDS product choline trimethylamine-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358179.1 protein_id gnl|my_center|LOCUS_06540 44843 43422 gene locus_tag LOCUS_06550 44843 43422 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462303.1 protein_id gnl|my_center|LOCUS_06550 45161 44856 gene locus_tag LOCUS_06560 45161 44856 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986626.1 protein_id gnl|my_center|LOCUS_06560 45469 45173 gene locus_tag LOCUS_06570 45469 45173 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358244.1 protein_id gnl|my_center|LOCUS_06570 45766 45482 gene locus_tag LOCUS_06580 45766 45482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986627.1 protein_id gnl|my_center|LOCUS_06580 46778 45768 gene locus_tag LOCUS_06590 46778 45768 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986628.1 protein_id gnl|my_center|LOCUS_06590 47074 46790 gene locus_tag LOCUS_06600 gene eutM 47074 46790 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358305.1 protein_id gnl|my_center|LOCUS_06600 48488 47643 gene locus_tag LOCUS_06610 48488 47643 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402124.1 protein_id gnl|my_center|LOCUS_06610 50229 48796 gene locus_tag LOCUS_06620 50229 48796 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989524.1 protein_id gnl|my_center|LOCUS_06620 50875 50513 gene locus_tag LOCUS_06630 50875 50513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 51855 52298 gene locus_tag LOCUS_06640 51855 52298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 52905 52450 gene locus_tag LOCUS_06650 52905 52450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 54402 53077 gene locus_tag LOCUS_06660 54402 53077 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_06660 55280 54597 gene locus_tag LOCUS_06670 55280 54597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 55711 55235 gene locus_tag LOCUS_06680 55711 55235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06680 56109 56468 gene locus_tag LOCUS_06690 56109 56468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 56563 57171 gene locus_tag LOCUS_06700 56563 57171 CDS product accessory gene regulator ArgB-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932273.1 protein_id gnl|my_center|LOCUS_06700 57146 57298 gene locus_tag LOCUS_06710 57146 57298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 57299 58624 gene locus_tag LOCUS_06720 57299 58624 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262113.1 protein_id gnl|my_center|LOCUS_06720 58621 59376 gene locus_tag LOCUS_06730 58621 59376 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262114.1 protein_id gnl|my_center|LOCUS_06730 60000 59422 gene locus_tag LOCUS_06740 60000 59422 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292856.1 protein_id gnl|my_center|LOCUS_06740 60448 61239 gene locus_tag LOCUS_06750 60448 61239 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774239.1 protein_id gnl|my_center|LOCUS_06750 61767 61327 gene locus_tag LOCUS_06760 61767 61327 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245063.1 protein_id gnl|my_center|LOCUS_06760 63379 61865 gene locus_tag LOCUS_06770 63379 61865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 64050 63760 gene locus_tag LOCUS_06780 64050 63760 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294972.1 protein_id gnl|my_center|LOCUS_06780 65795 64068 gene locus_tag LOCUS_06790 gene liaX 65795 64068 CDS product daptomycin-sensing surface protein LiaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002330768.1 protein_id gnl|my_center|LOCUS_06790 66260 65979 gene locus_tag LOCUS_06800 66260 65979 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294972.1 protein_id gnl|my_center|LOCUS_06800 66544 66963 gene locus_tag LOCUS_06810 66544 66963 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403014.1 protein_id gnl|my_center|LOCUS_06810 67291 67890 gene locus_tag LOCUS_06820 67291 67890 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830988.1 protein_id gnl|my_center|LOCUS_06820 67890 68345 gene locus_tag LOCUS_06830 67890 68345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 68625 69032 gene locus_tag LOCUS_06840 68625 69032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 69166 69999 gene locus_tag LOCUS_06850 69166 69999 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379058.1 protein_id gnl|my_center|LOCUS_06850 70988 70278 gene locus_tag LOCUS_06860 70988 70278 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837175.1 protein_id gnl|my_center|LOCUS_06860 71463 70993 gene locus_tag LOCUS_06870 71463 70993 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294693.1 protein_id gnl|my_center|LOCUS_06870 73007 71577 gene locus_tag LOCUS_06880 73007 71577 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819086.1 protein_id gnl|my_center|LOCUS_06880 73584 72997 gene locus_tag LOCUS_06890 73584 72997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 74300 73611 gene locus_tag LOCUS_06900 74300 73611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 75435 74350 gene locus_tag LOCUS_06910 75435 74350 CDS product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361272.1 protein_id gnl|my_center|LOCUS_06910 76240 75503 gene locus_tag LOCUS_06920 76240 75503 CDS product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355609.1 protein_id gnl|my_center|LOCUS_06920 77043 76264 gene locus_tag LOCUS_06930 77043 76264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 77800 77075 gene locus_tag LOCUS_06940 77800 77075 CDS product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385163.1 protein_id gnl|my_center|LOCUS_06940 78164 77775 gene locus_tag LOCUS_06950 78164 77775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 80821 78173 gene locus_tag LOCUS_06960 80821 78173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 81624 83321 gene locus_tag LOCUS_06970 81624 83321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 84075 83410 gene locus_tag LOCUS_06980 gene yeiL 84075 83410 CDS product transcriptional regulator YeiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379563.1 protein_id gnl|my_center|LOCUS_06980 84164 84766 gene locus_tag LOCUS_06990 84164 84766 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383117.1 protein_id gnl|my_center|LOCUS_06990 86043 84808 gene locus_tag LOCUS_07000 86043 84808 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810376.1 protein_id gnl|my_center|LOCUS_07000 86234 86989 gene locus_tag LOCUS_07010 86234 86989 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_07010 88341 87190 gene locus_tag LOCUS_07020 88341 87190 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295931.1 protein_id gnl|my_center|LOCUS_07020 89996 88587 gene locus_tag LOCUS_07030 89996 88587 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948841.1 protein_id gnl|my_center|LOCUS_07030 91873 90026 gene locus_tag LOCUS_07040 91873 90026 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027425.1 protein_id gnl|my_center|LOCUS_07040 93021 92188 gene locus_tag LOCUS_07050 93021 92188 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922015.1 protein_id gnl|my_center|LOCUS_07050 93532 93293 gene locus_tag LOCUS_07060 93532 93293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 94541 93615 gene locus_tag LOCUS_07070 gene glsA 94541 93615 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295938.1 protein_id gnl|my_center|LOCUS_07070 95990 94563 gene locus_tag LOCUS_07080 95990 94563 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295940.1 protein_id gnl|my_center|LOCUS_07080 97220 96006 gene locus_tag LOCUS_07090 97220 96006 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296683.1 protein_id gnl|my_center|LOCUS_07090 97980 97447 gene locus_tag LOCUS_07100 97980 97447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07100 98430 98002 gene locus_tag LOCUS_07110 98430 98002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07110 100295 98604 gene locus_tag LOCUS_07120 100295 98604 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224504.1 protein_id gnl|my_center|LOCUS_07120 103919 100299 gene locus_tag LOCUS_07130 gene uca 103919 100299 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138224727.1 protein_id gnl|my_center|LOCUS_07130 104637 103924 gene locus_tag LOCUS_07140 104637 103924 CDS product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206332.1 protein_id gnl|my_center|LOCUS_07140 105296 104634 gene locus_tag LOCUS_07150 105296 104634 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_07150 106119 105322 gene locus_tag LOCUS_07160 106119 105322 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094604.1 protein_id gnl|my_center|LOCUS_07160 106940 106131 gene locus_tag LOCUS_07170 106940 106131 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392004.1 protein_id gnl|my_center|LOCUS_07170 108031 106970 gene locus_tag LOCUS_07180 108031 106970 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143100.1 protein_id gnl|my_center|LOCUS_07180 108406 108053 gene locus_tag LOCUS_07190 108406 108053 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877171.1 protein_id gnl|my_center|LOCUS_07190 108754 108419 gene locus_tag LOCUS_07200 108754 108419 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963577.1 protein_id gnl|my_center|LOCUS_07200 110582 109488 gene locus_tag LOCUS_07210 110582 109488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 111226 110861 gene locus_tag LOCUS_07220 111226 110861 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990834.1 protein_id gnl|my_center|LOCUS_07220 111396 111755 gene locus_tag LOCUS_07230 111396 111755 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362343.1 protein_id gnl|my_center|LOCUS_07230 112664 111807 gene locus_tag LOCUS_07240 112664 111807 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132680.1 protein_id gnl|my_center|LOCUS_07240 113474 112743 gene locus_tag LOCUS_07250 113474 112743 CDS product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460575.1 protein_id gnl|my_center|LOCUS_07250 114658 113516 gene locus_tag LOCUS_07260 114658 113516 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263552.1 protein_id gnl|my_center|LOCUS_07260 116419 114950 gene locus_tag LOCUS_07270 116419 114950 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002375743.1 protein_id gnl|my_center|LOCUS_07270 118290 116437 gene locus_tag LOCUS_07280 118290 116437 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948571.1 protein_id gnl|my_center|LOCUS_07280 118502 119392 gene locus_tag LOCUS_07290 118502 119392 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354705.1 protein_id gnl|my_center|LOCUS_07290 119863 119498 gene locus_tag LOCUS_07300 119863 119498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07300 120096 119932 gene locus_tag LOCUS_07310 120096 119932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07310 121196 120159 gene locus_tag LOCUS_07320 121196 120159 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642147.1 protein_id gnl|my_center|LOCUS_07320 122144 121308 gene locus_tag LOCUS_07330 122144 121308 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275478.1 protein_id gnl|my_center|LOCUS_07330 122914 122159 gene locus_tag LOCUS_07340 122914 122159 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816623.1 protein_id gnl|my_center|LOCUS_07340 123927 123019 gene locus_tag LOCUS_07350 123927 123019 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101944.1 protein_id gnl|my_center|LOCUS_07350 125289 124141 gene locus_tag LOCUS_07360 125289 124141 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295931.1 protein_id gnl|my_center|LOCUS_07360 126514 125456 gene locus_tag LOCUS_07370 126514 125456 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001812710.1 protein_id gnl|my_center|LOCUS_07370 127200 126637 gene locus_tag LOCUS_07380 127200 126637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 129614 127359 gene locus_tag LOCUS_07390 129614 127359 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987096.1 protein_id gnl|my_center|LOCUS_07390 130038 129607 gene locus_tag LOCUS_07400 130038 129607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 133348 130292 gene locus_tag LOCUS_07410 gene ebgA 133348 130292 CDS product beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706828.1 protein_id gnl|my_center|LOCUS_07410 134841 133345 gene locus_tag LOCUS_07420 134841 133345 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387186.1 protein_id gnl|my_center|LOCUS_07420 134972 135808 gene locus_tag LOCUS_07430 134972 135808 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714088.1 protein_id gnl|my_center|LOCUS_07430 136217 135897 gene locus_tag LOCUS_07440 136217 135897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 136722 136498 gene locus_tag LOCUS_07450 136722 136498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 138234 136849 gene locus_tag LOCUS_07460 138234 136849 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058964445.1 protein_id gnl|my_center|LOCUS_07460 139421 138273 gene locus_tag LOCUS_07470 139421 138273 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459150.1 protein_id gnl|my_center|LOCUS_07470 140226 139441 gene locus_tag LOCUS_07480 140226 139441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 142728 140248 gene locus_tag LOCUS_07490 142728 140248 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184871.1 protein_id gnl|my_center|LOCUS_07490 143708 142758 gene locus_tag LOCUS_07500 143708 142758 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459063.1 protein_id gnl|my_center|LOCUS_07500 145021 143918 gene locus_tag LOCUS_07510 145021 143918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 146044 145436 gene locus_tag LOCUS_07520 146044 145436 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294697.1 protein_id gnl|my_center|LOCUS_07520 146790 146059 gene locus_tag LOCUS_07530 146790 146059 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640897.1 protein_id gnl|my_center|LOCUS_07530 147583 146813 gene locus_tag LOCUS_07540 147583 146813 CDS product D-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729199.1 protein_id gnl|my_center|LOCUS_07540 148066 147593 gene locus_tag LOCUS_07550 148066 147593 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476683.1 protein_id gnl|my_center|LOCUS_07550 148478 148038 gene locus_tag LOCUS_07560 148478 148038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 150156 148495 gene locus_tag LOCUS_07570 150156 148495 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057757224.1 protein_id gnl|my_center|LOCUS_07570 151173 150169 gene locus_tag LOCUS_07580 151173 150169 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583055.1 protein_id gnl|my_center|LOCUS_07580 152033 151185 gene locus_tag LOCUS_07590 152033 151185 CDS product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294699.1 protein_id gnl|my_center|LOCUS_07590 152274 153020 gene locus_tag LOCUS_07600 152274 153020 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047704.1 protein_id gnl|my_center|LOCUS_07600 153044 153943 gene locus_tag LOCUS_07610 153044 153943 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420843.1 protein_id gnl|my_center|LOCUS_07610 154240 155049 gene locus_tag LOCUS_07620 154240 155049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 156217 155306 gene locus_tag LOCUS_07630 gene rbsK 156217 155306 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641604.1 protein_id gnl|my_center|LOCUS_07630 157220 156273 gene locus_tag LOCUS_07640 gene rihA 157220 156273 CDS product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097582.1 protein_id gnl|my_center|LOCUS_07640 158689 157241 gene locus_tag LOCUS_07650 158689 157241 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112416.1 protein_id gnl|my_center|LOCUS_07650 159554 158742 gene locus_tag LOCUS_07660 159554 158742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 160386 159538 gene locus_tag LOCUS_07670 160386 159538 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399677.1 protein_id gnl|my_center|LOCUS_07670 161163 160399 gene locus_tag LOCUS_07680 161163 160399 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014635952.1 protein_id gnl|my_center|LOCUS_07680 161803 161177 gene locus_tag LOCUS_07690 161803 161177 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922270.1 protein_id gnl|my_center|LOCUS_07690 162021 163919 gene locus_tag LOCUS_07700 162021 163919 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819456.1 protein_id gnl|my_center|LOCUS_07700 164112 165683 gene locus_tag LOCUS_07710 164112 165683 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013355994.1 protein_id gnl|my_center|LOCUS_07710 >Feature sequence05 484 1191 gene locus_tag LOCUS_07720 484 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 1279 8178 gene locus_tag LOCUS_07730 1279 8178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 9203 8307 gene locus_tag LOCUS_07740 9203 8307 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 protein_id gnl|my_center|LOCUS_07740 9487 10836 gene locus_tag LOCUS_07750 9487 10836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 12326 10917 gene locus_tag LOCUS_07760 12326 10917 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131604.1 protein_id gnl|my_center|LOCUS_07760 13143 12544 gene locus_tag LOCUS_07770 gene dhaL 13143 12544 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360441.1 protein_id gnl|my_center|LOCUS_07770 14151 13168 gene locus_tag LOCUS_07780 gene dhaK 14151 13168 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363860.1 protein_id gnl|my_center|LOCUS_07780 14551 14153 gene locus_tag LOCUS_07790 gene dhaM 14551 14153 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386689.1 protein_id gnl|my_center|LOCUS_07790 15737 14607 gene locus_tag LOCUS_07800 15737 14607 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363858.1 protein_id gnl|my_center|LOCUS_07800 15906 16922 gene locus_tag LOCUS_07810 15906 16922 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382271.1 protein_id gnl|my_center|LOCUS_07810 17080 19227 gene locus_tag LOCUS_07820 17080 19227 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286261.1 protein_id gnl|my_center|LOCUS_07820 19254 19691 gene locus_tag LOCUS_07830 19254 19691 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026217689.1 protein_id gnl|my_center|LOCUS_07830 19719 20105 gene locus_tag LOCUS_07840 19719 20105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 20259 20684 gene locus_tag LOCUS_07850 20259 20684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 20876 22489 gene locus_tag LOCUS_07860 20876 22489 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287759.1 protein_id gnl|my_center|LOCUS_07860 22494 22844 gene locus_tag LOCUS_07870 22494 22844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 22912 23421 gene locus_tag LOCUS_07880 gene gst 22912 23421 CDS product DinB family glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002375627.1 protein_id gnl|my_center|LOCUS_07880 23695 23871 gene locus_tag LOCUS_07890 23695 23871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07890 23871 24248 gene locus_tag LOCUS_07900 23871 24248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07900 24351 24965 gene locus_tag LOCUS_07910 24351 24965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07910 25288 27141 gene locus_tag LOCUS_07920 25288 27141 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861973.1 protein_id gnl|my_center|LOCUS_07920 27143 28183 gene locus_tag LOCUS_07930 gene ypdE 27143 28183 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891992.1 protein_id gnl|my_center|LOCUS_07930 28198 28503 gene locus_tag LOCUS_07940 28198 28503 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421329.1 protein_id gnl|my_center|LOCUS_07940 28531 28872 gene locus_tag LOCUS_07950 28531 28872 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421322.1 protein_id gnl|my_center|LOCUS_07950 28980 30305 gene locus_tag LOCUS_07960 28980 30305 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861972.1 protein_id gnl|my_center|LOCUS_07960 30322 31380 gene locus_tag LOCUS_07970 30322 31380 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861971.1 protein_id gnl|my_center|LOCUS_07970 31382 32569 gene locus_tag LOCUS_07980 31382 32569 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437779.1 protein_id gnl|my_center|LOCUS_07980 32692 33429 gene locus_tag LOCUS_07990 gene truA 32692 33429 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294728.1 protein_id gnl|my_center|LOCUS_07990 34248 33478 gene locus_tag LOCUS_08000 34248 33478 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287492.1 protein_id gnl|my_center|LOCUS_08000 35158 34241 gene locus_tag LOCUS_08010 35158 34241 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287494.1 protein_id gnl|my_center|LOCUS_08010 35322 35657 gene locus_tag LOCUS_08020 35322 35657 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461784.1 protein_id gnl|my_center|LOCUS_08020 35647 36405 gene locus_tag LOCUS_08030 35647 36405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 36536 38194 gene locus_tag LOCUS_08040 36536 38194 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287495.1 protein_id gnl|my_center|LOCUS_08040 38672 42076 gene locus_tag LOCUS_08050 38672 42076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 42073 43632 gene locus_tag LOCUS_08060 42073 43632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 43838 45550 gene locus_tag LOCUS_08070 43838 45550 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286054.1 protein_id gnl|my_center|LOCUS_08070 45640 46740 gene locus_tag LOCUS_08080 gene srtC 45640 46740 CDS product Ebp pilus assembly class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379311.1 protein_id gnl|my_center|LOCUS_08080 46783 47238 gene locus_tag LOCUS_08090 46783 47238 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722849.1 protein_id gnl|my_center|LOCUS_08090 47241 47660 gene locus_tag LOCUS_08100 47241 47660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 47701 48411 gene locus_tag LOCUS_08110 47701 48411 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774183.1 protein_id gnl|my_center|LOCUS_08110 48991 48461 gene locus_tag LOCUS_08120 48991 48461 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860666.1 protein_id gnl|my_center|LOCUS_08120 49555 48995 gene locus_tag LOCUS_08130 49555 48995 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_08130 49669 50535 gene locus_tag LOCUS_08140 49669 50535 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943443.1 protein_id gnl|my_center|LOCUS_08140 50618 51319 gene locus_tag LOCUS_08150 50618 51319 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296566.1 protein_id gnl|my_center|LOCUS_08150 52828 51362 gene locus_tag LOCUS_08160 52828 51362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 53222 53578 gene locus_tag LOCUS_08170 53222 53578 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083350.1 protein_id gnl|my_center|LOCUS_08170 53643 54149 gene locus_tag LOCUS_08180 53643 54149 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355189.1 protein_id gnl|my_center|LOCUS_08180 55016 54243 gene locus_tag LOCUS_08190 55016 54243 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722392.1 protein_id gnl|my_center|LOCUS_08190 55329 55111 gene locus_tag LOCUS_08200 55329 55111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 55396 56469 gene locus_tag LOCUS_08210 55396 56469 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476685.1 protein_id gnl|my_center|LOCUS_08210 56502 56930 gene locus_tag LOCUS_08220 56502 56930 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476684.1 protein_id gnl|my_center|LOCUS_08220 56999 57472 gene locus_tag LOCUS_08230 56999 57472 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476683.1 protein_id gnl|my_center|LOCUS_08230 57497 58264 gene locus_tag LOCUS_08240 57497 58264 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476682.1 protein_id gnl|my_center|LOCUS_08240 58264 59121 gene locus_tag LOCUS_08250 58264 59121 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476681.1 protein_id gnl|my_center|LOCUS_08250 59466 63953 gene locus_tag LOCUS_08260 59466 63953 CDS product collagen binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989916.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08260 63859 64290 gene locus_tag LOCUS_08270 63859 64290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08270 64388 65017 gene locus_tag LOCUS_08280 64388 65017 CDS product CatA-like O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021707.1 protein_id gnl|my_center|LOCUS_08280 65064 65717 gene locus_tag LOCUS_08290 65064 65717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456006.1 protein_id gnl|my_center|LOCUS_08290 65817 66569 gene locus_tag LOCUS_08300 gene map 65817 66569 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356886.1 protein_id gnl|my_center|LOCUS_08300 66761 67534 gene locus_tag LOCUS_08310 66761 67534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 67567 67842 gene locus_tag LOCUS_08320 67567 67842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 68031 69803 gene locus_tag LOCUS_08330 68031 69803 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361446.1 protein_id gnl|my_center|LOCUS_08330 69984 70955 gene locus_tag LOCUS_08340 69984 70955 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775988.1 protein_id gnl|my_center|LOCUS_08340 71199 72035 gene locus_tag LOCUS_08350 gene msrA 71199 72035 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287588.1 protein_id gnl|my_center|LOCUS_08350 72135 72797 gene locus_tag LOCUS_08360 72135 72797 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461502.1 protein_id gnl|my_center|LOCUS_08360 72925 73284 gene locus_tag LOCUS_08370 72925 73284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 73590 74327 gene locus_tag LOCUS_08380 73590 74327 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567984.1 protein_id gnl|my_center|LOCUS_08380 74402 75037 gene locus_tag LOCUS_08390 74402 75037 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296392.1 protein_id gnl|my_center|LOCUS_08390 75156 76262 gene locus_tag LOCUS_08400 75156 76262 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379459.1 protein_id gnl|my_center|LOCUS_08400 76545 77369 gene locus_tag LOCUS_08410 76545 77369 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896899.1 protein_id gnl|my_center|LOCUS_08410 77429 78121 gene locus_tag LOCUS_08420 77429 78121 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836295.1 protein_id gnl|my_center|LOCUS_08420 78134 79360 gene locus_tag LOCUS_08430 78134 79360 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288819.1 protein_id gnl|my_center|LOCUS_08430 79975 79409 gene locus_tag LOCUS_08440 79975 79409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 82234 80300 gene locus_tag LOCUS_08450 82234 80300 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861602.1 protein_id gnl|my_center|LOCUS_08450 82603 83064 gene locus_tag LOCUS_08460 82603 83064 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897772.1 protein_id gnl|my_center|LOCUS_08460 83061 83384 gene locus_tag LOCUS_08470 83061 83384 CDS product fructose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454881.1 protein_id gnl|my_center|LOCUS_08470 83408 84508 gene locus_tag LOCUS_08480 83408 84508 CDS product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893660.1 protein_id gnl|my_center|LOCUS_08480 84586 87261 gene locus_tag LOCUS_08490 gene mngB 84586 87261 CDS product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861603.1 protein_id gnl|my_center|LOCUS_08490 87288 88166 gene locus_tag LOCUS_08500 87288 88166 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748811.1 protein_id gnl|my_center|LOCUS_08500 88324 88749 gene locus_tag LOCUS_08510 gene psiE 88324 88749 CDS product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355869.1 protein_id gnl|my_center|LOCUS_08510 89661 88786 gene locus_tag LOCUS_08520 89661 88786 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047873.1 protein_id gnl|my_center|LOCUS_08520 90118 91443 gene locus_tag LOCUS_08530 90118 91443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 93117 91549 gene locus_tag LOCUS_08540 93117 91549 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922193.1 protein_id gnl|my_center|LOCUS_08540 93342 93130 gene locus_tag LOCUS_08550 93342 93130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 94369 93383 gene locus_tag LOCUS_08560 94369 93383 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439110.1 protein_id gnl|my_center|LOCUS_08560 94516 95442 gene locus_tag LOCUS_08570 94516 95442 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262252.1 protein_id gnl|my_center|LOCUS_08570 95868 96353 gene locus_tag LOCUS_08580 95868 96353 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460539.1 protein_id gnl|my_center|LOCUS_08580 96907 97719 gene locus_tag LOCUS_08590 96907 97719 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387408.1 protein_id gnl|my_center|LOCUS_08590 97712 98512 gene locus_tag LOCUS_08600 97712 98512 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948217.1 protein_id gnl|my_center|LOCUS_08600 98524 99498 gene locus_tag LOCUS_08610 98524 99498 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896423.1 protein_id gnl|my_center|LOCUS_08610 99491 100147 gene locus_tag LOCUS_08620 99491 100147 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358543.1 protein_id gnl|my_center|LOCUS_08620 100322 101521 gene locus_tag LOCUS_08630 100322 101521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 101714 103363 gene locus_tag LOCUS_08640 101714 103363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322202.1 protein_id gnl|my_center|LOCUS_08640 103461 103727 gene locus_tag LOCUS_08650 103461 103727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286049.1 protein_id gnl|my_center|LOCUS_08650 103748 104626 gene locus_tag LOCUS_08660 103748 104626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08660 105083 104874 gene locus_tag LOCUS_08670 105083 104874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 105457 105143 gene locus_tag LOCUS_08680 105457 105143 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321527.1 protein_id gnl|my_center|LOCUS_08680 105727 105467 gene locus_tag LOCUS_08690 105727 105467 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294653.1 protein_id gnl|my_center|LOCUS_08690 105907 106218 gene locus_tag LOCUS_08700 105907 106218 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365287.1 protein_id gnl|my_center|LOCUS_08700 106220 107869 gene locus_tag LOCUS_08710 106220 107869 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387331.1 protein_id gnl|my_center|LOCUS_08710 107862 108161 gene locus_tag LOCUS_08720 107862 108161 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355066.1 protein_id gnl|my_center|LOCUS_08720 108321 108998 gene locus_tag LOCUS_08730 gene deoC 108321 108998 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764575.1 protein_id gnl|my_center|LOCUS_08730 109003 109449 gene locus_tag LOCUS_08740 109003 109449 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963556.1 protein_id gnl|my_center|LOCUS_08740 109465 110841 gene locus_tag LOCUS_08750 109465 110841 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963557.1 protein_id gnl|my_center|LOCUS_08750 110841 111872 gene locus_tag LOCUS_08760 gene iolG 110841 111872 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_08760 111873 112919 gene locus_tag LOCUS_08770 111873 112919 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_08770 112988 113764 gene locus_tag LOCUS_08780 112988 113764 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366720.1 protein_id gnl|my_center|LOCUS_08780 114720 113809 gene locus_tag LOCUS_08790 114720 113809 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101519.1 protein_id gnl|my_center|LOCUS_08790 115078 116391 gene locus_tag LOCUS_08800 115078 116391 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294686.1 protein_id gnl|my_center|LOCUS_08800 116790 117497 gene locus_tag LOCUS_08810 116790 117497 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359135.1 protein_id gnl|my_center|LOCUS_08810 118765 119334 gene locus_tag LOCUS_08820 118765 119334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 119399 120097 gene locus_tag LOCUS_08830 119399 120097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 120357 121868 gene locus_tag LOCUS_08840 gene gadC 120357 121868 CDS product glutamate:gamma-aminobutyrate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905871.1 protein_id gnl|my_center|LOCUS_08840 121896 123296 gene locus_tag LOCUS_08850 121896 123296 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905870.1 protein_id gnl|my_center|LOCUS_08850 124780 123326 gene locus_tag LOCUS_08860 124780 123326 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010755320.1 protein_id gnl|my_center|LOCUS_08860 125428 127725 gene locus_tag LOCUS_08870 gene pflB 125428 127725 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357529.1 protein_id gnl|my_center|LOCUS_08870 127907 129316 gene locus_tag LOCUS_08880 127907 129316 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362470.1 protein_id gnl|my_center|LOCUS_08880 130007 129351 gene locus_tag LOCUS_08890 130007 129351 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356081.1 protein_id gnl|my_center|LOCUS_08890 130414 130701 gene locus_tag LOCUS_08900 130414 130701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289230.1 protein_id gnl|my_center|LOCUS_08900 130717 131913 gene locus_tag LOCUS_08910 130717 131913 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723548.1 protein_id gnl|my_center|LOCUS_08910 132790 131972 gene locus_tag LOCUS_08920 132790 131972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 133089 134135 gene locus_tag LOCUS_08930 133089 134135 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381968.1 protein_id gnl|my_center|LOCUS_08930 134408 136090 gene locus_tag LOCUS_08940 134408 136090 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287130.1 protein_id gnl|my_center|LOCUS_08940 136211 136417 gene locus_tag LOCUS_08950 136211 136417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 136507 137934 gene locus_tag LOCUS_08960 136507 137934 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357746.1 protein_id gnl|my_center|LOCUS_08960 138071 139402 gene locus_tag LOCUS_08970 138071 139402 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287134.1 protein_id gnl|my_center|LOCUS_08970 139417 140364 gene locus_tag LOCUS_08980 139417 140364 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287135.1 protein_id gnl|my_center|LOCUS_08980 140575 141426 gene locus_tag LOCUS_08990 140575 141426 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287471.1 protein_id gnl|my_center|LOCUS_08990 141431 143392 gene locus_tag LOCUS_09000 gene nagE 141431 143392 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287473.1 protein_id gnl|my_center|LOCUS_09000 143513 143836 gene locus_tag LOCUS_09010 143513 143836 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357741.1 protein_id gnl|my_center|LOCUS_09010 143951 144661 gene locus_tag LOCUS_09020 143951 144661 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287139.1 protein_id gnl|my_center|LOCUS_09020 144947 145282 gene locus_tag LOCUS_09030 144947 145282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287147.1 protein_id gnl|my_center|LOCUS_09030 145364 145879 gene locus_tag LOCUS_09040 gene tadA 145364 145879 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362126.1 protein_id gnl|my_center|LOCUS_09040 146151 147020 gene locus_tag LOCUS_09050 146151 147020 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286307.1 protein_id gnl|my_center|LOCUS_09050 147032 147526 gene locus_tag LOCUS_09060 147032 147526 CDS product LURP-one-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261892.1 protein_id gnl|my_center|LOCUS_09060 148049 147570 gene locus_tag LOCUS_09070 148049 147570 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289775.1 protein_id gnl|my_center|LOCUS_09070 148145 149524 gene locus_tag LOCUS_09080 148145 149524 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287155.1 protein_id gnl|my_center|LOCUS_09080 149559 150179 gene locus_tag LOCUS_09090 149559 150179 CDS product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357954.1 protein_id gnl|my_center|LOCUS_09090 150184 150954 gene locus_tag LOCUS_09100 150184 150954 CDS product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287159.1 protein_id gnl|my_center|LOCUS_09100 150944 151579 gene locus_tag LOCUS_09110 150944 151579 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287161.1 protein_id gnl|my_center|LOCUS_09110 152107 151598 gene locus_tag LOCUS_09120 152107 151598 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287163.1 protein_id gnl|my_center|LOCUS_09120 153109 152126 gene locus_tag LOCUS_09130 153109 152126 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287165.1 protein_id gnl|my_center|LOCUS_09130 153238 153825 gene locus_tag LOCUS_09140 153238 153825 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287167.1 protein_id gnl|my_center|LOCUS_09140 155016 153850 gene locus_tag LOCUS_09150 155016 153850 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311494.1 protein_id gnl|my_center|LOCUS_09150 155094 155474 gene locus_tag LOCUS_09160 155094 155474 CDS product CvfD/Ygs/GSP13 family RNA-binding post-transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287231.1 protein_id gnl|my_center|LOCUS_09160 155563 155922 gene locus_tag LOCUS_09170 155563 155922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287172.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence06 373 230 gene locus_tag LOCUS_09180 373 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 428 1132 gene locus_tag LOCUS_09190 428 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1269 1114 gene locus_tag LOCUS_09200 1269 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 1424 1272 gene locus_tag LOCUS_09210 1424 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1912 1439 gene locus_tag LOCUS_09220 1912 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 2822 1905 gene locus_tag LOCUS_09230 2822 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 3240 2962 gene locus_tag LOCUS_09240 3240 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 3539 3237 gene locus_tag LOCUS_09250 3539 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 3734 3552 gene locus_tag LOCUS_09260 3734 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 4032 4343 gene locus_tag LOCUS_09270 4032 4343 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286580.1 protein_id gnl|my_center|LOCUS_09270 4364 4768 gene locus_tag LOCUS_09280 4364 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 4858 5583 gene locus_tag LOCUS_09290 4858 5583 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385631.1 protein_id gnl|my_center|LOCUS_09290 5694 6836 gene locus_tag LOCUS_09300 5694 6836 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905403.1 protein_id gnl|my_center|LOCUS_09300 7211 6936 gene locus_tag LOCUS_09310 7211 6936 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701976.1 protein_id gnl|my_center|LOCUS_09310 7534 9057 gene locus_tag LOCUS_09320 7534 9057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 9035 10579 gene locus_tag LOCUS_09330 9035 10579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 10973 10572 gene locus_tag LOCUS_09340 10973 10572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 11269 12405 gene locus_tag LOCUS_09350 gene ald 11269 12405 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243280.1 protein_id gnl|my_center|LOCUS_09350 12492 14186 gene locus_tag LOCUS_09360 12492 14186 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775294.1 protein_id gnl|my_center|LOCUS_09360 15324 14545 gene locus_tag LOCUS_09370 15324 14545 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930637.1 protein_id gnl|my_center|LOCUS_09370 15432 16127 gene locus_tag LOCUS_09380 15432 16127 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905450.1 protein_id gnl|my_center|LOCUS_09380 16205 17977 gene locus_tag LOCUS_09390 16205 17977 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285966.1 protein_id gnl|my_center|LOCUS_09390 18550 18044 gene locus_tag LOCUS_09400 18550 18044 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289239.1 protein_id gnl|my_center|LOCUS_09400 19014 18556 gene locus_tag LOCUS_09410 19014 18556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 20363 19209 gene locus_tag LOCUS_09420 20363 19209 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921836.1 protein_id gnl|my_center|LOCUS_09420 21446 20484 gene locus_tag LOCUS_09430 21446 20484 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659266.1 protein_id gnl|my_center|LOCUS_09430 22767 21724 gene locus_tag LOCUS_09440 22767 21724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814297.1 protein_id gnl|my_center|LOCUS_09440 23105 22770 gene locus_tag LOCUS_09450 23105 22770 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814298.1 protein_id gnl|my_center|LOCUS_09450 24437 23211 gene locus_tag LOCUS_09460 24437 23211 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990082.1 protein_id gnl|my_center|LOCUS_09460 25624 24437 gene locus_tag LOCUS_09470 25624 24437 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009918143.1 protein_id gnl|my_center|LOCUS_09470 26707 25625 gene locus_tag LOCUS_09480 gene serC 26707 25625 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931650.1 protein_id gnl|my_center|LOCUS_09480 27197 27060 gene locus_tag LOCUS_09490 27197 27060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 27661 27233 gene locus_tag LOCUS_09500 27661 27233 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888119.1 protein_id gnl|my_center|LOCUS_09500 29043 27952 gene locus_tag LOCUS_09510 29043 27952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 29829 29242 gene locus_tag LOCUS_09520 29829 29242 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054128.1 protein_id gnl|my_center|LOCUS_09520 30867 30256 gene locus_tag LOCUS_09530 30867 30256 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476510.1 protein_id gnl|my_center|LOCUS_09530 31035 31736 gene locus_tag LOCUS_09540 31035 31736 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286289.1 protein_id gnl|my_center|LOCUS_09540 31736 33985 gene locus_tag LOCUS_09550 gene mubY 31736 33985 CDS product mutanobactin A system ABC transporter permease subunit MubY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002282912.1 protein_id gnl|my_center|LOCUS_09550 35519 34032 gene locus_tag LOCUS_09560 gene yjeM 35519 34032 CDS product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102020.1 protein_id gnl|my_center|LOCUS_09560 37755 36160 gene locus_tag LOCUS_09570 37755 36160 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296509.1 protein_id gnl|my_center|LOCUS_09570 38506 37748 gene locus_tag LOCUS_09580 38506 37748 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287741.1 protein_id gnl|my_center|LOCUS_09580 39061 38594 gene locus_tag LOCUS_09590 39061 38594 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861914.1 protein_id gnl|my_center|LOCUS_09590 39387 39181 gene locus_tag LOCUS_09600 39387 39181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 39925 39539 gene locus_tag LOCUS_09610 39925 39539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286333.1 protein_id gnl|my_center|LOCUS_09610 40487 39918 gene locus_tag LOCUS_09620 40487 39918 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286331.1 protein_id gnl|my_center|LOCUS_09620 41969 40497 gene locus_tag LOCUS_09630 41969 40497 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286329.1 protein_id gnl|my_center|LOCUS_09630 42937 42056 gene locus_tag LOCUS_09640 42937 42056 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286319.1 protein_id gnl|my_center|LOCUS_09640 43563 42991 gene locus_tag LOCUS_09650 43563 42991 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701817.1 protein_id gnl|my_center|LOCUS_09650 44380 43685 gene locus_tag LOCUS_09660 44380 43685 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195828.1 protein_id gnl|my_center|LOCUS_09660 45872 44412 gene locus_tag LOCUS_09670 45872 44412 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023851.1 protein_id gnl|my_center|LOCUS_09670 46058 48364 gene locus_tag LOCUS_09680 46058 48364 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303731.1 protein_id gnl|my_center|LOCUS_09680 49272 48415 gene locus_tag LOCUS_09690 49272 48415 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902813.1 protein_id gnl|my_center|LOCUS_09690 50497 49346 gene locus_tag LOCUS_09700 50497 49346 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355768.1 protein_id gnl|my_center|LOCUS_09700 51239 50517 gene locus_tag LOCUS_09710 51239 50517 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361352.1 protein_id gnl|my_center|LOCUS_09710 52683 51232 gene locus_tag LOCUS_09720 52683 51232 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358820.1 protein_id gnl|my_center|LOCUS_09720 52825 53907 gene locus_tag LOCUS_09730 52825 53907 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358821.1 protein_id gnl|my_center|LOCUS_09730 56048 54243 gene locus_tag LOCUS_09740 56048 54243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002332930.1 protein_id gnl|my_center|LOCUS_09740 56581 56045 gene locus_tag LOCUS_09750 56581 56045 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235787673.1 protein_id gnl|my_center|LOCUS_09750 56974 58404 gene locus_tag LOCUS_09760 gene arcD 56974 58404 CDS product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267884.1 protein_id gnl|my_center|LOCUS_09760 59460 58474 gene locus_tag LOCUS_09770 gene menA 59460 58474 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289029.1 protein_id gnl|my_center|LOCUS_09770 60500 59550 gene locus_tag LOCUS_09780 gene menA 60500 59550 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289029.1 protein_id gnl|my_center|LOCUS_09780 61566 60502 gene locus_tag LOCUS_09790 61566 60502 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354751.1 protein_id gnl|my_center|LOCUS_09790 62745 61846 gene locus_tag LOCUS_09800 62745 61846 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378870.1 protein_id gnl|my_center|LOCUS_09800 63005 64960 gene locus_tag LOCUS_09810 63005 64960 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354747.1 protein_id gnl|my_center|LOCUS_09810 65120 65533 gene locus_tag LOCUS_09820 65120 65533 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294810.1 protein_id gnl|my_center|LOCUS_09820 65545 66111 gene locus_tag LOCUS_09830 65545 66111 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289378.1 protein_id gnl|my_center|LOCUS_09830 66108 67094 gene locus_tag LOCUS_09840 66108 67094 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289380.1 protein_id gnl|my_center|LOCUS_09840 67487 67137 gene locus_tag LOCUS_09850 67487 67137 CDS product DUF1634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722429.1 protein_id gnl|my_center|LOCUS_09850 68335 67487 gene locus_tag LOCUS_09860 68335 67487 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101335.1 protein_id gnl|my_center|LOCUS_09860 70049 68481 gene locus_tag LOCUS_09870 70049 68481 CDS product phosphatase PAP2/LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379014.1 protein_id gnl|my_center|LOCUS_09870 71226 70075 gene locus_tag LOCUS_09880 71226 70075 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357833.1 protein_id gnl|my_center|LOCUS_09880 72346 71204 gene locus_tag LOCUS_09890 72346 71204 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002331743.1 protein_id gnl|my_center|LOCUS_09890 72978 75179 gene locus_tag LOCUS_09900 72978 75179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 75920 75225 gene locus_tag LOCUS_09910 75920 75225 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916629.1 protein_id gnl|my_center|LOCUS_09910 76556 75921 gene locus_tag LOCUS_09920 76556 75921 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294161.1 protein_id gnl|my_center|LOCUS_09920 76704 77273 gene locus_tag LOCUS_09930 gene lepB 76704 77273 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294105.1 protein_id gnl|my_center|LOCUS_09930 77761 77342 gene locus_tag LOCUS_09940 77761 77342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434963.1 protein_id gnl|my_center|LOCUS_09940 79062 77764 gene locus_tag LOCUS_09950 79062 77764 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387639.1 protein_id gnl|my_center|LOCUS_09950 80254 79310 gene locus_tag LOCUS_09960 80254 79310 CDS product permease prefix domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387089.1 protein_id gnl|my_center|LOCUS_09960 80584 80258 gene locus_tag LOCUS_09970 80584 80258 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356722.1 protein_id gnl|my_center|LOCUS_09970 80781 81890 gene locus_tag LOCUS_09980 80781 81890 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379062.1 protein_id gnl|my_center|LOCUS_09980 82470 81907 gene locus_tag LOCUS_09990 82470 81907 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_09990 83173 82472 gene locus_tag LOCUS_10000 gene deoC 83173 82472 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667269.1 protein_id gnl|my_center|LOCUS_10000 84240 83320 gene locus_tag LOCUS_10010 84240 83320 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286852.1 protein_id gnl|my_center|LOCUS_10010 84532 85563 gene locus_tag LOCUS_10020 84532 85563 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286855.1 protein_id gnl|my_center|LOCUS_10020 85565 86731 gene locus_tag LOCUS_10030 85565 86731 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286858.1 protein_id gnl|my_center|LOCUS_10030 87805 87954 gene locus_tag LOCUS_10040 87805 87954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321680.1 protein_id gnl|my_center|LOCUS_10040 88123 88380 gene locus_tag LOCUS_10050 88123 88380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 88540 88719 gene locus_tag LOCUS_10060 88540 88719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 88769 89203 gene locus_tag LOCUS_10070 88769 89203 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286361.1 protein_id gnl|my_center|LOCUS_10070 89325 89501 gene locus_tag LOCUS_10080 89325 89501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 89596 90114 gene locus_tag LOCUS_10090 89596 90114 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309892.1 protein_id gnl|my_center|LOCUS_10090 90245 91135 gene locus_tag LOCUS_10100 gene rarD 90245 91135 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003734267.1 protein_id gnl|my_center|LOCUS_10100 91342 91178 gene locus_tag LOCUS_10110 91342 91178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 92561 91662 gene locus_tag LOCUS_10120 gene gyaR 92561 91662 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868561.1 protein_id gnl|my_center|LOCUS_10120 94189 92744 gene locus_tag LOCUS_10130 94189 92744 CDS product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482596.1 protein_id gnl|my_center|LOCUS_10130 94634 94203 gene locus_tag LOCUS_10140 94634 94203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 95789 94644 gene locus_tag LOCUS_10150 95789 94644 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246548.1 protein_id gnl|my_center|LOCUS_10150 96356 95799 gene locus_tag LOCUS_10160 gene hxlB 96356 95799 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246343.1 protein_id gnl|my_center|LOCUS_10160 97065 96370 gene locus_tag LOCUS_10170 gene rpe 97065 96370 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431138.1 protein_id gnl|my_center|LOCUS_10170 97345 98094 gene locus_tag LOCUS_10180 97345 98094 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706132.1 protein_id gnl|my_center|LOCUS_10180 98956 98129 gene locus_tag LOCUS_10190 gene dapF 98956 98129 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_10190 100279 98981 gene locus_tag LOCUS_10200 gene lysA 100279 98981 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_10200 101449 100295 gene locus_tag LOCUS_10210 101449 100295 CDS product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891676.1 protein_id gnl|my_center|LOCUS_10210 103091 101697 gene locus_tag LOCUS_10220 103091 101697 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156264865.1 protein_id gnl|my_center|LOCUS_10220 103278 104549 gene locus_tag LOCUS_10230 gene celB 103278 104549 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748651.1 protein_id gnl|my_center|LOCUS_10230 104648 105367 gene locus_tag LOCUS_10240 104648 105367 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296966.1 protein_id gnl|my_center|LOCUS_10240 105669 105430 gene locus_tag LOCUS_10250 105669 105430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 107351 105663 gene locus_tag LOCUS_10260 107351 105663 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101347.1 protein_id gnl|my_center|LOCUS_10260 109363 107411 gene locus_tag LOCUS_10270 109363 107411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 109954 111585 gene locus_tag LOCUS_10280 109954 111585 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296476.1 protein_id gnl|my_center|LOCUS_10280 111725 113047 gene locus_tag LOCUS_10290 111725 113047 CDS product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002308483.1 protein_id gnl|my_center|LOCUS_10290 114398 113106 gene locus_tag LOCUS_10300 114398 113106 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476353.1 protein_id gnl|my_center|LOCUS_10300 114997 114551 gene locus_tag LOCUS_10310 gene bltD 114997 114551 CDS product spermine/spermidine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229879.1 protein_id gnl|my_center|LOCUS_10310 116653 115118 gene locus_tag LOCUS_10320 116653 115118 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675007.1 protein_id gnl|my_center|LOCUS_10320 117241 116708 gene locus_tag LOCUS_10330 117241 116708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 119149 117470 gene locus_tag LOCUS_10340 119149 117470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 119415 119564 gene locus_tag LOCUS_10350 119415 119564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 119827 120111 gene locus_tag LOCUS_10360 119827 120111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 120469 120143 gene locus_tag LOCUS_10370 120469 120143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 120736 121446 gene locus_tag LOCUS_10380 120736 121446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 121464 122243 gene locus_tag LOCUS_10390 121464 122243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 122296 122763 gene locus_tag LOCUS_10400 122296 122763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10400 122806 122991 gene locus_tag LOCUS_10410 122806 122991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10410 122988 124442 gene locus_tag LOCUS_10420 122988 124442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 126303 124708 gene locus_tag LOCUS_10430 126303 124708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 126548 127513 gene locus_tag LOCUS_10440 126548 127513 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287608.1 protein_id gnl|my_center|LOCUS_10440 127569 128078 gene locus_tag LOCUS_10450 127569 128078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 129206 128592 gene locus_tag LOCUS_10460 129206 128592 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780836.1 protein_id gnl|my_center|LOCUS_10460 129564 129824 gene locus_tag LOCUS_10470 129564 129824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 129925 130659 gene locus_tag LOCUS_10480 129925 130659 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296401.1 protein_id gnl|my_center|LOCUS_10480 131109 130693 gene locus_tag LOCUS_10490 131109 130693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 131553 131299 gene locus_tag LOCUS_10500 131553 131299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 131888 133483 gene locus_tag LOCUS_10510 gene aspD 131888 133483 CDS product aspartate 4-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773720.1 protein_id gnl|my_center|LOCUS_10510 133642 134460 gene locus_tag LOCUS_10520 gene thiD 133642 134460 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364530.1 protein_id gnl|my_center|LOCUS_10520 134450 134998 gene locus_tag LOCUS_10530 134450 134998 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642750.1 protein_id gnl|my_center|LOCUS_10530 135509 135117 gene locus_tag LOCUS_10540 135509 135117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 135697 136437 gene locus_tag LOCUS_10550 135697 136437 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721674.1 protein_id gnl|my_center|LOCUS_10550 136453 137847 gene locus_tag LOCUS_10560 136453 137847 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721673.1 protein_id gnl|my_center|LOCUS_10560 137959 139032 gene locus_tag LOCUS_10570 137959 139032 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948306.1 protein_id gnl|my_center|LOCUS_10570 139339 139485 gene locus_tag LOCUS_10580 139339 139485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 140004 141533 gene locus_tag LOCUS_10590 140004 141533 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290558.1 protein_id gnl|my_center|LOCUS_10590 141786 142376 gene locus_tag LOCUS_10600 141786 142376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 142860 142420 gene locus_tag LOCUS_10610 142860 142420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 143024 144595 gene locus_tag LOCUS_10620 143024 144595 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002326755.1 protein_id gnl|my_center|LOCUS_10620 145103 144636 gene locus_tag LOCUS_10630 145103 144636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10630 145488 145757 gene locus_tag LOCUS_10640 145488 145757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289125.1 protein_id gnl|my_center|LOCUS_10640 145800 146720 gene locus_tag LOCUS_10650 145800 146720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 146882 147898 gene locus_tag LOCUS_10660 146882 147898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 148585 147938 gene locus_tag LOCUS_10670 gene fsa 148585 147938 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723193.1 protein_id gnl|my_center|LOCUS_10670 148826 149197 gene locus_tag LOCUS_10680 148826 149197 CDS product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288062.1 protein_id gnl|my_center|LOCUS_10680 149699 149274 gene locus_tag LOCUS_10690 149699 149274 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358161.1 protein_id gnl|my_center|LOCUS_10690 151302 149689 gene locus_tag LOCUS_10700 151302 149689 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382010.1 protein_id gnl|my_center|LOCUS_10700 151598 151446 gene locus_tag LOCUS_10710 151598 151446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 151986 153110 gene locus_tag LOCUS_10720 151986 153110 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356443.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence07 83 634 gene locus_tag LOCUS_10730 83 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1601 675 gene locus_tag LOCUS_10740 1601 675 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101217.1 protein_id gnl|my_center|LOCUS_10740 2292 1666 gene locus_tag LOCUS_10750 2292 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10750 2792 2412 gene locus_tag LOCUS_10760 2792 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10760 4380 2785 gene locus_tag LOCUS_10770 4380 2785 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905480.1 protein_id gnl|my_center|LOCUS_10770 7411 4418 gene locus_tag LOCUS_10780 7411 4418 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905479.1 protein_id gnl|my_center|LOCUS_10780 8750 7740 gene locus_tag LOCUS_10790 8750 7740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 8993 8829 gene locus_tag LOCUS_10800 8993 8829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 9287 9982 gene locus_tag LOCUS_10810 9287 9982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 10729 10139 gene locus_tag LOCUS_10820 10729 10139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 12062 10920 gene locus_tag LOCUS_10830 gene queG 12062 10920 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382325.1 protein_id gnl|my_center|LOCUS_10830 14527 12551 gene locus_tag LOCUS_10840 gene tkt 14527 12551 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245397.1 protein_id gnl|my_center|LOCUS_10840 15829 14555 gene locus_tag LOCUS_10850 15829 14555 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345347.1 protein_id gnl|my_center|LOCUS_10850 16129 15848 gene locus_tag LOCUS_10860 16129 15848 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435756.1 protein_id gnl|my_center|LOCUS_10860 18192 16126 gene locus_tag LOCUS_10870 18192 16126 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862017.1 protein_id gnl|my_center|LOCUS_10870 19221 18730 gene locus_tag LOCUS_10880 19221 18730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10880 19633 19259 gene locus_tag LOCUS_10890 19633 19259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10890 21469 20672 gene locus_tag LOCUS_10900 21469 20672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 21701 21474 gene locus_tag LOCUS_10910 21701 21474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 22392 21688 gene locus_tag LOCUS_10920 22392 21688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10920 23547 22612 gene locus_tag LOCUS_10930 23547 22612 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014554495.1 protein_id gnl|my_center|LOCUS_10930 24341 23544 gene locus_tag LOCUS_10940 24341 23544 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922273.1 protein_id gnl|my_center|LOCUS_10940 25177 24338 gene locus_tag LOCUS_10950 25177 24338 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922272.1 protein_id gnl|my_center|LOCUS_10950 25911 25174 gene locus_tag LOCUS_10960 25911 25174 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073996416.1 protein_id gnl|my_center|LOCUS_10960 26512 25904 gene locus_tag LOCUS_10970 26512 25904 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393553.1 protein_id gnl|my_center|LOCUS_10970 27349 26645 gene locus_tag LOCUS_10980 27349 26645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 28783 27461 gene locus_tag LOCUS_10990 28783 27461 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461202.1 protein_id gnl|my_center|LOCUS_10990 29468 28776 gene locus_tag LOCUS_11000 29468 28776 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461203.1 protein_id gnl|my_center|LOCUS_11000 29700 30668 gene locus_tag LOCUS_11010 29700 30668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 31691 30744 gene locus_tag LOCUS_11020 31691 30744 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390188.1 protein_id gnl|my_center|LOCUS_11020 32814 31717 gene locus_tag LOCUS_11030 gene wecB 32814 31717 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365185.1 protein_id gnl|my_center|LOCUS_11030 33463 32981 gene locus_tag LOCUS_11040 33463 32981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 36365 33480 gene locus_tag LOCUS_11050 36365 33480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 37114 36431 gene locus_tag LOCUS_11060 37114 36431 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338483.1 protein_id gnl|my_center|LOCUS_11060 37909 37136 gene locus_tag LOCUS_11070 37909 37136 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338484.1 protein_id gnl|my_center|LOCUS_11070 38628 37945 gene locus_tag LOCUS_11080 38628 37945 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060578.1 protein_id gnl|my_center|LOCUS_11080 39591 38875 gene locus_tag LOCUS_11090 39591 38875 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774183.1 protein_id gnl|my_center|LOCUS_11090 40838 39588 gene locus_tag LOCUS_11100 40838 39588 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476423.1 protein_id gnl|my_center|LOCUS_11100 41560 40835 gene locus_tag LOCUS_11110 gene vpsK 41560 40835 CDS product exopolysaccharide biosynthesis glycosyltransferase VpsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 protein_id gnl|my_center|LOCUS_11110 42975 41557 gene locus_tag LOCUS_11120 42975 41557 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091276.1 protein_id gnl|my_center|LOCUS_11120 44189 42972 gene locus_tag LOCUS_11130 44189 42972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 44902 44216 gene locus_tag LOCUS_11140 44902 44216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 45955 44915 gene locus_tag LOCUS_11150 45955 44915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 47199 45943 gene locus_tag LOCUS_11160 47199 45943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 47500 49074 gene locus_tag LOCUS_11170 47500 49074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 49909 49148 gene locus_tag LOCUS_11180 49909 49148 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338482.1 protein_id gnl|my_center|LOCUS_11180 50466 50936 gene locus_tag LOCUS_11190 50466 50936 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860814.1 protein_id gnl|my_center|LOCUS_11190 51122 52204 gene locus_tag LOCUS_11200 51122 52204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 53656 52256 gene locus_tag LOCUS_11210 53656 52256 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298077.1 protein_id gnl|my_center|LOCUS_11210 55197 53701 gene locus_tag LOCUS_11220 55197 53701 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288620.1 protein_id gnl|my_center|LOCUS_11220 55934 55224 gene locus_tag LOCUS_11230 55934 55224 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028020226.1 protein_id gnl|my_center|LOCUS_11230 56819 56004 gene locus_tag LOCUS_11240 56819 56004 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002400076.1 protein_id gnl|my_center|LOCUS_11240 57799 56831 gene locus_tag LOCUS_11250 57799 56831 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288613.1 protein_id gnl|my_center|LOCUS_11250 58791 58039 gene locus_tag LOCUS_11260 58791 58039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 59360 58860 gene locus_tag LOCUS_11270 59360 58860 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356327.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11270 59476 59300 gene locus_tag LOCUS_11280 59476 59300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 60279 59854 gene locus_tag LOCUS_11290 60279 59854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 60787 60305 gene locus_tag LOCUS_11300 60787 60305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 61230 60841 gene locus_tag LOCUS_11310 61230 60841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646453.1 protein_id gnl|my_center|LOCUS_11310 61391 61242 gene locus_tag LOCUS_11320 61391 61242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 61666 61478 gene locus_tag LOCUS_11330 61666 61478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 62246 62061 gene locus_tag LOCUS_11340 62246 62061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 62859 62206 gene locus_tag LOCUS_11350 62859 62206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 63255 62998 gene locus_tag LOCUS_11360 63255 62998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 64144 63917 gene locus_tag LOCUS_11370 64144 63917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 64352 64137 gene locus_tag LOCUS_11380 64352 64137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 66684 64387 gene locus_tag LOCUS_11390 66684 64387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 66770 67009 gene locus_tag LOCUS_11400 66770 67009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 68557 67157 gene locus_tag LOCUS_11410 68557 67157 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546946.1 protein_id gnl|my_center|LOCUS_11410 69937 68597 gene locus_tag LOCUS_11420 69937 68597 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097450.1 protein_id gnl|my_center|LOCUS_11420 70798 70094 gene locus_tag LOCUS_11430 70798 70094 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100904.1 protein_id gnl|my_center|LOCUS_11430 71376 70948 gene locus_tag LOCUS_11440 71376 70948 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289716.1 protein_id gnl|my_center|LOCUS_11440 71606 71373 gene locus_tag LOCUS_11450 71606 71373 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289715.1 protein_id gnl|my_center|LOCUS_11450 72339 71791 gene locus_tag LOCUS_11460 72339 71791 CDS product DUF2716 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886642.1 protein_id gnl|my_center|LOCUS_11460 73798 73106 gene locus_tag LOCUS_11470 73798 73106 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383568.1 protein_id gnl|my_center|LOCUS_11470 73838 74455 gene locus_tag LOCUS_11480 73838 74455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387231.1 protein_id gnl|my_center|LOCUS_11480 74468 75769 gene locus_tag LOCUS_11490 74468 75769 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359847.1 protein_id gnl|my_center|LOCUS_11490 76638 75850 gene locus_tag LOCUS_11500 76638 75850 CDS product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101556.1 protein_id gnl|my_center|LOCUS_11500 77236 76832 gene locus_tag LOCUS_11510 77236 76832 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355245.1 protein_id gnl|my_center|LOCUS_11510 77478 77236 gene locus_tag LOCUS_11520 77478 77236 CDS product addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358371.1 protein_id gnl|my_center|LOCUS_11520 78160 77657 gene locus_tag LOCUS_11530 78160 77657 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090572.1 protein_id gnl|my_center|LOCUS_11530 79586 79071 gene locus_tag LOCUS_11540 79586 79071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 80043 79603 gene locus_tag LOCUS_11550 80043 79603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 80513 80055 gene locus_tag LOCUS_11560 80513 80055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 81014 80532 gene locus_tag LOCUS_11570 81014 80532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931585.1 protein_id gnl|my_center|LOCUS_11570 83660 81030 gene locus_tag LOCUS_11580 83660 81030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 84802 84131 gene locus_tag LOCUS_11590 84802 84131 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774183.1 protein_id gnl|my_center|LOCUS_11590 85062 84829 gene locus_tag LOCUS_11600 85062 84829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 89622 85159 gene locus_tag LOCUS_11610 89622 85159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 90004 89615 gene locus_tag LOCUS_11620 90004 89615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 91073 89994 gene locus_tag LOCUS_11630 91073 89994 CDS product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383570.1 protein_id gnl|my_center|LOCUS_11630 91825 91142 gene locus_tag LOCUS_11640 91825 91142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 93302 92196 gene locus_tag LOCUS_11650 93302 92196 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_11650 95223 93736 gene locus_tag LOCUS_11660 95223 93736 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081638484.1 protein_id gnl|my_center|LOCUS_11660 96342 95482 gene locus_tag LOCUS_11670 96342 95482 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289586.1 protein_id gnl|my_center|LOCUS_11670 97807 96353 gene locus_tag LOCUS_11680 97807 96353 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092480235.1 protein_id gnl|my_center|LOCUS_11680 99645 97807 gene locus_tag LOCUS_11690 99645 97807 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092480236.1 protein_id gnl|my_center|LOCUS_11690 101949 100132 gene locus_tag LOCUS_11700 101949 100132 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146623251.1 protein_id gnl|my_center|LOCUS_11700 103545 102082 gene locus_tag LOCUS_11710 103545 102082 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931832.1 protein_id gnl|my_center|LOCUS_11710 103677 104678 gene locus_tag LOCUS_11720 103677 104678 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476555.1 protein_id gnl|my_center|LOCUS_11720 104671 104838 gene locus_tag LOCUS_11730 104671 104838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 105626 104886 gene locus_tag LOCUS_11740 105626 104886 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774183.1 protein_id gnl|my_center|LOCUS_11740 105922 105692 gene locus_tag LOCUS_11750 105922 105692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 108866 105936 gene locus_tag LOCUS_11760 108866 105936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 109281 108850 gene locus_tag LOCUS_11770 109281 108850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 110342 109287 gene locus_tag LOCUS_11780 110342 109287 CDS product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383570.1 protein_id gnl|my_center|LOCUS_11780 111082 110405 gene locus_tag LOCUS_11790 111082 110405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 112640 111525 gene locus_tag LOCUS_11800 112640 111525 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_11800 113271 113969 gene locus_tag LOCUS_11810 113271 113969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 114735 114121 gene locus_tag LOCUS_11820 114735 114121 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033729412.1 protein_id gnl|my_center|LOCUS_11820 115061 114750 gene locus_tag LOCUS_11830 115061 114750 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381365.1 protein_id gnl|my_center|LOCUS_11830 116992 116108 gene locus_tag LOCUS_11840 116992 116108 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775600.1 protein_id gnl|my_center|LOCUS_11840 117858 116989 gene locus_tag LOCUS_11850 117858 116989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 118114 118338 gene locus_tag LOCUS_11860 118114 118338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 118894 118382 gene locus_tag LOCUS_11870 118894 118382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 119262 119468 gene locus_tag LOCUS_11880 119262 119468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323011.1 protein_id gnl|my_center|LOCUS_11880 119720 119541 gene locus_tag LOCUS_11890 119720 119541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 120121 119936 gene locus_tag LOCUS_11900 120121 119936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 120284 120718 gene locus_tag LOCUS_11910 120284 120718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 121573 121019 gene locus_tag LOCUS_11920 121573 121019 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008113.1 protein_id gnl|my_center|LOCUS_11920 123083 122232 gene locus_tag LOCUS_11930 123083 122232 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804229.1 protein_id gnl|my_center|LOCUS_11930 123875 123099 gene locus_tag LOCUS_11940 123875 123099 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390209.1 protein_id gnl|my_center|LOCUS_11940 124984 123872 gene locus_tag LOCUS_11950 124984 123872 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390206.1 protein_id gnl|my_center|LOCUS_11950 126519 125047 gene locus_tag LOCUS_11960 126519 125047 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644028.1 protein_id gnl|my_center|LOCUS_11960 128433 126532 gene locus_tag LOCUS_11970 128433 126532 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721643.1 protein_id gnl|my_center|LOCUS_11970 129359 128535 gene locus_tag LOCUS_11980 129359 128535 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964715.1 protein_id gnl|my_center|LOCUS_11980 131065 129752 gene locus_tag LOCUS_11990 131065 129752 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130092.1 protein_id gnl|my_center|LOCUS_11990 131985 131125 gene locus_tag LOCUS_12000 131985 131125 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285988.1 protein_id gnl|my_center|LOCUS_12000 134662 131990 gene locus_tag LOCUS_12010 134662 131990 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285985.1 protein_id gnl|my_center|LOCUS_12010 135968 134679 gene locus_tag LOCUS_12020 135968 134679 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016173124.1 protein_id gnl|my_center|LOCUS_12020 136124 137164 gene locus_tag LOCUS_12030 136124 137164 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302559.1 protein_id gnl|my_center|LOCUS_12030 137157 139298 gene locus_tag LOCUS_12040 137157 139298 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002374433.1 protein_id gnl|my_center|LOCUS_12040 140864 139359 gene locus_tag LOCUS_12050 140864 139359 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387242.1 protein_id gnl|my_center|LOCUS_12050 142584 140854 gene locus_tag LOCUS_12060 142584 140854 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356857.1 protein_id gnl|my_center|LOCUS_12060 143191 142577 gene locus_tag LOCUS_12070 143191 142577 CDS product DUF624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362905.1 protein_id gnl|my_center|LOCUS_12070 144877 143417 gene locus_tag LOCUS_12080 144877 143417 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370392.1 protein_id gnl|my_center|LOCUS_12080 145824 144901 gene locus_tag LOCUS_12090 145824 144901 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359877.1 protein_id gnl|my_center|LOCUS_12090 146779 145835 gene locus_tag LOCUS_12100 146779 145835 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389270.1 protein_id gnl|my_center|LOCUS_12100 147037 148146 gene locus_tag LOCUS_12110 gene ugpC 147037 148146 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289507.1 protein_id gnl|my_center|LOCUS_12110 148775 148305 gene locus_tag LOCUS_12120 148775 148305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 149848 149501 gene locus_tag LOCUS_12130 149848 149501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 150272 149877 gene locus_tag LOCUS_12140 150272 149877 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809639.1 protein_id gnl|my_center|LOCUS_12140 150955 151164 gene locus_tag LOCUS_12150 150955 151164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 151176 151388 gene locus_tag LOCUS_12160 151176 151388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence08 592 290 gene locus_tag LOCUS_12170 592 290 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287692.1 protein_id gnl|my_center|LOCUS_12170 789 1586 gene locus_tag LOCUS_12180 789 1586 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287690.1 protein_id gnl|my_center|LOCUS_12180 1637 2779 gene locus_tag LOCUS_12190 1637 2779 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287688.1 protein_id gnl|my_center|LOCUS_12190 4257 2863 gene locus_tag LOCUS_12200 gene sufB 4257 2863 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287686.1 protein_id gnl|my_center|LOCUS_12200 4800 4327 gene locus_tag LOCUS_12210 4800 4327 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287684.1 protein_id gnl|my_center|LOCUS_12210 6022 4787 gene locus_tag LOCUS_12220 6022 4787 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376739.1 protein_id gnl|my_center|LOCUS_12220 7299 6022 gene locus_tag LOCUS_12230 gene sufD 7299 6022 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287681.1 protein_id gnl|my_center|LOCUS_12230 8083 7313 gene locus_tag LOCUS_12240 gene sufC 8083 7313 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287679.1 protein_id gnl|my_center|LOCUS_12240 8528 8208 gene locus_tag LOCUS_12250 8528 8208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 9645 8803 gene locus_tag LOCUS_12260 9645 8803 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287678.1 protein_id gnl|my_center|LOCUS_12260 10407 9721 gene locus_tag LOCUS_12270 10407 9721 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287674.1 protein_id gnl|my_center|LOCUS_12270 11557 10400 gene locus_tag LOCUS_12280 11557 10400 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304234.1 protein_id gnl|my_center|LOCUS_12280 12240 11908 gene locus_tag LOCUS_12290 12240 11908 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291179.1 protein_id gnl|my_center|LOCUS_12290 12598 12245 gene locus_tag LOCUS_12300 12598 12245 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295166.1 protein_id gnl|my_center|LOCUS_12300 13790 12591 gene locus_tag LOCUS_12310 13790 12591 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291183.1 protein_id gnl|my_center|LOCUS_12310 14500 13880 gene locus_tag LOCUS_12320 14500 13880 CDS product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386206.1 protein_id gnl|my_center|LOCUS_12320 14714 14641 gene locus_tag LOCUS_t00100 14714 14641 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14849 15085 gene locus_tag LOCUS_12330 14849 15085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294094.1 protein_id gnl|my_center|LOCUS_12330 15836 15207 gene locus_tag LOCUS_12340 gene upp 15836 15207 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294095.1 protein_id gnl|my_center|LOCUS_12340 17235 15994 gene locus_tag LOCUS_12350 17235 15994 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356623.1 protein_id gnl|my_center|LOCUS_12350 18317 17304 gene locus_tag LOCUS_12360 18317 17304 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294101.1 protein_id gnl|my_center|LOCUS_12360 19329 18496 gene locus_tag LOCUS_12370 gene prmC 19329 18496 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379699.1 protein_id gnl|my_center|LOCUS_12370 20395 19322 gene locus_tag LOCUS_12380 gene prfA 20395 19322 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289676.1 protein_id gnl|my_center|LOCUS_12380 20980 20399 gene locus_tag LOCUS_12390 20980 20399 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387135.1 protein_id gnl|my_center|LOCUS_12390 21191 22726 gene locus_tag LOCUS_12400 21191 22726 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949006.1 protein_id gnl|my_center|LOCUS_12400 23200 22742 gene locus_tag LOCUS_12410 23200 22742 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905994.1 protein_id gnl|my_center|LOCUS_12410 23282 24013 gene locus_tag LOCUS_12420 23282 24013 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905995.1 protein_id gnl|my_center|LOCUS_12420 24127 25524 gene locus_tag LOCUS_12430 24127 25524 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287243.1 protein_id gnl|my_center|LOCUS_12430 25714 27066 gene locus_tag LOCUS_12440 25714 27066 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287244.1 protein_id gnl|my_center|LOCUS_12440 27059 27745 gene locus_tag LOCUS_12450 27059 27745 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287245.1 protein_id gnl|my_center|LOCUS_12450 28736 27786 gene locus_tag LOCUS_12460 gene manA 28736 27786 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 protein_id gnl|my_center|LOCUS_12460 29855 28824 gene locus_tag LOCUS_12470 29855 28824 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287263.1 protein_id gnl|my_center|LOCUS_12470 30814 29993 gene locus_tag LOCUS_12480 30814 29993 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287264.1 protein_id gnl|my_center|LOCUS_12480 31116 31424 gene locus_tag LOCUS_12490 31116 31424 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355066.1 protein_id gnl|my_center|LOCUS_12490 31523 32143 gene locus_tag LOCUS_12500 31523 32143 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287272.1 protein_id gnl|my_center|LOCUS_12500 33343 32180 gene locus_tag LOCUS_12510 33343 32180 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287273.1 protein_id gnl|my_center|LOCUS_12510 33700 33356 gene locus_tag LOCUS_12520 33700 33356 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356567.1 protein_id gnl|my_center|LOCUS_12520 33807 34826 gene locus_tag LOCUS_12530 33807 34826 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287276.1 protein_id gnl|my_center|LOCUS_12530 34840 35001 gene locus_tag LOCUS_12540 34840 35001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287277.1 protein_id gnl|my_center|LOCUS_12540 36242 35817 gene locus_tag LOCUS_12550 36242 35817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287278.1 protein_id gnl|my_center|LOCUS_12550 36396 36902 gene locus_tag LOCUS_12560 36396 36902 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_12560 39629 36951 gene locus_tag LOCUS_12570 39629 36951 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377094.1 protein_id gnl|my_center|LOCUS_12570 40619 39873 gene locus_tag LOCUS_12580 40619 39873 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 protein_id gnl|my_center|LOCUS_12580 42443 40638 gene locus_tag LOCUS_12590 42443 40638 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379566.1 protein_id gnl|my_center|LOCUS_12590 43460 42636 gene locus_tag LOCUS_12600 gene nadE 43460 42636 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287302.1 protein_id gnl|my_center|LOCUS_12600 44948 43476 gene locus_tag LOCUS_12610 44948 43476 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356538.1 protein_id gnl|my_center|LOCUS_12610 45470 45111 gene locus_tag LOCUS_12620 45470 45111 CDS product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287305.1 protein_id gnl|my_center|LOCUS_12620 48541 45626 gene locus_tag LOCUS_12630 48541 45626 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485697.1 protein_id gnl|my_center|LOCUS_12630 50529 48901 gene locus_tag LOCUS_12640 gene groL 50529 48901 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288864.1 protein_id gnl|my_center|LOCUS_12640 50836 50552 gene locus_tag LOCUS_12650 gene groES 50836 50552 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288862.1 protein_id gnl|my_center|LOCUS_12650 51036 51680 gene locus_tag LOCUS_12660 51036 51680 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288860.1 protein_id gnl|my_center|LOCUS_12660 51759 52379 gene locus_tag LOCUS_12670 51759 52379 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288856.1 protein_id gnl|my_center|LOCUS_12670 52571 53845 gene locus_tag LOCUS_12680 52571 53845 CDS product ISL3-like element IS1476 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016252543.1 protein_id gnl|my_center|LOCUS_12680 54750 53935 gene locus_tag LOCUS_12690 54750 53935 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288854.1 protein_id gnl|my_center|LOCUS_12690 55638 54793 gene locus_tag LOCUS_12700 55638 54793 CDS product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288853.1 protein_id gnl|my_center|LOCUS_12700 56952 55639 gene locus_tag LOCUS_12710 gene yycH 56952 55639 CDS product two-component system activity regulator YycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288852.1 protein_id gnl|my_center|LOCUS_12710 58778 56949 gene locus_tag LOCUS_12720 gene walK 58778 56949 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288851.1 protein_id gnl|my_center|LOCUS_12720 59485 58781 gene locus_tag LOCUS_12730 gene yycF 59485 58781 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357947.1 protein_id gnl|my_center|LOCUS_12730 60573 59719 gene locus_tag LOCUS_12740 60573 59719 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288847.1 protein_id gnl|my_center|LOCUS_12740 61114 60566 gene locus_tag LOCUS_12750 61114 60566 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357951.1 protein_id gnl|my_center|LOCUS_12750 61271 61345 gene locus_tag LOCUS_t00110 61271 61345 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 61879 62976 gene locus_tag LOCUS_12760 61879 62976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 64090 63134 gene locus_tag LOCUS_12770 64090 63134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 65501 64548 gene locus_tag LOCUS_12780 65501 64548 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289330.1 protein_id gnl|my_center|LOCUS_12780 66575 65529 gene locus_tag LOCUS_12790 66575 65529 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289332.1 protein_id gnl|my_center|LOCUS_12790 67616 66582 gene locus_tag LOCUS_12800 67616 66582 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289334.1 protein_id gnl|my_center|LOCUS_12800 68557 67616 gene locus_tag LOCUS_12810 68557 67616 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293573.1 protein_id gnl|my_center|LOCUS_12810 70909 69248 gene locus_tag LOCUS_12820 70909 69248 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289796.1 protein_id gnl|my_center|LOCUS_12820 71420 71232 gene locus_tag LOCUS_12830 71420 71232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 71515 73029 gene locus_tag LOCUS_12840 71515 73029 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723152.1 protein_id gnl|my_center|LOCUS_12840 73085 74131 gene locus_tag LOCUS_12850 gene leuB 73085 74131 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162527.1 protein_id gnl|my_center|LOCUS_12850 74203 75576 gene locus_tag LOCUS_12860 gene leuC 74203 75576 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989859.1 protein_id gnl|my_center|LOCUS_12860 75576 76160 gene locus_tag LOCUS_12870 gene leuD 75576 76160 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131129.1 protein_id gnl|my_center|LOCUS_12870 78044 76269 gene locus_tag LOCUS_12880 78044 76269 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990058.1 protein_id gnl|my_center|LOCUS_12880 78789 78088 gene locus_tag LOCUS_12890 78789 78088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 79157 79023 gene locus_tag LOCUS_12900 79157 79023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355364.1 protein_id gnl|my_center|LOCUS_12900 81307 79145 gene locus_tag LOCUS_12910 gene feoB 81307 79145 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399646.1 protein_id gnl|my_center|LOCUS_12910 81778 81308 gene locus_tag LOCUS_12920 81778 81308 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287797.1 protein_id gnl|my_center|LOCUS_12920 82172 82390 gene locus_tag LOCUS_12930 gene nrdH 82172 82390 CDS product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287795.1 protein_id gnl|my_center|LOCUS_12930 82698 84857 gene locus_tag LOCUS_12940 gene nrdE 82698 84857 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355358.1 protein_id gnl|my_center|LOCUS_12940 84942 85907 gene locus_tag LOCUS_12950 gene nrdF 84942 85907 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287792.1 protein_id gnl|my_center|LOCUS_12950 86738 86034 gene locus_tag LOCUS_12960 86738 86034 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355354.1 protein_id gnl|my_center|LOCUS_12960 87515 86808 gene locus_tag LOCUS_12970 87515 86808 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285969.1 protein_id gnl|my_center|LOCUS_12970 88186 87611 gene locus_tag LOCUS_12980 88186 87611 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108273.1 protein_id gnl|my_center|LOCUS_12980 89121 88420 gene locus_tag LOCUS_12990 gene nagB 89121 88420 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355352.1 protein_id gnl|my_center|LOCUS_12990 89766 89278 gene locus_tag LOCUS_13000 89766 89278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492212.1 protein_id gnl|my_center|LOCUS_13000 90553 89747 gene locus_tag LOCUS_13010 90553 89747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 91818 90550 gene locus_tag LOCUS_13020 91818 90550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 93419 92280 gene locus_tag LOCUS_13030 93419 92280 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287246.1 protein_id gnl|my_center|LOCUS_13030 93858 93421 gene locus_tag LOCUS_13040 93858 93421 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701041.1 protein_id gnl|my_center|LOCUS_13040 95938 93887 gene locus_tag LOCUS_13050 95938 93887 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643698.1 protein_id gnl|my_center|LOCUS_13050 97792 96026 gene locus_tag LOCUS_13060 97792 96026 CDS product PTS mannitol-specific transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706745.1 protein_id gnl|my_center|LOCUS_13060 98323 97952 gene locus_tag LOCUS_13070 98323 97952 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356033.1 protein_id gnl|my_center|LOCUS_13070 99344 98433 gene locus_tag LOCUS_13080 99344 98433 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286670.1 protein_id gnl|my_center|LOCUS_13080 100169 99366 gene locus_tag LOCUS_13090 100169 99366 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294546.1 protein_id gnl|my_center|LOCUS_13090 101192 100203 gene locus_tag LOCUS_13100 101192 100203 CDS product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356030.1 protein_id gnl|my_center|LOCUS_13100 101769 101269 gene locus_tag LOCUS_13110 101769 101269 CDS product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385473.1 protein_id gnl|my_center|LOCUS_13110 104745 101971 gene locus_tag LOCUS_13120 104745 101971 CDS product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289453.1 protein_id gnl|my_center|LOCUS_13120 106569 105130 gene locus_tag LOCUS_13130 106569 105130 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_13130 107949 106582 gene locus_tag LOCUS_13140 gene trkA 107949 106582 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_13140 108457 108191 gene locus_tag LOCUS_13150 108457 108191 CDS product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262921.1 protein_id gnl|my_center|LOCUS_13150 108858 108565 gene locus_tag LOCUS_13160 gene rpmA 108858 108565 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289452.1 protein_id gnl|my_center|LOCUS_13160 109221 108871 gene locus_tag LOCUS_13170 109221 108871 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289451.1 protein_id gnl|my_center|LOCUS_13170 109547 109239 gene locus_tag LOCUS_13180 gene rplU 109547 109239 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289450.1 protein_id gnl|my_center|LOCUS_13180 109786 110433 gene locus_tag LOCUS_13190 109786 110433 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289449.1 protein_id gnl|my_center|LOCUS_13190 110433 111101 gene locus_tag LOCUS_13200 110433 111101 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706832.1 protein_id gnl|my_center|LOCUS_13200 111201 112040 gene locus_tag LOCUS_13210 111201 112040 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549553.1 protein_id gnl|my_center|LOCUS_13210 112100 112175 gene locus_tag LOCUS_t00120 112100 112175 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 113309 112365 gene locus_tag LOCUS_13220 gene glcK 113309 112365 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_13220 114232 113321 gene locus_tag LOCUS_13230 114232 113321 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_13230 115487 114309 gene locus_tag LOCUS_13240 115487 114309 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161951924.1 protein_id gnl|my_center|LOCUS_13240 116506 115511 gene locus_tag LOCUS_13250 116506 115511 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707197.1 protein_id gnl|my_center|LOCUS_13250 117980 116487 gene locus_tag LOCUS_13260 gene gguA 117980 116487 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_13260 119131 117998 gene locus_tag LOCUS_13270 119131 117998 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243020.1 protein_id gnl|my_center|LOCUS_13270 119957 119142 gene locus_tag LOCUS_13280 119957 119142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 120172 121071 gene locus_tag LOCUS_13290 120172 121071 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_13290 121068 122123 gene locus_tag LOCUS_13300 121068 122123 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 protein_id gnl|my_center|LOCUS_13300 122399 124357 gene locus_tag LOCUS_13310 122399 124357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 125028 124651 gene locus_tag LOCUS_13320 125028 124651 CDS product HsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453603.1 protein_id gnl|my_center|LOCUS_13320 125452 125030 gene locus_tag LOCUS_13330 125452 125030 CDS product DUF2871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111798.1 protein_id gnl|my_center|LOCUS_13330 125865 125449 gene locus_tag LOCUS_13340 125865 125449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111796.1 protein_id gnl|my_center|LOCUS_13340 126484 125924 gene locus_tag LOCUS_13350 126484 125924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 126880 126608 gene locus_tag LOCUS_13360 126880 126608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566252.1 protein_id gnl|my_center|LOCUS_13360 127623 126994 gene locus_tag LOCUS_13370 127623 126994 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267179.1 protein_id gnl|my_center|LOCUS_13370 128577 127690 gene locus_tag LOCUS_13380 128577 127690 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018365292.1 protein_id gnl|my_center|LOCUS_13380 129634 128681 gene locus_tag LOCUS_13390 129634 128681 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101494.1 protein_id gnl|my_center|LOCUS_13390 129769 130134 gene locus_tag LOCUS_13400 129769 130134 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861394.1 protein_id gnl|my_center|LOCUS_13400 130305 130613 gene locus_tag LOCUS_13410 130305 130613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 131152 130649 gene locus_tag LOCUS_13420 131152 130649 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320930.1 protein_id gnl|my_center|LOCUS_13420 131430 133034 gene locus_tag LOCUS_13430 131430 133034 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288103.1 protein_id gnl|my_center|LOCUS_13430 134078 133083 gene locus_tag LOCUS_13440 134078 133083 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288240.1 protein_id gnl|my_center|LOCUS_13440 134724 134071 gene locus_tag LOCUS_13450 134724 134071 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288242.1 protein_id gnl|my_center|LOCUS_13450 136566 134737 gene locus_tag LOCUS_13460 gene bglP 136566 134737 CDS product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242943.1 protein_id gnl|my_center|LOCUS_13460 136840 138039 gene locus_tag LOCUS_13470 136840 138039 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770856.1 protein_id gnl|my_center|LOCUS_13470 138832 138125 gene locus_tag LOCUS_13480 138832 138125 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097539.1 protein_id gnl|my_center|LOCUS_13480 140022 139015 gene locus_tag LOCUS_13490 140022 139015 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356394.1 protein_id gnl|my_center|LOCUS_13490 140801 140064 gene locus_tag LOCUS_13500 140801 140064 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288100.1 protein_id gnl|my_center|LOCUS_13500 141571 140798 gene locus_tag LOCUS_13510 141571 140798 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288098.1 protein_id gnl|my_center|LOCUS_13510 141774 141604 gene locus_tag LOCUS_13520 141774 141604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 142925 141846 gene locus_tag LOCUS_13530 142925 141846 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288096.1 protein_id gnl|my_center|LOCUS_13530 143078 143488 gene locus_tag LOCUS_13540 143078 143488 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385906.1 protein_id gnl|my_center|LOCUS_13540 144700 143528 gene locus_tag LOCUS_13550 144700 143528 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296167.1 protein_id gnl|my_center|LOCUS_13550 145826 144687 gene locus_tag LOCUS_13560 145826 144687 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294551.1 protein_id gnl|my_center|LOCUS_13560 146769 145837 gene locus_tag LOCUS_13570 146769 145837 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015509966.1 protein_id gnl|my_center|LOCUS_13570 146921 148021 gene locus_tag LOCUS_13580 146921 148021 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289599.1 protein_id gnl|my_center|LOCUS_13580 148076 148708 gene locus_tag LOCUS_13590 148076 148708 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289597.1 protein_id gnl|my_center|LOCUS_13590 149895 148810 gene locus_tag LOCUS_13600 149895 148810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 >Feature sequence09 118 3102 gene locus_tag LOCUS_13610 118 3102 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002326842.1 protein_id gnl|my_center|LOCUS_13610 3426 4334 gene locus_tag LOCUS_13620 3426 4334 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964711.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13620 4315 4518 gene locus_tag LOCUS_13630 4315 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 4674 6062 gene locus_tag LOCUS_13640 4674 6062 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289073.1 protein_id gnl|my_center|LOCUS_13640 6077 6901 gene locus_tag LOCUS_13650 6077 6901 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107914.1 protein_id gnl|my_center|LOCUS_13650 6879 7868 gene locus_tag LOCUS_13660 6879 7868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 7884 8585 gene locus_tag LOCUS_13670 7884 8585 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380521.1 protein_id gnl|my_center|LOCUS_13670 8600 9655 gene locus_tag LOCUS_13680 8600 9655 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383751.1 protein_id gnl|my_center|LOCUS_13680 10225 10040 gene locus_tag LOCUS_13690 10225 10040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 10351 11085 gene locus_tag LOCUS_13700 10351 11085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 11101 12297 gene locus_tag LOCUS_13710 11101 12297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 12369 13205 gene locus_tag LOCUS_13720 12369 13205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 13207 14652 gene locus_tag LOCUS_13730 13207 14652 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101282.1 protein_id gnl|my_center|LOCUS_13730 14666 15619 gene locus_tag LOCUS_13740 14666 15619 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289372.1 protein_id gnl|my_center|LOCUS_13740 15687 16637 gene locus_tag LOCUS_13750 15687 16637 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289860.1 protein_id gnl|my_center|LOCUS_13750 16729 18468 gene locus_tag LOCUS_13760 16729 18468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 18564 19043 gene locus_tag LOCUS_13770 gene greA 18564 19043 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355133.1 protein_id gnl|my_center|LOCUS_13770 19179 19901 gene locus_tag LOCUS_13780 gene liaF 19179 19901 CDS product cell wall-active antibiotics response protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002327152.1 protein_id gnl|my_center|LOCUS_13780 19898 20995 gene locus_tag LOCUS_13790 19898 20995 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365182.1 protein_id gnl|my_center|LOCUS_13790 21029 21661 gene locus_tag LOCUS_13800 21029 21661 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289153.1 protein_id gnl|my_center|LOCUS_13800 21766 22431 gene locus_tag LOCUS_13810 21766 22431 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289151.1 protein_id gnl|my_center|LOCUS_13810 22444 22737 gene locus_tag LOCUS_13820 22444 22737 CDS product iron-sulfur cluster biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289149.1 protein_id gnl|my_center|LOCUS_13820 22749 23681 gene locus_tag LOCUS_13830 22749 23681 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289773.1 protein_id gnl|my_center|LOCUS_13830 24693 23746 gene locus_tag LOCUS_13840 24693 23746 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289148.1 protein_id gnl|my_center|LOCUS_13840 25597 24782 gene locus_tag LOCUS_13850 25597 24782 CDS product DUF1189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289147.1 protein_id gnl|my_center|LOCUS_13850 25760 26227 gene locus_tag LOCUS_13860 25760 26227 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292862.1 protein_id gnl|my_center|LOCUS_13860 26300 26908 gene locus_tag LOCUS_13870 26300 26908 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387688.1 protein_id gnl|my_center|LOCUS_13870 27149 28381 gene locus_tag LOCUS_13880 27149 28381 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295400.1 protein_id gnl|my_center|LOCUS_13880 29789 28416 gene locus_tag LOCUS_13890 gene rlmD 29789 28416 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295399.1 protein_id gnl|my_center|LOCUS_13890 29974 30771 gene locus_tag LOCUS_13900 gene recX 29974 30771 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002318634.1 protein_id gnl|my_center|LOCUS_13900 30764 31915 gene locus_tag LOCUS_13910 gene mutY 30764 31915 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773812.1 protein_id gnl|my_center|LOCUS_13910 32013 32546 gene locus_tag LOCUS_13920 32013 32546 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290817.1 protein_id gnl|my_center|LOCUS_13920 33042 32608 gene locus_tag LOCUS_13930 33042 32608 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290819.1 protein_id gnl|my_center|LOCUS_13930 33119 34243 gene locus_tag LOCUS_13940 33119 34243 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290821.1 protein_id gnl|my_center|LOCUS_13940 34356 35732 gene locus_tag LOCUS_13950 34356 35732 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295395.1 protein_id gnl|my_center|LOCUS_13950 35950 37527 gene locus_tag LOCUS_13960 35950 37527 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748648.1 protein_id gnl|my_center|LOCUS_13960 37551 39335 gene locus_tag LOCUS_13970 37551 39335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002332930.1 protein_id gnl|my_center|LOCUS_13970 39648 39352 gene locus_tag LOCUS_13980 39648 39352 CDS product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290825.1 protein_id gnl|my_center|LOCUS_13980 39863 41122 gene locus_tag LOCUS_13990 39863 41122 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287937.1 protein_id gnl|my_center|LOCUS_13990 43346 41259 gene locus_tag LOCUS_14000 43346 41259 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287598.1 protein_id gnl|my_center|LOCUS_14000 43567 43830 gene locus_tag LOCUS_14010 43567 43830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 43921 44187 gene locus_tag LOCUS_14020 43921 44187 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287602.1 protein_id gnl|my_center|LOCUS_14020 44187 45914 gene locus_tag LOCUS_14030 gene ptsP 44187 45914 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287603.1 protein_id gnl|my_center|LOCUS_14030 46083 47126 gene locus_tag LOCUS_14040 46083 47126 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287604.1 protein_id gnl|my_center|LOCUS_14040 47142 48380 gene locus_tag LOCUS_14050 47142 48380 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287605.1 protein_id gnl|my_center|LOCUS_14050 48444 49310 gene locus_tag LOCUS_14060 48444 49310 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287606.1 protein_id gnl|my_center|LOCUS_14060 49415 49645 gene locus_tag LOCUS_14070 49415 49645 CDS product YkuJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379802.1 protein_id gnl|my_center|LOCUS_14070 49810 50973 gene locus_tag LOCUS_14080 49810 50973 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706799.1 protein_id gnl|my_center|LOCUS_14080 51173 51613 gene locus_tag LOCUS_14090 51173 51613 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362455.1 protein_id gnl|my_center|LOCUS_14090 51610 52572 gene locus_tag LOCUS_14100 51610 52572 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287612.1 protein_id gnl|my_center|LOCUS_14100 52625 52852 gene locus_tag LOCUS_14110 52625 52852 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287614.1 protein_id gnl|my_center|LOCUS_14110 52917 53861 gene locus_tag LOCUS_14120 gene fabD 52917 53861 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356280.1 protein_id gnl|my_center|LOCUS_14120 53845 54576 gene locus_tag LOCUS_14130 gene fabG 53845 54576 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287617.1 protein_id gnl|my_center|LOCUS_14130 54594 55820 gene locus_tag LOCUS_14140 gene fabF 54594 55820 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287619.1 protein_id gnl|my_center|LOCUS_14140 55823 56293 gene locus_tag LOCUS_14150 gene accB 55823 56293 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379800.1 protein_id gnl|my_center|LOCUS_14150 56306 56728 gene locus_tag LOCUS_14160 gene fabZ 56306 56728 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287621.1 protein_id gnl|my_center|LOCUS_14160 56729 58099 gene locus_tag LOCUS_14170 56729 58099 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384028.1 protein_id gnl|my_center|LOCUS_14170 58111 58980 gene locus_tag LOCUS_14180 gene accD 58111 58980 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773830.1 protein_id gnl|my_center|LOCUS_14180 58977 59762 gene locus_tag LOCUS_14190 58977 59762 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362363.1 protein_id gnl|my_center|LOCUS_14190 59893 60699 gene locus_tag LOCUS_14200 59893 60699 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261966.1 protein_id gnl|my_center|LOCUS_14200 60852 61691 gene locus_tag LOCUS_14210 60852 61691 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261966.1 protein_id gnl|my_center|LOCUS_14210 61704 62393 gene locus_tag LOCUS_14220 61704 62393 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255158.1 protein_id gnl|my_center|LOCUS_14220 62403 63146 gene locus_tag LOCUS_14230 62403 63146 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002943067.1 protein_id gnl|my_center|LOCUS_14230 63273 63797 gene locus_tag LOCUS_14240 63273 63797 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356296.1 protein_id gnl|my_center|LOCUS_14240 63798 64907 gene locus_tag LOCUS_14250 gene yqeH 63798 64907 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287628.1 protein_id gnl|my_center|LOCUS_14250 64938 65249 gene locus_tag LOCUS_14260 gene yhbY 64938 65249 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287630.1 protein_id gnl|my_center|LOCUS_14260 65285 65920 gene locus_tag LOCUS_14270 65285 65920 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287632.1 protein_id gnl|my_center|LOCUS_14270 65910 66506 gene locus_tag LOCUS_14280 gene yqeK 65910 66506 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287635.1 protein_id gnl|my_center|LOCUS_14280 66600 66938 gene locus_tag LOCUS_14290 gene rsfS 66600 66938 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033582077.1 protein_id gnl|my_center|LOCUS_14290 66938 67666 gene locus_tag LOCUS_14300 66938 67666 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356302.1 protein_id gnl|my_center|LOCUS_14300 67755 68894 gene locus_tag LOCUS_14310 67755 68894 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002394037.1 protein_id gnl|my_center|LOCUS_14310 68966 69685 gene locus_tag LOCUS_14320 68966 69685 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287641.1 protein_id gnl|my_center|LOCUS_14320 72026 69744 gene locus_tag LOCUS_14330 gene helD 72026 69744 CDS product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287644.1 protein_id gnl|my_center|LOCUS_14330 73022 72156 gene locus_tag LOCUS_14340 73022 72156 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379188.1 protein_id gnl|my_center|LOCUS_14340 73450 73040 gene locus_tag LOCUS_14350 73450 73040 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600350.1 protein_id gnl|my_center|LOCUS_14350 73643 73819 gene locus_tag LOCUS_14360 73643 73819 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356318.1 protein_id gnl|my_center|LOCUS_14360 74134 76074 gene locus_tag LOCUS_14370 gene thrS 74134 76074 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287651.1 protein_id gnl|my_center|LOCUS_14370 76458 78575 gene locus_tag LOCUS_14380 76458 78575 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287654.1 protein_id gnl|my_center|LOCUS_14380 78680 79153 gene locus_tag LOCUS_14390 78680 79153 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837194.1 protein_id gnl|my_center|LOCUS_14390 79278 79427 gene locus_tag LOCUS_14400 gene rpmG 79278 79427 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356321.1 protein_id gnl|my_center|LOCUS_14400 79605 80012 gene locus_tag LOCUS_14410 79605 80012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 80009 80746 gene locus_tag LOCUS_14420 80009 80746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302142.1 protein_id gnl|my_center|LOCUS_14420 81729 80803 gene locus_tag LOCUS_14430 81729 80803 CDS product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379233.1 protein_id gnl|my_center|LOCUS_14430 81889 82686 gene locus_tag LOCUS_14440 81889 82686 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002325771.1 protein_id gnl|my_center|LOCUS_14440 82679 83662 gene locus_tag LOCUS_14450 82679 83662 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379232.1 protein_id gnl|my_center|LOCUS_14450 83659 84642 gene locus_tag LOCUS_14460 83659 84642 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296124.1 protein_id gnl|my_center|LOCUS_14460 84660 85655 gene locus_tag LOCUS_14470 84660 85655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 85712 86248 gene locus_tag LOCUS_14480 85712 86248 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289886.1 protein_id gnl|my_center|LOCUS_14480 86296 86958 gene locus_tag LOCUS_14490 86296 86958 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289885.1 protein_id gnl|my_center|LOCUS_14490 87066 87230 gene locus_tag LOCUS_14500 87066 87230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 87214 87420 gene locus_tag LOCUS_14510 87214 87420 CDS product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293902.1 protein_id gnl|my_center|LOCUS_14510 87422 88378 gene locus_tag LOCUS_14520 87422 88378 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288462.1 protein_id gnl|my_center|LOCUS_14520 88405 88806 gene locus_tag LOCUS_14530 88405 88806 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356334.1 protein_id gnl|my_center|LOCUS_14530 88946 89758 gene locus_tag LOCUS_14540 gene yidA 88946 89758 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295119.1 protein_id gnl|my_center|LOCUS_14540 89743 89931 gene locus_tag LOCUS_14550 89743 89931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 89867 90166 gene locus_tag LOCUS_14560 89867 90166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14560 90265 91638 gene locus_tag LOCUS_14570 90265 91638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14570 91833 91666 gene locus_tag LOCUS_14580 91833 91666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 92041 93030 gene locus_tag LOCUS_14590 gene galE 92041 93030 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293897.1 protein_id gnl|my_center|LOCUS_14590 93042 94523 gene locus_tag LOCUS_14600 gene galT 93042 94523 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288451.1 protein_id gnl|my_center|LOCUS_14600 94536 95525 gene locus_tag LOCUS_14610 94536 95525 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379303.1 protein_id gnl|my_center|LOCUS_14610 95652 96359 gene locus_tag LOCUS_14620 gene tsaB 95652 96359 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385746.1 protein_id gnl|my_center|LOCUS_14620 96343 96891 gene locus_tag LOCUS_14630 gene rimI 96343 96891 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288446.1 protein_id gnl|my_center|LOCUS_14630 96892 97317 gene locus_tag LOCUS_14640 gene rimI 96892 97317 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288445.1 protein_id gnl|my_center|LOCUS_14640 97310 98332 gene locus_tag LOCUS_14650 gene tsaD 97310 98332 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288444.1 protein_id gnl|my_center|LOCUS_14650 98811 99824 gene locus_tag LOCUS_14660 gene argF 98811 99824 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983808.1 protein_id gnl|my_center|LOCUS_14660 100110 101801 gene locus_tag LOCUS_14670 gene argS 100110 101801 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288432.1 protein_id gnl|my_center|LOCUS_14670 102351 101872 gene locus_tag LOCUS_14680 102351 101872 CDS product ArgR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293881.1 protein_id gnl|my_center|LOCUS_14680 102745 103542 gene locus_tag LOCUS_14690 gene rpsB 102745 103542 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293880.1 protein_id gnl|my_center|LOCUS_14690 103621 104505 gene locus_tag LOCUS_14700 gene tsf 103621 104505 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293878.1 protein_id gnl|my_center|LOCUS_14700 104634 105356 gene locus_tag LOCUS_14710 gene pyrH 104634 105356 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293877.1 protein_id gnl|my_center|LOCUS_14710 105358 105915 gene locus_tag LOCUS_14720 gene frr 105358 105915 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293875.1 protein_id gnl|my_center|LOCUS_14720 106107 106907 gene locus_tag LOCUS_14730 106107 106907 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294134.1 protein_id gnl|my_center|LOCUS_14730 106904 107698 gene locus_tag LOCUS_14740 106904 107698 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296531.1 protein_id gnl|my_center|LOCUS_14740 107876 109144 gene locus_tag LOCUS_14750 gene rseP 107876 109144 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294136.1 protein_id gnl|my_center|LOCUS_14750 109244 113587 gene locus_tag LOCUS_14760 109244 113587 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288497.1 protein_id gnl|my_center|LOCUS_14760 113754 114227 gene locus_tag LOCUS_14770 gene rimP 113754 114227 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288499.1 protein_id gnl|my_center|LOCUS_14770 114342 115559 gene locus_tag LOCUS_14780 gene nusA 114342 115559 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288500.1 protein_id gnl|my_center|LOCUS_14780 115579 115875 gene locus_tag LOCUS_14790 115579 115875 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363794.1 protein_id gnl|my_center|LOCUS_14790 115868 116170 gene locus_tag LOCUS_14800 115868 116170 CDS product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288509.1 protein_id gnl|my_center|LOCUS_14800 116183 118912 gene locus_tag LOCUS_14810 gene infB 116183 118912 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288511.1 protein_id gnl|my_center|LOCUS_14810 118998 119345 gene locus_tag LOCUS_14820 gene rbfA 118998 119345 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288513.1 protein_id gnl|my_center|LOCUS_14820 119469 119759 gene locus_tag LOCUS_14830 119469 119759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290188.1 protein_id gnl|my_center|LOCUS_14830 119764 121845 gene locus_tag LOCUS_14840 119764 121845 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288388.1 protein_id gnl|my_center|LOCUS_14840 121980 122903 gene locus_tag LOCUS_14850 gene truB 121980 122903 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294474.1 protein_id gnl|my_center|LOCUS_14850 122907 123854 gene locus_tag LOCUS_14860 gene ribF 122907 123854 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288521.1 protein_id gnl|my_center|LOCUS_14860 123949 124347 gene locus_tag LOCUS_14870 123949 124347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 124416 125138 gene locus_tag LOCUS_14880 124416 125138 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948430.1 protein_id gnl|my_center|LOCUS_14880 125131 125871 gene locus_tag LOCUS_14890 125131 125871 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061295975.1 protein_id gnl|my_center|LOCUS_14890 125892 126719 gene locus_tag LOCUS_14900 125892 126719 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435784.1 protein_id gnl|my_center|LOCUS_14900 126864 127052 gene locus_tag LOCUS_14910 126864 127052 CDS product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895603.1 protein_id gnl|my_center|LOCUS_14910 127122 128033 gene locus_tag LOCUS_14920 127122 128033 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860715.1 protein_id gnl|my_center|LOCUS_14920 128464 128081 gene locus_tag LOCUS_14930 128464 128081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 128813 129979 gene locus_tag LOCUS_14940 128813 129979 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365726.1 protein_id gnl|my_center|LOCUS_14940 130222 130022 gene locus_tag LOCUS_14950 130222 130022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287763.1 protein_id gnl|my_center|LOCUS_14950 130461 131333 gene locus_tag LOCUS_14960 130461 131333 CDS product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289807.1 protein_id gnl|my_center|LOCUS_14960 133144 131411 gene locus_tag LOCUS_14970 133144 131411 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297195.1 protein_id gnl|my_center|LOCUS_14970 133836 133141 gene locus_tag LOCUS_14980 133836 133141 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293705.1 protein_id gnl|my_center|LOCUS_14980 133958 134419 gene locus_tag LOCUS_14990 133958 134419 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369322.1 protein_id gnl|my_center|LOCUS_14990 134419 134757 gene locus_tag LOCUS_15000 134419 134757 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293708.1 protein_id gnl|my_center|LOCUS_15000 134894 136309 gene locus_tag LOCUS_15010 gene ffh 134894 136309 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293709.1 protein_id gnl|my_center|LOCUS_15010 136958 136353 gene locus_tag LOCUS_15020 136958 136353 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893393.1 protein_id gnl|my_center|LOCUS_15020 138165 136963 gene locus_tag LOCUS_15030 138165 136963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 139046 138162 gene locus_tag LOCUS_15040 139046 138162 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722129.1 protein_id gnl|my_center|LOCUS_15040 139429 139043 gene locus_tag LOCUS_15050 139429 139043 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_15050 139572 140135 gene locus_tag LOCUS_15060 139572 140135 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293710.1 protein_id gnl|my_center|LOCUS_15060 140220 140732 gene locus_tag LOCUS_15070 140220 140732 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297192.1 protein_id gnl|my_center|LOCUS_15070 141405 140758 gene locus_tag LOCUS_15080 141405 140758 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065188.1 protein_id gnl|my_center|LOCUS_15080 142088 141534 gene locus_tag LOCUS_15090 142088 141534 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293714.1 protein_id gnl|my_center|LOCUS_15090 142280 142555 gene locus_tag LOCUS_15100 gene rpsP 142280 142555 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290274.1 protein_id gnl|my_center|LOCUS_15100 142567 142812 gene locus_tag LOCUS_15110 142567 142812 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290277.1 protein_id gnl|my_center|LOCUS_15110 142891 143739 gene locus_tag LOCUS_15120 142891 143739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371451.1 protein_id gnl|my_center|LOCUS_15120 143762 144286 gene locus_tag LOCUS_15130 gene rimM 143762 144286 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369214.1 protein_id gnl|my_center|LOCUS_15130 144276 145013 gene locus_tag LOCUS_15140 gene trmD 144276 145013 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381776.1 protein_id gnl|my_center|LOCUS_15140 145329 145676 gene locus_tag LOCUS_15150 gene rplS 145329 145676 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357176.1 protein_id gnl|my_center|LOCUS_15150 146036 146692 gene locus_tag LOCUS_15160 146036 146692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286921.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence10 111 1145 gene locus_tag LOCUS_15170 111 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 1220 1558 gene locus_tag LOCUS_15180 1220 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1561 1830 gene locus_tag LOCUS_15190 1561 1830 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359993.1 protein_id gnl|my_center|LOCUS_15190 1823 1948 gene locus_tag LOCUS_15200 1823 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1948 2961 gene locus_tag LOCUS_15210 1948 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 3232 3307 gene locus_tag LOCUS_t00130 3232 3307 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3430 4404 gene locus_tag LOCUS_15220 gene bsh 3430 4404 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287105.1 protein_id gnl|my_center|LOCUS_15220 5094 5780 gene locus_tag LOCUS_15230 5094 5780 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156264871.1 protein_id gnl|my_center|LOCUS_15230 6324 6070 gene locus_tag LOCUS_15240 6324 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295437.1 protein_id gnl|my_center|LOCUS_15240 6803 7705 gene locus_tag LOCUS_15250 6803 7705 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379342.1 protein_id gnl|my_center|LOCUS_15250 7716 8552 gene locus_tag LOCUS_15260 7716 8552 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287743.1 protein_id gnl|my_center|LOCUS_15260 8766 9446 gene locus_tag LOCUS_15270 8766 9446 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003605134.1 protein_id gnl|my_center|LOCUS_15270 9443 10432 gene locus_tag LOCUS_15280 9443 10432 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837284.1 protein_id gnl|my_center|LOCUS_15280 10576 11337 gene locus_tag LOCUS_15290 10576 11337 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173358.1 protein_id gnl|my_center|LOCUS_15290 11341 13329 gene locus_tag LOCUS_15300 11341 13329 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459160.1 protein_id gnl|my_center|LOCUS_15300 14526 13366 gene locus_tag LOCUS_15310 14526 13366 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295845.1 protein_id gnl|my_center|LOCUS_15310 14759 15100 gene locus_tag LOCUS_15320 14759 15100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 15332 15514 gene locus_tag LOCUS_15330 15332 15514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 15577 17547 gene locus_tag LOCUS_15340 15577 17547 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286297.1 protein_id gnl|my_center|LOCUS_15340 17721 18356 gene locus_tag LOCUS_15350 17721 18356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 18499 19839 gene locus_tag LOCUS_15360 18499 19839 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454646.1 protein_id gnl|my_center|LOCUS_15360 19849 20739 gene locus_tag LOCUS_15370 19849 20739 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436909.1 protein_id gnl|my_center|LOCUS_15370 20746 21816 gene locus_tag LOCUS_15380 gene buk 20746 21816 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454677.1 protein_id gnl|my_center|LOCUS_15380 21862 22980 gene locus_tag LOCUS_15390 21862 22980 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642307.1 protein_id gnl|my_center|LOCUS_15390 22995 23669 gene locus_tag LOCUS_15400 22995 23669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425116.1 protein_id gnl|my_center|LOCUS_15400 24151 23705 gene locus_tag LOCUS_15410 24151 23705 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678773.1 protein_id gnl|my_center|LOCUS_15410 24323 25180 gene locus_tag LOCUS_15420 24323 25180 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774245.1 protein_id gnl|my_center|LOCUS_15420 25499 26212 gene locus_tag LOCUS_15430 25499 26212 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876566.1 protein_id gnl|my_center|LOCUS_15430 27016 26249 gene locus_tag LOCUS_15440 27016 26249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 27929 29278 gene locus_tag LOCUS_15450 gene trpE 27929 29278 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003734037.1 protein_id gnl|my_center|LOCUS_15450 29275 29805 gene locus_tag LOCUS_15460 29275 29805 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836634.1 protein_id gnl|my_center|LOCUS_15460 29806 30819 gene locus_tag LOCUS_15470 gene trpD 29806 30819 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723937.1 protein_id gnl|my_center|LOCUS_15470 30820 31578 gene locus_tag LOCUS_15480 gene trpC 30820 31578 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723936.1 protein_id gnl|my_center|LOCUS_15480 31575 32180 gene locus_tag LOCUS_15490 31575 32180 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603742.1 protein_id gnl|my_center|LOCUS_15490 32532 33725 gene locus_tag LOCUS_15500 gene trpB 32532 33725 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723934.1 protein_id gnl|my_center|LOCUS_15500 33722 34477 gene locus_tag LOCUS_15510 gene trpA 33722 34477 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723933.1 protein_id gnl|my_center|LOCUS_15510 34548 35954 gene locus_tag LOCUS_15520 34548 35954 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641197.1 protein_id gnl|my_center|LOCUS_15520 36147 36530 gene locus_tag LOCUS_15530 36147 36530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 36850 37743 gene locus_tag LOCUS_15540 36850 37743 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362274.1 protein_id gnl|my_center|LOCUS_15540 38078 39496 gene locus_tag LOCUS_15550 38078 39496 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356974.1 protein_id gnl|my_center|LOCUS_15550 39489 40532 gene locus_tag LOCUS_15560 gene cydB 39489 40532 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379582.1 protein_id gnl|my_center|LOCUS_15560 40652 42364 gene locus_tag LOCUS_15570 gene cydD 40652 42364 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378477.1 protein_id gnl|my_center|LOCUS_15570 42361 44109 gene locus_tag LOCUS_15580 gene cydC 42361 44109 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383727.1 protein_id gnl|my_center|LOCUS_15580 44431 44961 gene locus_tag LOCUS_15590 44431 44961 CDS product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902203.1 protein_id gnl|my_center|LOCUS_15590 45108 46151 gene locus_tag LOCUS_15600 45108 46151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 46372 46226 gene locus_tag LOCUS_15610 46372 46226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 46565 46996 gene locus_tag LOCUS_15620 46565 46996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 46993 48183 gene locus_tag LOCUS_15630 46993 48183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 48427 49269 gene locus_tag LOCUS_15640 48427 49269 CDS product sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674729.1 protein_id gnl|my_center|LOCUS_15640 50878 49325 gene locus_tag LOCUS_15650 50878 49325 CDS product M protein trans-acting positive regulator PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837580.1 protein_id gnl|my_center|LOCUS_15650 51053 52426 gene locus_tag LOCUS_15660 51053 52426 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371458.1 protein_id gnl|my_center|LOCUS_15660 52609 53238 gene locus_tag LOCUS_15670 52609 53238 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836620.1 protein_id gnl|my_center|LOCUS_15670 53272 55590 gene locus_tag LOCUS_15680 53272 55590 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983425.1 protein_id gnl|my_center|LOCUS_15680 55587 56342 gene locus_tag LOCUS_15690 55587 56342 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721684.1 protein_id gnl|my_center|LOCUS_15690 56442 57335 gene locus_tag LOCUS_15700 56442 57335 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018365292.1 protein_id gnl|my_center|LOCUS_15700 57389 57805 gene locus_tag LOCUS_15710 57389 57805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 58983 58045 gene locus_tag LOCUS_15720 58983 58045 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385468.1 protein_id gnl|my_center|LOCUS_15720 59063 59689 gene locus_tag LOCUS_15730 59063 59689 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723214.1 protein_id gnl|my_center|LOCUS_15730 60962 62104 gene locus_tag LOCUS_15740 gene xerS 60962 62104 CDS product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817930.1 protein_id gnl|my_center|LOCUS_15740 62869 62219 gene locus_tag LOCUS_15750 gene rpe 62869 62219 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721855.1 protein_id gnl|my_center|LOCUS_15750 63826 62906 gene locus_tag LOCUS_15760 gene rbsK 63826 62906 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420966.1 protein_id gnl|my_center|LOCUS_15760 64829 63849 gene locus_tag LOCUS_15770 gene rbsR 64829 63849 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104055.1 protein_id gnl|my_center|LOCUS_15770 65120 66535 gene locus_tag LOCUS_15780 65120 66535 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966239.1 protein_id gnl|my_center|LOCUS_15780 66556 66684 gene locus_tag LOCUS_15790 66556 66684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 66723 67106 gene locus_tag LOCUS_15800 66723 67106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15800 67655 67209 gene locus_tag LOCUS_15810 67655 67209 CDS product Spx/MgsR family RNA polymerase-binding regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286258.1 protein_id gnl|my_center|LOCUS_15810 69264 67759 gene locus_tag LOCUS_15820 69264 67759 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288171.1 protein_id gnl|my_center|LOCUS_15820 69946 69386 gene locus_tag LOCUS_15830 69946 69386 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_15830 71129 69939 gene locus_tag LOCUS_15840 71129 69939 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002351560.1 protein_id gnl|my_center|LOCUS_15840 73346 71142 gene locus_tag LOCUS_15850 73346 71142 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296412.1 protein_id gnl|my_center|LOCUS_15850 74472 73573 gene locus_tag LOCUS_15860 74472 73573 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296414.1 protein_id gnl|my_center|LOCUS_15860 75282 74524 gene locus_tag LOCUS_15870 75282 74524 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861262.1 protein_id gnl|my_center|LOCUS_15870 76194 75439 gene locus_tag LOCUS_15880 76194 75439 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861262.1 protein_id gnl|my_center|LOCUS_15880 77567 76326 gene locus_tag LOCUS_15890 77567 76326 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888369.1 protein_id gnl|my_center|LOCUS_15890 78171 78569 gene locus_tag LOCUS_15900 78171 78569 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262616.1 protein_id gnl|my_center|LOCUS_15900 78582 78908 gene locus_tag LOCUS_15910 78582 78908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 80087 79014 gene locus_tag LOCUS_15920 80087 79014 CDS product trifunctional transcriptional activator/DNA repair protein Ada/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989338.1 protein_id gnl|my_center|LOCUS_15920 80306 81415 gene locus_tag LOCUS_15930 gene xerS 80306 81415 CDS product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064376022.1 protein_id gnl|my_center|LOCUS_15930 82193 81756 gene locus_tag LOCUS_15940 gene aroQ 82193 81756 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655954.1 protein_id gnl|my_center|LOCUS_15940 82582 82208 gene locus_tag LOCUS_15950 82582 82208 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921517.1 protein_id gnl|my_center|LOCUS_15950 83513 82575 gene locus_tag LOCUS_15960 83513 82575 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089136.1 protein_id gnl|my_center|LOCUS_15960 83950 83510 gene locus_tag LOCUS_15970 83950 83510 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163926.1 protein_id gnl|my_center|LOCUS_15970 85539 83953 gene locus_tag LOCUS_15980 85539 83953 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805650.1 protein_id gnl|my_center|LOCUS_15980 85662 86570 gene locus_tag LOCUS_15990 85662 86570 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989491.1 protein_id gnl|my_center|LOCUS_15990 86738 86950 gene locus_tag LOCUS_16000 86738 86950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 88189 86966 gene locus_tag LOCUS_16010 88189 86966 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379347.1 protein_id gnl|my_center|LOCUS_16010 88324 88199 gene locus_tag LOCUS_16020 88324 88199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16020 89300 88434 gene locus_tag LOCUS_16030 89300 88434 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174448.1 protein_id gnl|my_center|LOCUS_16030 89795 89376 gene locus_tag LOCUS_16040 89795 89376 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932866.1 protein_id gnl|my_center|LOCUS_16040 91009 90038 gene locus_tag LOCUS_16050 91009 90038 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_16050 92379 91708 gene locus_tag LOCUS_16060 92379 91708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 92815 92432 gene locus_tag LOCUS_16070 92815 92432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 93350 93060 gene locus_tag LOCUS_16080 93350 93060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 94053 93373 gene locus_tag LOCUS_16090 94053 93373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 94997 94260 gene locus_tag LOCUS_16100 94997 94260 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294400.1 protein_id gnl|my_center|LOCUS_16100 96181 95087 gene locus_tag LOCUS_16110 96181 95087 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837319.1 protein_id gnl|my_center|LOCUS_16110 97382 96135 gene locus_tag LOCUS_16120 97382 96135 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642565.1 protein_id gnl|my_center|LOCUS_16120 98586 97729 gene locus_tag LOCUS_16130 gene metF 98586 97729 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901421.1 protein_id gnl|my_center|LOCUS_16130 100833 98590 gene locus_tag LOCUS_16140 gene metE 100833 98590 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836499.1 protein_id gnl|my_center|LOCUS_16140 100969 101892 gene locus_tag LOCUS_16150 100969 101892 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101570.1 protein_id gnl|my_center|LOCUS_16150 102760 101951 gene locus_tag LOCUS_16160 102760 101951 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357903.1 protein_id gnl|my_center|LOCUS_16160 102961 102800 gene locus_tag LOCUS_16170 102961 102800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 104404 103034 gene locus_tag LOCUS_16180 104404 103034 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037272.1 protein_id gnl|my_center|LOCUS_16180 105032 104385 gene locus_tag LOCUS_16190 105032 104385 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865972.1 protein_id gnl|my_center|LOCUS_16190 105356 105688 gene locus_tag LOCUS_16200 105356 105688 CDS product YrdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267265.1 protein_id gnl|my_center|LOCUS_16200 105825 106715 gene locus_tag LOCUS_16210 gene dapA 105825 106715 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422063.1 protein_id gnl|my_center|LOCUS_16210 106716 107471 gene locus_tag LOCUS_16220 gene dapB 106716 107471 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_16220 107520 108221 gene locus_tag LOCUS_16230 gene dapD 107520 108221 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428057.1 protein_id gnl|my_center|LOCUS_16230 108469 109122 gene locus_tag LOCUS_16240 108469 109122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 109700 109164 gene locus_tag LOCUS_16250 109700 109164 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295080.1 protein_id gnl|my_center|LOCUS_16250 110434 109733 gene locus_tag LOCUS_16260 110434 109733 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296462.1 protein_id gnl|my_center|LOCUS_16260 111507 110446 gene locus_tag LOCUS_16270 111507 110446 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296464.1 protein_id gnl|my_center|LOCUS_16270 111671 112267 gene locus_tag LOCUS_16280 111671 112267 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895513.1 protein_id gnl|my_center|LOCUS_16280 113170 112349 gene locus_tag LOCUS_16290 113170 112349 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974053.1 protein_id gnl|my_center|LOCUS_16290 113261 115432 gene locus_tag LOCUS_16300 113261 115432 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019639497.1 protein_id gnl|my_center|LOCUS_16300 117097 115472 gene locus_tag LOCUS_16310 117097 115472 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775656.1 protein_id gnl|my_center|LOCUS_16310 119042 117090 gene locus_tag LOCUS_16320 119042 117090 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641781.1 protein_id gnl|my_center|LOCUS_16320 119316 120815 gene locus_tag LOCUS_16330 119316 120815 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382334.1 protein_id gnl|my_center|LOCUS_16330 120832 121815 gene locus_tag LOCUS_16340 120832 121815 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363973.1 protein_id gnl|my_center|LOCUS_16340 122295 121861 gene locus_tag LOCUS_16350 122295 121861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 123607 122555 gene locus_tag LOCUS_16360 123607 122555 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356169.1 protein_id gnl|my_center|LOCUS_16360 124448 123765 gene locus_tag LOCUS_16370 124448 123765 CDS product transcriptional regulator YeiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868719.1 protein_id gnl|my_center|LOCUS_16370 124643 125572 gene locus_tag LOCUS_16380 gene phnD 124643 125572 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254002.1 protein_id gnl|my_center|LOCUS_16380 125632 126423 gene locus_tag LOCUS_16390 gene phnC 125632 126423 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567449.1 protein_id gnl|my_center|LOCUS_16390 126395 127174 gene locus_tag LOCUS_16400 gene phnE 126395 127174 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576383.1 protein_id gnl|my_center|LOCUS_16400 127171 127953 gene locus_tag LOCUS_16410 gene phnE 127171 127953 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832009.1 protein_id gnl|my_center|LOCUS_16410 128028 128759 gene locus_tag LOCUS_16420 128028 128759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 128843 130390 gene locus_tag LOCUS_16430 128843 130390 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378886.1 protein_id gnl|my_center|LOCUS_16430 130841 130596 gene locus_tag LOCUS_16440 130841 130596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 132414 130945 gene locus_tag LOCUS_16450 132414 130945 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288588.1 protein_id gnl|my_center|LOCUS_16450 132641 133540 gene locus_tag LOCUS_16460 132641 133540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458844.1 protein_id gnl|my_center|LOCUS_16460 134335 133592 gene locus_tag LOCUS_16470 gene pnuC 134335 133592 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287078.1 protein_id gnl|my_center|LOCUS_16470 135087 134392 gene locus_tag LOCUS_16480 135087 134392 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321450.1 protein_id gnl|my_center|LOCUS_16480 136313 135309 gene locus_tag LOCUS_16490 136313 135309 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774220.1 protein_id gnl|my_center|LOCUS_16490 137388 136333 gene locus_tag LOCUS_16500 137388 136333 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287118.1 protein_id gnl|my_center|LOCUS_16500 138231 137404 gene locus_tag LOCUS_16510 138231 137404 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287116.1 protein_id gnl|my_center|LOCUS_16510 139003 138215 gene locus_tag LOCUS_16520 139003 138215 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287115.1 protein_id gnl|my_center|LOCUS_16520 139494 139024 gene locus_tag LOCUS_16530 139494 139024 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287114.1 protein_id gnl|my_center|LOCUS_16530 139937 139518 gene locus_tag LOCUS_16540 139937 139518 CDS product PTS mannose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287112.1 protein_id gnl|my_center|LOCUS_16540 142790 140019 gene locus_tag LOCUS_16550 142790 140019 CDS product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287111.1 protein_id gnl|my_center|LOCUS_16550 143118 143966 gene locus_tag LOCUS_16560 143118 143966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 143963 144655 gene locus_tag LOCUS_16570 143963 144655 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761471.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence11 1008 115 gene locus_tag LOCUS_16580 1008 115 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295354.1 protein_id gnl|my_center|LOCUS_16580 1131 2771 gene locus_tag LOCUS_16590 1131 2771 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296476.1 protein_id gnl|my_center|LOCUS_16590 2827 3792 gene locus_tag LOCUS_16600 2827 3792 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101262.1 protein_id gnl|my_center|LOCUS_16600 5453 3843 gene locus_tag LOCUS_16610 5453 3843 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288381.1 protein_id gnl|my_center|LOCUS_16610 5593 5970 gene locus_tag LOCUS_16620 5593 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 7757 6063 gene locus_tag LOCUS_16630 gene spxB 7757 6063 CDS product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288384.1 protein_id gnl|my_center|LOCUS_16630 8037 8855 gene locus_tag LOCUS_16640 8037 8855 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294342.1 protein_id gnl|my_center|LOCUS_16640 9098 8904 gene locus_tag LOCUS_16650 9098 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 9266 9838 gene locus_tag LOCUS_16660 9266 9838 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382268.1 protein_id gnl|my_center|LOCUS_16660 10626 10006 gene locus_tag LOCUS_16670 10626 10006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 11055 10672 gene locus_tag LOCUS_16680 11055 10672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 11497 12174 gene locus_tag LOCUS_16690 11497 12174 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416612.1 protein_id gnl|my_center|LOCUS_16690 12167 12574 gene locus_tag LOCUS_16700 12167 12574 CDS product DUF4809 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389555.1 protein_id gnl|my_center|LOCUS_16700 12798 14258 gene locus_tag LOCUS_16710 12798 14258 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015295.1 protein_id gnl|my_center|LOCUS_16710 14668 16749 gene locus_tag LOCUS_16720 14668 16749 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722025.1 protein_id gnl|my_center|LOCUS_16720 16749 17222 gene locus_tag LOCUS_16730 16749 17222 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642910.1 protein_id gnl|my_center|LOCUS_16730 17242 17532 gene locus_tag LOCUS_16740 17242 17532 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642909.1 protein_id gnl|my_center|LOCUS_16740 17676 18944 gene locus_tag LOCUS_16750 17676 18944 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642908.1 protein_id gnl|my_center|LOCUS_16750 18958 20016 gene locus_tag LOCUS_16760 18958 20016 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643576.1 protein_id gnl|my_center|LOCUS_16760 20152 22242 gene locus_tag LOCUS_16770 20152 22242 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722025.1 protein_id gnl|my_center|LOCUS_16770 22473 22931 gene locus_tag LOCUS_16780 22473 22931 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890480.1 protein_id gnl|my_center|LOCUS_16780 22957 23259 gene locus_tag LOCUS_16790 22957 23259 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861509.1 protein_id gnl|my_center|LOCUS_16790 23377 24798 gene locus_tag LOCUS_16800 23377 24798 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897455.1 protein_id gnl|my_center|LOCUS_16800 24820 25881 gene locus_tag LOCUS_16810 24820 25881 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861508.1 protein_id gnl|my_center|LOCUS_16810 25897 26592 gene locus_tag LOCUS_16820 25897 26592 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287284.1 protein_id gnl|my_center|LOCUS_16820 26618 26800 gene locus_tag LOCUS_16830 26618 26800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 26826 27671 gene locus_tag LOCUS_16840 gene rhaD 26826 27671 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363003.1 protein_id gnl|my_center|LOCUS_16840 27664 28689 gene locus_tag LOCUS_16850 27664 28689 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_16850 28830 29630 gene locus_tag LOCUS_16860 28830 29630 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379285.1 protein_id gnl|my_center|LOCUS_16860 29650 31491 gene locus_tag LOCUS_16870 29650 31491 CDS product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364610.1 protein_id gnl|my_center|LOCUS_16870 31524 32009 gene locus_tag LOCUS_16880 31524 32009 CDS product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355985.1 protein_id gnl|my_center|LOCUS_16880 32025 32585 gene locus_tag LOCUS_16890 32025 32585 CDS product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355983.1 protein_id gnl|my_center|LOCUS_16890 32678 33682 gene locus_tag LOCUS_16900 32678 33682 CDS product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379286.1 protein_id gnl|my_center|LOCUS_16900 33704 34057 gene locus_tag LOCUS_16910 33704 34057 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355981.1 protein_id gnl|my_center|LOCUS_16910 34352 35587 gene locus_tag LOCUS_16920 gene mtnK 34352 35587 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017133.1 protein_id gnl|my_center|LOCUS_16920 35600 36655 gene locus_tag LOCUS_16930 35600 36655 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017134.1 protein_id gnl|my_center|LOCUS_16930 36668 37309 gene locus_tag LOCUS_16940 36668 37309 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926550.1 protein_id gnl|my_center|LOCUS_16940 37834 39084 gene locus_tag LOCUS_16950 37834 39084 CDS product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989510.1 protein_id gnl|my_center|LOCUS_16950 39140 39520 gene locus_tag LOCUS_16960 39140 39520 CDS product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721339.1 protein_id gnl|my_center|LOCUS_16960 39591 40124 gene locus_tag LOCUS_16970 39591 40124 CDS product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721338.1 protein_id gnl|my_center|LOCUS_16970 40138 41202 gene locus_tag LOCUS_16980 40138 41202 CDS product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721337.1 protein_id gnl|my_center|LOCUS_16980 41228 41584 gene locus_tag LOCUS_16990 41228 41584 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721336.1 protein_id gnl|my_center|LOCUS_16990 41827 42789 gene locus_tag LOCUS_17000 41827 42789 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721341.1 protein_id gnl|my_center|LOCUS_17000 43749 42823 gene locus_tag LOCUS_17010 43749 42823 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289735.1 protein_id gnl|my_center|LOCUS_17010 43977 44969 gene locus_tag LOCUS_17020 43977 44969 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002414145.1 protein_id gnl|my_center|LOCUS_17020 45079 45984 gene locus_tag LOCUS_17030 gene rbsK 45079 45984 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014525052.1 protein_id gnl|my_center|LOCUS_17030 46001 46396 gene locus_tag LOCUS_17040 gene rbsD 46001 46396 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359153.1 protein_id gnl|my_center|LOCUS_17040 46421 47308 gene locus_tag LOCUS_17050 46421 47308 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378904.1 protein_id gnl|my_center|LOCUS_17050 47468 47869 gene locus_tag LOCUS_17060 47468 47869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 47929 48231 gene locus_tag LOCUS_17070 47929 48231 CDS product DUF5960 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289544.1 protein_id gnl|my_center|LOCUS_17070 48424 48753 gene locus_tag LOCUS_17080 48424 48753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 48763 49077 gene locus_tag LOCUS_17090 48763 49077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 49235 49564 gene locus_tag LOCUS_17100 49235 49564 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724232.1 protein_id gnl|my_center|LOCUS_17100 49564 50958 gene locus_tag LOCUS_17110 49564 50958 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989407.1 protein_id gnl|my_center|LOCUS_17110 51002 51292 gene locus_tag LOCUS_17120 51002 51292 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722919.1 protein_id gnl|my_center|LOCUS_17120 51299 52603 gene locus_tag LOCUS_17130 51299 52603 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724230.1 protein_id gnl|my_center|LOCUS_17130 52687 54543 gene locus_tag LOCUS_17140 52687 54543 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931606.1 protein_id gnl|my_center|LOCUS_17140 55776 54601 gene locus_tag LOCUS_17150 55776 54601 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295909.1 protein_id gnl|my_center|LOCUS_17150 56198 56878 gene locus_tag LOCUS_17160 56198 56878 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287801.1 protein_id gnl|my_center|LOCUS_17160 57100 58299 gene locus_tag LOCUS_17170 57100 58299 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287805.1 protein_id gnl|my_center|LOCUS_17170 58292 60016 gene locus_tag LOCUS_17180 58292 60016 CDS product ABC transporter permease/substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287807.1 protein_id gnl|my_center|LOCUS_17180 60336 62279 gene locus_tag LOCUS_17190 60336 62279 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048538587.1 protein_id gnl|my_center|LOCUS_17190 62280 62753 gene locus_tag LOCUS_17200 62280 62753 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892531.1 protein_id gnl|my_center|LOCUS_17200 62767 63051 gene locus_tag LOCUS_17210 62767 63051 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430711.1 protein_id gnl|my_center|LOCUS_17210 63090 64463 gene locus_tag LOCUS_17220 63090 64463 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887822.1 protein_id gnl|my_center|LOCUS_17220 64493 64999 gene locus_tag LOCUS_17230 64493 64999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860628.1 protein_id gnl|my_center|LOCUS_17230 64999 65646 gene locus_tag LOCUS_17240 64999 65646 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453954.1 protein_id gnl|my_center|LOCUS_17240 66756 65725 gene locus_tag LOCUS_17250 66756 65725 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733054.1 protein_id gnl|my_center|LOCUS_17250 66945 67421 gene locus_tag LOCUS_17260 66945 67421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 67331 69052 gene locus_tag LOCUS_17270 67331 69052 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986653.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17270 69077 69541 gene locus_tag LOCUS_17280 69077 69541 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733191.1 protein_id gnl|my_center|LOCUS_17280 69563 70975 gene locus_tag LOCUS_17290 69563 70975 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887822.1 protein_id gnl|my_center|LOCUS_17290 70968 71246 gene locus_tag LOCUS_17300 70968 71246 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430711.1 protein_id gnl|my_center|LOCUS_17300 71345 72082 gene locus_tag LOCUS_17310 71345 72082 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064392.1 protein_id gnl|my_center|LOCUS_17310 72093 72365 gene locus_tag LOCUS_17320 72093 72365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 73003 73959 gene locus_tag LOCUS_17330 73003 73959 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453966.1 protein_id gnl|my_center|LOCUS_17330 73976 74980 gene locus_tag LOCUS_17340 73976 74980 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887810.1 protein_id gnl|my_center|LOCUS_17340 75003 75980 gene locus_tag LOCUS_17350 75003 75980 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257218.1 protein_id gnl|my_center|LOCUS_17350 75993 77207 gene locus_tag LOCUS_17360 75993 77207 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263119.1 protein_id gnl|my_center|LOCUS_17360 77220 78611 gene locus_tag LOCUS_17370 gene lpdA 77220 78611 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382270.1 protein_id gnl|my_center|LOCUS_17370 79466 78654 gene locus_tag LOCUS_17380 gene proC 79466 78654 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363318.1 protein_id gnl|my_center|LOCUS_17380 79645 80598 gene locus_tag LOCUS_17390 79645 80598 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376144.1 protein_id gnl|my_center|LOCUS_17390 80598 80906 gene locus_tag LOCUS_17400 80598 80906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358867.1 protein_id gnl|my_center|LOCUS_17400 80981 81331 gene locus_tag LOCUS_17410 80981 81331 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357112.1 protein_id gnl|my_center|LOCUS_17410 81324 81689 gene locus_tag LOCUS_17420 81324 81689 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296407.1 protein_id gnl|my_center|LOCUS_17420 81878 82768 gene locus_tag LOCUS_17430 81878 82768 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047873.1 protein_id gnl|my_center|LOCUS_17430 82860 84434 gene locus_tag LOCUS_17440 82860 84434 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285917.1 protein_id gnl|my_center|LOCUS_17440 84500 84910 gene locus_tag LOCUS_17450 gene arr 84500 84910 CDS product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811445.1 protein_id gnl|my_center|LOCUS_17450 85916 84948 gene locus_tag LOCUS_17460 85916 84948 CDS product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287908.1 protein_id gnl|my_center|LOCUS_17460 86739 85981 gene locus_tag LOCUS_17470 86739 85981 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354962.1 protein_id gnl|my_center|LOCUS_17470 87704 86736 gene locus_tag LOCUS_17480 87704 86736 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287906.1 protein_id gnl|my_center|LOCUS_17480 88648 87701 gene locus_tag LOCUS_17490 88648 87701 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287905.1 protein_id gnl|my_center|LOCUS_17490 89116 88916 gene locus_tag LOCUS_17500 89116 88916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 89617 89252 gene locus_tag LOCUS_17510 89617 89252 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906243.1 protein_id gnl|my_center|LOCUS_17510 89716 90093 gene locus_tag LOCUS_17520 89716 90093 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254740.1 protein_id gnl|my_center|LOCUS_17520 90201 90968 gene locus_tag LOCUS_17530 90201 90968 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020166.1 protein_id gnl|my_center|LOCUS_17530 91118 92662 gene locus_tag LOCUS_17540 91118 92662 CDS product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642216.1 protein_id gnl|my_center|LOCUS_17540 92811 94475 gene locus_tag LOCUS_17550 92811 94475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101598.1 protein_id gnl|my_center|LOCUS_17550 95566 94559 gene locus_tag LOCUS_17560 95566 94559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 95874 96962 gene locus_tag LOCUS_17570 95874 96962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 97351 97530 gene locus_tag LOCUS_17580 97351 97530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 97701 98465 gene locus_tag LOCUS_17590 97701 98465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 98455 100140 gene locus_tag LOCUS_17600 gene cas8a1 98455 100140 CDS product type I-B CRISPR-associated protein Cas8b1/Cst1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861771.1 protein_id gnl|my_center|LOCUS_17600 100133 101020 gene locus_tag LOCUS_17610 gene cas7i 100133 101020 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861770.1 protein_id gnl|my_center|LOCUS_17610 101007 101759 gene locus_tag LOCUS_17620 gene cas5b 101007 101759 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439785.1 protein_id gnl|my_center|LOCUS_17620 101768 104050 gene locus_tag LOCUS_17630 101768 104050 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016965.1 protein_id gnl|my_center|LOCUS_17630 104060 104548 gene locus_tag LOCUS_17640 gene cas4 104060 104548 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016964.1 protein_id gnl|my_center|LOCUS_17640 104560 105549 gene locus_tag LOCUS_17650 gene cas1b 104560 105549 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896423.1 protein_id gnl|my_center|LOCUS_17650 105555 105836 gene locus_tag LOCUS_17660 gene cas2 105555 105836 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903132.1 protein_id gnl|my_center|LOCUS_17660 106023 107238 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcaaatctaaaaatagtggaatgtaaat 107356 107484 gene locus_tag LOCUS_17670 107356 107484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 107497 107835 gene locus_tag LOCUS_17680 107497 107835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 107846 108670 gene locus_tag LOCUS_17690 107846 108670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 108923 109460 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aatctaaaatagtggaatgtaaat 109749 110450 gene locus_tag LOCUS_17700 109749 110450 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860731.1 protein_id gnl|my_center|LOCUS_17700 110454 111359 gene locus_tag LOCUS_17710 110454 111359 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888178.1 protein_id gnl|my_center|LOCUS_17710 111438 112358 gene locus_tag LOCUS_17720 111438 112358 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860754.1 protein_id gnl|my_center|LOCUS_17720 112351 113076 gene locus_tag LOCUS_17730 112351 113076 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860753.1 protein_id gnl|my_center|LOCUS_17730 113275 113658 gene locus_tag LOCUS_17740 113275 113658 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197242566.1 protein_id gnl|my_center|LOCUS_17740 113970 113677 gene locus_tag LOCUS_17750 113970 113677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 114159 115001 gene locus_tag LOCUS_17760 114159 115001 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131024.1 protein_id gnl|my_center|LOCUS_17760 115162 115479 gene locus_tag LOCUS_17770 115162 115479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 116170 115526 gene locus_tag LOCUS_17780 116170 115526 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890774.1 protein_id gnl|my_center|LOCUS_17780 116906 116160 gene locus_tag LOCUS_17790 116906 116160 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890775.1 protein_id gnl|my_center|LOCUS_17790 117370 116906 gene locus_tag LOCUS_17800 117370 116906 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861830.1 protein_id gnl|my_center|LOCUS_17800 117565 118077 gene locus_tag LOCUS_17810 117565 118077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645189.1 protein_id gnl|my_center|LOCUS_17810 118067 119371 gene locus_tag LOCUS_17820 118067 119371 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131380.1 protein_id gnl|my_center|LOCUS_17820 119516 120838 gene locus_tag LOCUS_17830 119516 120838 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674709.1 protein_id gnl|my_center|LOCUS_17830 121095 120880 gene locus_tag LOCUS_17840 121095 120880 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354768.1 protein_id gnl|my_center|LOCUS_17840 121298 122593 gene locus_tag LOCUS_17850 121298 122593 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460409.1 protein_id gnl|my_center|LOCUS_17850 122599 123345 gene locus_tag LOCUS_17860 122599 123345 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943941.1 protein_id gnl|my_center|LOCUS_17860 123469 124425 gene locus_tag LOCUS_17870 123469 124425 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355191.1 protein_id gnl|my_center|LOCUS_17870 124695 126494 gene locus_tag LOCUS_17880 124695 126494 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476533.1 protein_id gnl|my_center|LOCUS_17880 126686 127192 gene locus_tag LOCUS_17890 126686 127192 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287450.1 protein_id gnl|my_center|LOCUS_17890 127205 128596 gene locus_tag LOCUS_17900 gene radA 127205 128596 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293096.1 protein_id gnl|my_center|LOCUS_17900 128674 129828 gene locus_tag LOCUS_17910 128674 129828 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368622.1 protein_id gnl|my_center|LOCUS_17910 129926 131383 gene locus_tag LOCUS_17920 gene gltX 129926 131383 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287447.1 protein_id gnl|my_center|LOCUS_17920 132002 132535 gene locus_tag LOCUS_17930 gene cysE 132002 132535 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287446.1 protein_id gnl|my_center|LOCUS_17930 132528 133937 gene locus_tag LOCUS_17940 gene cysS 132528 133937 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774249.1 protein_id gnl|my_center|LOCUS_17940 133937 134335 gene locus_tag LOCUS_17950 133937 134335 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356056.1 protein_id gnl|my_center|LOCUS_17950 134325 135158 gene locus_tag LOCUS_17960 gene rlmB 134325 135158 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387444.1 protein_id gnl|my_center|LOCUS_17960 135158 135685 gene locus_tag LOCUS_17970 135158 135685 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287439.1 protein_id gnl|my_center|LOCUS_17970 135758 136315 gene locus_tag LOCUS_17980 135758 136315 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356059.1 protein_id gnl|my_center|LOCUS_17980 136427 136672 gene locus_tag LOCUS_17990 136427 136672 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287434.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence12 359 961 gene locus_tag LOCUS_18000 359 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 3205 1763 gene locus_tag LOCUS_18010 3205 1763 CDS product DUF2142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963353.1 protein_id gnl|my_center|LOCUS_18010 4762 3623 gene locus_tag LOCUS_18020 4762 3623 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303488.1 protein_id gnl|my_center|LOCUS_18020 7883 5502 gene locus_tag LOCUS_18030 7883 5502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 8084 8680 gene locus_tag LOCUS_18040 8084 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 9675 8827 gene locus_tag LOCUS_18050 9675 8827 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102149.1 protein_id gnl|my_center|LOCUS_18050 10436 9687 gene locus_tag LOCUS_18060 gene fabG 10436 9687 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_18060 11943 11158 gene locus_tag LOCUS_18070 11943 11158 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943610.1 protein_id gnl|my_center|LOCUS_18070 12471 11989 gene locus_tag LOCUS_18080 12471 11989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 12740 14209 gene locus_tag LOCUS_18090 12740 14209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 14344 15840 gene locus_tag LOCUS_18100 14344 15840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 17204 15987 gene locus_tag LOCUS_18110 17204 15987 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100992.1 protein_id gnl|my_center|LOCUS_18110 19744 17351 gene locus_tag LOCUS_18120 19744 17351 CDS product beta-galactosidase GalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036450.1 protein_id gnl|my_center|LOCUS_18120 19860 20822 gene locus_tag LOCUS_18130 19860 20822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 21855 20839 gene locus_tag LOCUS_18140 21855 20839 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613409.1 protein_id gnl|my_center|LOCUS_18140 22136 23821 gene locus_tag LOCUS_18150 22136 23821 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775581.1 protein_id gnl|my_center|LOCUS_18150 23840 26665 gene locus_tag LOCUS_18160 23840 26665 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548204.1 protein_id gnl|my_center|LOCUS_18160 26658 27314 gene locus_tag LOCUS_18170 gene pgmB 26658 27314 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355844.1 protein_id gnl|my_center|LOCUS_18170 27330 28874 gene locus_tag LOCUS_18180 27330 28874 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994209.1 protein_id gnl|my_center|LOCUS_18180 29781 28918 gene locus_tag LOCUS_18190 29781 28918 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360061.1 protein_id gnl|my_center|LOCUS_18190 31162 29792 gene locus_tag LOCUS_18200 31162 29792 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035027539.1 protein_id gnl|my_center|LOCUS_18200 31965 31174 gene locus_tag LOCUS_18210 31965 31174 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028344.1 protein_id gnl|my_center|LOCUS_18210 34598 31977 gene locus_tag LOCUS_18220 gene mngB 34598 31977 CDS product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861811.1 protein_id gnl|my_center|LOCUS_18220 35103 34648 gene locus_tag LOCUS_18230 35103 34648 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167001.1 protein_id gnl|my_center|LOCUS_18230 36649 35117 gene locus_tag LOCUS_18240 36649 35117 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167004.1 protein_id gnl|my_center|LOCUS_18240 36930 37877 gene locus_tag LOCUS_18250 36930 37877 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303627.1 protein_id gnl|my_center|LOCUS_18250 38256 37933 gene locus_tag LOCUS_18260 38256 37933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 39473 38268 gene locus_tag LOCUS_18270 gene gguB 39473 38268 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287993.1 protein_id gnl|my_center|LOCUS_18270 41005 39473 gene locus_tag LOCUS_18280 gene gguA 41005 39473 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287995.1 protein_id gnl|my_center|LOCUS_18280 42166 41075 gene locus_tag LOCUS_18290 gene chvE 42166 41075 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287997.1 protein_id gnl|my_center|LOCUS_18290 42389 43354 gene locus_tag LOCUS_18300 42389 43354 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287999.1 protein_id gnl|my_center|LOCUS_18300 43364 44809 gene locus_tag LOCUS_18310 43364 44809 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288002.1 protein_id gnl|my_center|LOCUS_18310 44802 46334 gene locus_tag LOCUS_18320 44802 46334 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288004.1 protein_id gnl|my_center|LOCUS_18320 48789 46405 gene locus_tag LOCUS_18330 48789 46405 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294145.1 protein_id gnl|my_center|LOCUS_18330 50377 48953 gene locus_tag LOCUS_18340 gene araA 50377 48953 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287282.1 protein_id gnl|my_center|LOCUS_18340 51104 50412 gene locus_tag LOCUS_18350 51104 50412 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287284.1 protein_id gnl|my_center|LOCUS_18350 52706 51117 gene locus_tag LOCUS_18360 52706 51117 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287286.1 protein_id gnl|my_center|LOCUS_18360 53951 52869 gene locus_tag LOCUS_18370 53951 52869 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287288.1 protein_id gnl|my_center|LOCUS_18370 54420 54136 gene locus_tag LOCUS_18380 54420 54136 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286335.1 protein_id gnl|my_center|LOCUS_18380 54615 54519 gene locus_tag LOCUS_t00140 54615 54519 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 55124 54762 gene locus_tag LOCUS_18390 55124 54762 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386965.1 protein_id gnl|my_center|LOCUS_18390 57677 55611 gene locus_tag LOCUS_18400 57677 55611 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293776.1 protein_id gnl|my_center|LOCUS_18400 58107 58625 gene locus_tag LOCUS_18410 58107 58625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 58653 58856 gene locus_tag LOCUS_18420 58653 58856 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902968.1 protein_id gnl|my_center|LOCUS_18420 60691 58889 gene locus_tag LOCUS_18430 60691 58889 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286302.1 protein_id gnl|my_center|LOCUS_18430 61455 60703 gene locus_tag LOCUS_18440 61455 60703 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286304.1 protein_id gnl|my_center|LOCUS_18440 61863 61504 gene locus_tag LOCUS_18450 61863 61504 CDS product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286306.1 protein_id gnl|my_center|LOCUS_18450 62612 62067 gene locus_tag LOCUS_18460 62612 62067 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861803.1 protein_id gnl|my_center|LOCUS_18460 63111 62602 gene locus_tag LOCUS_18470 63111 62602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869496.1 protein_id gnl|my_center|LOCUS_18470 64500 63124 gene locus_tag LOCUS_18480 gene selA 64500 63124 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897684.1 protein_id gnl|my_center|LOCUS_18480 65640 64516 gene locus_tag LOCUS_18490 65640 64516 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681891.1 protein_id gnl|my_center|LOCUS_18490 67574 65694 gene locus_tag LOCUS_18500 gene selB 67574 65694 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454786.1 protein_id gnl|my_center|LOCUS_18500 67845 67579 gene locus_tag LOCUS_18510 67845 67579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 68466 67876 gene locus_tag LOCUS_18520 gene yedF 68466 67876 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681889.1 protein_id gnl|my_center|LOCUS_18520 69503 68481 gene locus_tag LOCUS_18530 gene selD 69503 68481 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462047.1 protein_id gnl|my_center|LOCUS_18530 71296 69722 gene locus_tag LOCUS_18540 71296 69722 CDS product hydantoinase/oxoprolinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989476.1 protein_id gnl|my_center|LOCUS_18540 72381 71284 gene locus_tag LOCUS_18550 72381 71284 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896855.1 protein_id gnl|my_center|LOCUS_18550 73677 72385 gene locus_tag LOCUS_18560 73677 72385 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893249.1 protein_id gnl|my_center|LOCUS_18560 75300 73819 gene locus_tag LOCUS_18570 75300 73819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 76382 75504 gene locus_tag LOCUS_18580 76382 75504 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048169.1 protein_id gnl|my_center|LOCUS_18580 77417 76401 gene locus_tag LOCUS_18590 77417 76401 CDS product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422090.1 protein_id gnl|my_center|LOCUS_18590 78026 77547 gene locus_tag LOCUS_18600 78026 77547 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422094.1 protein_id gnl|my_center|LOCUS_18600 78790 78053 gene locus_tag LOCUS_18610 gene prdD 78790 78053 CDS product proline reductase cluster protein PrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428092.1 protein_id gnl|my_center|LOCUS_18610 79713 78988 gene locus_tag LOCUS_18620 gene prdB 79713 78988 CDS product D-proline reductase (dithiol) protein PrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861888.1 transl_except (pos:complement(79261..79263),aa:Sec) note codon on position 151 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_18620 80022 79717 gene locus_tag LOCUS_18630 80022 79717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 81930 80032 gene locus_tag LOCUS_18640 gene prdA 81930 80032 CDS product D-proline reductase (dithiol) proprotein PrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422104.1 protein_id gnl|my_center|LOCUS_18640 83245 82070 gene locus_tag LOCUS_18650 gene prdC 83245 82070 CDS product proline reductase-associated electron transfer protein PrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431873.1 protein_id gnl|my_center|LOCUS_18650 85181 83826 gene locus_tag LOCUS_18660 85181 83826 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986557.1 protein_id gnl|my_center|LOCUS_18660 86088 85207 gene locus_tag LOCUS_18670 86088 85207 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986559.1 protein_id gnl|my_center|LOCUS_18670 87180 86104 gene locus_tag LOCUS_18680 87180 86104 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426912.1 protein_id gnl|my_center|LOCUS_18680 88172 87708 gene locus_tag LOCUS_18690 88172 87708 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832133.1 protein_id gnl|my_center|LOCUS_18690 89007 88249 gene locus_tag LOCUS_18700 89007 88249 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672268.1 protein_id gnl|my_center|LOCUS_18700 90216 89140 gene locus_tag LOCUS_18710 90216 89140 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454650.1 protein_id gnl|my_center|LOCUS_18710 90406 92307 gene locus_tag LOCUS_18720 90406 92307 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114166.1 protein_id gnl|my_center|LOCUS_18720 93886 92372 gene locus_tag LOCUS_18730 93886 92372 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182456.1 protein_id gnl|my_center|LOCUS_18730 95030 93945 gene locus_tag LOCUS_18740 95030 93945 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476547.1 protein_id gnl|my_center|LOCUS_18740 96221 95682 gene locus_tag LOCUS_18750 96221 95682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 97082 96234 gene locus_tag LOCUS_18760 97082 96234 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292680.1 protein_id gnl|my_center|LOCUS_18760 99249 98182 gene locus_tag LOCUS_18770 99249 98182 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130693.1 protein_id gnl|my_center|LOCUS_18770 99778 100602 gene locus_tag LOCUS_18780 99778 100602 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722905.1 protein_id gnl|my_center|LOCUS_18780 100620 101633 gene locus_tag LOCUS_18790 100620 101633 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722904.1 protein_id gnl|my_center|LOCUS_18790 101633 102295 gene locus_tag LOCUS_18800 101633 102295 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722903.1 protein_id gnl|my_center|LOCUS_18800 102388 102675 gene locus_tag LOCUS_18810 102388 102675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 102763 103398 gene locus_tag LOCUS_18820 102763 103398 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357443.1 protein_id gnl|my_center|LOCUS_18820 104622 103447 gene locus_tag LOCUS_18830 104622 103447 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286282.1 protein_id gnl|my_center|LOCUS_18830 104763 105305 gene locus_tag LOCUS_18840 104763 105305 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385758.1 protein_id gnl|my_center|LOCUS_18840 106311 105439 gene locus_tag LOCUS_18850 106311 105439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 106701 107399 gene locus_tag LOCUS_18860 106701 107399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 107433 107873 gene locus_tag LOCUS_18870 107433 107873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 107925 108092 gene locus_tag LOCUS_18880 107925 108092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 108296 108622 gene locus_tag LOCUS_18890 108296 108622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 108794 109054 gene locus_tag LOCUS_18900 108794 109054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 109369 109223 gene locus_tag LOCUS_18910 109369 109223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 109718 109401 gene locus_tag LOCUS_18920 109718 109401 CDS product YrhK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287574.1 protein_id gnl|my_center|LOCUS_18920 110343 110753 gene locus_tag LOCUS_18930 110343 110753 CDS product DUF4430 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894007.1 protein_id gnl|my_center|LOCUS_18930 110716 111306 gene locus_tag LOCUS_18940 110716 111306 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549293.1 protein_id gnl|my_center|LOCUS_18940 112046 111468 gene locus_tag LOCUS_18950 112046 111468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 112477 112094 gene locus_tag LOCUS_18960 112477 112094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 112757 112545 gene locus_tag LOCUS_18970 112757 112545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 112978 112769 gene locus_tag LOCUS_18980 112978 112769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 114280 113360 gene locus_tag LOCUS_18990 114280 113360 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721341.1 protein_id gnl|my_center|LOCUS_18990 114441 115277 gene locus_tag LOCUS_19000 114441 115277 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579877.1 protein_id gnl|my_center|LOCUS_19000 115296 115991 gene locus_tag LOCUS_19010 115296 115991 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674983.1 protein_id gnl|my_center|LOCUS_19010 115996 116514 gene locus_tag LOCUS_19020 115996 116514 CDS product YjbQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576695.1 protein_id gnl|my_center|LOCUS_19020 116690 117655 gene locus_tag LOCUS_19030 116690 117655 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235060.1 protein_id gnl|my_center|LOCUS_19030 117815 118162 gene locus_tag LOCUS_19040 117815 118162 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222020.1 protein_id gnl|my_center|LOCUS_19040 118140 118517 gene locus_tag LOCUS_19050 gene arsD 118140 118517 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222021.1 protein_id gnl|my_center|LOCUS_19050 118553 120277 gene locus_tag LOCUS_19060 gene arsA 118553 120277 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222022.1 protein_id gnl|my_center|LOCUS_19060 120353 120757 gene locus_tag LOCUS_19070 gene arsC 120353 120757 CDS product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288294.1 protein_id gnl|my_center|LOCUS_19070 122784 121534 gene locus_tag LOCUS_19080 122784 121534 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297404.1 protein_id gnl|my_center|LOCUS_19080 123571 125385 gene locus_tag LOCUS_19090 123571 125385 CDS product SpaA isopeptide-forming pilin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382226.1 protein_id gnl|my_center|LOCUS_19090 126453 126914 gene locus_tag LOCUS_19100 126453 126914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861726.1 protein_id gnl|my_center|LOCUS_19100 127420 128640 gene locus_tag LOCUS_19110 127420 128640 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684567.1 protein_id gnl|my_center|LOCUS_19110 128637 129398 gene locus_tag LOCUS_19120 128637 129398 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965675.1 protein_id gnl|my_center|LOCUS_19120 129447 130289 gene locus_tag LOCUS_19130 129447 130289 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287678.1 protein_id gnl|my_center|LOCUS_19130 130506 130757 gene locus_tag LOCUS_19140 130506 130757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174908.1 protein_id gnl|my_center|LOCUS_19140 131672 131019 gene locus_tag LOCUS_19150 131672 131019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 >Feature sequence13 2523 121 gene locus_tag LOCUS_19160 2523 121 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379735.1 protein_id gnl|my_center|LOCUS_19160 3204 2548 gene locus_tag LOCUS_19170 3204 2548 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289593.1 protein_id gnl|my_center|LOCUS_19170 3736 3230 gene locus_tag LOCUS_19180 gene trmL 3736 3230 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774238.1 protein_id gnl|my_center|LOCUS_19180 4878 4024 gene locus_tag LOCUS_19190 4878 4024 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294559.1 protein_id gnl|my_center|LOCUS_19190 5066 5701 gene locus_tag LOCUS_19200 gene cutC 5066 5701 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356490.1 protein_id gnl|my_center|LOCUS_19200 7213 5765 gene locus_tag LOCUS_19210 7213 5765 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931832.1 protein_id gnl|my_center|LOCUS_19210 7372 8172 gene locus_tag LOCUS_19220 7372 8172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 8634 8194 gene locus_tag LOCUS_19230 gene mutT 8634 8194 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246544.1 protein_id gnl|my_center|LOCUS_19230 10049 8676 gene locus_tag LOCUS_19240 gene mgtE 10049 8676 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294561.1 protein_id gnl|my_center|LOCUS_19240 11411 10518 gene locus_tag LOCUS_19250 11411 10518 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294562.1 protein_id gnl|my_center|LOCUS_19250 12219 11416 gene locus_tag LOCUS_19260 12219 11416 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356486.1 protein_id gnl|my_center|LOCUS_19260 12856 12191 gene locus_tag LOCUS_19270 12856 12191 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309982.1 protein_id gnl|my_center|LOCUS_19270 13062 13670 gene locus_tag LOCUS_19280 13062 13670 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289849.1 protein_id gnl|my_center|LOCUS_19280 13667 14311 gene locus_tag LOCUS_19290 13667 14311 CDS product ClpXP adapter SpxH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289850.1 protein_id gnl|my_center|LOCUS_19290 15434 14346 gene locus_tag LOCUS_19300 15434 14346 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286364.1 protein_id gnl|my_center|LOCUS_19300 16704 15526 gene locus_tag LOCUS_19310 16704 15526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 18836 17019 gene locus_tag LOCUS_19320 gene pepF 18836 17019 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288947.1 protein_id gnl|my_center|LOCUS_19320 19967 18969 gene locus_tag LOCUS_19330 19967 18969 CDS product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288958.1 protein_id gnl|my_center|LOCUS_19330 20749 20105 gene locus_tag LOCUS_19340 20749 20105 CDS product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356478.1 protein_id gnl|my_center|LOCUS_19340 20973 21578 gene locus_tag LOCUS_19350 20973 21578 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547369.1 protein_id gnl|my_center|LOCUS_19350 22012 21614 gene locus_tag LOCUS_19360 gene spxA 22012 21614 CDS product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356477.1 protein_id gnl|my_center|LOCUS_19360 22792 23511 gene locus_tag LOCUS_19370 22792 23511 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294563.1 protein_id gnl|my_center|LOCUS_19370 26712 23533 gene locus_tag LOCUS_19380 26712 23533 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288952.1 protein_id gnl|my_center|LOCUS_19380 29835 26713 gene locus_tag LOCUS_19390 29835 26713 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288954.1 protein_id gnl|my_center|LOCUS_19390 30968 29817 gene locus_tag LOCUS_19400 30968 29817 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706825.1 protein_id gnl|my_center|LOCUS_19400 31125 31853 gene locus_tag LOCUS_19410 31125 31853 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286317.1 protein_id gnl|my_center|LOCUS_19410 32546 31917 gene locus_tag LOCUS_19420 32546 31917 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356461.1 protein_id gnl|my_center|LOCUS_19420 32622 33356 gene locus_tag LOCUS_19430 32622 33356 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356457.1 protein_id gnl|my_center|LOCUS_19430 33346 33621 gene locus_tag LOCUS_19440 33346 33621 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304776.1 protein_id gnl|my_center|LOCUS_19440 35528 33645 gene locus_tag LOCUS_19450 35528 33645 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748733.1 protein_id gnl|my_center|LOCUS_19450 36711 35830 gene locus_tag LOCUS_19460 36711 35830 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357090.1 protein_id gnl|my_center|LOCUS_19460 38671 36899 gene locus_tag LOCUS_19470 gene aspS 38671 36899 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289105.1 protein_id gnl|my_center|LOCUS_19470 40029 38731 gene locus_tag LOCUS_19480 gene hisS 40029 38731 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366882.1 protein_id gnl|my_center|LOCUS_19480 40884 41819 gene locus_tag LOCUS_19490 40884 41819 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289101.1 protein_id gnl|my_center|LOCUS_19490 42906 41947 gene locus_tag LOCUS_19500 42906 41947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 44250 43279 gene locus_tag LOCUS_19510 44250 43279 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476165.1 protein_id gnl|my_center|LOCUS_19510 45132 44656 gene locus_tag LOCUS_19520 45132 44656 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817484.1 protein_id gnl|my_center|LOCUS_19520 47104 45665 gene locus_tag LOCUS_19530 gene proS 47104 45665 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895182.1 protein_id gnl|my_center|LOCUS_19530 48274 47423 gene locus_tag LOCUS_19540 48274 47423 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289459.1 protein_id gnl|my_center|LOCUS_19540 48586 50181 gene locus_tag LOCUS_19550 48586 50181 CDS product bifunctional aspartate transaminase/aspartate 4-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549954.1 protein_id gnl|my_center|LOCUS_19550 50794 50228 gene locus_tag LOCUS_19560 50794 50228 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399299.1 protein_id gnl|my_center|LOCUS_19560 50919 51446 gene locus_tag LOCUS_19570 50919 51446 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272442.1 protein_id gnl|my_center|LOCUS_19570 51545 52021 gene locus_tag LOCUS_19580 51545 52021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814545.1 protein_id gnl|my_center|LOCUS_19580 52232 53446 gene locus_tag LOCUS_19590 gene mtnK 52232 53446 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097617.1 protein_id gnl|my_center|LOCUS_19590 53464 54810 gene locus_tag LOCUS_19600 53464 54810 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989691.1 protein_id gnl|my_center|LOCUS_19600 54810 55367 gene locus_tag LOCUS_19610 54810 55367 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933856.1 protein_id gnl|my_center|LOCUS_19610 56609 55425 gene locus_tag LOCUS_19620 56609 55425 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836578.1 protein_id gnl|my_center|LOCUS_19620 57402 56686 gene locus_tag LOCUS_19630 57402 56686 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002907132.1 protein_id gnl|my_center|LOCUS_19630 58754 57636 gene locus_tag LOCUS_19640 58754 57636 CDS product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989698.1 protein_id gnl|my_center|LOCUS_19640 60155 58770 gene locus_tag LOCUS_19650 60155 58770 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989697.1 protein_id gnl|my_center|LOCUS_19650 61149 60148 gene locus_tag LOCUS_19660 61149 60148 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931568.1 protein_id gnl|my_center|LOCUS_19660 61430 61167 gene locus_tag LOCUS_19670 61430 61167 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736331.1 protein_id gnl|my_center|LOCUS_19670 62024 61518 gene locus_tag LOCUS_19680 62024 61518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 62926 62081 gene locus_tag LOCUS_19690 gene eutJ 62926 62081 CDS product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989696.1 protein_id gnl|my_center|LOCUS_19690 63574 62942 gene locus_tag LOCUS_19700 gene pduL 63574 62942 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989695.1 protein_id gnl|my_center|LOCUS_19700 63851 63567 gene locus_tag LOCUS_19710 gene pduA 63851 63567 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009934191.1 protein_id gnl|my_center|LOCUS_19710 64665 64090 gene locus_tag LOCUS_19720 64665 64090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 65039 64662 gene locus_tag LOCUS_19730 65039 64662 CDS product glycerol dehydratase reactivase beta/small subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836576.1 protein_id gnl|my_center|LOCUS_19730 66867 65029 gene locus_tag LOCUS_19740 66867 65029 CDS product diol dehydratase reactivase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931948.1 protein_id gnl|my_center|LOCUS_19740 67415 66903 gene locus_tag LOCUS_19750 67415 66903 CDS product diol dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836574.1 protein_id gnl|my_center|LOCUS_19750 68094 67429 gene locus_tag LOCUS_19760 68094 67429 CDS product propanediol/glycerol family dehydratase medium subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989693.1 protein_id gnl|my_center|LOCUS_19760 69912 68251 gene locus_tag LOCUS_19770 69912 68251 CDS product propanediol/glycerol family dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008947521.1 protein_id gnl|my_center|LOCUS_19770 70741 69932 gene locus_tag LOCUS_19780 gene pduB 70741 69932 CDS product propanediol utilization microcompartment protein PduB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097484.1 protein_id gnl|my_center|LOCUS_19780 71037 70759 gene locus_tag LOCUS_19790 gene pduA 71037 70759 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388660.1 protein_id gnl|my_center|LOCUS_19790 71320 72216 gene locus_tag LOCUS_19800 71320 72216 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721549.1 protein_id gnl|my_center|LOCUS_19800 73158 72718 gene locus_tag LOCUS_19810 73158 72718 CDS product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861387.1 protein_id gnl|my_center|LOCUS_19810 73512 73162 gene locus_tag LOCUS_19820 gene eutS 73512 73162 CDS product ethanolamine utilization microcompartment protein EutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721543.1 protein_id gnl|my_center|LOCUS_19820 74853 73657 gene locus_tag LOCUS_19830 74853 73657 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357064.1 protein_id gnl|my_center|LOCUS_19830 75909 74902 gene locus_tag LOCUS_19840 75909 74902 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286175.1 protein_id gnl|my_center|LOCUS_19840 76396 76076 gene locus_tag LOCUS_19850 76396 76076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 76811 76389 gene locus_tag LOCUS_19860 76811 76389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 77070 76798 gene locus_tag LOCUS_19870 77070 76798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 77524 77057 gene locus_tag LOCUS_19880 77524 77057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 77765 77496 gene locus_tag LOCUS_19890 gene comGC 77765 77496 CDS product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921720.1 protein_id gnl|my_center|LOCUS_19890 78775 77762 gene locus_tag LOCUS_19900 gene comGB 78775 77762 CDS product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286180.1 protein_id gnl|my_center|LOCUS_19900 79686 78754 gene locus_tag LOCUS_19910 gene comGA 79686 78754 CDS product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364362.1 protein_id gnl|my_center|LOCUS_19910 80430 79780 gene locus_tag LOCUS_19920 gene trmB 80430 79780 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286189.1 protein_id gnl|my_center|LOCUS_19920 81472 80690 gene locus_tag LOCUS_19930 81472 80690 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286194.1 protein_id gnl|my_center|LOCUS_19930 82431 81562 gene locus_tag LOCUS_19940 gene dat 82431 81562 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931211.1 protein_id gnl|my_center|LOCUS_19940 83643 82435 gene locus_tag LOCUS_19950 83643 82435 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371475.1 protein_id gnl|my_center|LOCUS_19950 84373 83636 gene locus_tag LOCUS_19960 84373 83636 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363160.1 protein_id gnl|my_center|LOCUS_19960 84566 84991 gene locus_tag LOCUS_19970 84566 84991 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355527.1 protein_id gnl|my_center|LOCUS_19970 84992 85372 gene locus_tag LOCUS_19980 84992 85372 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286203.1 protein_id gnl|my_center|LOCUS_19980 85533 86465 gene locus_tag LOCUS_19990 85533 86465 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286208.1 protein_id gnl|my_center|LOCUS_19990 86572 87402 gene locus_tag LOCUS_20000 86572 87402 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289327.1 protein_id gnl|my_center|LOCUS_20000 87698 88105 gene locus_tag LOCUS_20010 87698 88105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386980.1 protein_id gnl|my_center|LOCUS_20010 88524 88201 gene locus_tag LOCUS_20020 88524 88201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 89457 88639 gene locus_tag LOCUS_20030 89457 88639 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861906.1 protein_id gnl|my_center|LOCUS_20030 90630 89563 gene locus_tag LOCUS_20040 gene rlmN 90630 89563 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356987.1 protein_id gnl|my_center|LOCUS_20040 91661 90879 gene locus_tag LOCUS_20050 91661 90879 CDS product [formate-C-acetyltransferase]-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204153.1 protein_id gnl|my_center|LOCUS_20050 94024 91676 gene locus_tag LOCUS_20060 94024 91676 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184831.1 protein_id gnl|my_center|LOCUS_20060 94203 94961 gene locus_tag LOCUS_20070 94203 94961 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281586.1 protein_id gnl|my_center|LOCUS_20070 96091 95000 gene locus_tag LOCUS_20080 96091 95000 CDS product PTS fructose transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895303.1 protein_id gnl|my_center|LOCUS_20080 96414 96103 gene locus_tag LOCUS_20090 96414 96103 CDS product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435043.1 protein_id gnl|my_center|LOCUS_20090 96920 96459 gene locus_tag LOCUS_20100 96920 96459 CDS product fructose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391563.1 protein_id gnl|my_center|LOCUS_20100 98870 96924 gene locus_tag LOCUS_20110 gene manR 98870 96924 CDS product mannose transport/utilization transcriptional regulator ManR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245617.1 protein_id gnl|my_center|LOCUS_20110 101580 99178 gene locus_tag LOCUS_20120 101580 99178 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289244.1 protein_id gnl|my_center|LOCUS_20120 102526 101699 gene locus_tag LOCUS_20130 102526 101699 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262172.1 protein_id gnl|my_center|LOCUS_20130 103185 102550 gene locus_tag LOCUS_20140 103185 102550 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289241.1 protein_id gnl|my_center|LOCUS_20140 103840 103199 gene locus_tag LOCUS_20150 103840 103199 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303625.1 protein_id gnl|my_center|LOCUS_20150 105716 104625 gene locus_tag LOCUS_20160 105716 104625 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379152.1 protein_id gnl|my_center|LOCUS_20160 107125 105737 gene locus_tag LOCUS_20170 107125 105737 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922527.1 protein_id gnl|my_center|LOCUS_20170 108462 107209 gene locus_tag LOCUS_20180 108462 107209 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287577.1 protein_id gnl|my_center|LOCUS_20180 109623 108481 gene locus_tag LOCUS_20190 109623 108481 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254389.1 protein_id gnl|my_center|LOCUS_20190 109966 109637 gene locus_tag LOCUS_20200 109966 109637 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355919.1 protein_id gnl|my_center|LOCUS_20200 110307 109990 gene locus_tag LOCUS_20210 110307 109990 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286606.1 protein_id gnl|my_center|LOCUS_20210 113105 110427 gene locus_tag LOCUS_20220 113105 110427 CDS product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286607.1 protein_id gnl|my_center|LOCUS_20220 115386 113311 gene locus_tag LOCUS_20230 115386 113311 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002392265.1 protein_id gnl|my_center|LOCUS_20230 115696 115325 gene locus_tag LOCUS_20240 115696 115325 CDS product DUF1033 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286704.1 protein_id gnl|my_center|LOCUS_20240 115938 117185 gene locus_tag LOCUS_20250 115938 117185 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286708.1 protein_id gnl|my_center|LOCUS_20250 117264 117494 gene locus_tag LOCUS_20260 117264 117494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 119305 117548 gene locus_tag LOCUS_20270 119305 117548 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_20270 120586 119468 gene locus_tag LOCUS_20280 gene mnmA 120586 119468 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286726.1 protein_id gnl|my_center|LOCUS_20280 120770 121144 gene locus_tag LOCUS_20290 120770 121144 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358356.1 protein_id gnl|my_center|LOCUS_20290 121144 122508 gene locus_tag LOCUS_20300 121144 122508 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387654.1 protein_id gnl|my_center|LOCUS_20300 123039 122560 gene locus_tag LOCUS_20310 gene lepB 123039 122560 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358039.1 protein_id gnl|my_center|LOCUS_20310 123788 123183 gene locus_tag LOCUS_20320 123788 123183 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286728.1 protein_id gnl|my_center|LOCUS_20320 124549 123905 gene locus_tag LOCUS_20330 124549 123905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287642.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence14 202 130 gene locus_tag LOCUS_t00150 202 130 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 656 261 gene locus_tag LOCUS_20340 656 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 1245 718 gene locus_tag LOCUS_20350 1245 718 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288181.1 protein_id gnl|my_center|LOCUS_20350 1408 1611 gene locus_tag LOCUS_20360 1408 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288059.1 protein_id gnl|my_center|LOCUS_20360 1624 2118 gene locus_tag LOCUS_20370 1624 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2794 2198 gene locus_tag LOCUS_20380 2794 2198 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288054.1 protein_id gnl|my_center|LOCUS_20380 2979 3521 gene locus_tag LOCUS_20390 gene lepB 2979 3521 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358039.1 protein_id gnl|my_center|LOCUS_20390 3638 7120 gene locus_tag LOCUS_20400 3638 7120 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288051.1 protein_id gnl|my_center|LOCUS_20400 7110 10793 gene locus_tag LOCUS_20410 gene addA 7110 10793 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288050.1 protein_id gnl|my_center|LOCUS_20410 10860 11204 gene locus_tag LOCUS_20420 10860 11204 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358035.1 protein_id gnl|my_center|LOCUS_20420 11617 12660 gene locus_tag LOCUS_20430 gene pheS 11617 12660 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288048.1 protein_id gnl|my_center|LOCUS_20430 12667 15084 gene locus_tag LOCUS_20440 gene pheT 12667 15084 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288046.1 protein_id gnl|my_center|LOCUS_20440 15581 15228 gene locus_tag LOCUS_20450 15581 15228 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964634.1 protein_id gnl|my_center|LOCUS_20450 16840 15578 gene locus_tag LOCUS_20460 16840 15578 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 protein_id gnl|my_center|LOCUS_20460 18290 16842 gene locus_tag LOCUS_20470 18290 16842 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964632.1 protein_id gnl|my_center|LOCUS_20470 19036 18467 gene locus_tag LOCUS_20480 19036 18467 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964630.1 protein_id gnl|my_center|LOCUS_20480 20181 19207 gene locus_tag LOCUS_20490 20181 19207 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905181.1 protein_id gnl|my_center|LOCUS_20490 20363 21265 gene locus_tag LOCUS_20500 20363 21265 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360016.1 protein_id gnl|my_center|LOCUS_20500 21280 22488 gene locus_tag LOCUS_20510 21280 22488 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360017.1 protein_id gnl|my_center|LOCUS_20510 23569 22559 gene locus_tag LOCUS_20520 gene trpS 23569 22559 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288045.1 protein_id gnl|my_center|LOCUS_20520 23831 24568 gene locus_tag LOCUS_20530 23831 24568 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288042.1 protein_id gnl|my_center|LOCUS_20530 24580 25413 gene locus_tag LOCUS_20540 24580 25413 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288041.1 protein_id gnl|my_center|LOCUS_20540 25413 26057 gene locus_tag LOCUS_20550 25413 26057 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288038.1 protein_id gnl|my_center|LOCUS_20550 26077 26727 gene locus_tag LOCUS_20560 26077 26727 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288036.1 protein_id gnl|my_center|LOCUS_20560 27068 26838 gene locus_tag LOCUS_20570 27068 26838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 27221 28033 gene locus_tag LOCUS_20580 gene racE 27221 28033 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317207.1 protein_id gnl|my_center|LOCUS_20580 28035 29372 gene locus_tag LOCUS_20590 gene rph 28035 29372 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369622.1 protein_id gnl|my_center|LOCUS_20590 29369 29881 gene locus_tag LOCUS_20600 29369 29881 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288030.1 protein_id gnl|my_center|LOCUS_20600 29973 30455 gene locus_tag LOCUS_20610 29973 30455 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295789.1 protein_id gnl|my_center|LOCUS_20610 30627 30896 gene locus_tag LOCUS_20620 gene rpsN 30627 30896 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085659.1 protein_id gnl|my_center|LOCUS_20620 30986 31576 gene locus_tag LOCUS_20630 30986 31576 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642383.1 protein_id gnl|my_center|LOCUS_20630 32529 31615 gene locus_tag LOCUS_20640 32529 31615 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295791.1 protein_id gnl|my_center|LOCUS_20640 32683 33696 gene locus_tag LOCUS_20650 32683 33696 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989632.1 protein_id gnl|my_center|LOCUS_20650 33715 33870 gene locus_tag LOCUS_20660 33715 33870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 34722 33967 gene locus_tag LOCUS_20670 gene fabI 34722 33967 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295795.1 protein_id gnl|my_center|LOCUS_20670 34897 35334 gene locus_tag LOCUS_20680 gene fabZ 34897 35334 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355197.1 protein_id gnl|my_center|LOCUS_20680 36143 35394 gene locus_tag LOCUS_20690 36143 35394 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295798.1 protein_id gnl|my_center|LOCUS_20690 37308 36298 gene locus_tag LOCUS_20700 gene gap 37308 36298 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357638.1 protein_id gnl|my_center|LOCUS_20700 37554 38867 gene locus_tag LOCUS_20710 gene obgE 37554 38867 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002306800.1 protein_id gnl|my_center|LOCUS_20710 39586 40320 gene locus_tag LOCUS_20720 39586 40320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 40549 41094 gene locus_tag LOCUS_20730 40549 41094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295807.1 protein_id gnl|my_center|LOCUS_20730 41185 42108 gene locus_tag LOCUS_20740 gene rnz 41185 42108 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295809.1 protein_id gnl|my_center|LOCUS_20740 42153 42941 gene locus_tag LOCUS_20750 42153 42941 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357438.1 protein_id gnl|my_center|LOCUS_20750 42950 43378 gene locus_tag LOCUS_20760 42950 43378 CDS product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303793.1 protein_id gnl|my_center|LOCUS_20760 43469 45748 gene locus_tag LOCUS_20770 gene recJ 43469 45748 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338264.1 protein_id gnl|my_center|LOCUS_20770 45763 46275 gene locus_tag LOCUS_20780 45763 46275 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295813.1 protein_id gnl|my_center|LOCUS_20780 46677 46411 gene locus_tag LOCUS_20790 46677 46411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297436.1 protein_id gnl|my_center|LOCUS_20790 47403 46780 gene locus_tag LOCUS_20800 gene lexA 47403 46780 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357566.1 protein_id gnl|my_center|LOCUS_20800 47536 47778 gene locus_tag LOCUS_20810 47536 47778 CDS product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295816.1 protein_id gnl|my_center|LOCUS_20810 47871 49865 gene locus_tag LOCUS_20820 gene tkt 47871 49865 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295818.1 protein_id gnl|my_center|LOCUS_20820 50099 51442 gene locus_tag LOCUS_20830 50099 51442 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289543.1 protein_id gnl|my_center|LOCUS_20830 51555 52265 gene locus_tag LOCUS_20840 51555 52265 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289610.1 protein_id gnl|my_center|LOCUS_20840 52258 52911 gene locus_tag LOCUS_20850 gene nth 52258 52911 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357985.1 protein_id gnl|my_center|LOCUS_20850 55240 52928 gene locus_tag LOCUS_20860 55240 52928 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289606.1 protein_id gnl|my_center|LOCUS_20860 55850 55245 gene locus_tag LOCUS_20870 gene recU 55850 55245 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388848.1 protein_id gnl|my_center|LOCUS_20870 55931 56488 gene locus_tag LOCUS_20880 55931 56488 CDS product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369608.1 protein_id gnl|my_center|LOCUS_20880 56557 56958 gene locus_tag LOCUS_20890 gene gpsB 56557 56958 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295835.1 protein_id gnl|my_center|LOCUS_20890 57475 58641 gene locus_tag LOCUS_20900 57475 58641 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289183.1 protein_id gnl|my_center|LOCUS_20900 58628 59275 gene locus_tag LOCUS_20910 58628 59275 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289185.1 protein_id gnl|my_center|LOCUS_20910 59388 59735 gene locus_tag LOCUS_20920 59388 59735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 60062 59748 gene locus_tag LOCUS_20930 60062 59748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357740.1 protein_id gnl|my_center|LOCUS_20930 60183 61331 gene locus_tag LOCUS_20940 60183 61331 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289189.1 protein_id gnl|my_center|LOCUS_20940 61333 62682 gene locus_tag LOCUS_20950 61333 62682 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379408.1 protein_id gnl|my_center|LOCUS_20950 63141 62701 gene locus_tag LOCUS_20960 63141 62701 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289191.1 protein_id gnl|my_center|LOCUS_20960 63211 64263 gene locus_tag LOCUS_20970 63211 64263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 64530 67163 gene locus_tag LOCUS_20980 gene alaS 64530 67163 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357736.1 protein_id gnl|my_center|LOCUS_20980 67307 68767 gene locus_tag LOCUS_20990 gene cls 67307 68767 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371124.1 protein_id gnl|my_center|LOCUS_20990 69148 68762 gene locus_tag LOCUS_21000 69148 68762 CDS product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295847.1 protein_id gnl|my_center|LOCUS_21000 69184 69615 gene locus_tag LOCUS_21010 69184 69615 CDS product EbsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357403.1 protein_id gnl|my_center|LOCUS_21010 69825 69625 gene locus_tag LOCUS_21020 69825 69625 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357404.1 protein_id gnl|my_center|LOCUS_21020 70000 71673 gene locus_tag LOCUS_21030 70000 71673 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295854.1 protein_id gnl|my_center|LOCUS_21030 72587 71703 gene locus_tag LOCUS_21040 72587 71703 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989491.1 protein_id gnl|my_center|LOCUS_21040 72720 73895 gene locus_tag LOCUS_21050 72720 73895 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089188.1 protein_id gnl|my_center|LOCUS_21050 74105 75136 gene locus_tag LOCUS_21060 gene argC 74105 75136 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931826.1 protein_id gnl|my_center|LOCUS_21060 75159 76352 gene locus_tag LOCUS_21070 gene argJ 75159 76352 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989754.1 protein_id gnl|my_center|LOCUS_21070 76385 77134 gene locus_tag LOCUS_21080 gene argB 76385 77134 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989753.1 protein_id gnl|my_center|LOCUS_21080 77131 78282 gene locus_tag LOCUS_21090 77131 78282 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261875.1 protein_id gnl|my_center|LOCUS_21090 78641 79027 gene locus_tag LOCUS_21100 78641 79027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 79073 79621 gene locus_tag LOCUS_21110 79073 79621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 79864 80565 gene locus_tag LOCUS_21120 79864 80565 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295857.1 protein_id gnl|my_center|LOCUS_21120 80568 81029 gene locus_tag LOCUS_21130 gene lspA 80568 81029 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364048.1 protein_id gnl|my_center|LOCUS_21130 81022 81930 gene locus_tag LOCUS_21140 81022 81930 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295861.1 protein_id gnl|my_center|LOCUS_21140 82295 82837 gene locus_tag LOCUS_21150 gene pyrR 82295 82837 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357409.1 protein_id gnl|my_center|LOCUS_21150 82870 84141 gene locus_tag LOCUS_21160 82870 84141 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288870.1 protein_id gnl|my_center|LOCUS_21160 84231 85157 gene locus_tag LOCUS_21170 84231 85157 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288872.1 protein_id gnl|my_center|LOCUS_21170 85171 86451 gene locus_tag LOCUS_21180 85171 86451 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357412.1 protein_id gnl|my_center|LOCUS_21180 86456 87535 gene locus_tag LOCUS_21190 86456 87535 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360175.1 protein_id gnl|my_center|LOCUS_21190 87536 90718 gene locus_tag LOCUS_21200 gene carB 87536 90718 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288878.1 protein_id gnl|my_center|LOCUS_21200 90770 91540 gene locus_tag LOCUS_21210 90770 91540 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288879.1 protein_id gnl|my_center|LOCUS_21210 91540 92466 gene locus_tag LOCUS_21220 91540 92466 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288880.1 protein_id gnl|my_center|LOCUS_21220 92603 93319 gene locus_tag LOCUS_21230 gene pyrF 92603 93319 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369313.1 protein_id gnl|my_center|LOCUS_21230 93320 93946 gene locus_tag LOCUS_21240 gene pyrE 93320 93946 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288884.1 protein_id gnl|my_center|LOCUS_21240 94164 95195 gene locus_tag LOCUS_21250 94164 95195 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357754.1 protein_id gnl|my_center|LOCUS_21250 96895 95192 gene locus_tag LOCUS_21260 gene efbA 96895 95192 CDS product fibronectin-binding protein EfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379361.1 protein_id gnl|my_center|LOCUS_21260 98653 96986 gene locus_tag LOCUS_21270 98653 96986 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674608.1 protein_id gnl|my_center|LOCUS_21270 98828 99388 gene locus_tag LOCUS_21280 98828 99388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295864.1 protein_id gnl|my_center|LOCUS_21280 99779 100789 gene locus_tag LOCUS_21290 gene trpX 99779 100789 CDS product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391629.1 protein_id gnl|my_center|LOCUS_21290 100794 101675 gene locus_tag LOCUS_21300 100794 101675 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289631.1 protein_id gnl|my_center|LOCUS_21300 101680 102462 gene locus_tag LOCUS_21310 101680 102462 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357878.1 protein_id gnl|my_center|LOCUS_21310 102950 103828 gene locus_tag LOCUS_21320 gene aroE 102950 103828 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289627.1 protein_id gnl|my_center|LOCUS_21320 103850 104893 gene locus_tag LOCUS_21330 gene aroF 103850 104893 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289144.1 protein_id gnl|my_center|LOCUS_21330 104906 105964 gene locus_tag LOCUS_21340 gene aroB 104906 105964 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289143.1 protein_id gnl|my_center|LOCUS_21340 105968 107128 gene locus_tag LOCUS_21350 gene aroC 105968 107128 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357582.1 protein_id gnl|my_center|LOCUS_21350 107145 108218 gene locus_tag LOCUS_21360 107145 108218 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289140.1 protein_id gnl|my_center|LOCUS_21360 108223 109494 gene locus_tag LOCUS_21370 gene aroA 108223 109494 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289139.1 protein_id gnl|my_center|LOCUS_21370 109561 110070 gene locus_tag LOCUS_21380 109561 110070 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357579.1 protein_id gnl|my_center|LOCUS_21380 110070 110918 gene locus_tag LOCUS_21390 gene pheA 110070 110918 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382323.1 protein_id gnl|my_center|LOCUS_21390 111015 112196 gene locus_tag LOCUS_21400 111015 112196 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295866.1 protein_id gnl|my_center|LOCUS_21400 112276 113121 gene locus_tag LOCUS_21410 112276 113121 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286075.1 protein_id gnl|my_center|LOCUS_21410 113619 114098 gene locus_tag LOCUS_21420 113619 114098 CDS product DUF6530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286073.1 protein_id gnl|my_center|LOCUS_21420 114123 116354 gene locus_tag LOCUS_21430 114123 116354 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286072.1 protein_id gnl|my_center|LOCUS_21430 116933 116394 gene locus_tag LOCUS_21440 116933 116394 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286070.1 protein_id gnl|my_center|LOCUS_21440 117450 116956 gene locus_tag LOCUS_21450 117450 116956 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357086.1 protein_id gnl|my_center|LOCUS_21450 118244 117447 gene locus_tag LOCUS_21460 118244 117447 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362047.1 protein_id gnl|my_center|LOCUS_21460 118440 119063 gene locus_tag LOCUS_21470 118440 119063 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547287.1 protein_id gnl|my_center|LOCUS_21470 119222 119839 gene locus_tag LOCUS_21480 119222 119839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 119952 120620 gene locus_tag LOCUS_21490 119952 120620 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355232.1 protein_id gnl|my_center|LOCUS_21490 120810 120995 gene locus_tag LOCUS_21500 120810 120995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 121794 121198 gene locus_tag LOCUS_21510 121794 121198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 122408 122019 gene locus_tag LOCUS_21520 122408 122019 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398711.1 protein_id gnl|my_center|LOCUS_21520 122657 124756 gene locus_tag LOCUS_21530 122657 124756 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288584.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence15 1085 108 gene locus_tag LOCUS_21540 gene guaC 1085 108 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287992.1 protein_id gnl|my_center|LOCUS_21540 1695 1267 gene locus_tag LOCUS_21550 1695 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 3204 1954 gene locus_tag LOCUS_21560 gene purD 3204 1954 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288007.1 protein_id gnl|my_center|LOCUS_21560 4752 3220 gene locus_tag LOCUS_21570 gene purH 4752 3220 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288009.1 protein_id gnl|my_center|LOCUS_21570 5378 4809 gene locus_tag LOCUS_21580 gene purN 5378 4809 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369276.1 protein_id gnl|my_center|LOCUS_21580 6418 5375 gene locus_tag LOCUS_21590 gene purM 6418 5375 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288011.1 protein_id gnl|my_center|LOCUS_21590 8005 6566 gene locus_tag LOCUS_21600 gene purF 8005 6566 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288013.1 protein_id gnl|my_center|LOCUS_21600 10209 7990 gene locus_tag LOCUS_21610 gene purL 10209 7990 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288015.1 protein_id gnl|my_center|LOCUS_21610 10889 10209 gene locus_tag LOCUS_21620 gene purQ 10889 10209 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302316.1 protein_id gnl|my_center|LOCUS_21620 11145 10891 gene locus_tag LOCUS_21630 gene purS 11145 10891 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295474.1 protein_id gnl|my_center|LOCUS_21630 11864 11148 gene locus_tag LOCUS_21640 11864 11148 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288021.1 protein_id gnl|my_center|LOCUS_21640 12121 12492 gene locus_tag LOCUS_21650 12121 12492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297115.1 protein_id gnl|my_center|LOCUS_21650 13826 12531 gene locus_tag LOCUS_21660 gene purB 13826 12531 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288023.1 protein_id gnl|my_center|LOCUS_21660 14995 13874 gene locus_tag LOCUS_21670 gene purK 14995 13874 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288025.1 protein_id gnl|my_center|LOCUS_21670 15476 14988 gene locus_tag LOCUS_21680 gene purE 15476 14988 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303771.1 protein_id gnl|my_center|LOCUS_21680 16965 15682 gene locus_tag LOCUS_21690 16965 15682 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295470.1 protein_id gnl|my_center|LOCUS_21690 17548 16967 gene locus_tag LOCUS_21700 17548 16967 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356804.1 protein_id gnl|my_center|LOCUS_21700 17974 18891 gene locus_tag LOCUS_21710 17974 18891 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296674.1 protein_id gnl|my_center|LOCUS_21710 20006 18999 gene locus_tag LOCUS_21720 gene tdcB 20006 18999 CDS product bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632959.1 protein_id gnl|my_center|LOCUS_21720 21115 20006 gene locus_tag LOCUS_21730 gene ald 21115 20006 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959424.1 protein_id gnl|my_center|LOCUS_21730 21890 21453 gene locus_tag LOCUS_21740 21890 21453 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357560.1 protein_id gnl|my_center|LOCUS_21740 22913 21984 gene locus_tag LOCUS_21750 gene cysK 22913 21984 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723745.1 protein_id gnl|my_center|LOCUS_21750 23992 23144 gene locus_tag LOCUS_21760 23992 23144 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289538.1 protein_id gnl|my_center|LOCUS_21760 26862 24259 gene locus_tag LOCUS_21770 gene clpB 26862 24259 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356811.1 protein_id gnl|my_center|LOCUS_21770 27165 28175 gene locus_tag LOCUS_21780 27165 28175 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287486.1 protein_id gnl|my_center|LOCUS_21780 29271 28237 gene locus_tag LOCUS_21790 29271 28237 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288347.1 protein_id gnl|my_center|LOCUS_21790 30600 29371 gene locus_tag LOCUS_21800 gene pepT 30600 29371 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288340.1 protein_id gnl|my_center|LOCUS_21800 31742 30624 gene locus_tag LOCUS_21810 31742 30624 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288338.1 protein_id gnl|my_center|LOCUS_21810 32439 31726 gene locus_tag LOCUS_21820 32439 31726 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382286.1 protein_id gnl|my_center|LOCUS_21820 33484 32558 gene locus_tag LOCUS_21830 gene dnaI 33484 32558 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288331.1 protein_id gnl|my_center|LOCUS_21830 34794 33484 gene locus_tag LOCUS_21840 34794 33484 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288329.1 protein_id gnl|my_center|LOCUS_21840 35279 34806 gene locus_tag LOCUS_21850 gene nrdR 35279 34806 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288327.1 protein_id gnl|my_center|LOCUS_21850 36065 35466 gene locus_tag LOCUS_21860 gene coaE 36065 35466 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288324.1 protein_id gnl|my_center|LOCUS_21860 36901 36068 gene locus_tag LOCUS_21870 gene mutM 36901 36068 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288323.1 protein_id gnl|my_center|LOCUS_21870 39787 37148 gene locus_tag LOCUS_21880 gene polA 39787 37148 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355755.1 protein_id gnl|my_center|LOCUS_21880 40752 40069 gene locus_tag LOCUS_21890 40752 40069 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296397.1 protein_id gnl|my_center|LOCUS_21890 41218 40745 gene locus_tag LOCUS_21900 41218 40745 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296398.1 protein_id gnl|my_center|LOCUS_21900 42736 41402 gene locus_tag LOCUS_21910 gene murC 42736 41402 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357163.1 protein_id gnl|my_center|LOCUS_21910 43296 42838 gene locus_tag LOCUS_21920 43296 42838 CDS product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382248.1 protein_id gnl|my_center|LOCUS_21920 45460 43280 gene locus_tag LOCUS_21930 45460 43280 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296403.1 protein_id gnl|my_center|LOCUS_21930 45866 45540 gene locus_tag LOCUS_21940 45866 45540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21940 46440 45844 gene locus_tag LOCUS_21950 46440 45844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21950 47304 46576 gene locus_tag LOCUS_21960 47304 46576 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296404.1 protein_id gnl|my_center|LOCUS_21960 47707 47336 gene locus_tag LOCUS_21970 47707 47336 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358720.1 protein_id gnl|my_center|LOCUS_21970 49225 47834 gene locus_tag LOCUS_21980 49225 47834 CDS product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295194.1 protein_id gnl|my_center|LOCUS_21980 49886 49503 gene locus_tag LOCUS_21990 49886 49503 CDS product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291995.1 protein_id gnl|my_center|LOCUS_21990 50606 50001 gene locus_tag LOCUS_22000 50606 50001 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295196.1 protein_id gnl|my_center|LOCUS_22000 51296 50628 gene locus_tag LOCUS_22010 51296 50628 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295197.1 protein_id gnl|my_center|LOCUS_22010 51760 51347 gene locus_tag LOCUS_22020 51760 51347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322028.1 protein_id gnl|my_center|LOCUS_22020 51913 51785 gene locus_tag LOCUS_22030 51913 51785 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295229.1 protein_id gnl|my_center|LOCUS_22030 53280 51916 gene locus_tag LOCUS_22040 gene rlmD 53280 51916 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288467.1 protein_id gnl|my_center|LOCUS_22040 54462 53452 gene locus_tag LOCUS_22050 54462 53452 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288471.1 protein_id gnl|my_center|LOCUS_22050 55905 54475 gene locus_tag LOCUS_22060 gene gatB 55905 54475 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288473.1 protein_id gnl|my_center|LOCUS_22060 57374 55905 gene locus_tag LOCUS_22070 gene gatA 57374 55905 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361259.1 protein_id gnl|my_center|LOCUS_22070 57679 57374 gene locus_tag LOCUS_22080 gene gatC 57679 57374 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288477.1 protein_id gnl|my_center|LOCUS_22080 59898 57871 gene locus_tag LOCUS_22090 gene ligA 59898 57871 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361258.1 protein_id gnl|my_center|LOCUS_22090 62170 59921 gene locus_tag LOCUS_22100 gene pcrA 62170 59921 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002319708.1 protein_id gnl|my_center|LOCUS_22100 62322 63896 gene locus_tag LOCUS_22110 62322 63896 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288482.1 protein_id gnl|my_center|LOCUS_22110 65365 63905 gene locus_tag LOCUS_22120 65365 63905 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905850.1 protein_id gnl|my_center|LOCUS_22120 65523 66275 gene locus_tag LOCUS_22130 65523 66275 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323503.1 protein_id gnl|my_center|LOCUS_22130 66272 67192 gene locus_tag LOCUS_22140 gene pfkB 66272 67192 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358692.1 protein_id gnl|my_center|LOCUS_22140 67245 69167 gene locus_tag LOCUS_22150 67245 69167 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288483.1 protein_id gnl|my_center|LOCUS_22150 69394 69209 gene locus_tag LOCUS_22160 69394 69209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 70812 69445 gene locus_tag LOCUS_22170 70812 69445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288487.1 protein_id gnl|my_center|LOCUS_22170 70946 71098 gene locus_tag LOCUS_22180 70946 71098 CDS product SPJ_0845 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288488.1 protein_id gnl|my_center|LOCUS_22180 71691 71095 gene locus_tag LOCUS_22190 gene yihA 71691 71095 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288491.1 protein_id gnl|my_center|LOCUS_22190 72995 71748 gene locus_tag LOCUS_22200 gene clpX 72995 71748 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288492.1 protein_id gnl|my_center|LOCUS_22200 74521 73148 gene locus_tag LOCUS_22210 74521 73148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 76059 74776 gene locus_tag LOCUS_22220 gene tig 76059 74776 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292069.1 protein_id gnl|my_center|LOCUS_22220 77086 76163 gene locus_tag LOCUS_22230 77086 76163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 77628 77083 gene locus_tag LOCUS_22240 77628 77083 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296311.1 protein_id gnl|my_center|LOCUS_22240 78659 77631 gene locus_tag LOCUS_22250 gene sppA 78659 77631 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296309.1 protein_id gnl|my_center|LOCUS_22250 78957 78670 gene locus_tag LOCUS_22260 78957 78670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379593.1 protein_id gnl|my_center|LOCUS_22260 79435 81243 gene locus_tag LOCUS_22270 gene glmS 79435 81243 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287825.1 protein_id gnl|my_center|LOCUS_22270 82683 81328 gene locus_tag LOCUS_22280 gene glmM 82683 81328 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287824.1 protein_id gnl|my_center|LOCUS_22280 83807 82707 gene locus_tag LOCUS_22290 83807 82707 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287822.1 protein_id gnl|my_center|LOCUS_22290 84688 83804 gene locus_tag LOCUS_22300 gene cdaA 84688 83804 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287821.1 protein_id gnl|my_center|LOCUS_22300 88561 84890 gene locus_tag LOCUS_22310 gene nifJ 88561 84890 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706520.1 protein_id gnl|my_center|LOCUS_22310 88841 89356 gene locus_tag LOCUS_22320 88841 89356 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773452.1 protein_id gnl|my_center|LOCUS_22320 90314 89379 gene locus_tag LOCUS_22330 gene whiA 90314 89379 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289698.1 protein_id gnl|my_center|LOCUS_22330 91411 90413 gene locus_tag LOCUS_22340 91411 90413 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289697.1 protein_id gnl|my_center|LOCUS_22340 92295 91408 gene locus_tag LOCUS_22350 gene rapZ 92295 91408 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289695.1 protein_id gnl|my_center|LOCUS_22350 93312 92599 gene locus_tag LOCUS_22360 93312 92599 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296517.1 protein_id gnl|my_center|LOCUS_22360 94571 93315 gene locus_tag LOCUS_22370 94571 93315 CDS product D-aspartate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294441.1 protein_id gnl|my_center|LOCUS_22370 97494 94669 gene locus_tag LOCUS_22380 gene uvrA 97494 94669 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361280.1 protein_id gnl|my_center|LOCUS_22380 99563 97572 gene locus_tag LOCUS_22390 gene uvrB 99563 97572 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294444.1 protein_id gnl|my_center|LOCUS_22390 99809 101971 gene locus_tag LOCUS_22400 99809 101971 CDS product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361277.1 protein_id gnl|my_center|LOCUS_22400 101972 102721 gene locus_tag LOCUS_22410 101972 102721 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355616.1 protein_id gnl|my_center|LOCUS_22410 103786 102743 gene locus_tag LOCUS_22420 103786 102743 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914442.1 protein_id gnl|my_center|LOCUS_22420 105104 103917 gene locus_tag LOCUS_22430 gene tuf 105104 103917 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289463.1 protein_id gnl|my_center|LOCUS_22430 105439 105714 gene locus_tag LOCUS_22440 105439 105714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 105716 106354 gene locus_tag LOCUS_22450 105716 106354 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700976.1 protein_id gnl|my_center|LOCUS_22450 106351 107112 gene locus_tag LOCUS_22460 gene fetB 106351 107112 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476516.1 protein_id gnl|my_center|LOCUS_22460 108411 107155 gene locus_tag LOCUS_22470 gene ilvA 108411 107155 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989860.1 protein_id gnl|my_center|LOCUS_22470 109420 108425 gene locus_tag LOCUS_22480 gene ilvC 109420 108425 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931317.1 protein_id gnl|my_center|LOCUS_22480 109956 109480 gene locus_tag LOCUS_22490 gene ilvN 109956 109480 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723150.1 protein_id gnl|my_center|LOCUS_22490 111664 109958 gene locus_tag LOCUS_22500 gene ilvB 111664 109958 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732013.1 protein_id gnl|my_center|LOCUS_22500 113358 111676 gene locus_tag LOCUS_22510 gene ilvD 113358 111676 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728794.1 protein_id gnl|my_center|LOCUS_22510 115594 113789 gene locus_tag LOCUS_22520 115594 113789 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285918.1 protein_id gnl|my_center|LOCUS_22520 117317 115575 gene locus_tag LOCUS_22530 117317 115575 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359874.1 protein_id gnl|my_center|LOCUS_22530 117395 118231 gene locus_tag LOCUS_22540 gene bltR 117395 118231 CDS product multidrug efflux transcriptional regulator BltR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229881.1 protein_id gnl|my_center|LOCUS_22540 118608 119774 gene locus_tag LOCUS_22550 118608 119774 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930902.1 protein_id gnl|my_center|LOCUS_22550 120070 119855 gene locus_tag LOCUS_22560 120070 119855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 120631 120558 gene locus_tag LOCUS_t00160 120631 120558 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 120774 120689 gene locus_tag LOCUS_t00170 120774 120689 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 120868 120798 gene locus_tag LOCUS_t00180 120868 120798 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 121010 120937 gene locus_tag LOCUS_t00190 121010 120937 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 121092 121019 gene locus_tag LOCUS_t00200 121092 121019 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 121175 121103 gene locus_tag LOCUS_t00210 121175 121103 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 121264 121182 gene locus_tag LOCUS_t00220 121264 121182 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 121340 121265 gene locus_tag LOCUS_t00230 121340 121265 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 121449 121374 gene locus_tag LOCUS_t00240 121449 121374 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 121526 121452 gene locus_tag LOCUS_t00250 121526 121452 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 121611 121538 gene locus_tag LOCUS_t00260 121611 121538 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 121716 121626 gene locus_tag LOCUS_t00270 121716 121626 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 121839 121764 gene locus_tag LOCUS_t00280 121839 121764 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence16 603 109 gene locus_tag LOCUS_22570 603 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 913 1173 gene locus_tag LOCUS_22580 913 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 1616 2041 gene locus_tag LOCUS_22590 1616 2041 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131384.1 protein_id gnl|my_center|LOCUS_22590 2338 2078 gene locus_tag LOCUS_22600 2338 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295437.1 protein_id gnl|my_center|LOCUS_22600 2579 2325 gene locus_tag LOCUS_22610 2579 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 2769 3557 gene locus_tag LOCUS_22620 2769 3557 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966775.1 protein_id gnl|my_center|LOCUS_22620 3839 4822 gene locus_tag LOCUS_22630 3839 4822 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966774.1 protein_id gnl|my_center|LOCUS_22630 5381 5623 gene locus_tag LOCUS_22640 5381 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 6248 5877 gene locus_tag LOCUS_22650 6248 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 6457 6894 gene locus_tag LOCUS_22660 6457 6894 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131384.1 protein_id gnl|my_center|LOCUS_22660 7242 6922 gene locus_tag LOCUS_22670 7242 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 7432 8313 gene locus_tag LOCUS_22680 7432 8313 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640443.1 protein_id gnl|my_center|LOCUS_22680 8333 8740 gene locus_tag LOCUS_22690 8333 8740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 10041 8782 gene locus_tag LOCUS_22700 10041 8782 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434922.1 protein_id gnl|my_center|LOCUS_22700 10465 11037 gene locus_tag LOCUS_22710 10465 11037 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130266.1 protein_id gnl|my_center|LOCUS_22710 11215 11985 gene locus_tag LOCUS_22720 11215 11985 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021321.1 protein_id gnl|my_center|LOCUS_22720 12057 13178 gene locus_tag LOCUS_22730 12057 13178 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355745.1 protein_id gnl|my_center|LOCUS_22730 13190 13810 gene locus_tag LOCUS_22740 13190 13810 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568628.1 protein_id gnl|my_center|LOCUS_22740 13815 14723 gene locus_tag LOCUS_22750 13815 14723 CDS product osmoprotectant ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355743.1 protein_id gnl|my_center|LOCUS_22750 14723 15340 gene locus_tag LOCUS_22760 14723 15340 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363261.1 protein_id gnl|my_center|LOCUS_22760 16090 15377 gene locus_tag LOCUS_22770 16090 15377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 16308 17795 gene locus_tag LOCUS_22780 16308 17795 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059304.1 protein_id gnl|my_center|LOCUS_22780 17864 18652 gene locus_tag LOCUS_22790 17864 18652 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048185.1 protein_id gnl|my_center|LOCUS_22790 18652 19575 gene locus_tag LOCUS_22800 18652 19575 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048184.1 protein_id gnl|my_center|LOCUS_22800 19624 20400 gene locus_tag LOCUS_22810 19624 20400 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021347.1 protein_id gnl|my_center|LOCUS_22810 20440 21885 gene locus_tag LOCUS_22820 20440 21885 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039681.1 protein_id gnl|my_center|LOCUS_22820 22217 23956 gene locus_tag LOCUS_22830 gene ade 22217 23956 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476052.1 protein_id gnl|my_center|LOCUS_22830 24258 24001 gene locus_tag LOCUS_22840 24258 24001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 26160 24394 gene locus_tag LOCUS_22850 26160 24394 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989585.1 protein_id gnl|my_center|LOCUS_22850 26428 27828 gene locus_tag LOCUS_22860 26428 27828 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287852.1 protein_id gnl|my_center|LOCUS_22860 27852 28169 gene locus_tag LOCUS_22870 27852 28169 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321527.1 protein_id gnl|my_center|LOCUS_22870 28372 30297 gene locus_tag LOCUS_22880 28372 30297 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861973.1 protein_id gnl|my_center|LOCUS_22880 30302 30628 gene locus_tag LOCUS_22890 30302 30628 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379645.1 protein_id gnl|my_center|LOCUS_22890 30647 30985 gene locus_tag LOCUS_22900 30647 30985 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421322.1 protein_id gnl|my_center|LOCUS_22900 31001 32350 gene locus_tag LOCUS_22910 31001 32350 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861972.1 protein_id gnl|my_center|LOCUS_22910 32410 33492 gene locus_tag LOCUS_22920 32410 33492 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583399.1 protein_id gnl|my_center|LOCUS_22920 33476 34522 gene locus_tag LOCUS_22930 33476 34522 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456664.1 protein_id gnl|my_center|LOCUS_22930 34509 35702 gene locus_tag LOCUS_22940 34509 35702 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642879.1 protein_id gnl|my_center|LOCUS_22940 35887 37527 gene locus_tag LOCUS_22950 gene manR 35887 37527 CDS product mannose transport/utilization transcriptional regulator ManR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245617.1 protein_id gnl|my_center|LOCUS_22950 37524 37970 gene locus_tag LOCUS_22960 37524 37970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 37967 38251 gene locus_tag LOCUS_22970 37967 38251 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454867.1 protein_id gnl|my_center|LOCUS_22970 38256 39506 gene locus_tag LOCUS_22980 38256 39506 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897756.1 protein_id gnl|my_center|LOCUS_22980 39507 40244 gene locus_tag LOCUS_22990 39507 40244 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861599.1 protein_id gnl|my_center|LOCUS_22990 40504 40325 gene locus_tag LOCUS_23000 40504 40325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357684.1 protein_id gnl|my_center|LOCUS_23000 40579 40746 gene locus_tag LOCUS_23010 40579 40746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 40827 41015 gene locus_tag LOCUS_23020 40827 41015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 41197 41676 gene locus_tag LOCUS_23030 41197 41676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 41683 42282 gene locus_tag LOCUS_23040 41683 42282 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723074.1 protein_id gnl|my_center|LOCUS_23040 42421 43335 gene locus_tag LOCUS_23050 42421 43335 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369696.1 protein_id gnl|my_center|LOCUS_23050 43328 44266 gene locus_tag LOCUS_23060 43328 44266 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965621.1 protein_id gnl|my_center|LOCUS_23060 44263 45057 gene locus_tag LOCUS_23070 44263 45057 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989455.1 protein_id gnl|my_center|LOCUS_23070 47194 45101 gene locus_tag LOCUS_23080 47194 45101 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288584.1 protein_id gnl|my_center|LOCUS_23080 48133 47390 gene locus_tag LOCUS_23090 48133 47390 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287242.1 protein_id gnl|my_center|LOCUS_23090 48394 49125 gene locus_tag LOCUS_23100 48394 49125 CDS product GntR family transcriptional regulator, LSA1692 subfamily inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357984.1 protein_id gnl|my_center|LOCUS_23100 49162 50463 gene locus_tag LOCUS_23110 49162 50463 CDS product Sapep family Mn(2+)-dependent dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386630.1 protein_id gnl|my_center|LOCUS_23110 50626 51579 gene locus_tag LOCUS_23120 50626 51579 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361636.1 protein_id gnl|my_center|LOCUS_23120 51603 51932 gene locus_tag LOCUS_23130 51603 51932 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357981.1 protein_id gnl|my_center|LOCUS_23130 51959 53314 gene locus_tag LOCUS_23140 gene celB 51959 53314 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384702.1 protein_id gnl|my_center|LOCUS_23140 53424 53753 gene locus_tag LOCUS_23150 53424 53753 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577029.1 protein_id gnl|my_center|LOCUS_23150 54370 53828 gene locus_tag LOCUS_23160 54370 53828 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357340.1 protein_id gnl|my_center|LOCUS_23160 54548 55327 gene locus_tag LOCUS_23170 54548 55327 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432388.1 protein_id gnl|my_center|LOCUS_23170 55355 57757 gene locus_tag LOCUS_23180 55355 57757 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903701.1 protein_id gnl|my_center|LOCUS_23180 58335 59264 gene locus_tag LOCUS_23190 gene trxB 58335 59264 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948886.1 protein_id gnl|my_center|LOCUS_23190 59315 59632 gene locus_tag LOCUS_23200 59315 59632 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356487.1 protein_id gnl|my_center|LOCUS_23200 59676 60140 gene locus_tag LOCUS_23210 gene grdA 59676 60140 CDS product glycine/sarcosine/betaine reductase complex selenoprotein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081450071.1 transl_except (pos:59802..59804,aa:Sec) note codon on position 43 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_23210 60221 61756 gene locus_tag LOCUS_23220 gene grdC 60221 61756 CDS product glycine/sarcosine/betaine reductase complex component C subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897537.1 protein_id gnl|my_center|LOCUS_23220 61761 62918 gene locus_tag LOCUS_23230 gene grdD 61761 62918 CDS product glycine/sarcosine/betaine reductase complex component C subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430750.1 protein_id gnl|my_center|LOCUS_23230 63015 64340 gene locus_tag LOCUS_23240 63015 64340 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416871.1 protein_id gnl|my_center|LOCUS_23240 64391 65710 gene locus_tag LOCUS_23250 gene grdH 64391 65710 CDS product betaine reductase complex component B subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:O69407 transl_except (pos:65441..65443,aa:Sec) note codon on position 351 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_23250 65773 67236 gene locus_tag LOCUS_23260 65773 67236 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948787.1 protein_id gnl|my_center|LOCUS_23260 67438 68136 gene locus_tag LOCUS_23270 67438 68136 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069330175.1 protein_id gnl|my_center|LOCUS_23270 68179 68736 gene locus_tag LOCUS_23280 68179 68736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 68694 69299 gene locus_tag LOCUS_23290 68694 69299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 70837 69344 gene locus_tag LOCUS_23300 gene lsa(A) 70837 69344 CDS product ABC-F type ribosomal protection protein Lsa(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387187.1 protein_id gnl|my_center|LOCUS_23300 71482 73230 gene locus_tag LOCUS_23310 71482 73230 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288160.1 protein_id gnl|my_center|LOCUS_23310 73306 73677 gene locus_tag LOCUS_23320 73306 73677 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592713.1 protein_id gnl|my_center|LOCUS_23320 73786 74286 gene locus_tag LOCUS_23330 73786 74286 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296569.1 protein_id gnl|my_center|LOCUS_23330 74476 77094 gene locus_tag LOCUS_23340 gene ppdK 74476 77094 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_23340 77714 79132 gene locus_tag LOCUS_23350 gene pepV 77714 79132 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371462.1 protein_id gnl|my_center|LOCUS_23350 79218 81137 gene locus_tag LOCUS_23360 79218 81137 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861201.1 protein_id gnl|my_center|LOCUS_23360 81130 81495 gene locus_tag LOCUS_23370 81130 81495 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889198.1 protein_id gnl|my_center|LOCUS_23370 81978 81703 gene locus_tag LOCUS_23380 81978 81703 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418727.1 protein_id gnl|my_center|LOCUS_23380 82190 84580 gene locus_tag LOCUS_23390 82190 84580 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101183.1 protein_id gnl|my_center|LOCUS_23390 84777 85685 gene locus_tag LOCUS_23400 84777 85685 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964193.1 protein_id gnl|my_center|LOCUS_23400 85774 86748 gene locus_tag LOCUS_23410 85774 86748 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567693.1 protein_id gnl|my_center|LOCUS_23410 86846 87394 gene locus_tag LOCUS_23420 86846 87394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 87805 87476 gene locus_tag LOCUS_23430 87805 87476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 88043 88537 gene locus_tag LOCUS_23440 88043 88537 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814642.1 protein_id gnl|my_center|LOCUS_23440 88534 89697 gene locus_tag LOCUS_23450 88534 89697 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_23450 89908 91026 gene locus_tag LOCUS_23460 89908 91026 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287791.1 protein_id gnl|my_center|LOCUS_23460 92501 91107 gene locus_tag LOCUS_23470 92501 91107 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294242.1 protein_id gnl|my_center|LOCUS_23470 92808 93785 gene locus_tag LOCUS_23480 92808 93785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 94767 93802 gene locus_tag LOCUS_23490 94767 93802 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262734.1 protein_id gnl|my_center|LOCUS_23490 95040 96059 gene locus_tag LOCUS_23500 gene ptcA 95040 96059 CDS product putrescine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355587.1 protein_id gnl|my_center|LOCUS_23500 96175 97596 gene locus_tag LOCUS_23510 96175 97596 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355588.1 protein_id gnl|my_center|LOCUS_23510 97550 98647 gene locus_tag LOCUS_23520 gene aguA 97550 98647 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363185.1 protein_id gnl|my_center|LOCUS_23520 98657 99586 gene locus_tag LOCUS_23530 gene arcC 98657 99586 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363186.1 protein_id gnl|my_center|LOCUS_23530 99753 101087 gene locus_tag LOCUS_23540 99753 101087 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721657.1 protein_id gnl|my_center|LOCUS_23540 101080 103377 gene locus_tag LOCUS_23550 101080 103377 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990068.1 protein_id gnl|my_center|LOCUS_23550 103441 104403 gene locus_tag LOCUS_23560 103441 104403 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293830.1 protein_id gnl|my_center|LOCUS_23560 104526 105920 gene locus_tag LOCUS_23570 104526 105920 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035027539.1 protein_id gnl|my_center|LOCUS_23570 106413 105979 gene locus_tag LOCUS_23580 106413 105979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 109045 106478 gene locus_tag LOCUS_23590 109045 106478 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048098.1 protein_id gnl|my_center|LOCUS_23590 109227 110177 gene locus_tag LOCUS_23600 109227 110177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 >Feature sequence17 1399 98 gene locus_tag LOCUS_23610 1399 98 CDS product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287463.1 protein_id gnl|my_center|LOCUS_23610 2109 2426 gene locus_tag LOCUS_23620 2109 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 3450 2686 gene locus_tag LOCUS_23630 3450 2686 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673992.1 protein_id gnl|my_center|LOCUS_23630 4382 3447 gene locus_tag LOCUS_23640 4382 3447 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592685.1 protein_id gnl|my_center|LOCUS_23640 4591 4379 gene locus_tag LOCUS_23650 4591 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 5711 4584 gene locus_tag LOCUS_23660 5711 4584 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673991.1 protein_id gnl|my_center|LOCUS_23660 6522 5848 gene locus_tag LOCUS_23670 6522 5848 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262999.1 protein_id gnl|my_center|LOCUS_23670 7421 6549 gene locus_tag LOCUS_23680 7421 6549 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986930.1 protein_id gnl|my_center|LOCUS_23680 8083 7418 gene locus_tag LOCUS_23690 8083 7418 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986925.1 protein_id gnl|my_center|LOCUS_23690 9071 8076 gene locus_tag LOCUS_23700 9071 8076 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012100493.1 protein_id gnl|my_center|LOCUS_23700 9765 9085 gene locus_tag LOCUS_23710 9765 9085 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986926.1 protein_id gnl|my_center|LOCUS_23710 10757 9762 gene locus_tag LOCUS_23720 10757 9762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 11535 10741 gene locus_tag LOCUS_23730 11535 10741 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948770.1 protein_id gnl|my_center|LOCUS_23730 12386 11529 gene locus_tag LOCUS_23740 12386 11529 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948769.1 protein_id gnl|my_center|LOCUS_23740 13617 12379 gene locus_tag LOCUS_23750 13617 12379 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948768.1 protein_id gnl|my_center|LOCUS_23750 14382 13627 gene locus_tag LOCUS_23760 14382 13627 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263000.1 protein_id gnl|my_center|LOCUS_23760 14738 14379 gene locus_tag LOCUS_23770 14738 14379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23770 16145 15114 gene locus_tag LOCUS_23780 16145 15114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 16629 17009 gene locus_tag LOCUS_23790 16629 17009 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383771.1 protein_id gnl|my_center|LOCUS_23790 17652 17164 gene locus_tag LOCUS_23800 17652 17164 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287700.1 protein_id gnl|my_center|LOCUS_23800 17907 18461 gene locus_tag LOCUS_23810 17907 18461 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287055.1 protein_id gnl|my_center|LOCUS_23810 19852 18521 gene locus_tag LOCUS_23820 19852 18521 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905313.1 protein_id gnl|my_center|LOCUS_23820 20065 20736 gene locus_tag LOCUS_23830 20065 20736 CDS product transcriptional regulator YeiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868719.1 protein_id gnl|my_center|LOCUS_23830 21335 20868 gene locus_tag LOCUS_23840 gene msrA 21335 20868 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288397.1 protein_id gnl|my_center|LOCUS_23840 22215 21397 gene locus_tag LOCUS_23850 22215 21397 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287678.1 protein_id gnl|my_center|LOCUS_23850 23215 22607 gene locus_tag LOCUS_23860 23215 22607 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311505.1 protein_id gnl|my_center|LOCUS_23860 25977 23248 gene locus_tag LOCUS_23870 25977 23248 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113849264.1 protein_id gnl|my_center|LOCUS_23870 27093 26116 gene locus_tag LOCUS_23880 27093 26116 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322451.1 protein_id gnl|my_center|LOCUS_23880 27997 27182 gene locus_tag LOCUS_23890 27997 27182 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298371.1 protein_id gnl|my_center|LOCUS_23890 28801 28013 gene locus_tag LOCUS_23900 28801 28013 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071854933.1 protein_id gnl|my_center|LOCUS_23900 29286 28816 gene locus_tag LOCUS_23910 29286 28816 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298375.1 protein_id gnl|my_center|LOCUS_23910 29702 29283 gene locus_tag LOCUS_23920 29702 29283 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071854935.1 protein_id gnl|my_center|LOCUS_23920 30982 29999 gene locus_tag LOCUS_23930 30982 29999 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966767.1 protein_id gnl|my_center|LOCUS_23930 31149 31856 gene locus_tag LOCUS_23940 31149 31856 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861086.1 protein_id gnl|my_center|LOCUS_23940 32310 31930 gene locus_tag LOCUS_23950 32310 31930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 32833 32327 gene locus_tag LOCUS_23960 32833 32327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 33339 32830 gene locus_tag LOCUS_23970 33339 32830 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903083.1 protein_id gnl|my_center|LOCUS_23970 33595 34359 gene locus_tag LOCUS_23980 33595 34359 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321321.1 protein_id gnl|my_center|LOCUS_23980 34491 35717 gene locus_tag LOCUS_23990 34491 35717 CDS product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296334.1 protein_id gnl|my_center|LOCUS_23990 36509 35868 gene locus_tag LOCUS_24000 36509 35868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 36933 36550 gene locus_tag LOCUS_24010 36933 36550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 37356 37628 gene locus_tag LOCUS_24020 37356 37628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 39502 37751 gene locus_tag LOCUS_24030 gene recQ 39502 37751 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356683.1 protein_id gnl|my_center|LOCUS_24030 41463 39625 gene locus_tag LOCUS_24040 gene lepA 41463 39625 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288355.1 protein_id gnl|my_center|LOCUS_24040 41825 43042 gene locus_tag LOCUS_24050 41825 43042 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356813.1 protein_id gnl|my_center|LOCUS_24050 43029 43538 gene locus_tag LOCUS_24060 43029 43538 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288352.1 protein_id gnl|my_center|LOCUS_24060 43528 44190 gene locus_tag LOCUS_24070 43528 44190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321495.1 protein_id gnl|my_center|LOCUS_24070 44722 44231 gene locus_tag LOCUS_24080 44722 44231 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058223026.1 protein_id gnl|my_center|LOCUS_24080 44955 45668 gene locus_tag LOCUS_24090 44955 45668 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294563.1 protein_id gnl|my_center|LOCUS_24090 46294 45701 gene locus_tag LOCUS_24100 46294 45701 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748663.1 protein_id gnl|my_center|LOCUS_24100 47247 46561 gene locus_tag LOCUS_24110 47247 46561 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295463.1 protein_id gnl|my_center|LOCUS_24110 47901 47287 gene locus_tag LOCUS_24120 47901 47287 CDS product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295461.1 protein_id gnl|my_center|LOCUS_24120 48696 47911 gene locus_tag LOCUS_24130 48696 47911 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321179.1 protein_id gnl|my_center|LOCUS_24130 49246 48713 gene locus_tag LOCUS_24140 49246 48713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295457.1 protein_id gnl|my_center|LOCUS_24140 49430 50386 gene locus_tag LOCUS_24150 49430 50386 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016628808.1 protein_id gnl|my_center|LOCUS_24150 50487 51083 gene locus_tag LOCUS_24160 50487 51083 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295450.1 protein_id gnl|my_center|LOCUS_24160 53717 51102 gene locus_tag LOCUS_24170 53717 51102 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706591.1 protein_id gnl|my_center|LOCUS_24170 54431 53730 gene locus_tag LOCUS_24180 54431 53730 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774180.1 protein_id gnl|my_center|LOCUS_24180 54593 55036 gene locus_tag LOCUS_24190 54593 55036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680353.1 protein_id gnl|my_center|LOCUS_24190 55622 55104 gene locus_tag LOCUS_24200 55622 55104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 56352 55654 gene locus_tag LOCUS_24210 56352 55654 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068399.1 protein_id gnl|my_center|LOCUS_24210 57627 56482 gene locus_tag LOCUS_24220 gene nagA 57627 56482 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357814.1 protein_id gnl|my_center|LOCUS_24220 58530 57706 gene locus_tag LOCUS_24230 58530 57706 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381942.1 protein_id gnl|my_center|LOCUS_24230 58795 58711 gene locus_tag LOCUS_t00290 58795 58711 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 59026 58841 gene locus_tag LOCUS_24240 59026 58841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288067.1 protein_id gnl|my_center|LOCUS_24240 59694 59089 gene locus_tag LOCUS_24250 59694 59089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289257.1 protein_id gnl|my_center|LOCUS_24250 61625 59793 gene locus_tag LOCUS_24260 61625 59793 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905518.1 protein_id gnl|my_center|LOCUS_24260 64044 61606 gene locus_tag LOCUS_24270 64044 61606 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476256.1 protein_id gnl|my_center|LOCUS_24270 65604 64177 gene locus_tag LOCUS_24280 gene glgA 65604 64177 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476257.1 protein_id gnl|my_center|LOCUS_24280 66755 65607 gene locus_tag LOCUS_24290 gene glgD 66755 65607 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476258.1 protein_id gnl|my_center|LOCUS_24290 67914 66742 gene locus_tag LOCUS_24300 67914 66742 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563805.1 protein_id gnl|my_center|LOCUS_24300 69827 67926 gene locus_tag LOCUS_24310 gene glgB 69827 67926 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476259.1 protein_id gnl|my_center|LOCUS_24310 70252 70806 gene locus_tag LOCUS_24320 70252 70806 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289260.1 protein_id gnl|my_center|LOCUS_24320 71672 70809 gene locus_tag LOCUS_24330 71672 70809 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722771.1 protein_id gnl|my_center|LOCUS_24330 72477 71677 gene locus_tag LOCUS_24340 72477 71677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 73581 72652 gene locus_tag LOCUS_24350 73581 72652 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360265.1 protein_id gnl|my_center|LOCUS_24350 74512 73727 gene locus_tag LOCUS_24360 gene pflA 74512 73727 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357530.1 protein_id gnl|my_center|LOCUS_24360 77059 74768 gene locus_tag LOCUS_24370 gene pflB 77059 74768 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_24370 79795 77348 gene locus_tag LOCUS_24380 gene parC 79795 77348 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357527.1 protein_id gnl|my_center|LOCUS_24380 81845 79809 gene locus_tag LOCUS_24390 gene parE 81845 79809 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138821006.1 protein_id gnl|my_center|LOCUS_24390 82525 82103 gene locus_tag LOCUS_24400 82525 82103 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296996.1 protein_id gnl|my_center|LOCUS_24400 82649 83278 gene locus_tag LOCUS_24410 gene plsY 82649 83278 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382346.1 protein_id gnl|my_center|LOCUS_24410 83279 83893 gene locus_tag LOCUS_24420 83279 83893 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476045.1 protein_id gnl|my_center|LOCUS_24420 84822 83953 gene locus_tag LOCUS_24430 84822 83953 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296994.1 protein_id gnl|my_center|LOCUS_24430 85737 84949 gene locus_tag LOCUS_24440 gene codY 85737 84949 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290223.1 protein_id gnl|my_center|LOCUS_24440 87146 85755 gene locus_tag LOCUS_24450 gene hslU 87146 85755 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360239.1 protein_id gnl|my_center|LOCUS_24450 87732 87187 gene locus_tag LOCUS_24460 gene hslV 87732 87187 CDS product HslU--HslV peptidase proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288419.1 protein_id gnl|my_center|LOCUS_24460 88661 87762 gene locus_tag LOCUS_24470 gene xerC 88661 87762 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357488.1 protein_id gnl|my_center|LOCUS_24470 90159 88861 gene locus_tag LOCUS_24480 gene trmFO 90159 88861 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320953.1 protein_id gnl|my_center|LOCUS_24480 92258 90180 gene locus_tag LOCUS_24490 gene topA 92258 90180 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298115.1 protein_id gnl|my_center|LOCUS_24490 93214 92360 gene locus_tag LOCUS_24500 gene dprA 93214 92360 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382350.1 protein_id gnl|my_center|LOCUS_24500 94037 93273 gene locus_tag LOCUS_24510 94037 93273 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296990.1 protein_id gnl|my_center|LOCUS_24510 94885 94037 gene locus_tag LOCUS_24520 gene ylqF 94885 94037 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357480.1 protein_id gnl|my_center|LOCUS_24520 96148 95132 gene locus_tag LOCUS_24530 96148 95132 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986736.1 protein_id gnl|my_center|LOCUS_24530 96847 96299 gene locus_tag LOCUS_24540 gene lepB 96847 96299 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294418.1 protein_id gnl|my_center|LOCUS_24540 98339 96891 gene locus_tag LOCUS_24550 98339 96891 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390869.1 protein_id gnl|my_center|LOCUS_24550 98613 98392 gene locus_tag LOCUS_24560 98613 98392 CDS product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364020.1 protein_id gnl|my_center|LOCUS_24560 99255 98641 gene locus_tag LOCUS_24570 99255 98641 CDS product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288396.1 protein_id gnl|my_center|LOCUS_24570 100106 99255 gene locus_tag LOCUS_24580 100106 99255 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288395.1 protein_id gnl|my_center|LOCUS_24580 100996 100157 gene locus_tag LOCUS_24590 100996 100157 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357444.1 protein_id gnl|my_center|LOCUS_24590 101601 101107 gene locus_tag LOCUS_24600 101601 101107 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288392.1 protein_id gnl|my_center|LOCUS_24600 103507 101636 gene locus_tag LOCUS_24610 103507 101636 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365663.1 protein_id gnl|my_center|LOCUS_24610 104201 103620 gene locus_tag LOCUS_24620 104201 103620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 104842 104390 gene locus_tag LOCUS_24630 104842 104390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357586.1 protein_id gnl|my_center|LOCUS_24630 105277 104915 gene locus_tag LOCUS_24640 105277 104915 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357588.1 protein_id gnl|my_center|LOCUS_24640 106491 105274 gene locus_tag LOCUS_24650 106491 105274 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298132.1 protein_id gnl|my_center|LOCUS_24650 106838 106488 gene locus_tag LOCUS_24660 106838 106488 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363944.1 protein_id gnl|my_center|LOCUS_24660 107006 107896 gene locus_tag LOCUS_24670 107006 107896 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294412.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence18 2326 182 gene locus_tag LOCUS_24680 2326 182 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378512.1 protein_id gnl|my_center|LOCUS_24680 5492 2331 gene locus_tag LOCUS_24690 5492 2331 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383762.1 protein_id gnl|my_center|LOCUS_24690 6700 5495 gene locus_tag LOCUS_24700 6700 5495 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356901.1 protein_id gnl|my_center|LOCUS_24700 7527 6715 gene locus_tag LOCUS_24710 7527 6715 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289081.1 protein_id gnl|my_center|LOCUS_24710 8506 7865 gene locus_tag LOCUS_24720 8506 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 8940 8557 gene locus_tag LOCUS_24730 8940 8557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 10515 9253 gene locus_tag LOCUS_24740 10515 9253 CDS product EpaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294529.1 protein_id gnl|my_center|LOCUS_24740 12632 10536 gene locus_tag LOCUS_24750 12632 10536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302719.1 protein_id gnl|my_center|LOCUS_24750 13461 12589 gene locus_tag LOCUS_24760 13461 12589 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286453.1 protein_id gnl|my_center|LOCUS_24760 14324 13479 gene locus_tag LOCUS_24770 gene rfbD 14324 13479 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286428.1 protein_id gnl|my_center|LOCUS_24770 15542 14514 gene locus_tag LOCUS_24780 gene rfbB 15542 14514 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292882.1 protein_id gnl|my_center|LOCUS_24780 16227 15646 gene locus_tag LOCUS_24790 gene rfbC 16227 15646 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476437.1 protein_id gnl|my_center|LOCUS_24790 17099 16230 gene locus_tag LOCUS_24800 gene rfbA 17099 16230 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364387.1 protein_id gnl|my_center|LOCUS_24800 17905 17168 gene locus_tag LOCUS_24810 17905 17168 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362119.1 protein_id gnl|my_center|LOCUS_24810 18715 17921 gene locus_tag LOCUS_24820 18715 17921 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286455.1 protein_id gnl|my_center|LOCUS_24820 19849 18731 gene locus_tag LOCUS_24830 19849 18731 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286457.1 protein_id gnl|my_center|LOCUS_24830 20860 19937 gene locus_tag LOCUS_24840 20860 19937 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286461.1 protein_id gnl|my_center|LOCUS_24840 21640 20876 gene locus_tag LOCUS_24850 gene map 21640 20876 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356886.1 protein_id gnl|my_center|LOCUS_24850 21976 22419 gene locus_tag LOCUS_24860 21976 22419 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286465.1 protein_id gnl|my_center|LOCUS_24860 22532 23770 gene locus_tag LOCUS_24870 22532 23770 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286469.1 protein_id gnl|my_center|LOCUS_24870 23892 23817 gene locus_tag LOCUS_t00300 23892 23817 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25260 24082 gene locus_tag LOCUS_24880 25260 24082 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286608.1 protein_id gnl|my_center|LOCUS_24880 26270 25269 gene locus_tag LOCUS_24890 26270 25269 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355910.1 protein_id gnl|my_center|LOCUS_24890 27096 26365 gene locus_tag LOCUS_24900 gene sfsA 27096 26365 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002318601.1 protein_id gnl|my_center|LOCUS_24900 27330 27686 gene locus_tag LOCUS_24910 27330 27686 CDS product DUF4828 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355908.1 protein_id gnl|my_center|LOCUS_24910 29148 27712 gene locus_tag LOCUS_24920 29148 27712 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262483.1 protein_id gnl|my_center|LOCUS_24920 33640 29150 gene locus_tag LOCUS_24930 gene gltB 33640 29150 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279635.1 protein_id gnl|my_center|LOCUS_24930 33856 34503 gene locus_tag LOCUS_24940 33856 34503 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286616.1 protein_id gnl|my_center|LOCUS_24940 34624 36138 gene locus_tag LOCUS_24950 gene zwf 34624 36138 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355906.1 protein_id gnl|my_center|LOCUS_24950 39020 36234 gene locus_tag LOCUS_24960 gene ileS 39020 36234 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286621.1 protein_id gnl|my_center|LOCUS_24960 40029 39325 gene locus_tag LOCUS_24970 40029 39325 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286622.1 protein_id gnl|my_center|LOCUS_24970 40834 40052 gene locus_tag LOCUS_24980 40834 40052 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355903.1 protein_id gnl|my_center|LOCUS_24980 41122 40847 gene locus_tag LOCUS_24990 41122 40847 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355902.1 protein_id gnl|my_center|LOCUS_24990 41774 41136 gene locus_tag LOCUS_25000 41774 41136 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002393457.1 protein_id gnl|my_center|LOCUS_25000 42461 41784 gene locus_tag LOCUS_25010 42461 41784 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286628.1 protein_id gnl|my_center|LOCUS_25010 43714 42476 gene locus_tag LOCUS_25020 gene ftsZ 43714 42476 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286629.1 protein_id gnl|my_center|LOCUS_25020 45061 43736 gene locus_tag LOCUS_25030 gene ftsA 45061 43736 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286631.1 protein_id gnl|my_center|LOCUS_25030 46345 45227 gene locus_tag LOCUS_25040 46345 45227 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286633.1 protein_id gnl|my_center|LOCUS_25040 47440 46349 gene locus_tag LOCUS_25050 gene murG 47440 46349 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286637.1 protein_id gnl|my_center|LOCUS_25050 48814 47450 gene locus_tag LOCUS_25060 gene murD 48814 47450 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286638.1 protein_id gnl|my_center|LOCUS_25060 49791 48829 gene locus_tag LOCUS_25070 gene mraY 49791 48829 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286639.1 protein_id gnl|my_center|LOCUS_25070 51915 49807 gene locus_tag LOCUS_25080 51915 49807 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286640.1 protein_id gnl|my_center|LOCUS_25080 52374 51997 gene locus_tag LOCUS_25090 gene ftsL 52374 51997 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294542.1 protein_id gnl|my_center|LOCUS_25090 53333 52380 gene locus_tag LOCUS_25100 gene rsmH 53333 52380 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355891.1 protein_id gnl|my_center|LOCUS_25100 53780 53349 gene locus_tag LOCUS_25110 gene mraZ 53780 53349 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355890.1 protein_id gnl|my_center|LOCUS_25110 54320 53949 gene locus_tag LOCUS_25120 54320 53949 CDS product DUF3397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383401.1 protein_id gnl|my_center|LOCUS_25120 54681 54457 gene locus_tag LOCUS_25130 54681 54457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 56361 54691 gene locus_tag LOCUS_25140 gene recN 56361 54691 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286651.1 protein_id gnl|my_center|LOCUS_25140 56848 56390 gene locus_tag LOCUS_25150 56848 56390 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286653.1 protein_id gnl|my_center|LOCUS_25150 57679 56864 gene locus_tag LOCUS_25160 57679 56864 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364633.1 protein_id gnl|my_center|LOCUS_25160 58608 57724 gene locus_tag LOCUS_25170 58608 57724 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379200.1 protein_id gnl|my_center|LOCUS_25170 58829 58608 gene locus_tag LOCUS_25180 58829 58608 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286657.1 protein_id gnl|my_center|LOCUS_25180 60163 58829 gene locus_tag LOCUS_25190 gene xseA 60163 58829 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286658.1 protein_id gnl|my_center|LOCUS_25190 61036 60179 gene locus_tag LOCUS_25200 61036 60179 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286660.1 protein_id gnl|my_center|LOCUS_25200 61552 61094 gene locus_tag LOCUS_25210 gene nusB 61552 61094 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286662.1 protein_id gnl|my_center|LOCUS_25210 61970 61545 gene locus_tag LOCUS_25220 61970 61545 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286664.1 protein_id gnl|my_center|LOCUS_25220 62715 62158 gene locus_tag LOCUS_25230 gene efp 62715 62158 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722482.1 protein_id gnl|my_center|LOCUS_25230 63995 62931 gene locus_tag LOCUS_25240 63995 62931 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286665.1 protein_id gnl|my_center|LOCUS_25240 64354 64118 gene locus_tag LOCUS_25250 64354 64118 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286666.1 protein_id gnl|my_center|LOCUS_25250 65255 64554 gene locus_tag LOCUS_25260 65255 64554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 65410 65937 gene locus_tag LOCUS_25270 65410 65937 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287456.1 protein_id gnl|my_center|LOCUS_25270 66065 67270 gene locus_tag LOCUS_25280 66065 67270 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296013.1 protein_id gnl|my_center|LOCUS_25280 68064 67354 gene locus_tag LOCUS_25290 68064 67354 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131466.1 protein_id gnl|my_center|LOCUS_25290 68940 68128 gene locus_tag LOCUS_25300 68940 68128 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355995.1 protein_id gnl|my_center|LOCUS_25300 69544 68954 gene locus_tag LOCUS_25310 gene rsxA 69544 68954 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_25310 70221 69544 gene locus_tag LOCUS_25320 70221 69544 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869098.1 protein_id gnl|my_center|LOCUS_25320 70797 70234 gene locus_tag LOCUS_25330 70797 70234 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_25330 71735 70794 gene locus_tag LOCUS_25340 71735 70794 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_25340 73057 71732 gene locus_tag LOCUS_25350 gene rsxC 73057 71732 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_25350 74752 73388 gene locus_tag LOCUS_25360 74752 73388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 75466 76092 gene locus_tag LOCUS_25370 75466 76092 CDS product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355609.1 protein_id gnl|my_center|LOCUS_25370 76254 77270 gene locus_tag LOCUS_25380 76254 77270 CDS product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014525057.1 protein_id gnl|my_center|LOCUS_25380 77431 77955 gene locus_tag LOCUS_25390 77431 77955 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860885.1 protein_id gnl|my_center|LOCUS_25390 77982 78797 gene locus_tag LOCUS_25400 77982 78797 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272169.1 protein_id gnl|my_center|LOCUS_25400 78846 79268 gene locus_tag LOCUS_25410 78846 79268 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082839.1 protein_id gnl|my_center|LOCUS_25410 79382 79999 gene locus_tag LOCUS_25420 79382 79999 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771615.1 protein_id gnl|my_center|LOCUS_25420 80119 80796 gene locus_tag LOCUS_25430 80119 80796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 80979 81401 gene locus_tag LOCUS_25440 80979 81401 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026330850.1 protein_id gnl|my_center|LOCUS_25440 82042 81434 gene locus_tag LOCUS_25450 82042 81434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 82973 82596 gene locus_tag LOCUS_25460 82973 82596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 83437 82988 gene locus_tag LOCUS_25470 83437 82988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 84314 83595 gene locus_tag LOCUS_25480 84314 83595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 85770 84619 gene locus_tag LOCUS_25490 85770 84619 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130389.1 protein_id gnl|my_center|LOCUS_25490 86588 85791 gene locus_tag LOCUS_25500 86588 85791 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258428.1 protein_id gnl|my_center|LOCUS_25500 87463 86714 gene locus_tag LOCUS_25510 87463 86714 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824948.1 protein_id gnl|my_center|LOCUS_25510 87906 89150 gene locus_tag LOCUS_25520 87906 89150 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_25520 90265 89576 gene locus_tag LOCUS_25530 90265 89576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 90624 90271 gene locus_tag LOCUS_25540 90624 90271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359764.1 protein_id gnl|my_center|LOCUS_25540 91521 90640 gene locus_tag LOCUS_25550 91521 90640 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706541.1 protein_id gnl|my_center|LOCUS_25550 91892 91656 gene locus_tag LOCUS_25560 91892 91656 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287739.1 protein_id gnl|my_center|LOCUS_25560 92007 92780 gene locus_tag LOCUS_25570 92007 92780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287697.1 protein_id gnl|my_center|LOCUS_25570 93234 92833 gene locus_tag LOCUS_25580 93234 92833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287695.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence19 1550 66 gene locus_tag LOCUS_25590 1550 66 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321200.1 protein_id gnl|my_center|LOCUS_25590 2303 1602 gene locus_tag LOCUS_25600 2303 1602 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294273.1 protein_id gnl|my_center|LOCUS_25600 2709 2281 gene locus_tag LOCUS_25610 2709 2281 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297153.1 protein_id gnl|my_center|LOCUS_25610 3453 3025 gene locus_tag LOCUS_25620 gene msrB 3453 3025 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294252.1 protein_id gnl|my_center|LOCUS_25620 4166 3609 gene locus_tag LOCUS_25630 4166 3609 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294256.1 protein_id gnl|my_center|LOCUS_25630 6182 4182 gene locus_tag LOCUS_25640 gene mutL 6182 4182 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297134.1 protein_id gnl|my_center|LOCUS_25640 8759 6204 gene locus_tag LOCUS_25650 gene mutS 8759 6204 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378992.1 protein_id gnl|my_center|LOCUS_25650 9145 8759 gene locus_tag LOCUS_25660 9145 8759 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297137.1 protein_id gnl|my_center|LOCUS_25660 9955 9161 gene locus_tag LOCUS_25670 9955 9161 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297139.1 protein_id gnl|my_center|LOCUS_25670 11164 10088 gene locus_tag LOCUS_25680 11164 10088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 12275 11157 gene locus_tag LOCUS_25690 12275 11157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 13477 12698 gene locus_tag LOCUS_25700 13477 12698 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294261.1 protein_id gnl|my_center|LOCUS_25700 14131 13493 gene locus_tag LOCUS_25710 14131 13493 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297142.1 protein_id gnl|my_center|LOCUS_25710 14493 15104 gene locus_tag LOCUS_25720 gene rpsD 14493 15104 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294265.1 protein_id gnl|my_center|LOCUS_25720 15215 15448 gene locus_tag LOCUS_25730 15215 15448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 16070 15537 gene locus_tag LOCUS_25740 16070 15537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 16492 16109 gene locus_tag LOCUS_25750 16492 16109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 16705 16496 gene locus_tag LOCUS_25760 16705 16496 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009915104.1 protein_id gnl|my_center|LOCUS_25760 16887 17804 gene locus_tag LOCUS_25770 16887 17804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 18545 17841 gene locus_tag LOCUS_25780 18545 17841 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460538.1 protein_id gnl|my_center|LOCUS_25780 19471 18545 gene locus_tag LOCUS_25790 19471 18545 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986927.1 protein_id gnl|my_center|LOCUS_25790 20877 19849 gene locus_tag LOCUS_25800 20877 19849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 21137 21583 gene locus_tag LOCUS_25810 21137 21583 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816710.1 protein_id gnl|my_center|LOCUS_25810 22822 21608 gene locus_tag LOCUS_25820 22822 21608 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387329.1 protein_id gnl|my_center|LOCUS_25820 23498 22812 gene locus_tag LOCUS_25830 23498 22812 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365285.1 protein_id gnl|my_center|LOCUS_25830 24313 23495 gene locus_tag LOCUS_25840 24313 23495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 24594 25136 gene locus_tag LOCUS_25850 24594 25136 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354975.1 protein_id gnl|my_center|LOCUS_25850 25242 26399 gene locus_tag LOCUS_25860 25242 26399 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890730.1 protein_id gnl|my_center|LOCUS_25860 27306 26422 gene locus_tag LOCUS_25870 27306 26422 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285988.1 protein_id gnl|my_center|LOCUS_25870 28253 27354 gene locus_tag LOCUS_25880 28253 27354 CDS product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722257.1 protein_id gnl|my_center|LOCUS_25880 29128 28277 gene locus_tag LOCUS_25890 29128 28277 CDS product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989903.1 protein_id gnl|my_center|LOCUS_25890 30271 29186 gene locus_tag LOCUS_25900 30271 29186 CDS product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727867.1 protein_id gnl|my_center|LOCUS_25900 30837 30520 gene locus_tag LOCUS_25910 30837 30520 CDS product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722260.1 protein_id gnl|my_center|LOCUS_25910 31354 30860 gene locus_tag LOCUS_25920 31354 30860 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930923.1 protein_id gnl|my_center|LOCUS_25920 32825 31356 gene locus_tag LOCUS_25930 32825 31356 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989904.1 protein_id gnl|my_center|LOCUS_25930 33775 33149 gene locus_tag LOCUS_25940 33775 33149 CDS product DUF1054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359064.1 protein_id gnl|my_center|LOCUS_25940 34044 35051 gene locus_tag LOCUS_25950 34044 35051 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485388.1 protein_id gnl|my_center|LOCUS_25950 35266 35997 gene locus_tag LOCUS_25960 35266 35997 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290500.1 protein_id gnl|my_center|LOCUS_25960 36296 36051 gene locus_tag LOCUS_25970 36296 36051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 36591 36842 gene locus_tag LOCUS_25980 36591 36842 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290397.1 protein_id gnl|my_center|LOCUS_25980 36842 37159 gene locus_tag LOCUS_25990 36842 37159 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290394.1 protein_id gnl|my_center|LOCUS_25990 38840 37329 gene locus_tag LOCUS_26000 gene gltX 38840 37329 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254122.1 protein_id gnl|my_center|LOCUS_26000 40293 38917 gene locus_tag LOCUS_26010 40293 38917 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905870.1 protein_id gnl|my_center|LOCUS_26010 41807 40329 gene locus_tag LOCUS_26020 41807 40329 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549250.1 protein_id gnl|my_center|LOCUS_26020 42256 43764 gene locus_tag LOCUS_26030 42256 43764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 44783 44034 gene locus_tag LOCUS_26040 44783 44034 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287306.1 protein_id gnl|my_center|LOCUS_26040 46147 45194 gene locus_tag LOCUS_26050 46147 45194 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174124611.1 protein_id gnl|my_center|LOCUS_26050 46841 46227 gene locus_tag LOCUS_26060 46841 46227 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355114.1 protein_id gnl|my_center|LOCUS_26060 47893 47021 gene locus_tag LOCUS_26070 47893 47021 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111110.1 protein_id gnl|my_center|LOCUS_26070 48010 49020 gene locus_tag LOCUS_26080 48010 49020 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202433.1 protein_id gnl|my_center|LOCUS_26080 50235 49048 gene locus_tag LOCUS_26090 50235 49048 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379231.1 protein_id gnl|my_center|LOCUS_26090 51197 50445 gene locus_tag LOCUS_26100 51197 50445 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289259.1 protein_id gnl|my_center|LOCUS_26100 52003 51296 gene locus_tag LOCUS_26110 gene deoD 52003 51296 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289197.1 protein_id gnl|my_center|LOCUS_26110 52873 52055 gene locus_tag LOCUS_26120 52873 52055 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289198.1 protein_id gnl|my_center|LOCUS_26120 54071 52899 gene locus_tag LOCUS_26130 gene deoB 54071 52899 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289199.1 protein_id gnl|my_center|LOCUS_26130 55454 54501 gene locus_tag LOCUS_26140 55454 54501 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356172.1 protein_id gnl|my_center|LOCUS_26140 56584 55454 gene locus_tag LOCUS_26150 56584 55454 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383845.1 protein_id gnl|my_center|LOCUS_26150 58139 56577 gene locus_tag LOCUS_26160 58139 56577 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381361.1 protein_id gnl|my_center|LOCUS_26160 59423 58326 gene locus_tag LOCUS_26170 59423 58326 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356169.1 protein_id gnl|my_center|LOCUS_26170 59875 59483 gene locus_tag LOCUS_26180 59875 59483 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289205.1 protein_id gnl|my_center|LOCUS_26180 60555 59893 gene locus_tag LOCUS_26190 gene deoC 60555 59893 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289206.1 protein_id gnl|my_center|LOCUS_26190 61919 60618 gene locus_tag LOCUS_26200 61919 60618 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356165.1 protein_id gnl|my_center|LOCUS_26200 63075 62059 gene locus_tag LOCUS_26210 63075 62059 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294322.1 protein_id gnl|my_center|LOCUS_26210 63227 63598 gene locus_tag LOCUS_26220 63227 63598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565443.1 protein_id gnl|my_center|LOCUS_26220 63646 64413 gene locus_tag LOCUS_26230 63646 64413 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563775.1 protein_id gnl|my_center|LOCUS_26230 65763 64537 gene locus_tag LOCUS_26240 65763 64537 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815633.1 protein_id gnl|my_center|LOCUS_26240 66667 65804 gene locus_tag LOCUS_26250 66667 65804 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815634.1 protein_id gnl|my_center|LOCUS_26250 67492 66680 gene locus_tag LOCUS_26260 67492 66680 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165149.1 protein_id gnl|my_center|LOCUS_26260 68038 67550 gene locus_tag LOCUS_26270 68038 67550 CDS product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167379.1 protein_id gnl|my_center|LOCUS_26270 68453 68040 gene locus_tag LOCUS_26280 68453 68040 CDS product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245650.1 protein_id gnl|my_center|LOCUS_26280 69310 68510 gene locus_tag LOCUS_26290 69310 68510 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379285.1 protein_id gnl|my_center|LOCUS_26290 69988 69515 gene locus_tag LOCUS_26300 69988 69515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 70912 70046 gene locus_tag LOCUS_26310 70912 70046 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439096.1 protein_id gnl|my_center|LOCUS_26310 71993 71046 gene locus_tag LOCUS_26320 71993 71046 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815637.1 protein_id gnl|my_center|LOCUS_26320 72205 73326 gene locus_tag LOCUS_26330 72205 73326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404767.1 protein_id gnl|my_center|LOCUS_26330 73964 73365 gene locus_tag LOCUS_26340 73964 73365 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304012.1 protein_id gnl|my_center|LOCUS_26340 74550 73969 gene locus_tag LOCUS_26350 74550 73969 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356161.1 protein_id gnl|my_center|LOCUS_26350 75201 74605 gene locus_tag LOCUS_26360 75201 74605 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836848.1 protein_id gnl|my_center|LOCUS_26360 75580 76503 gene locus_tag LOCUS_26370 gene coaA 75580 76503 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288627.1 protein_id gnl|my_center|LOCUS_26370 76559 78127 gene locus_tag LOCUS_26380 gene guaA 76559 78127 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288629.1 protein_id gnl|my_center|LOCUS_26380 78651 79682 gene locus_tag LOCUS_26390 78651 79682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26390 79734 80492 gene locus_tag LOCUS_26400 79734 80492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 80703 80584 gene locus_tag LOCUS_26410 80703 80584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 81025 82395 gene locus_tag LOCUS_26420 81025 82395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26420 82603 83298 gene locus_tag LOCUS_26430 82603 83298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 85340 83448 gene locus_tag LOCUS_26440 85340 83448 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091102695.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26440 85644 85462 gene locus_tag LOCUS_26450 85644 85462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 86047 86322 gene locus_tag LOCUS_26460 86047 86322 CDS product CD3324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436543.1 protein_id gnl|my_center|LOCUS_26460 86484 86636 gene locus_tag LOCUS_26470 86484 86636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 87599 86739 gene locus_tag LOCUS_26480 87599 86739 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358647.1 protein_id gnl|my_center|LOCUS_26480 87786 88673 gene locus_tag LOCUS_26490 87786 88673 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355746.1 protein_id gnl|my_center|LOCUS_26490 88940 89575 gene locus_tag LOCUS_26500 88940 89575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 91648 89633 gene locus_tag LOCUS_26510 91648 89633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 92418 91666 gene locus_tag LOCUS_26520 92418 91666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 >Feature sequence20 423 722 gene locus_tag LOCUS_26530 423 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 1319 897 gene locus_tag LOCUS_26540 1319 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26540 1527 1333 gene locus_tag LOCUS_26550 1527 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 2624 1956 gene locus_tag LOCUS_26560 2624 1956 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296505.1 protein_id gnl|my_center|LOCUS_26560 3703 2807 gene locus_tag LOCUS_26570 3703 2807 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674382.1 protein_id gnl|my_center|LOCUS_26570 3965 3738 gene locus_tag LOCUS_26580 3965 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 4090 4779 gene locus_tag LOCUS_26590 4090 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 5146 4799 gene locus_tag LOCUS_26600 5146 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 5595 5525 gene locus_tag LOCUS_t00310 5595 5525 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5729 6067 gene locus_tag LOCUS_26610 5729 6067 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287745.1 protein_id gnl|my_center|LOCUS_26610 6786 6142 gene locus_tag LOCUS_26620 6786 6142 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287746.1 protein_id gnl|my_center|LOCUS_26620 6989 8908 gene locus_tag LOCUS_26630 6989 8908 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287747.1 protein_id gnl|my_center|LOCUS_26630 8976 9635 gene locus_tag LOCUS_26640 8976 9635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 10556 9918 gene locus_tag LOCUS_26650 10556 9918 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354907.1 protein_id gnl|my_center|LOCUS_26650 11650 10583 gene locus_tag LOCUS_26660 gene uxuA 11650 10583 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296654.1 protein_id gnl|my_center|LOCUS_26660 12115 11672 gene locus_tag LOCUS_26670 12115 11672 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354905.1 protein_id gnl|my_center|LOCUS_26670 13004 12132 gene locus_tag LOCUS_26680 13004 12132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 13545 13039 gene locus_tag LOCUS_26690 13545 13039 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354904.1 protein_id gnl|my_center|LOCUS_26690 14436 13567 gene locus_tag LOCUS_26700 14436 13567 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296647.1 protein_id gnl|my_center|LOCUS_26700 15302 14460 gene locus_tag LOCUS_26710 15302 14460 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296646.1 protein_id gnl|my_center|LOCUS_26710 16480 15377 gene locus_tag LOCUS_26720 16480 15377 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387385.1 protein_id gnl|my_center|LOCUS_26720 17493 16495 gene locus_tag LOCUS_26730 17493 16495 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387386.1 protein_id gnl|my_center|LOCUS_26730 17767 18627 gene locus_tag LOCUS_26740 17767 18627 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296639.1 protein_id gnl|my_center|LOCUS_26740 19409 18789 gene locus_tag LOCUS_26750 19409 18789 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244154.1 protein_id gnl|my_center|LOCUS_26750 21297 19402 gene locus_tag LOCUS_26760 21297 19402 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989614.1 protein_id gnl|my_center|LOCUS_26760 22794 21352 gene locus_tag LOCUS_26770 22794 21352 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930652.1 protein_id gnl|my_center|LOCUS_26770 23204 22863 gene locus_tag LOCUS_26780 23204 22863 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721484.1 protein_id gnl|my_center|LOCUS_26780 24508 23243 gene locus_tag LOCUS_26790 24508 23243 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721483.1 protein_id gnl|my_center|LOCUS_26790 24835 24512 gene locus_tag LOCUS_26800 24835 24512 CDS product PTS lactose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732400.1 protein_id gnl|my_center|LOCUS_26800 27630 24970 gene locus_tag LOCUS_26810 27630 24970 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476462.1 protein_id gnl|my_center|LOCUS_26810 29327 28206 gene locus_tag LOCUS_26820 29327 28206 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948743.1 protein_id gnl|my_center|LOCUS_26820 30112 29459 gene locus_tag LOCUS_26830 30112 29459 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485135.1 protein_id gnl|my_center|LOCUS_26830 30722 30162 gene locus_tag LOCUS_26840 gene hxlB 30722 30162 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246343.1 protein_id gnl|my_center|LOCUS_26840 31372 30737 gene locus_tag LOCUS_26850 gene hxlA 31372 30737 CDS product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776031.1 protein_id gnl|my_center|LOCUS_26850 32382 31390 gene locus_tag LOCUS_26860 32382 31390 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389095.1 protein_id gnl|my_center|LOCUS_26860 33038 32388 gene locus_tag LOCUS_26870 gene dhaL 33038 32388 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267780.1 protein_id gnl|my_center|LOCUS_26870 34201 33035 gene locus_tag LOCUS_26880 34201 33035 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476472.1 protein_id gnl|my_center|LOCUS_26880 34632 34201 gene locus_tag LOCUS_26890 34632 34201 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246714.1 protein_id gnl|my_center|LOCUS_26890 34960 34649 gene locus_tag LOCUS_26900 34960 34649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 36639 34978 gene locus_tag LOCUS_26910 gene mtlR 36639 34978 CDS product mannitol operon transcriptional activator MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246695.1 protein_id gnl|my_center|LOCUS_26910 38154 36703 gene locus_tag LOCUS_26920 38154 36703 CDS product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886406.1 protein_id gnl|my_center|LOCUS_26920 38343 38900 gene locus_tag LOCUS_26930 38343 38900 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116008.1 protein_id gnl|my_center|LOCUS_26930 39830 38964 gene locus_tag LOCUS_26940 gene fba 39830 38964 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392146.1 protein_id gnl|my_center|LOCUS_26940 40363 39824 gene locus_tag LOCUS_26950 40363 39824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 41829 40360 gene locus_tag LOCUS_26960 gene xylB 41829 40360 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082695.1 protein_id gnl|my_center|LOCUS_26960 42891 41848 gene locus_tag LOCUS_26970 42891 41848 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680926.1 protein_id gnl|my_center|LOCUS_26970 43732 42902 gene locus_tag LOCUS_26980 43732 42902 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476681.1 protein_id gnl|my_center|LOCUS_26980 44489 43725 gene locus_tag LOCUS_26990 44489 43725 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476682.1 protein_id gnl|my_center|LOCUS_26990 44983 44507 gene locus_tag LOCUS_27000 44983 44507 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426364.1 protein_id gnl|my_center|LOCUS_27000 45413 45000 gene locus_tag LOCUS_27010 45413 45000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 47548 45647 gene locus_tag LOCUS_27020 gene licR 47548 45647 CDS product transcriptional regulator LicR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243034.1 protein_id gnl|my_center|LOCUS_27020 48532 47696 gene locus_tag LOCUS_27030 48532 47696 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131785.1 protein_id gnl|my_center|LOCUS_27030 50466 48934 gene locus_tag LOCUS_27040 50466 48934 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113563.1 protein_id gnl|my_center|LOCUS_27040 51859 50459 gene locus_tag LOCUS_27050 51859 50459 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001304938.1 protein_id gnl|my_center|LOCUS_27050 52148 51861 gene locus_tag LOCUS_27060 52148 51861 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041396.1 protein_id gnl|my_center|LOCUS_27060 52643 52161 gene locus_tag LOCUS_27070 52643 52161 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892531.1 protein_id gnl|my_center|LOCUS_27070 53494 52646 gene locus_tag LOCUS_27080 53494 52646 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131785.1 protein_id gnl|my_center|LOCUS_27080 54238 53498 gene locus_tag LOCUS_27090 54238 53498 CDS product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296489.1 protein_id gnl|my_center|LOCUS_27090 55710 54598 gene locus_tag LOCUS_27100 55710 54598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 56812 56000 gene locus_tag LOCUS_27110 gene bltR 56812 56000 CDS product multidrug efflux transcriptional regulator BltR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229881.1 protein_id gnl|my_center|LOCUS_27110 56939 57634 gene locus_tag LOCUS_27120 56939 57634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 58751 57681 gene locus_tag LOCUS_27130 58751 57681 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287033.1 protein_id gnl|my_center|LOCUS_27130 59593 58748 gene locus_tag LOCUS_27140 59593 58748 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287036.1 protein_id gnl|my_center|LOCUS_27140 60399 59590 gene locus_tag LOCUS_27150 60399 59590 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287038.1 protein_id gnl|my_center|LOCUS_27150 61503 60415 gene locus_tag LOCUS_27160 61503 60415 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356508.1 protein_id gnl|my_center|LOCUS_27160 62067 61525 gene locus_tag LOCUS_27170 62067 61525 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356507.1 protein_id gnl|my_center|LOCUS_27170 62568 63563 gene locus_tag LOCUS_27180 62568 63563 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287041.1 protein_id gnl|my_center|LOCUS_27180 63560 64285 gene locus_tag LOCUS_27190 63560 64285 CDS product phosphopantothenate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287044.1 protein_id gnl|my_center|LOCUS_27190 64282 64824 gene locus_tag LOCUS_27200 gene coaC 64282 64824 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359573.1 protein_id gnl|my_center|LOCUS_27200 64828 65451 gene locus_tag LOCUS_27210 64828 65451 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287046.1 protein_id gnl|my_center|LOCUS_27210 66450 65497 gene locus_tag LOCUS_27220 gene murB 66450 65497 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287058.1 protein_id gnl|my_center|LOCUS_27220 67402 66491 gene locus_tag LOCUS_27230 67402 66491 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287059.1 protein_id gnl|my_center|LOCUS_27230 67518 68273 gene locus_tag LOCUS_27240 67518 68273 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387194.1 protein_id gnl|my_center|LOCUS_27240 68350 68883 gene locus_tag LOCUS_27250 68350 68883 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291442.1 protein_id gnl|my_center|LOCUS_27250 69426 68905 gene locus_tag LOCUS_27260 69426 68905 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287063.1 protein_id gnl|my_center|LOCUS_27260 69890 69423 gene locus_tag LOCUS_27270 gene tsaE 69890 69423 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002395673.1 protein_id gnl|my_center|LOCUS_27270 70514 70050 gene locus_tag LOCUS_27280 70514 70050 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289250.1 protein_id gnl|my_center|LOCUS_27280 70969 70517 gene locus_tag LOCUS_27290 70969 70517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 71786 71007 gene locus_tag LOCUS_27300 gene glvR 71786 71007 CDS product MurR/RpiR family transcriptional regulator GlvR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233607.1 protein_id gnl|my_center|LOCUS_27300 73182 71851 gene locus_tag LOCUS_27310 73182 71851 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963854.1 protein_id gnl|my_center|LOCUS_27310 74791 73202 gene locus_tag LOCUS_27320 gene malP 74791 73202 CDS product PTS maltose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233606.1 protein_id gnl|my_center|LOCUS_27320 76026 75046 gene locus_tag LOCUS_27330 gene pta 76026 75046 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320882.1 protein_id gnl|my_center|LOCUS_27330 76865 76185 gene locus_tag LOCUS_27340 76865 76185 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287070.1 protein_id gnl|my_center|LOCUS_27340 77073 77897 gene locus_tag LOCUS_27350 77073 77897 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287072.1 protein_id gnl|my_center|LOCUS_27350 77924 78445 gene locus_tag LOCUS_27360 77924 78445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287073.1 protein_id gnl|my_center|LOCUS_27360 79088 78507 gene locus_tag LOCUS_27370 79088 78507 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287074.1 protein_id gnl|my_center|LOCUS_27370 79290 80357 gene locus_tag LOCUS_27380 79290 80357 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675020.1 protein_id gnl|my_center|LOCUS_27380 80682 81149 gene locus_tag LOCUS_27390 80682 81149 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948558.1 protein_id gnl|my_center|LOCUS_27390 81139 81585 gene locus_tag LOCUS_27400 81139 81585 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966715.1 protein_id gnl|my_center|LOCUS_27400 84370 81632 gene locus_tag LOCUS_27410 gene mgtA 84370 81632 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296188.1 protein_id gnl|my_center|LOCUS_27410 84914 84486 gene locus_tag LOCUS_27420 84914 84486 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331629.1 protein_id gnl|my_center|LOCUS_27420 87941 85524 gene locus_tag LOCUS_27430 87941 85524 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317658.1 protein_id gnl|my_center|LOCUS_27430 88171 89322 gene locus_tag LOCUS_27440 88171 89322 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361740.1 protein_id gnl|my_center|LOCUS_27440 89801 90250 gene locus_tag LOCUS_27450 gene nrdI 89801 90250 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382293.1 protein_id gnl|my_center|LOCUS_27450 90337 91242 gene locus_tag LOCUS_27460 90337 91242 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100973.1 protein_id gnl|my_center|LOCUS_27460 >Feature sequence21 397 92 gene locus_tag LOCUS_27470 397 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27470 1530 1063 gene locus_tag LOCUS_27480 1530 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 1614 2336 gene locus_tag LOCUS_27490 1614 2336 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948077.1 protein_id gnl|my_center|LOCUS_27490 3707 2337 gene locus_tag LOCUS_27500 3707 2337 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101332.1 protein_id gnl|my_center|LOCUS_27500 4609 3710 gene locus_tag LOCUS_27510 gene gnd 4609 3710 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592805.1 protein_id gnl|my_center|LOCUS_27510 6025 4694 gene locus_tag LOCUS_27520 6025 4694 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948079.1 protein_id gnl|my_center|LOCUS_27520 7641 6028 gene locus_tag LOCUS_27530 7641 6028 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986061.1 protein_id gnl|my_center|LOCUS_27530 8916 7822 gene locus_tag LOCUS_27540 8916 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 10151 9150 gene locus_tag LOCUS_27550 10151 9150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 10587 10321 gene locus_tag LOCUS_27560 10587 10321 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290330.1 protein_id gnl|my_center|LOCUS_27560 11981 10686 gene locus_tag LOCUS_27570 gene rho 11981 10686 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290332.1 protein_id gnl|my_center|LOCUS_27570 13252 11981 gene locus_tag LOCUS_27580 13252 11981 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357969.1 protein_id gnl|my_center|LOCUS_27580 14737 13661 gene locus_tag LOCUS_27590 14737 13661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 16067 15198 gene locus_tag LOCUS_27600 16067 15198 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357972.1 protein_id gnl|my_center|LOCUS_27600 17858 16248 gene locus_tag LOCUS_27610 17858 16248 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286999.1 protein_id gnl|my_center|LOCUS_27610 18497 18048 gene locus_tag LOCUS_27620 18497 18048 CDS product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287902.1 protein_id gnl|my_center|LOCUS_27620 18731 20350 gene locus_tag LOCUS_27630 18731 20350 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002396652.1 protein_id gnl|my_center|LOCUS_27630 21120 20416 gene locus_tag LOCUS_27640 21120 20416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 22703 21390 gene locus_tag LOCUS_27650 gene eno 22703 21390 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357098.1 protein_id gnl|my_center|LOCUS_27650 23575 22820 gene locus_tag LOCUS_27660 gene tpiA 23575 22820 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292815.1 protein_id gnl|my_center|LOCUS_27660 24914 23724 gene locus_tag LOCUS_27670 24914 23724 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295135.1 protein_id gnl|my_center|LOCUS_27670 26064 25063 gene locus_tag LOCUS_27680 gene gap 26064 25063 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292818.1 protein_id gnl|my_center|LOCUS_27680 27143 26100 gene locus_tag LOCUS_27690 27143 26100 CDS product central glycolytic genes regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321448.1 protein_id gnl|my_center|LOCUS_27690 28620 27319 gene locus_tag LOCUS_27700 gene rpoN 28620 27319 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295132.1 protein_id gnl|my_center|LOCUS_27700 28672 28745 gene locus_tag LOCUS_t00320 28672 28745 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 30153 28894 gene locus_tag LOCUS_27710 30153 28894 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289099.1 protein_id gnl|my_center|LOCUS_27710 30883 30275 gene locus_tag LOCUS_27720 gene rpoE 30883 30275 CDS product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304561.1 protein_id gnl|my_center|LOCUS_27720 31391 30957 gene locus_tag LOCUS_27730 31391 30957 CDS product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295125.1 protein_id gnl|my_center|LOCUS_27730 31534 32346 gene locus_tag LOCUS_27740 31534 32346 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390086.1 protein_id gnl|my_center|LOCUS_27740 32336 33685 gene locus_tag LOCUS_27750 32336 33685 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304556.1 protein_id gnl|my_center|LOCUS_27750 34151 33708 gene locus_tag LOCUS_27760 34151 33708 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132021.1 protein_id gnl|my_center|LOCUS_27760 34289 34657 gene locus_tag LOCUS_27770 34289 34657 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002327753.1 protein_id gnl|my_center|LOCUS_27770 36111 34750 gene locus_tag LOCUS_27780 36111 34750 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304549.1 protein_id gnl|my_center|LOCUS_27780 36777 36145 gene locus_tag LOCUS_27790 36777 36145 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295103.1 protein_id gnl|my_center|LOCUS_27790 38158 36782 gene locus_tag LOCUS_27800 38158 36782 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292842.1 protein_id gnl|my_center|LOCUS_27800 39932 38151 gene locus_tag LOCUS_27810 39932 38151 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295101.1 protein_id gnl|my_center|LOCUS_27810 40257 39946 gene locus_tag LOCUS_27820 40257 39946 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292844.1 protein_id gnl|my_center|LOCUS_27820 41242 40247 gene locus_tag LOCUS_27830 41242 40247 CDS product V-type ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304547.1 protein_id gnl|my_center|LOCUS_27830 41884 41300 gene locus_tag LOCUS_27840 41884 41300 CDS product V-type sodium ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296452.1 protein_id gnl|my_center|LOCUS_27840 42506 42036 gene locus_tag LOCUS_27850 42506 42036 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292848.1 protein_id gnl|my_center|LOCUS_27850 44486 42525 gene locus_tag LOCUS_27860 44486 42525 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296453.1 protein_id gnl|my_center|LOCUS_27860 44796 44476 gene locus_tag LOCUS_27870 44796 44476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 45113 45835 gene locus_tag LOCUS_27880 45113 45835 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358005.1 protein_id gnl|my_center|LOCUS_27880 45994 46671 gene locus_tag LOCUS_27890 45994 46671 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357457.1 protein_id gnl|my_center|LOCUS_27890 46673 47944 gene locus_tag LOCUS_27900 46673 47944 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357458.1 protein_id gnl|my_center|LOCUS_27900 49438 47990 gene locus_tag LOCUS_27910 49438 47990 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666065.1 protein_id gnl|my_center|LOCUS_27910 50446 49631 gene locus_tag LOCUS_27920 50446 49631 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706576.1 protein_id gnl|my_center|LOCUS_27920 51778 50519 gene locus_tag LOCUS_27930 51778 50519 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357698.1 protein_id gnl|my_center|LOCUS_27930 52670 51771 gene locus_tag LOCUS_27940 52670 51771 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295091.1 protein_id gnl|my_center|LOCUS_27940 53146 52682 gene locus_tag LOCUS_27950 53146 52682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 53349 53143 gene locus_tag LOCUS_27960 53349 53143 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002927075.1 protein_id gnl|my_center|LOCUS_27960 55213 53438 gene locus_tag LOCUS_27970 gene uvrC 55213 53438 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357701.1 protein_id gnl|my_center|LOCUS_27970 55770 55456 gene locus_tag LOCUS_27980 gene trxA 55770 55456 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290803.1 protein_id gnl|my_center|LOCUS_27980 58247 55887 gene locus_tag LOCUS_27990 58247 55887 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296458.1 protein_id gnl|my_center|LOCUS_27990 58856 58308 gene locus_tag LOCUS_28000 58856 58308 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295088.1 protein_id gnl|my_center|LOCUS_28000 59303 58869 gene locus_tag LOCUS_28010 gene zapA 59303 58869 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357706.1 protein_id gnl|my_center|LOCUS_28010 59438 60340 gene locus_tag LOCUS_28020 gene rnhC 59438 60340 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295085.1 protein_id gnl|my_center|LOCUS_28020 61575 60385 gene locus_tag LOCUS_28030 61575 60385 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436463.1 protein_id gnl|my_center|LOCUS_28030 63139 61682 gene locus_tag LOCUS_28040 63139 61682 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387328.1 protein_id gnl|my_center|LOCUS_28040 64012 63353 gene locus_tag LOCUS_28050 64012 63353 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002347025.1 protein_id gnl|my_center|LOCUS_28050 64875 64012 gene locus_tag LOCUS_28060 64875 64012 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295916.1 protein_id gnl|my_center|LOCUS_28060 66161 65058 gene locus_tag LOCUS_28070 66161 65058 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296473.1 protein_id gnl|my_center|LOCUS_28070 67219 66776 gene locus_tag LOCUS_28080 67219 66776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 67916 67224 gene locus_tag LOCUS_28090 67916 67224 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073934.1 protein_id gnl|my_center|LOCUS_28090 68354 68118 gene locus_tag LOCUS_28100 68354 68118 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287739.1 protein_id gnl|my_center|LOCUS_28100 68468 69241 gene locus_tag LOCUS_28110 68468 69241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287697.1 protein_id gnl|my_center|LOCUS_28110 69498 69722 gene locus_tag LOCUS_28120 69498 69722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28120 73404 69952 gene locus_tag LOCUS_28130 73404 69952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 74060 73488 gene locus_tag LOCUS_28140 74060 73488 CDS product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079938.1 protein_id gnl|my_center|LOCUS_28140 75130 74336 gene locus_tag LOCUS_28150 gene aph(3')-IIIa 75130 74336 CDS product aminoglycoside O-phosphotransferase APH(3')-IIIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096887.1 protein_id gnl|my_center|LOCUS_28150 75765 75223 gene locus_tag LOCUS_28160 gene sat4 75765 75223 CDS product streptothricin N-acetyltransferase Sat4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627290.1 protein_id gnl|my_center|LOCUS_28160 76670 75762 gene locus_tag LOCUS_28170 gene ant(6) 76670 75762 CDS product aminoglycoside nucleotidyltransferase ANT(6)-Ia inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255866.1 protein_id gnl|my_center|LOCUS_28170 77437 76703 gene locus_tag LOCUS_28180 77437 76703 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662263.1 protein_id gnl|my_center|LOCUS_28180 78287 77418 gene locus_tag LOCUS_28190 78287 77418 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228166.1 protein_id gnl|my_center|LOCUS_28190 78635 78390 gene locus_tag LOCUS_28200 78635 78390 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567888.1 protein_id gnl|my_center|LOCUS_28200 79336 78662 gene locus_tag LOCUS_28210 79336 78662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 79557 80852 gene locus_tag LOCUS_28220 79557 80852 CDS product ISL3-like element ISEfa5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297185.1 protein_id gnl|my_center|LOCUS_28220 >Feature sequence22 482 2491 gene locus_tag LOCUS_28230 gene metG 482 2491 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289325.1 protein_id gnl|my_center|LOCUS_28230 3250 2537 gene locus_tag LOCUS_28240 3250 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943785.1 protein_id gnl|my_center|LOCUS_28240 3947 3234 gene locus_tag LOCUS_28250 3947 3234 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454384.1 protein_id gnl|my_center|LOCUS_28250 4801 3944 gene locus_tag LOCUS_28260 4801 3944 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459427.1 protein_id gnl|my_center|LOCUS_28260 5391 4804 gene locus_tag LOCUS_28270 5391 4804 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813921.1 protein_id gnl|my_center|LOCUS_28270 5568 5873 gene locus_tag LOCUS_28280 5568 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321681.1 protein_id gnl|my_center|LOCUS_28280 6822 10976 gene locus_tag LOCUS_28290 6822 10976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 10973 12448 gene locus_tag LOCUS_28300 gene ebpB 10973 12448 CDS product endocarditis and biofilm-associated pilus minor subunit EbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379309.1 protein_id gnl|my_center|LOCUS_28300 12453 14357 gene locus_tag LOCUS_28310 12453 14357 CDS product SpaA isopeptide-forming pilin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390106.1 protein_id gnl|my_center|LOCUS_28310 14374 15225 gene locus_tag LOCUS_28320 14374 15225 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286052.1 protein_id gnl|my_center|LOCUS_28320 15305 15454 gene locus_tag LOCUS_28330 15305 15454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 15624 15887 gene locus_tag LOCUS_28340 15624 15887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 16770 16258 gene locus_tag LOCUS_28350 16770 16258 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163283.1 protein_id gnl|my_center|LOCUS_28350 16897 17748 gene locus_tag LOCUS_28360 16897 17748 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069751.1 protein_id gnl|my_center|LOCUS_28360 18085 18927 gene locus_tag LOCUS_28370 18085 18927 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002327764.1 protein_id gnl|my_center|LOCUS_28370 19062 20969 gene locus_tag LOCUS_28380 19062 20969 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861819.1 protein_id gnl|my_center|LOCUS_28380 21931 21014 gene locus_tag LOCUS_28390 21931 21014 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289172.1 protein_id gnl|my_center|LOCUS_28390 22150 23541 gene locus_tag LOCUS_28400 22150 23541 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289176.1 protein_id gnl|my_center|LOCUS_28400 23563 24996 gene locus_tag LOCUS_28410 23563 24996 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002375743.1 protein_id gnl|my_center|LOCUS_28410 25645 28911 gene locus_tag LOCUS_28420 gene ebpA 25645 28911 CDS product endocarditis and biofilm-associated pilus tip protein EbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154080969.1 protein_id gnl|my_center|LOCUS_28420 29335 32601 gene locus_tag LOCUS_28430 29335 32601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 34064 35557 gene locus_tag LOCUS_28440 34064 35557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 35970 36692 gene locus_tag LOCUS_28450 35970 36692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 36704 38389 gene locus_tag LOCUS_28460 36704 38389 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674873.1 protein_id gnl|my_center|LOCUS_28460 38906 42775 gene locus_tag LOCUS_28470 38906 42775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 42775 43542 gene locus_tag LOCUS_28480 42775 43542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 43532 45124 gene locus_tag LOCUS_28490 43532 45124 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674873.1 protein_id gnl|my_center|LOCUS_28490 45658 45233 gene locus_tag LOCUS_28500 45658 45233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 46143 45949 gene locus_tag LOCUS_28510 46143 45949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 46732 46088 gene locus_tag LOCUS_28520 46732 46088 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797128.1 protein_id gnl|my_center|LOCUS_28520 47341 47108 gene locus_tag LOCUS_28530 47341 47108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 47802 47650 gene locus_tag LOCUS_28540 47802 47650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 48120 47890 gene locus_tag LOCUS_28550 48120 47890 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296663.1 protein_id gnl|my_center|LOCUS_28550 48683 48372 gene locus_tag LOCUS_28560 48683 48372 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989541.1 protein_id gnl|my_center|LOCUS_28560 49263 48820 gene locus_tag LOCUS_28570 49263 48820 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966756.1 protein_id gnl|my_center|LOCUS_28570 50265 49588 gene locus_tag LOCUS_28580 50265 49588 CDS product HXXEE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836486.1 protein_id gnl|my_center|LOCUS_28580 50759 50526 gene locus_tag LOCUS_28590 50759 50526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 51449 51153 gene locus_tag LOCUS_28600 51449 51153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 51913 51605 gene locus_tag LOCUS_28610 51913 51605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717610.1 protein_id gnl|my_center|LOCUS_28610 52591 52007 gene locus_tag LOCUS_28620 52591 52007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714111.1 protein_id gnl|my_center|LOCUS_28620 53242 52934 gene locus_tag LOCUS_28630 53242 52934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717610.1 protein_id gnl|my_center|LOCUS_28630 54640 53990 gene locus_tag LOCUS_28640 gene catA 54640 53990 CDS product type A-8 chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143686.1 protein_id gnl|my_center|LOCUS_28640 55290 56750 gene locus_tag LOCUS_28650 55290 56750 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989613.1 protein_id gnl|my_center|LOCUS_28650 56969 58489 gene locus_tag LOCUS_28660 56969 58489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 58813 62049 gene locus_tag LOCUS_28670 58813 62049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 62624 64117 gene locus_tag LOCUS_28680 62624 64117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 64864 64268 gene locus_tag LOCUS_28690 64864 64268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293998.1 protein_id gnl|my_center|LOCUS_28690 65079 65885 gene locus_tag LOCUS_28700 65079 65885 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097421.1 protein_id gnl|my_center|LOCUS_28700 66056 66832 gene locus_tag LOCUS_28710 66056 66832 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294001.1 protein_id gnl|my_center|LOCUS_28710 66825 67388 gene locus_tag LOCUS_28720 gene rnmV 66825 67388 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358848.1 protein_id gnl|my_center|LOCUS_28720 67385 68257 gene locus_tag LOCUS_28730 gene rsmA 67385 68257 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358849.1 protein_id gnl|my_center|LOCUS_28730 68375 69529 gene locus_tag LOCUS_28740 68375 69529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 70453 69635 gene locus_tag LOCUS_28750 70453 69635 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289254.1 protein_id gnl|my_center|LOCUS_28750 70600 71283 gene locus_tag LOCUS_28760 70600 71283 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358533.1 protein_id gnl|my_center|LOCUS_28760 71346 72848 gene locus_tag LOCUS_28770 71346 72848 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289252.1 protein_id gnl|my_center|LOCUS_28770 72872 73342 gene locus_tag LOCUS_28780 72872 73342 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289250.1 protein_id gnl|my_center|LOCUS_28780 74012 73392 gene locus_tag LOCUS_28790 74012 73392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 75216 73996 gene locus_tag LOCUS_28800 75216 73996 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861862.1 protein_id gnl|my_center|LOCUS_28800 75922 75218 gene locus_tag LOCUS_28810 75922 75218 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433732.1 protein_id gnl|my_center|LOCUS_28810 76260 77534 gene locus_tag LOCUS_28820 76260 77534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 >Feature sequence23 1105 542 gene locus_tag LOCUS_28830 1105 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 1821 1360 gene locus_tag LOCUS_28840 1821 1360 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289439.1 protein_id gnl|my_center|LOCUS_28840 2479 1823 gene locus_tag LOCUS_28850 2479 1823 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229807.1 protein_id gnl|my_center|LOCUS_28850 3591 2659 gene locus_tag LOCUS_28860 3591 2659 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289436.1 protein_id gnl|my_center|LOCUS_28860 4210 4902 gene locus_tag LOCUS_28870 4210 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 6082 4889 gene locus_tag LOCUS_28880 6082 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 7020 6076 gene locus_tag LOCUS_28890 7020 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 8192 7242 gene locus_tag LOCUS_28900 8192 7242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 8609 10072 gene locus_tag LOCUS_28910 8609 10072 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751387.1 protein_id gnl|my_center|LOCUS_28910 11009 10410 gene locus_tag LOCUS_28920 11009 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 11429 12145 gene locus_tag LOCUS_28930 11429 12145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 12440 12649 gene locus_tag LOCUS_28940 12440 12649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 12663 12875 gene locus_tag LOCUS_28950 12663 12875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 12943 13326 gene locus_tag LOCUS_28960 12943 13326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 13372 13995 gene locus_tag LOCUS_28970 13372 13995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 14244 14056 gene locus_tag LOCUS_28980 14244 14056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 14383 14925 gene locus_tag LOCUS_28990 14383 14925 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765622.1 protein_id gnl|my_center|LOCUS_28990 15041 15373 gene locus_tag LOCUS_29000 15041 15373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475559.1 protein_id gnl|my_center|LOCUS_29000 15412 15966 gene locus_tag LOCUS_29010 15412 15966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 16156 17181 gene locus_tag LOCUS_29020 16156 17181 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288292.1 protein_id gnl|my_center|LOCUS_29020 17354 17998 gene locus_tag LOCUS_29030 17354 17998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 17999 18202 gene locus_tag LOCUS_29040 17999 18202 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423163.1 protein_id gnl|my_center|LOCUS_29040 20936 18246 gene locus_tag LOCUS_29050 20936 18246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 21176 22018 gene locus_tag LOCUS_29060 gene pgoN 21176 22018 CDS product glyoxal/methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243374.1 protein_id gnl|my_center|LOCUS_29060 22532 22182 gene locus_tag LOCUS_29070 22532 22182 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370162.1 protein_id gnl|my_center|LOCUS_29070 22758 22525 gene locus_tag LOCUS_29080 22758 22525 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370161.1 protein_id gnl|my_center|LOCUS_29080 23962 22931 gene locus_tag LOCUS_29090 23962 22931 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287486.1 protein_id gnl|my_center|LOCUS_29090 24645 23989 gene locus_tag LOCUS_29100 gene frxA 24645 23989 CDS product NAD(P)H-dependent flavin oxidoreductase FrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373527.1 protein_id gnl|my_center|LOCUS_29100 24869 25237 gene locus_tag LOCUS_29110 24869 25237 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644291.1 protein_id gnl|my_center|LOCUS_29110 25563 26951 gene locus_tag LOCUS_29120 25563 26951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 27708 26986 gene locus_tag LOCUS_29130 27708 26986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 27864 28664 gene locus_tag LOCUS_29140 27864 28664 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288811.1 protein_id gnl|my_center|LOCUS_29140 28700 30280 gene locus_tag LOCUS_29150 28700 30280 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966695.1 protein_id gnl|my_center|LOCUS_29150 30316 31641 gene locus_tag LOCUS_29160 30316 31641 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160113.1 protein_id gnl|my_center|LOCUS_29160 32709 31741 gene locus_tag LOCUS_29170 32709 31741 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810614.1 protein_id gnl|my_center|LOCUS_29170 33959 32790 gene locus_tag LOCUS_29180 33959 32790 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887601.1 protein_id gnl|my_center|LOCUS_29180 34297 34689 gene locus_tag LOCUS_29190 34297 34689 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355126.1 protein_id gnl|my_center|LOCUS_29190 34682 36412 gene locus_tag LOCUS_29200 34682 36412 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721531.1 protein_id gnl|my_center|LOCUS_29200 36402 38045 gene locus_tag LOCUS_29210 36402 38045 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932493.1 protein_id gnl|my_center|LOCUS_29210 38209 38862 gene locus_tag LOCUS_29220 38209 38862 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674956.1 protein_id gnl|my_center|LOCUS_29220 39093 40226 gene locus_tag LOCUS_29230 gene wecB 39093 40226 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365185.1 protein_id gnl|my_center|LOCUS_29230 40239 41105 gene locus_tag LOCUS_29240 40239 41105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 41255 42571 gene locus_tag LOCUS_29250 41255 42571 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267735.1 protein_id gnl|my_center|LOCUS_29250 42583 43701 gene locus_tag LOCUS_29260 42583 43701 CDS product glycosyl hydrolase family 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267197.1 protein_id gnl|my_center|LOCUS_29260 44637 43786 gene locus_tag LOCUS_29270 44637 43786 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547285.1 protein_id gnl|my_center|LOCUS_29270 45281 44727 gene locus_tag LOCUS_29280 45281 44727 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262592.1 protein_id gnl|my_center|LOCUS_29280 45574 45299 gene locus_tag LOCUS_29290 45574 45299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29290 45892 45584 gene locus_tag LOCUS_29300 45892 45584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 46708 46022 gene locus_tag LOCUS_29310 46708 46022 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359858.1 protein_id gnl|my_center|LOCUS_29310 47330 46734 gene locus_tag LOCUS_29320 47330 46734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 47403 48008 gene locus_tag LOCUS_29330 47403 48008 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722300.1 protein_id gnl|my_center|LOCUS_29330 48469 49308 gene locus_tag LOCUS_29340 48469 49308 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361212.1 protein_id gnl|my_center|LOCUS_29340 50180 49410 gene locus_tag LOCUS_29350 50180 49410 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358536.1 protein_id gnl|my_center|LOCUS_29350 51220 50177 gene locus_tag LOCUS_29360 51220 50177 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370914.1 protein_id gnl|my_center|LOCUS_29360 52844 51387 gene locus_tag LOCUS_29370 52844 51387 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679996.1 protein_id gnl|my_center|LOCUS_29370 53537 52845 gene locus_tag LOCUS_29380 53537 52845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 54154 53549 gene locus_tag LOCUS_29390 54154 53549 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054303.1 protein_id gnl|my_center|LOCUS_29390 55917 54178 gene locus_tag LOCUS_29400 55917 54178 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006301633.1 protein_id gnl|my_center|LOCUS_29400 57667 55919 gene locus_tag LOCUS_29410 57667 55919 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107303.1 protein_id gnl|my_center|LOCUS_29410 58101 57895 gene locus_tag LOCUS_29420 58101 57895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 59555 58035 gene locus_tag LOCUS_29430 59555 58035 CDS product zinc ABC transporter substrate-binding protein AdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387410.1 protein_id gnl|my_center|LOCUS_29430 60608 59901 gene locus_tag LOCUS_29440 60608 59901 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774183.1 protein_id gnl|my_center|LOCUS_29440 62017 60884 gene locus_tag LOCUS_29450 62017 60884 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_29450 62439 64022 gene locus_tag LOCUS_29460 62439 64022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 >Feature sequence24 1143 937 gene locus_tag LOCUS_29470 1143 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 1418 3439 gene locus_tag LOCUS_29480 1418 3439 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460906.1 protein_id gnl|my_center|LOCUS_29480 3527 4972 gene locus_tag LOCUS_29490 3527 4972 CDS product IS1182-like element ISEfa7 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748808.1 protein_id gnl|my_center|LOCUS_29490 5129 5515 gene locus_tag LOCUS_29500 5129 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 5542 6000 gene locus_tag LOCUS_29510 5542 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 6017 6295 gene locus_tag LOCUS_29520 6017 6295 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815795.1 protein_id gnl|my_center|LOCUS_29520 6307 7680 gene locus_tag LOCUS_29530 gene sgcC 6307 7680 CDS product PTS sugar transporter subunit IIC SgcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460843.1 protein_id gnl|my_center|LOCUS_29530 7700 8710 gene locus_tag LOCUS_29540 7700 8710 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033831.1 protein_id gnl|my_center|LOCUS_29540 8726 9901 gene locus_tag LOCUS_29550 8726 9901 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074782808.1 protein_id gnl|my_center|LOCUS_29550 10264 10443 gene locus_tag LOCUS_29560 10264 10443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 10763 11191 gene locus_tag LOCUS_29570 10763 11191 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048604071.1 protein_id gnl|my_center|LOCUS_29570 11178 11420 gene locus_tag LOCUS_29580 11178 11420 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288964.1 protein_id gnl|my_center|LOCUS_29580 11856 12164 gene locus_tag LOCUS_29590 11856 12164 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002300928.1 protein_id gnl|my_center|LOCUS_29590 12269 13447 gene locus_tag LOCUS_29600 12269 13447 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288969.1 protein_id gnl|my_center|LOCUS_29600 14303 13698 gene locus_tag LOCUS_29610 14303 13698 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775494.1 protein_id gnl|my_center|LOCUS_29610 14468 15169 gene locus_tag LOCUS_29620 14468 15169 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293839.1 protein_id gnl|my_center|LOCUS_29620 15339 16688 gene locus_tag LOCUS_29630 15339 16688 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358780.1 protein_id gnl|my_center|LOCUS_29630 16732 17019 gene locus_tag LOCUS_29640 16732 17019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 17016 18104 gene locus_tag LOCUS_29650 17016 18104 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379152.1 protein_id gnl|my_center|LOCUS_29650 18113 19219 gene locus_tag LOCUS_29660 18113 19219 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774176.1 protein_id gnl|my_center|LOCUS_29660 19209 20303 gene locus_tag LOCUS_29670 19209 20303 CDS product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706694.1 protein_id gnl|my_center|LOCUS_29670 20316 21056 gene locus_tag LOCUS_29680 20316 21056 CDS product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378063.1 protein_id gnl|my_center|LOCUS_29680 21213 22208 gene locus_tag LOCUS_29690 21213 22208 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379155.1 protein_id gnl|my_center|LOCUS_29690 22501 23043 gene locus_tag LOCUS_29700 22501 23043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 24845 23097 gene locus_tag LOCUS_29710 24845 23097 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_29710 26735 24858 gene locus_tag LOCUS_29720 26735 24858 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986412.1 protein_id gnl|my_center|LOCUS_29720 27332 26832 gene locus_tag LOCUS_29730 gene nuoE 27332 26832 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986413.1 protein_id gnl|my_center|LOCUS_29730 27859 28806 gene locus_tag LOCUS_29740 27859 28806 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732102.1 protein_id gnl|my_center|LOCUS_29740 28848 29228 gene locus_tag LOCUS_29750 28848 29228 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244460.1 protein_id gnl|my_center|LOCUS_29750 29342 29668 gene locus_tag LOCUS_29760 29342 29668 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435227.1 protein_id gnl|my_center|LOCUS_29760 30204 31544 gene locus_tag LOCUS_29770 30204 31544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 31740 31579 gene locus_tag LOCUS_29780 31740 31579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 31995 31762 gene locus_tag LOCUS_29790 31995 31762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29790 32303 32725 gene locus_tag LOCUS_29800 32303 32725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29800 33545 32937 gene locus_tag LOCUS_29810 33545 32937 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903175.1 protein_id gnl|my_center|LOCUS_29810 33963 33586 gene locus_tag LOCUS_29820 33963 33586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193116.1 protein_id gnl|my_center|LOCUS_29820 34187 34999 gene locus_tag LOCUS_29830 34187 34999 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472638.1 protein_id gnl|my_center|LOCUS_29830 35063 36109 gene locus_tag LOCUS_29840 35063 36109 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964365.1 protein_id gnl|my_center|LOCUS_29840 37530 36157 gene locus_tag LOCUS_29850 gene mgaSpn 37530 36157 CDS product virulence factor transcriptional regulator MgaSpn inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205278.1 protein_id gnl|my_center|LOCUS_29850 37633 37499 gene locus_tag LOCUS_29860 37633 37499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 37796 38143 gene locus_tag LOCUS_29870 37796 38143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29870 38853 39452 gene locus_tag LOCUS_29880 38853 39452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 40621 39530 gene locus_tag LOCUS_29890 40621 39530 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082555.1 protein_id gnl|my_center|LOCUS_29890 41352 40621 gene locus_tag LOCUS_29900 41352 40621 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002505902.1 protein_id gnl|my_center|LOCUS_29900 41637 42194 gene locus_tag LOCUS_29910 41637 42194 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053025875.1 protein_id gnl|my_center|LOCUS_29910 42345 44663 gene locus_tag LOCUS_29920 42345 44663 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983425.1 protein_id gnl|my_center|LOCUS_29920 44682 45437 gene locus_tag LOCUS_29930 44682 45437 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721684.1 protein_id gnl|my_center|LOCUS_29930 45514 46113 gene locus_tag LOCUS_29940 45514 46113 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860731.1 protein_id gnl|my_center|LOCUS_29940 46100 47008 gene locus_tag LOCUS_29950 46100 47008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 47158 48348 gene locus_tag LOCUS_29960 47158 48348 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429271.1 protein_id gnl|my_center|LOCUS_29960 48479 49240 gene locus_tag LOCUS_29970 48479 49240 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107878.1 protein_id gnl|my_center|LOCUS_29970 49237 49776 gene locus_tag LOCUS_29980 49237 49776 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272617.1 protein_id gnl|my_center|LOCUS_29980 50783 49809 gene locus_tag LOCUS_29990 50783 49809 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373739.1 protein_id gnl|my_center|LOCUS_29990 51535 53028 gene locus_tag LOCUS_30000 gene eat(A) 51535 53028 CDS product ABC-F type ribosomal protection-like protein Eat(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296175.1 protein_id gnl|my_center|LOCUS_30000 53375 53070 gene locus_tag LOCUS_30010 53375 53070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30010 54700 53780 gene locus_tag LOCUS_30020 54700 53780 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321047.1 protein_id gnl|my_center|LOCUS_30020 54996 54724 gene locus_tag LOCUS_30030 54996 54724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 55939 55076 gene locus_tag LOCUS_30040 55939 55076 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966758.1 protein_id gnl|my_center|LOCUS_30040 56055 56870 gene locus_tag LOCUS_30050 56055 56870 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895633.1 protein_id gnl|my_center|LOCUS_30050 57052 57516 gene locus_tag LOCUS_30060 57052 57516 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438486.1 protein_id gnl|my_center|LOCUS_30060 57486 57653 gene locus_tag LOCUS_30070 57486 57653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 57658 59310 gene locus_tag LOCUS_30080 gene alsS 57658 59310 CDS product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379348.1 protein_id gnl|my_center|LOCUS_30080 59406 60119 gene locus_tag LOCUS_30090 gene budA 59406 60119 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357922.1 protein_id gnl|my_center|LOCUS_30090 >Feature sequence25 466 1743 gene locus_tag LOCUS_30100 466 1743 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289088.1 protein_id gnl|my_center|LOCUS_30100 3164 1758 gene locus_tag LOCUS_30110 3164 1758 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007473297.1 protein_id gnl|my_center|LOCUS_30110 3911 3444 gene locus_tag LOCUS_30120 3911 3444 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964081.1 protein_id gnl|my_center|LOCUS_30120 7546 4007 gene locus_tag LOCUS_30130 7546 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 7927 8211 gene locus_tag LOCUS_30140 7927 8211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 8270 8737 gene locus_tag LOCUS_30150 8270 8737 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293649.1 protein_id gnl|my_center|LOCUS_30150 9937 8783 gene locus_tag LOCUS_30160 gene fucO 9937 8783 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288246.1 protein_id gnl|my_center|LOCUS_30160 10606 10316 gene locus_tag LOCUS_30170 gene rhaM 10606 10316 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379067.1 protein_id gnl|my_center|LOCUS_30170 11457 10624 gene locus_tag LOCUS_30180 gene rhaD 11457 10624 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924506.1 protein_id gnl|my_center|LOCUS_30180 12795 11518 gene locus_tag LOCUS_30190 gene rhaA 12795 11518 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288249.1 protein_id gnl|my_center|LOCUS_30190 14289 12832 gene locus_tag LOCUS_30200 gene rhaB 14289 12832 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379065.1 protein_id gnl|my_center|LOCUS_30200 16019 14301 gene locus_tag LOCUS_30210 16019 14301 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118830.1 protein_id gnl|my_center|LOCUS_30210 16112 17107 gene locus_tag LOCUS_30220 16112 17107 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732166.1 protein_id gnl|my_center|LOCUS_30220 17744 17391 gene locus_tag LOCUS_30230 gene crcB 17744 17391 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989889.1 protein_id gnl|my_center|LOCUS_30230 18121 17741 gene locus_tag LOCUS_30240 gene crcB 18121 17741 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712071.1 protein_id gnl|my_center|LOCUS_30240 18258 18929 gene locus_tag LOCUS_30250 18258 18929 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288638.1 protein_id gnl|my_center|LOCUS_30250 19518 18973 gene locus_tag LOCUS_30260 19518 18973 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360970.1 protein_id gnl|my_center|LOCUS_30260 20246 19554 gene locus_tag LOCUS_30270 20246 19554 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286756.1 protein_id gnl|my_center|LOCUS_30270 20569 20285 gene locus_tag LOCUS_30280 gene macP 20569 20285 CDS product cell wall synthase accessory phosphoprotein MacP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286760.1 protein_id gnl|my_center|LOCUS_30280 21478 20915 gene locus_tag LOCUS_30290 21478 20915 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356449.1 protein_id gnl|my_center|LOCUS_30290 21787 22440 gene locus_tag LOCUS_30300 21787 22440 CDS product 5-bromo-4-chloroindolyl phosphate hydrolysis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286764.1 protein_id gnl|my_center|LOCUS_30300 22507 23697 gene locus_tag LOCUS_30310 22507 23697 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356447.1 protein_id gnl|my_center|LOCUS_30310 24600 23737 gene locus_tag LOCUS_30320 24600 23737 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286769.1 protein_id gnl|my_center|LOCUS_30320 25698 24676 gene locus_tag LOCUS_30330 25698 24676 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286770.1 protein_id gnl|my_center|LOCUS_30330 26379 25708 gene locus_tag LOCUS_30340 26379 25708 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291233.1 protein_id gnl|my_center|LOCUS_30340 26856 26503 gene locus_tag LOCUS_30350 26856 26503 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563820.1 protein_id gnl|my_center|LOCUS_30350 28470 26977 gene locus_tag LOCUS_30360 28470 26977 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922400.1 protein_id gnl|my_center|LOCUS_30360 31309 28889 gene locus_tag LOCUS_30370 31309 28889 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646275.1 protein_id gnl|my_center|LOCUS_30370 31733 31485 gene locus_tag LOCUS_30380 31733 31485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30380 31991 31770 gene locus_tag LOCUS_30390 31991 31770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30390 33042 32098 gene locus_tag LOCUS_30400 33042 32098 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286211.1 protein_id gnl|my_center|LOCUS_30400 35669 33039 gene locus_tag LOCUS_30410 35669 33039 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286213.1 protein_id gnl|my_center|LOCUS_30410 36840 35659 gene locus_tag LOCUS_30420 36840 35659 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286214.1 protein_id gnl|my_center|LOCUS_30420 37020 37202 gene locus_tag LOCUS_30430 37020 37202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 38374 37235 gene locus_tag LOCUS_30440 38374 37235 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245877.1 protein_id gnl|my_center|LOCUS_30440 39046 38705 gene locus_tag LOCUS_30450 39046 38705 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355518.1 protein_id gnl|my_center|LOCUS_30450 41317 39116 gene locus_tag LOCUS_30460 41317 39116 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285990.1 protein_id gnl|my_center|LOCUS_30460 41618 42469 gene locus_tag LOCUS_30470 41618 42469 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321119.1 protein_id gnl|my_center|LOCUS_30470 43229 42570 gene locus_tag LOCUS_30480 43229 42570 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286836.1 protein_id gnl|my_center|LOCUS_30480 45283 43646 gene locus_tag LOCUS_30490 45283 43646 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285966.1 protein_id gnl|my_center|LOCUS_30490 45409 46905 gene locus_tag LOCUS_30500 45409 46905 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285962.1 protein_id gnl|my_center|LOCUS_30500 47811 46918 gene locus_tag LOCUS_30510 47811 46918 CDS product DUF561 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722294.1 protein_id gnl|my_center|LOCUS_30510 50435 47922 gene locus_tag LOCUS_30520 gene leuS 50435 47922 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775383.1 protein_id gnl|my_center|LOCUS_30520 51184 51843 gene locus_tag LOCUS_30530 51184 51843 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355669.1 protein_id gnl|my_center|LOCUS_30530 51840 52820 gene locus_tag LOCUS_30540 51840 52820 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285909.1 protein_id gnl|my_center|LOCUS_30540 52795 53358 gene locus_tag LOCUS_30550 52795 53358 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285906.1 protein_id gnl|my_center|LOCUS_30550 54154 53366 gene locus_tag LOCUS_30560 54154 53366 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295567.1 protein_id gnl|my_center|LOCUS_30560 55655 54177 gene locus_tag LOCUS_30570 55655 54177 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386972.1 protein_id gnl|my_center|LOCUS_30570 56962 55772 gene locus_tag LOCUS_30580 gene metK 56962 55772 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289731.1 protein_id gnl|my_center|LOCUS_30580 57229 57154 gene locus_tag LOCUS_t00330 57229 57154 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 57332 57243 gene locus_tag LOCUS_t00340 57332 57243 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 57428 57355 gene locus_tag LOCUS_t00350 57428 57355 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 57513 57443 gene locus_tag LOCUS_t00360 57513 57443 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 57595 57520 gene locus_tag LOCUS_t00370 57595 57520 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 57672 57599 gene locus_tag LOCUS_t00380 57672 57599 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence26 <1 559 gene locus_tag LOCUS_30590 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002296623.1:ISL3 family transposase 1899 844 gene locus_tag LOCUS_30600 1899 844 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017134.1 protein_id gnl|my_center|LOCUS_30600 3120 1900 gene locus_tag LOCUS_30610 gene mtnK 3120 1900 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017133.1 protein_id gnl|my_center|LOCUS_30610 4313 3144 gene locus_tag LOCUS_30620 4313 3144 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903257.1 protein_id gnl|my_center|LOCUS_30620 5070 4417 gene locus_tag LOCUS_30630 5070 4417 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926557.1 protein_id gnl|my_center|LOCUS_30630 6536 5073 gene locus_tag LOCUS_30640 6536 5073 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399436.1 protein_id gnl|my_center|LOCUS_30640 7513 6533 gene locus_tag LOCUS_30650 gene serA 7513 6533 CDS product D-3-phosphoglycerate dehydrogenase SerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403698.1 protein_id gnl|my_center|LOCUS_30650 8908 7550 gene locus_tag LOCUS_30660 8908 7550 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626870.1 protein_id gnl|my_center|LOCUS_30660 9115 9876 gene locus_tag LOCUS_30670 gene rhaR 9115 9876 CDS product rhamnose catabolism operon transcriptional regulator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968057.1 protein_id gnl|my_center|LOCUS_30670 11744 10884 gene locus_tag LOCUS_30680 11744 10884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 12383 11823 gene locus_tag LOCUS_30690 12383 11823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 12552 12881 gene locus_tag LOCUS_30700 12552 12881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 14588 12960 gene locus_tag LOCUS_30710 14588 12960 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645241.1 protein_id gnl|my_center|LOCUS_30710 15262 14603 gene locus_tag LOCUS_30720 15262 14603 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287128.1 protein_id gnl|my_center|LOCUS_30720 16779 15289 gene locus_tag LOCUS_30730 16779 15289 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287129.1 protein_id gnl|my_center|LOCUS_30730 16919 17593 gene locus_tag LOCUS_30740 16919 17593 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286063.1 protein_id gnl|my_center|LOCUS_30740 17598 18923 gene locus_tag LOCUS_30750 17598 18923 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286064.1 protein_id gnl|my_center|LOCUS_30750 19731 19063 gene locus_tag LOCUS_30760 gene alsE 19731 19063 CDS product D-allulose-6-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311314.1 protein_id gnl|my_center|LOCUS_30760 20494 19751 gene locus_tag LOCUS_30770 20494 19751 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824948.1 protein_id gnl|my_center|LOCUS_30770 21099 20545 gene locus_tag LOCUS_30780 gene hxlB 21099 20545 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246343.1 protein_id gnl|my_center|LOCUS_30780 22135 21083 gene locus_tag LOCUS_30790 22135 21083 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384594.1 protein_id gnl|my_center|LOCUS_30790 22980 22153 gene locus_tag LOCUS_30800 22980 22153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30800 23739 22981 gene locus_tag LOCUS_30810 23739 22981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 24249 23773 gene locus_tag LOCUS_30820 24249 23773 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476683.1 protein_id gnl|my_center|LOCUS_30820 24668 24252 gene locus_tag LOCUS_30830 24668 24252 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860837.1 protein_id gnl|my_center|LOCUS_30830 27375 24853 gene locus_tag LOCUS_30840 27375 24853 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435945.1 protein_id gnl|my_center|LOCUS_30840 28410 27946 gene locus_tag LOCUS_30850 28410 27946 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948080.1 protein_id gnl|my_center|LOCUS_30850 29198 28413 gene locus_tag LOCUS_30860 29198 28413 CDS product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644021.1 protein_id gnl|my_center|LOCUS_30860 30591 29167 gene locus_tag LOCUS_30870 30591 29167 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644020.1 protein_id gnl|my_center|LOCUS_30870 31474 30584 gene locus_tag LOCUS_30880 31474 30584 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644019.1 protein_id gnl|my_center|LOCUS_30880 31909 31652 gene locus_tag LOCUS_30890 31909 31652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 32722 31952 gene locus_tag LOCUS_30900 32722 31952 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294261.1 protein_id gnl|my_center|LOCUS_30900 33002 33877 gene locus_tag LOCUS_30910 33002 33877 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_30910 34955 34281 gene locus_tag LOCUS_30920 34955 34281 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101847.1 protein_id gnl|my_center|LOCUS_30920 35770 34967 gene locus_tag LOCUS_30930 35770 34967 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289420.1 protein_id gnl|my_center|LOCUS_30930 36852 35797 gene locus_tag LOCUS_30940 36852 35797 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643576.1 protein_id gnl|my_center|LOCUS_30940 37913 36849 gene locus_tag LOCUS_30950 37913 36849 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930553.1 protein_id gnl|my_center|LOCUS_30950 39261 37990 gene locus_tag LOCUS_30960 39261 37990 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722022.1 protein_id gnl|my_center|LOCUS_30960 39615 39322 gene locus_tag LOCUS_30970 39615 39322 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642909.1 protein_id gnl|my_center|LOCUS_30970 40107 39631 gene locus_tag LOCUS_30980 40107 39631 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642910.1 protein_id gnl|my_center|LOCUS_30980 42183 40111 gene locus_tag LOCUS_30990 42183 40111 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722025.1 protein_id gnl|my_center|LOCUS_30990 43790 42933 gene locus_tag LOCUS_31000 43790 42933 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009912760.1 protein_id gnl|my_center|LOCUS_31000 44317 43859 gene locus_tag LOCUS_31010 44317 43859 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288815.1 protein_id gnl|my_center|LOCUS_31010 45659 44331 gene locus_tag LOCUS_31020 45659 44331 CDS product maltose-6'-phosphate glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288813.1 protein_id gnl|my_center|LOCUS_31020 47089 45674 gene locus_tag LOCUS_31030 47089 45674 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321325.1 protein_id gnl|my_center|LOCUS_31030 47871 47107 gene locus_tag LOCUS_31040 47871 47107 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288811.1 protein_id gnl|my_center|LOCUS_31040 48799 47978 gene locus_tag LOCUS_31050 48799 47978 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288809.1 protein_id gnl|my_center|LOCUS_31050 50800 49190 gene locus_tag LOCUS_31060 50800 49190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 52203 51220 gene locus_tag LOCUS_31070 52203 51220 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931329.1 protein_id gnl|my_center|LOCUS_31070 54129 52204 gene locus_tag LOCUS_31080 54129 52204 CDS product PTS beta-glucoside transporter subunit IIBCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990070.1 protein_id gnl|my_center|LOCUS_31080 55061 54231 gene locus_tag LOCUS_31090 55061 54231 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722147.1 protein_id gnl|my_center|LOCUS_31090 >Feature sequence27 1262 102 gene locus_tag LOCUS_31100 gene dnaJ 1262 102 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357822.1 protein_id gnl|my_center|LOCUS_31100 3241 1412 gene locus_tag LOCUS_31110 gene dnaK 3241 1412 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292134.1 protein_id gnl|my_center|LOCUS_31110 3849 3292 gene locus_tag LOCUS_31120 gene grpE 3849 3292 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357827.1 protein_id gnl|my_center|LOCUS_31120 4923 3883 gene locus_tag LOCUS_31130 gene hrcA 4923 3883 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289532.1 protein_id gnl|my_center|LOCUS_31130 6193 5045 gene locus_tag LOCUS_31140 gene hemW 6193 5045 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289534.1 protein_id gnl|my_center|LOCUS_31140 7214 6321 gene locus_tag LOCUS_31150 7214 6321 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002325723.1 protein_id gnl|my_center|LOCUS_31150 7971 7393 gene locus_tag LOCUS_31160 7971 7393 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836545.1 protein_id gnl|my_center|LOCUS_31160 8729 7968 gene locus_tag LOCUS_31170 gene cobS 8729 7968 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989692.1 protein_id gnl|my_center|LOCUS_31170 9313 8726 gene locus_tag LOCUS_31180 gene cobU 9313 8726 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836543.1 protein_id gnl|my_center|LOCUS_31180 10099 9320 gene locus_tag LOCUS_31190 10099 9320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924995.1 protein_id gnl|my_center|LOCUS_31190 10757 10062 gene locus_tag LOCUS_31200 10757 10062 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931590.1 protein_id gnl|my_center|LOCUS_31200 11712 10768 gene locus_tag LOCUS_31210 gene hemC 11712 10768 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886587.1 protein_id gnl|my_center|LOCUS_31210 12316 11750 gene locus_tag LOCUS_31220 12316 11750 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724741.1 protein_id gnl|my_center|LOCUS_31220 13815 12313 gene locus_tag LOCUS_31230 13815 12313 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836536.1 protein_id gnl|my_center|LOCUS_31230 14624 13815 gene locus_tag LOCUS_31240 14624 13815 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989706.1 protein_id gnl|my_center|LOCUS_31240 15617 15315 gene locus_tag LOCUS_31250 15617 15315 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721603.1 protein_id gnl|my_center|LOCUS_31250 16350 15601 gene locus_tag LOCUS_31260 16350 15601 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901131.1 protein_id gnl|my_center|LOCUS_31260 17066 16356 gene locus_tag LOCUS_31270 17066 16356 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721601.1 protein_id gnl|my_center|LOCUS_31270 17841 17059 gene locus_tag LOCUS_31280 17841 17059 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721600.1 protein_id gnl|my_center|LOCUS_31280 19268 17844 gene locus_tag LOCUS_31290 gene cobA 19268 17844 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721599.1 protein_id gnl|my_center|LOCUS_31290 20013 19273 gene locus_tag LOCUS_31300 gene cobK 20013 19273 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437730.1 protein_id gnl|my_center|LOCUS_31300 20735 20010 gene locus_tag LOCUS_31310 gene cobJ 20735 20010 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896461.1 protein_id gnl|my_center|LOCUS_31310 21772 20714 gene locus_tag LOCUS_31320 gene cbiG 21772 20714 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901140.1 protein_id gnl|my_center|LOCUS_31320 22532 21765 gene locus_tag LOCUS_31330 22532 21765 CDS product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924853.1 protein_id gnl|my_center|LOCUS_31330 23055 22537 gene locus_tag LOCUS_31340 23055 22537 CDS product decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836530.1 protein_id gnl|my_center|LOCUS_31340 23692 23081 gene locus_tag LOCUS_31350 23692 23081 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836529.1 protein_id gnl|my_center|LOCUS_31350 24810 23689 gene locus_tag LOCUS_31360 gene cbiD 24810 23689 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721592.1 protein_id gnl|my_center|LOCUS_31360 25460 24810 gene locus_tag LOCUS_31370 25460 24810 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721591.1 protein_id gnl|my_center|LOCUS_31370 26431 25475 gene locus_tag LOCUS_31380 gene cbiB 26431 25475 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989705.1 protein_id gnl|my_center|LOCUS_31380 27783 26428 gene locus_tag LOCUS_31390 27783 26428 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989704.1 protein_id gnl|my_center|LOCUS_31390 28663 27674 gene locus_tag LOCUS_31400 28663 27674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989699.1 protein_id gnl|my_center|LOCUS_31400 29724 28660 gene locus_tag LOCUS_31410 gene cobD 29724 28660 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926914.1 protein_id gnl|my_center|LOCUS_31410 30243 29746 gene locus_tag LOCUS_31420 30243 29746 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009934281.1 protein_id gnl|my_center|LOCUS_31420 30929 32446 gene locus_tag LOCUS_31430 gene yjeM 30929 32446 CDS product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476411.1 protein_id gnl|my_center|LOCUS_31430 32471 32923 gene locus_tag LOCUS_31440 32471 32923 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009659744.1 protein_id gnl|my_center|LOCUS_31440 33102 32980 gene locus_tag LOCUS_31450 33102 32980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 33877 33221 gene locus_tag LOCUS_31460 gene tenA 33877 33221 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255229.1 protein_id gnl|my_center|LOCUS_31460 34000 34158 gene locus_tag LOCUS_31470 34000 34158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 34307 35134 gene locus_tag LOCUS_31480 34307 35134 CDS product aminoglycoside 6-adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816862.1 protein_id gnl|my_center|LOCUS_31480 36093 35185 gene locus_tag LOCUS_31490 36093 35185 CDS product DUF2268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862008.1 protein_id gnl|my_center|LOCUS_31490 36244 36972 gene locus_tag LOCUS_31500 36244 36972 CDS product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280271.1 protein_id gnl|my_center|LOCUS_31500 37001 37438 gene locus_tag LOCUS_31510 37001 37438 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727266.1 protein_id gnl|my_center|LOCUS_31510 38352 37486 gene locus_tag LOCUS_31520 38352 37486 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254502.1 protein_id gnl|my_center|LOCUS_31520 38670 38452 gene locus_tag LOCUS_31530 38670 38452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 38926 38651 gene locus_tag LOCUS_31540 38926 38651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 41440 39170 gene locus_tag LOCUS_31550 41440 39170 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860819.1 protein_id gnl|my_center|LOCUS_31550 42981 41824 gene locus_tag LOCUS_31560 gene grdD 42981 41824 CDS product glycine/sarcosine/betaine reductase complex component C subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430750.1 protein_id gnl|my_center|LOCUS_31560 44527 42992 gene locus_tag LOCUS_31570 gene grdC 44527 42992 CDS product glycine/sarcosine/betaine reductase complex component C subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897537.1 protein_id gnl|my_center|LOCUS_31570 44862 44539 gene locus_tag LOCUS_31580 44862 44539 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356487.1 protein_id gnl|my_center|LOCUS_31580 45827 44859 gene locus_tag LOCUS_31590 gene trxB 45827 44859 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416869.1 protein_id gnl|my_center|LOCUS_31590 47229 45928 gene locus_tag LOCUS_31600 gene grdB 47229 45928 CDS product glycine reductase complex selenoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011345263.1 transl_except (pos:complement(46186..46188),aa:Sec) note codon on position 348 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_31600 47721 47248 gene locus_tag LOCUS_31610 gene grdA 47721 47248 CDS product glycine/sarcosine/betaine reductase complex selenoprotein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081450071.1 transl_except (pos:complement(47587..47589),aa:Sec) note codon on position 45 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_31610 49031 47745 gene locus_tag LOCUS_31620 49031 47745 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416871.1 protein_id gnl|my_center|LOCUS_31620 49459 49070 gene locus_tag LOCUS_31630 49459 49070 CDS product GrdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948883.1 protein_id gnl|my_center|LOCUS_31630 50492 51169 gene locus_tag LOCUS_31640 50492 51169 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386953.1 protein_id gnl|my_center|LOCUS_31640 52233 51298 gene locus_tag LOCUS_31650 52233 51298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 53059 52202 gene locus_tag LOCUS_31660 53059 52202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 >Feature sequence28 1400 1014 gene locus_tag LOCUS_31670 1400 1014 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985015.1 protein_id gnl|my_center|LOCUS_31670 1730 1416 gene locus_tag LOCUS_31680 1730 1416 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420682.1 protein_id gnl|my_center|LOCUS_31680 2181 2855 gene locus_tag LOCUS_31690 2181 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 2902 3936 gene locus_tag LOCUS_31700 2902 3936 CDS product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014525057.1 protein_id gnl|my_center|LOCUS_31700 4258 6708 gene locus_tag LOCUS_31710 4258 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296469.1 protein_id gnl|my_center|LOCUS_31710 6954 8441 gene locus_tag LOCUS_31720 6954 8441 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989904.1 protein_id gnl|my_center|LOCUS_31720 8428 8856 gene locus_tag LOCUS_31730 8428 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 8868 9185 gene locus_tag LOCUS_31740 8868 9185 CDS product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705652.1 protein_id gnl|my_center|LOCUS_31740 9197 9646 gene locus_tag LOCUS_31750 9197 9646 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705653.1 protein_id gnl|my_center|LOCUS_31750 9665 10765 gene locus_tag LOCUS_31760 9665 10765 CDS product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366291.1 protein_id gnl|my_center|LOCUS_31760 10786 11490 gene locus_tag LOCUS_31770 gene alsE 10786 11490 CDS product D-allulose-6-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314355.1 protein_id gnl|my_center|LOCUS_31770 11672 12139 gene locus_tag LOCUS_31780 11672 12139 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064815.1 protein_id gnl|my_center|LOCUS_31780 13936 12185 gene locus_tag LOCUS_31790 13936 12185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_31790 15647 13926 gene locus_tag LOCUS_31800 gene efrA 15647 13926 CDS product multidrug efflux ABC transporter subunit EfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748727.1 protein_id gnl|my_center|LOCUS_31800 16081 15644 gene locus_tag LOCUS_31810 16081 15644 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902189.1 protein_id gnl|my_center|LOCUS_31810 16412 17176 gene locus_tag LOCUS_31820 16412 17176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 17173 18846 gene locus_tag LOCUS_31830 17173 18846 CDS product putative 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861992.1 protein_id gnl|my_center|LOCUS_31830 18903 19877 gene locus_tag LOCUS_31840 18903 19877 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750887.1 protein_id gnl|my_center|LOCUS_31840 19889 20986 gene locus_tag LOCUS_31850 gene phnW 19889 20986 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002326249.1 protein_id gnl|my_center|LOCUS_31850 20976 21797 gene locus_tag LOCUS_31860 20976 21797 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687382.1 protein_id gnl|my_center|LOCUS_31860 22586 24841 gene locus_tag LOCUS_31870 22586 24841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 24858 25424 gene locus_tag LOCUS_31880 24858 25424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 25444 26184 gene locus_tag LOCUS_31890 25444 26184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 26203 27312 gene locus_tag LOCUS_31900 26203 27312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386995.1 protein_id gnl|my_center|LOCUS_31900 27445 27765 gene locus_tag LOCUS_31910 27445 27765 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545882.1 protein_id gnl|my_center|LOCUS_31910 27983 28462 gene locus_tag LOCUS_31920 27983 28462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 28602 28976 gene locus_tag LOCUS_31930 28602 28976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 29001 29654 gene locus_tag LOCUS_31940 29001 29654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 30015 30287 gene locus_tag LOCUS_31950 30015 30287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 30807 30397 gene locus_tag LOCUS_31960 30807 30397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 31244 30792 gene locus_tag LOCUS_31970 31244 30792 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437661.1 protein_id gnl|my_center|LOCUS_31970 31449 31979 gene locus_tag LOCUS_31980 31449 31979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 32126 32557 gene locus_tag LOCUS_31990 32126 32557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 32861 34147 gene locus_tag LOCUS_32000 32861 34147 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674204.1 protein_id gnl|my_center|LOCUS_32000 36119 34200 gene locus_tag LOCUS_32010 36119 34200 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674124.1 protein_id gnl|my_center|LOCUS_32010 36297 36611 gene locus_tag LOCUS_32020 36297 36611 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898152.1 protein_id gnl|my_center|LOCUS_32020 36630 37898 gene locus_tag LOCUS_32030 36630 37898 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013245438.1 protein_id gnl|my_center|LOCUS_32030 37970 38317 gene locus_tag LOCUS_32040 37970 38317 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573646.1 protein_id gnl|my_center|LOCUS_32040 38329 39117 gene locus_tag LOCUS_32050 38329 39117 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721303.1 protein_id gnl|my_center|LOCUS_32050 39198 40631 gene locus_tag LOCUS_32060 39198 40631 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674121.1 protein_id gnl|my_center|LOCUS_32060 40631 41230 gene locus_tag LOCUS_32070 40631 41230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583336.1 protein_id gnl|my_center|LOCUS_32070 41364 41798 gene locus_tag LOCUS_32080 41364 41798 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905539.1 protein_id gnl|my_center|LOCUS_32080 41802 43181 gene locus_tag LOCUS_32090 41802 43181 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948764.1 protein_id gnl|my_center|LOCUS_32090 43326 43661 gene locus_tag LOCUS_32100 43326 43661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 43721 44149 gene locus_tag LOCUS_32110 43721 44149 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986120.1 protein_id gnl|my_center|LOCUS_32110 44251 46017 gene locus_tag LOCUS_32120 44251 46017 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263293.1 protein_id gnl|my_center|LOCUS_32120 46010 47794 gene locus_tag LOCUS_32130 46010 47794 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263294.1 protein_id gnl|my_center|LOCUS_32130 48454 52326 gene locus_tag LOCUS_32140 gene ebpA 48454 52326 CDS product endocarditis and biofilm-associated pilus tip protein EbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154080969.1 protein_id gnl|my_center|LOCUS_32140 >Feature sequence29 1044 292 gene locus_tag LOCUS_32150 1044 292 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369238.1 protein_id gnl|my_center|LOCUS_32150 2308 1145 gene locus_tag LOCUS_32160 2308 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 4191 3439 gene locus_tag LOCUS_32170 4191 3439 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288278.1 protein_id gnl|my_center|LOCUS_32170 4477 4211 gene locus_tag LOCUS_32180 4477 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288318.1 protein_id gnl|my_center|LOCUS_32180 5896 4505 gene locus_tag LOCUS_32190 5896 4505 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288281.1 protein_id gnl|my_center|LOCUS_32190 6228 5929 gene locus_tag LOCUS_32200 6228 5929 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288285.1 protein_id gnl|my_center|LOCUS_32200 6719 6261 gene locus_tag LOCUS_32210 6719 6261 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288286.1 protein_id gnl|my_center|LOCUS_32210 7010 7771 gene locus_tag LOCUS_32220 7010 7771 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288287.1 protein_id gnl|my_center|LOCUS_32220 7768 8739 gene locus_tag LOCUS_32230 7768 8739 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288288.1 protein_id gnl|my_center|LOCUS_32230 8875 9738 gene locus_tag LOCUS_32240 8875 9738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458844.1 protein_id gnl|my_center|LOCUS_32240 12198 9769 gene locus_tag LOCUS_32250 12198 9769 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922724.1 protein_id gnl|my_center|LOCUS_32250 12814 12347 gene locus_tag LOCUS_32260 12814 12347 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860652.1 protein_id gnl|my_center|LOCUS_32260 13245 12946 gene locus_tag LOCUS_32270 13245 12946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 14075 13332 gene locus_tag LOCUS_32280 14075 13332 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132534.1 protein_id gnl|my_center|LOCUS_32280 14234 15010 gene locus_tag LOCUS_32290 14234 15010 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406170.1 protein_id gnl|my_center|LOCUS_32290 15940 15065 gene locus_tag LOCUS_32300 15940 15065 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289172.1 protein_id gnl|my_center|LOCUS_32300 16200 16619 gene locus_tag LOCUS_32310 16200 16619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 16760 17938 gene locus_tag LOCUS_32320 16760 17938 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903257.1 protein_id gnl|my_center|LOCUS_32320 17993 18367 gene locus_tag LOCUS_32330 17993 18367 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641539.1 protein_id gnl|my_center|LOCUS_32330 20302 18437 gene locus_tag LOCUS_32340 20302 18437 CDS product PTS transporter subunit IIBCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860826.1 protein_id gnl|my_center|LOCUS_32340 22010 20295 gene locus_tag LOCUS_32350 22010 20295 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674766.1 protein_id gnl|my_center|LOCUS_32350 23064 22066 gene locus_tag LOCUS_32360 23064 22066 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102083.1 protein_id gnl|my_center|LOCUS_32360 23829 23230 gene locus_tag LOCUS_32370 23829 23230 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294697.1 protein_id gnl|my_center|LOCUS_32370 24715 23849 gene locus_tag LOCUS_32380 24715 23849 CDS product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294699.1 protein_id gnl|my_center|LOCUS_32380 25141 24746 gene locus_tag LOCUS_32390 25141 24746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329646.1 protein_id gnl|my_center|LOCUS_32390 26440 25157 gene locus_tag LOCUS_32400 26440 25157 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296769.1 protein_id gnl|my_center|LOCUS_32400 27080 26772 gene locus_tag LOCUS_32410 27080 26772 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292534.1 protein_id gnl|my_center|LOCUS_32410 29199 27130 gene locus_tag LOCUS_32420 29199 27130 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287536.1 protein_id gnl|my_center|LOCUS_32420 30549 30238 gene locus_tag LOCUS_32430 30549 30238 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565067.1 protein_id gnl|my_center|LOCUS_32430 30974 30561 gene locus_tag LOCUS_32440 30974 30561 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296336.1 protein_id gnl|my_center|LOCUS_32440 31513 30998 gene locus_tag LOCUS_32450 31513 30998 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_32450 32514 31633 gene locus_tag LOCUS_32460 32514 31633 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906179.1 protein_id gnl|my_center|LOCUS_32460 33467 32634 gene locus_tag LOCUS_32470 33467 32634 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723815.1 protein_id gnl|my_center|LOCUS_32470 35055 33604 gene locus_tag LOCUS_32480 35055 33604 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289178.1 protein_id gnl|my_center|LOCUS_32480 36945 35098 gene locus_tag LOCUS_32490 36945 35098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 38106 37213 gene locus_tag LOCUS_32500 38106 37213 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289172.1 protein_id gnl|my_center|LOCUS_32500 38529 38110 gene locus_tag LOCUS_32510 gene adhR 38529 38110 CDS product aldehyde stress transcriptional regulator AdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398725.1 protein_id gnl|my_center|LOCUS_32510 39192 38719 gene locus_tag LOCUS_32520 39192 38719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 40436 39456 gene locus_tag LOCUS_32530 40436 39456 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930477.1 protein_id gnl|my_center|LOCUS_32530 41502 40525 gene locus_tag LOCUS_32540 41502 40525 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101851.1 protein_id gnl|my_center|LOCUS_32540 42545 41526 gene locus_tag LOCUS_32550 42545 41526 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642679.1 protein_id gnl|my_center|LOCUS_32550 42696 42520 gene locus_tag LOCUS_32560 42696 42520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 42783 43658 gene locus_tag LOCUS_32570 42783 43658 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286051.1 protein_id gnl|my_center|LOCUS_32570 44276 43698 gene locus_tag LOCUS_32580 44276 43698 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924169.1 protein_id gnl|my_center|LOCUS_32580 45052 44480 gene locus_tag LOCUS_32590 45052 44480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 45794 45303 gene locus_tag LOCUS_32600 45794 45303 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296667.1 protein_id gnl|my_center|LOCUS_32600 46049 45804 gene locus_tag LOCUS_32610 46049 45804 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568375.1 protein_id gnl|my_center|LOCUS_32610 46666 46073 gene locus_tag LOCUS_32620 46666 46073 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356090.1 protein_id gnl|my_center|LOCUS_32620 47666 47028 gene locus_tag LOCUS_32630 47666 47028 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817367.1 protein_id gnl|my_center|LOCUS_32630 48229 47681 gene locus_tag LOCUS_32640 48229 47681 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434848.1 protein_id gnl|my_center|LOCUS_32640 49471 48464 gene locus_tag LOCUS_32650 49471 48464 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682144.1 protein_id gnl|my_center|LOCUS_32650 50138 49644 gene locus_tag LOCUS_32660 50138 49644 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003091.1 protein_id gnl|my_center|LOCUS_32660 50614 50171 gene locus_tag LOCUS_32670 50614 50171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 50734 51552 gene locus_tag LOCUS_32680 50734 51552 CDS product elongation factor G-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774153.1 protein_id gnl|my_center|LOCUS_32680 >Feature sequence30 1430 2266 gene locus_tag LOCUS_32690 1430 2266 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002923661.1 protein_id gnl|my_center|LOCUS_32690 2282 3682 gene locus_tag LOCUS_32700 gene lacG 2282 3682 CDS product 6-phospho-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288636.1 protein_id gnl|my_center|LOCUS_32700 3773 4090 gene locus_tag LOCUS_32710 3773 4090 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288635.1 protein_id gnl|my_center|LOCUS_32710 4112 5779 gene locus_tag LOCUS_32720 4112 5779 CDS product PTS lactose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288634.1 protein_id gnl|my_center|LOCUS_32720 5821 6558 gene locus_tag LOCUS_32730 5821 6558 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369238.1 protein_id gnl|my_center|LOCUS_32730 8069 6609 gene locus_tag LOCUS_32740 8069 6609 CDS product PTS glucitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357183.1 protein_id gnl|my_center|LOCUS_32740 8393 8091 gene locus_tag LOCUS_32750 8393 8091 CDS product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357185.1 protein_id gnl|my_center|LOCUS_32750 8929 8438 gene locus_tag LOCUS_32760 8929 8438 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357187.1 protein_id gnl|my_center|LOCUS_32760 9085 9861 gene locus_tag LOCUS_32770 9085 9861 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288637.1 protein_id gnl|my_center|LOCUS_32770 9911 10339 gene locus_tag LOCUS_32780 gene lacA 9911 10339 CDS product galactose-6-phosphate isomerase subunit LacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357188.1 protein_id gnl|my_center|LOCUS_32780 10363 10878 gene locus_tag LOCUS_32790 gene lacB 10363 10878 CDS product galactose-6-phosphate isomerase subunit LacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216917.1 protein_id gnl|my_center|LOCUS_32790 10891 11817 gene locus_tag LOCUS_32800 gene lacC 10891 11817 CDS product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775547.1 protein_id gnl|my_center|LOCUS_32800 11830 12816 gene locus_tag LOCUS_32810 gene lacD 11830 12816 CDS product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371479.1 protein_id gnl|my_center|LOCUS_32810 13992 13141 gene locus_tag LOCUS_32820 13992 13141 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288523.1 protein_id gnl|my_center|LOCUS_32820 14799 14014 gene locus_tag LOCUS_32830 14799 14014 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547434.1 protein_id gnl|my_center|LOCUS_32830 15742 15197 gene locus_tag LOCUS_32840 15742 15197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905913.1 protein_id gnl|my_center|LOCUS_32840 16337 16564 gene locus_tag LOCUS_32850 16337 16564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 16615 16905 gene locus_tag LOCUS_32860 16615 16905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 17056 17571 gene locus_tag LOCUS_32870 17056 17571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 17775 18131 gene locus_tag LOCUS_32880 17775 18131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 18464 20686 gene locus_tag LOCUS_32890 18464 20686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 20690 21223 gene locus_tag LOCUS_32900 20690 21223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 21243 21824 gene locus_tag LOCUS_32910 21243 21824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 21852 22097 gene locus_tag LOCUS_32920 21852 22097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 22773 22156 gene locus_tag LOCUS_32930 22773 22156 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675038.1 protein_id gnl|my_center|LOCUS_32930 23711 22842 gene locus_tag LOCUS_32940 23711 22842 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989461.1 protein_id gnl|my_center|LOCUS_32940 23821 24387 gene locus_tag LOCUS_32950 23821 24387 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722981.1 protein_id gnl|my_center|LOCUS_32950 24449 24919 gene locus_tag LOCUS_32960 24449 24919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 25580 24972 gene locus_tag LOCUS_32970 25580 24972 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101549.1 protein_id gnl|my_center|LOCUS_32970 26055 26534 gene locus_tag LOCUS_32980 26055 26534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 26546 26734 gene locus_tag LOCUS_32990 26546 26734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 26831 27814 gene locus_tag LOCUS_33000 26831 27814 CDS product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643511.1 protein_id gnl|my_center|LOCUS_33000 29855 27891 gene locus_tag LOCUS_33010 29855 27891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 31063 30170 gene locus_tag LOCUS_33020 31063 30170 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287299.1 protein_id gnl|my_center|LOCUS_33020 31285 32547 gene locus_tag LOCUS_33030 31285 32547 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964838.1 protein_id gnl|my_center|LOCUS_33030 32562 33533 gene locus_tag LOCUS_33040 32562 33533 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287289.1 protein_id gnl|my_center|LOCUS_33040 33762 35738 gene locus_tag LOCUS_33050 33762 35738 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860818.1 protein_id gnl|my_center|LOCUS_33050 35749 36498 gene locus_tag LOCUS_33060 35749 36498 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891631.1 protein_id gnl|my_center|LOCUS_33060 36687 38111 gene locus_tag LOCUS_33070 36687 38111 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861817.1 protein_id gnl|my_center|LOCUS_33070 40189 38153 gene locus_tag LOCUS_33080 40189 38153 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_33080 40330 41307 gene locus_tag LOCUS_33090 40330 41307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 41752 42153 gene locus_tag LOCUS_33100 41752 42153 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354951.1 protein_id gnl|my_center|LOCUS_33100 42302 43834 gene locus_tag LOCUS_33110 42302 43834 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321200.1 protein_id gnl|my_center|LOCUS_33110 43946 50122 gene locus_tag LOCUS_33120 43946 50122 CDS product SpaA isopeptide-forming pilin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067392747.1 protein_id gnl|my_center|LOCUS_33120 >Feature sequence31 843 133 gene locus_tag LOCUS_33130 843 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 2340 931 gene locus_tag LOCUS_33140 2340 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 2665 3141 gene locus_tag LOCUS_33150 2665 3141 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360627.1 protein_id gnl|my_center|LOCUS_33150 3259 3486 gene locus_tag LOCUS_33160 3259 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 4951 3716 gene locus_tag LOCUS_33170 gene icd 4951 3716 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 protein_id gnl|my_center|LOCUS_33170 7599 4951 gene locus_tag LOCUS_33180 gene acnA 7599 4951 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027165.1 protein_id gnl|my_center|LOCUS_33180 7768 9111 gene locus_tag LOCUS_33190 7768 9111 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017864221.1 protein_id gnl|my_center|LOCUS_33190 9931 9143 gene locus_tag LOCUS_33200 9931 9143 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245153.1 protein_id gnl|my_center|LOCUS_33200 10179 11162 gene locus_tag LOCUS_33210 10179 11162 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963715.1 protein_id gnl|my_center|LOCUS_33210 11347 12087 gene locus_tag LOCUS_33220 11347 12087 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837540.1 protein_id gnl|my_center|LOCUS_33220 12196 12441 gene locus_tag LOCUS_33230 12196 12441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 12455 13726 gene locus_tag LOCUS_33240 12455 13726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329694.1 protein_id gnl|my_center|LOCUS_33240 13795 14757 gene locus_tag LOCUS_33250 13795 14757 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963717.1 protein_id gnl|my_center|LOCUS_33250 14754 15377 gene locus_tag LOCUS_33260 14754 15377 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963718.1 protein_id gnl|my_center|LOCUS_33260 15377 15919 gene locus_tag LOCUS_33270 gene hxlB 15377 15919 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963719.1 protein_id gnl|my_center|LOCUS_33270 15929 16567 gene locus_tag LOCUS_33280 15929 16567 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288242.1 protein_id gnl|my_center|LOCUS_33280 16825 18018 gene locus_tag LOCUS_33290 16825 18018 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732150.1 protein_id gnl|my_center|LOCUS_33290 18021 19268 gene locus_tag LOCUS_33300 18021 19268 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813994.1 protein_id gnl|my_center|LOCUS_33300 20083 19319 gene locus_tag LOCUS_33310 20083 19319 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321321.1 protein_id gnl|my_center|LOCUS_33310 20306 21373 gene locus_tag LOCUS_33320 gene ulaG 20306 21373 CDS product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288825.1 protein_id gnl|my_center|LOCUS_33320 21391 21849 gene locus_tag LOCUS_33330 21391 21849 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288826.1 protein_id gnl|my_center|LOCUS_33330 21862 23352 gene locus_tag LOCUS_33340 21862 23352 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288827.1 protein_id gnl|my_center|LOCUS_33340 23394 23606 gene locus_tag LOCUS_33350 23394 23606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33350 23708 24349 gene locus_tag LOCUS_33360 23708 24349 CDS product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288832.1 protein_id gnl|my_center|LOCUS_33360 24351 25211 gene locus_tag LOCUS_33370 24351 25211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33370 25198 25914 gene locus_tag LOCUS_33380 25198 25914 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295327.1 protein_id gnl|my_center|LOCUS_33380 26378 27217 gene locus_tag LOCUS_33390 26378 27217 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528922.1 protein_id gnl|my_center|LOCUS_33390 27254 27805 gene locus_tag LOCUS_33400 27254 27805 CDS product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356937.1 protein_id gnl|my_center|LOCUS_33400 27822 29510 gene locus_tag LOCUS_33410 27822 29510 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380507.1 protein_id gnl|my_center|LOCUS_33410 29497 30330 gene locus_tag LOCUS_33420 29497 30330 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356939.1 protein_id gnl|my_center|LOCUS_33420 30622 30416 gene locus_tag LOCUS_33430 30622 30416 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289418.1 protein_id gnl|my_center|LOCUS_33430 31200 30837 gene locus_tag LOCUS_tm00010 31200 30837 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 31411 32133 gene locus_tag LOCUS_33440 31411 32133 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288590.1 protein_id gnl|my_center|LOCUS_33440 32130 33611 gene locus_tag LOCUS_33450 32130 33611 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288588.1 protein_id gnl|my_center|LOCUS_33450 35086 33647 gene locus_tag LOCUS_33460 35086 33647 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295362.1 protein_id gnl|my_center|LOCUS_33460 35877 35221 gene locus_tag LOCUS_33470 35877 35221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 38114 36003 gene locus_tag LOCUS_33480 38114 36003 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288584.1 protein_id gnl|my_center|LOCUS_33480 38292 39461 gene locus_tag LOCUS_33490 38292 39461 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379363.1 protein_id gnl|my_center|LOCUS_33490 39484 40233 gene locus_tag LOCUS_33500 gene aroD 39484 40233 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288579.1 protein_id gnl|my_center|LOCUS_33500 41379 40342 gene locus_tag LOCUS_33510 41379 40342 CDS product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721333.1 protein_id gnl|my_center|LOCUS_33510 41510 41995 gene locus_tag LOCUS_33520 gene ybaK 41510 41995 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288577.1 protein_id gnl|my_center|LOCUS_33520 43248 41992 gene locus_tag LOCUS_33530 43248 41992 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288576.1 protein_id gnl|my_center|LOCUS_33530 43411 44754 gene locus_tag LOCUS_33540 gene gdhA 43411 44754 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379420.1 protein_id gnl|my_center|LOCUS_33540 44841 46187 gene locus_tag LOCUS_33550 44841 46187 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288574.1 protein_id gnl|my_center|LOCUS_33550 46500 46718 gene locus_tag LOCUS_33560 46500 46718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 >Feature sequence32 1660 149 gene locus_tag LOCUS_33570 1660 149 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311258.1 protein_id gnl|my_center|LOCUS_33570 3158 1848 gene locus_tag LOCUS_33580 3158 1848 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387692.1 protein_id gnl|my_center|LOCUS_33580 3747 3175 gene locus_tag LOCUS_33590 3747 3175 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390470.1 protein_id gnl|my_center|LOCUS_33590 4840 3947 gene locus_tag LOCUS_33600 4840 3947 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549090.1 protein_id gnl|my_center|LOCUS_33600 4959 6155 gene locus_tag LOCUS_33610 4959 6155 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966774.1 protein_id gnl|my_center|LOCUS_33610 6868 6218 gene locus_tag LOCUS_33620 6868 6218 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297022.1 protein_id gnl|my_center|LOCUS_33620 7234 8241 gene locus_tag LOCUS_33630 7234 8241 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289776.1 protein_id gnl|my_center|LOCUS_33630 8887 8243 gene locus_tag LOCUS_33640 gene cutC 8887 8243 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356490.1 protein_id gnl|my_center|LOCUS_33640 10075 8906 gene locus_tag LOCUS_33650 10075 8906 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_33650 10862 10158 gene locus_tag LOCUS_33660 10862 10158 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732177.1 protein_id gnl|my_center|LOCUS_33660 11758 10949 gene locus_tag LOCUS_33670 11758 10949 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728733.1 protein_id gnl|my_center|LOCUS_33670 12557 11739 gene locus_tag LOCUS_33680 12557 11739 CDS product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721639.1 protein_id gnl|my_center|LOCUS_33680 13041 12559 gene locus_tag LOCUS_33690 13041 12559 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721638.1 protein_id gnl|my_center|LOCUS_33690 13410 13060 gene locus_tag LOCUS_33700 13410 13060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 14115 13420 gene locus_tag LOCUS_33710 14115 13420 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025186461.1 protein_id gnl|my_center|LOCUS_33710 14730 14311 gene locus_tag LOCUS_33720 14730 14311 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131142.1 protein_id gnl|my_center|LOCUS_33720 15128 15922 gene locus_tag LOCUS_33730 15128 15922 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774239.1 protein_id gnl|my_center|LOCUS_33730 16577 17947 gene locus_tag LOCUS_33740 16577 17947 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286833.1 protein_id gnl|my_center|LOCUS_33740 18041 18487 gene locus_tag LOCUS_33750 18041 18487 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986684.1 protein_id gnl|my_center|LOCUS_33750 19732 18524 gene locus_tag LOCUS_33760 19732 18524 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706833.1 protein_id gnl|my_center|LOCUS_33760 19878 20231 gene locus_tag LOCUS_33770 19878 20231 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356348.1 protein_id gnl|my_center|LOCUS_33770 21129 20311 gene locus_tag LOCUS_33780 gene thiD 21129 20311 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362487.1 protein_id gnl|my_center|LOCUS_33780 21755 21126 gene locus_tag LOCUS_33790 gene thiE 21755 21126 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714091.1 protein_id gnl|my_center|LOCUS_33790 22561 21746 gene locus_tag LOCUS_33800 22561 21746 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387209.1 protein_id gnl|my_center|LOCUS_33800 23082 22561 gene locus_tag LOCUS_33810 gene thiW 23082 22561 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381399.1 protein_id gnl|my_center|LOCUS_33810 23450 23839 gene locus_tag LOCUS_33820 23450 23839 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287076.1 protein_id gnl|my_center|LOCUS_33820 28068 23878 gene locus_tag LOCUS_33830 28068 23878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 28877 28203 gene locus_tag LOCUS_33840 28877 28203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 29811 28879 gene locus_tag LOCUS_33850 gene srtC1 29811 28879 CDS product FCT-2 pilus polymerization class B sortase SrtC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921812.1 protein_id gnl|my_center|LOCUS_33850 31081 29813 gene locus_tag LOCUS_33860 31081 29813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 31690 31142 gene locus_tag LOCUS_33870 gene lepB 31690 31142 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662501.1 protein_id gnl|my_center|LOCUS_33870 32480 32187 gene locus_tag LOCUS_33880 32480 32187 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363321.1 protein_id gnl|my_center|LOCUS_33880 34024 32501 gene locus_tag LOCUS_33890 34024 32501 CDS product M protein trans-acting positive regulator PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245188.1 protein_id gnl|my_center|LOCUS_33890 34794 34408 gene locus_tag LOCUS_33900 34794 34408 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254453.1 protein_id gnl|my_center|LOCUS_33900 35371 34862 gene locus_tag LOCUS_33910 35371 34862 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_33910 36435 35434 gene locus_tag LOCUS_33920 36435 35434 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819141.1 protein_id gnl|my_center|LOCUS_33920 36644 36967 gene locus_tag LOCUS_33930 36644 36967 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356136.1 protein_id gnl|my_center|LOCUS_33930 38093 37119 gene locus_tag LOCUS_33940 38093 37119 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287490.1 protein_id gnl|my_center|LOCUS_33940 38490 39194 gene locus_tag LOCUS_33950 38490 39194 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359858.1 protein_id gnl|my_center|LOCUS_33950 39305 40741 gene locus_tag LOCUS_33960 39305 40741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 40881 41075 gene locus_tag LOCUS_33970 40881 41075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 41145 42137 gene locus_tag LOCUS_33980 41145 42137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 43168 42272 gene locus_tag LOCUS_33990 43168 42272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 >Feature sequence33 2101 608 gene locus_tag LOCUS_34000 gene lysS 2101 608 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296055.1 protein_id gnl|my_center|LOCUS_34000 3199 2192 gene locus_tag LOCUS_34010 gene dusB 3199 2192 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290055.1 protein_id gnl|my_center|LOCUS_34010 4086 3202 gene locus_tag LOCUS_34020 gene hslO 4086 3202 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296053.1 protein_id gnl|my_center|LOCUS_34020 4548 4237 gene locus_tag LOCUS_34030 4548 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 5107 4589 gene locus_tag LOCUS_34040 gene paiA 5107 4589 CDS product spermidine/spermine N(1)-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244000.1 protein_id gnl|my_center|LOCUS_34040 7233 5167 gene locus_tag LOCUS_34050 gene ftsH 7233 5167 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287418.1 protein_id gnl|my_center|LOCUS_34050 7875 7330 gene locus_tag LOCUS_34060 gene hpt 7875 7330 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287415.1 protein_id gnl|my_center|LOCUS_34060 9223 7889 gene locus_tag LOCUS_34070 gene tilS 9223 7889 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287414.1 protein_id gnl|my_center|LOCUS_34070 9765 9322 gene locus_tag LOCUS_34080 9765 9322 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356258.1 protein_id gnl|my_center|LOCUS_34080 10255 9821 gene locus_tag LOCUS_34090 10255 9821 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287409.1 protein_id gnl|my_center|LOCUS_34090 10556 10290 gene locus_tag LOCUS_34100 10556 10290 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287407.1 protein_id gnl|my_center|LOCUS_34100 12149 10560 gene locus_tag LOCUS_34110 12149 10560 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287405.1 protein_id gnl|my_center|LOCUS_34110 15674 12162 gene locus_tag LOCUS_34120 gene mfd 15674 12162 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287403.1 protein_id gnl|my_center|LOCUS_34120 16292 15735 gene locus_tag LOCUS_34130 gene pth 16292 15735 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287401.1 protein_id gnl|my_center|LOCUS_34130 16649 17629 gene locus_tag LOCUS_34140 16649 17629 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287399.1 protein_id gnl|my_center|LOCUS_34140 17837 19243 gene locus_tag LOCUS_34150 17837 19243 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287397.1 protein_id gnl|my_center|LOCUS_34150 20018 19296 gene locus_tag LOCUS_34160 20018 19296 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287391.1 protein_id gnl|my_center|LOCUS_34160 20596 20093 gene locus_tag LOCUS_34170 20596 20093 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287389.1 protein_id gnl|my_center|LOCUS_34170 22117 20663 gene locus_tag LOCUS_34180 22117 20663 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287386.1 protein_id gnl|my_center|LOCUS_34180 22863 22333 gene locus_tag LOCUS_34190 gene mreD 22863 22333 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287385.1 protein_id gnl|my_center|LOCUS_34190 23717 22860 gene locus_tag LOCUS_34200 gene mreC 23717 22860 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287383.1 protein_id gnl|my_center|LOCUS_34200 24518 23880 gene locus_tag LOCUS_34210 24518 23880 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287382.1 protein_id gnl|my_center|LOCUS_34210 25168 24518 gene locus_tag LOCUS_34220 gene rpe 25168 24518 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354925.1 protein_id gnl|my_center|LOCUS_34220 26123 25242 gene locus_tag LOCUS_34230 gene rsgA 26123 25242 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287379.1 protein_id gnl|my_center|LOCUS_34230 28443 26287 gene locus_tag LOCUS_34240 gene ireK 28443 26287 CDS product serine/threonine protein kinase IreK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387383.1 protein_id gnl|my_center|LOCUS_34240 29183 28440 gene locus_tag LOCUS_34250 29183 28440 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 protein_id gnl|my_center|LOCUS_34250 30557 29205 gene locus_tag LOCUS_34260 gene rsmB 30557 29205 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378969.1 protein_id gnl|my_center|LOCUS_34260 31499 30558 gene locus_tag LOCUS_34270 gene fmt 31499 30558 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365369.1 protein_id gnl|my_center|LOCUS_34270 31983 31492 gene locus_tag LOCUS_34280 gene def 31983 31492 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287369.1 protein_id gnl|my_center|LOCUS_34280 34412 32010 gene locus_tag LOCUS_34290 gene priA 34412 32010 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287367.1 protein_id gnl|my_center|LOCUS_34290 34873 34571 gene locus_tag LOCUS_34300 gene rpoZ 34873 34571 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287365.1 protein_id gnl|my_center|LOCUS_34300 35492 34878 gene locus_tag LOCUS_34310 gene gmk 35492 34878 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287358.1 protein_id gnl|my_center|LOCUS_34310 36488 35604 gene locus_tag LOCUS_34320 36488 35604 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387384.1 protein_id gnl|my_center|LOCUS_34320 36739 36524 gene locus_tag LOCUS_34330 36739 36524 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381076.1 protein_id gnl|my_center|LOCUS_34330 38377 36764 gene locus_tag LOCUS_34340 38377 36764 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287350.1 protein_id gnl|my_center|LOCUS_34340 39204 38500 gene locus_tag LOCUS_34350 39204 38500 CDS product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296196.1 protein_id gnl|my_center|LOCUS_34350 39473 40243 gene locus_tag LOCUS_34360 39473 40243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354996.1 protein_id gnl|my_center|LOCUS_34360 40881 40294 gene locus_tag LOCUS_34370 gene thiT 40881 40294 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287348.1 protein_id gnl|my_center|LOCUS_34370 41459 41097 gene locus_tag LOCUS_34380 41459 41097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289815.1 protein_id gnl|my_center|LOCUS_34380 41990 41532 gene locus_tag LOCUS_34390 41990 41532 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387365.1 protein_id gnl|my_center|LOCUS_34390 42044 43012 gene locus_tag LOCUS_34400 42044 43012 CDS product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101156.1 protein_id gnl|my_center|LOCUS_34400 43590 43015 gene locus_tag LOCUS_34410 43590 43015 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289813.1 protein_id gnl|my_center|LOCUS_34410 44603 43602 gene locus_tag LOCUS_34420 gene ruvB 44603 43602 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381340.1 protein_id gnl|my_center|LOCUS_34420 45210 44617 gene locus_tag LOCUS_34430 gene ruvA 45210 44617 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290528.1 protein_id gnl|my_center|LOCUS_34430 >Feature sequence34 13 98 gene locus_tag LOCUS_t00390 13 98 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 110 185 gene locus_tag LOCUS_t00400 110 185 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 200 276 gene locus_tag LOCUS_t00410 200 276 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 397 861 gene locus_tag LOCUS_34440 397 861 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289036.1 protein_id gnl|my_center|LOCUS_34440 867 3365 gene locus_tag LOCUS_34450 867 3365 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378875.1 protein_id gnl|my_center|LOCUS_34450 3471 4385 gene locus_tag LOCUS_34460 3471 4385 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354722.1 protein_id gnl|my_center|LOCUS_34460 4399 5640 gene locus_tag LOCUS_34470 4399 5640 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304804.1 protein_id gnl|my_center|LOCUS_34470 5817 7166 gene locus_tag LOCUS_34480 gene gor 5817 7166 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289031.1 protein_id gnl|my_center|LOCUS_34480 8179 7226 gene locus_tag LOCUS_34490 8179 7226 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304811.1 protein_id gnl|my_center|LOCUS_34490 9081 8278 gene locus_tag LOCUS_34500 9081 8278 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289388.1 protein_id gnl|my_center|LOCUS_34500 9979 9059 gene locus_tag LOCUS_34510 9979 9059 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289390.1 protein_id gnl|my_center|LOCUS_34510 10984 10019 gene locus_tag LOCUS_34520 10984 10019 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289394.1 protein_id gnl|my_center|LOCUS_34520 11693 15307 gene locus_tag LOCUS_34530 gene rpoB 11693 15307 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295964.1 protein_id gnl|my_center|LOCUS_34530 15508 19161 gene locus_tag LOCUS_34540 gene rpoC 15508 19161 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288141.1 protein_id gnl|my_center|LOCUS_34540 19375 20475 gene locus_tag LOCUS_34550 19375 20475 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295400.1 protein_id gnl|my_center|LOCUS_34550 20621 21145 gene locus_tag LOCUS_34560 gene msrA 20621 21145 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723414.1 protein_id gnl|my_center|LOCUS_34560 21324 21127 gene locus_tag LOCUS_34570 21324 21127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 21944 22411 gene locus_tag LOCUS_34580 21944 22411 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297290.1 protein_id gnl|my_center|LOCUS_34580 23157 22453 gene locus_tag LOCUS_34590 23157 22453 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666310.1 protein_id gnl|my_center|LOCUS_34590 24679 23150 gene locus_tag LOCUS_34600 24679 23150 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_34600 25515 24766 gene locus_tag LOCUS_34610 25515 24766 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363162.1 protein_id gnl|my_center|LOCUS_34610 25663 26613 gene locus_tag LOCUS_34620 gene pfkB 25663 26613 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355534.1 protein_id gnl|my_center|LOCUS_34620 26595 28037 gene locus_tag LOCUS_34630 26595 28037 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355535.1 protein_id gnl|my_center|LOCUS_34630 28051 28509 gene locus_tag LOCUS_34640 28051 28509 CDS product fructose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358680.1 protein_id gnl|my_center|LOCUS_34640 28506 29480 gene locus_tag LOCUS_34650 gene lacD 28506 29480 CDS product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371479.1 protein_id gnl|my_center|LOCUS_34650 30891 29521 gene locus_tag LOCUS_34660 gene argH 30891 29521 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989893.1 protein_id gnl|my_center|LOCUS_34660 32421 31213 gene locus_tag LOCUS_34670 32421 31213 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731945.1 protein_id gnl|my_center|LOCUS_34670 32758 33201 gene locus_tag LOCUS_34680 gene rplM 32758 33201 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295975.1 protein_id gnl|my_center|LOCUS_34680 33218 33610 gene locus_tag LOCUS_34690 gene rpsI 33218 33610 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354786.1 protein_id gnl|my_center|LOCUS_34690 34925 33699 gene locus_tag LOCUS_34700 34925 33699 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205010568.1 protein_id gnl|my_center|LOCUS_34700 35155 34997 gene locus_tag LOCUS_34710 35155 34997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 37512 36577 gene locus_tag LOCUS_34720 37512 36577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34720 37819 37493 gene locus_tag LOCUS_34730 37819 37493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34730 38787 38936 gene locus_tag LOCUS_34740 38787 38936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 >Feature sequence35 347 114 gene locus_tag LOCUS_34750 gene rpsR 347 114 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288370.1 protein_id gnl|my_center|LOCUS_34750 877 371 gene locus_tag LOCUS_34760 gene ssb 877 371 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288368.1 protein_id gnl|my_center|LOCUS_34760 1224 922 gene locus_tag LOCUS_34770 gene rpsF 1224 922 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356019.1 protein_id gnl|my_center|LOCUS_34770 3908 1404 gene locus_tag LOCUS_34780 gene gyrA 3908 1404 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361457.1 protein_id gnl|my_center|LOCUS_34780 5872 3923 gene locus_tag LOCUS_34790 gene gyrB 5872 3923 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288364.1 protein_id gnl|my_center|LOCUS_34790 6991 5873 gene locus_tag LOCUS_34800 gene recF 6991 5873 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288363.1 protein_id gnl|my_center|LOCUS_34800 7220 6978 gene locus_tag LOCUS_34810 gene yaaA 7220 6978 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295251.1 protein_id gnl|my_center|LOCUS_34810 8585 7455 gene locus_tag LOCUS_34820 gene dnaN 8585 7455 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288361.1 protein_id gnl|my_center|LOCUS_34820 10153 8828 gene locus_tag LOCUS_34830 gene dnaA 10153 8828 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288360.1 protein_id gnl|my_center|LOCUS_34830 10669 10803 gene locus_tag LOCUS_34840 gene rpmH 10669 10803 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293121.1 protein_id gnl|my_center|LOCUS_34840 10941 11276 gene locus_tag LOCUS_34850 gene rnpA 10941 11276 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295255.1 protein_id gnl|my_center|LOCUS_34850 11294 12115 gene locus_tag LOCUS_34860 11294 12115 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295256.1 protein_id gnl|my_center|LOCUS_34860 12177 12947 gene locus_tag LOCUS_34870 12177 12947 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387430.1 protein_id gnl|my_center|LOCUS_34870 13167 14564 gene locus_tag LOCUS_34880 gene mnmE 13167 14564 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295261.1 protein_id gnl|my_center|LOCUS_34880 14580 16481 gene locus_tag LOCUS_34890 gene mnmG 14580 16481 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355988.1 protein_id gnl|my_center|LOCUS_34890 17408 16653 gene locus_tag LOCUS_34900 gene aroD 17408 16653 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357400.1 protein_id gnl|my_center|LOCUS_34900 18297 17419 gene locus_tag LOCUS_34910 18297 17419 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983735.1 protein_id gnl|my_center|LOCUS_34910 19679 18471 gene locus_tag LOCUS_34920 19679 18471 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704390.1 protein_id gnl|my_center|LOCUS_34920 19824 20714 gene locus_tag LOCUS_34930 19824 20714 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989491.1 protein_id gnl|my_center|LOCUS_34930 20834 21547 gene locus_tag LOCUS_34940 gene rsmG 20834 21547 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355977.1 protein_id gnl|my_center|LOCUS_34940 21618 22385 gene locus_tag LOCUS_34950 21618 22385 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_34950 22372 23262 gene locus_tag LOCUS_34960 22372 23262 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288806.1 protein_id gnl|my_center|LOCUS_34960 23310 23507 gene locus_tag LOCUS_34970 23310 23507 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355974.1 protein_id gnl|my_center|LOCUS_34970 23538 24638 gene locus_tag LOCUS_34980 gene ychF 23538 24638 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293105.1 protein_id gnl|my_center|LOCUS_34980 24653 25357 gene locus_tag LOCUS_34990 24653 25357 CDS product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296943.1 protein_id gnl|my_center|LOCUS_34990 26110 25397 gene locus_tag LOCUS_35000 26110 25397 CDS product DUF4811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286342.1 protein_id gnl|my_center|LOCUS_35000 27573 26107 gene locus_tag LOCUS_35010 27573 26107 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286343.1 protein_id gnl|my_center|LOCUS_35010 27717 28184 gene locus_tag LOCUS_35020 27717 28184 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286344.1 protein_id gnl|my_center|LOCUS_35020 28295 29779 gene locus_tag LOCUS_35030 gene guaB 28295 29779 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355966.1 protein_id gnl|my_center|LOCUS_35030 31118 29838 gene locus_tag LOCUS_35040 gene serS 31118 29838 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295265.1 protein_id gnl|my_center|LOCUS_35040 32584 31403 gene locus_tag LOCUS_35050 32584 31403 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295267.1 protein_id gnl|my_center|LOCUS_35050 33263 32574 gene locus_tag LOCUS_35060 33263 32574 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295268.1 protein_id gnl|my_center|LOCUS_35060 >Feature sequence36 107 182 gene locus_tag LOCUS_t00420 107 182 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 281 643 gene locus_tag LOCUS_35070 281 643 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287966.1 protein_id gnl|my_center|LOCUS_35070 1278 658 gene locus_tag LOCUS_35080 1278 658 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379044.1 protein_id gnl|my_center|LOCUS_35080 2263 1289 gene locus_tag LOCUS_35090 2263 1289 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399656.1 protein_id gnl|my_center|LOCUS_35090 2387 3034 gene locus_tag LOCUS_35100 2387 3034 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_35100 3755 3090 gene locus_tag LOCUS_35110 3755 3090 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002326685.1 protein_id gnl|my_center|LOCUS_35110 4529 5932 gene locus_tag LOCUS_35120 4529 5932 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287397.1 protein_id gnl|my_center|LOCUS_35120 6241 6972 gene locus_tag LOCUS_35130 6241 6972 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360115.1 protein_id gnl|my_center|LOCUS_35130 6985 8157 gene locus_tag LOCUS_35140 6985 8157 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357242.1 protein_id gnl|my_center|LOCUS_35140 8182 9189 gene locus_tag LOCUS_35150 gene lacD 8182 9189 CDS product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357245.1 protein_id gnl|my_center|LOCUS_35150 9200 10153 gene locus_tag LOCUS_35160 9200 10153 CDS product hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706669.1 protein_id gnl|my_center|LOCUS_35160 10864 10154 gene locus_tag LOCUS_35170 10864 10154 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901967.1 protein_id gnl|my_center|LOCUS_35170 11037 12815 gene locus_tag LOCUS_35180 11037 12815 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364115.1 protein_id gnl|my_center|LOCUS_35180 12818 13297 gene locus_tag LOCUS_35190 12818 13297 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364114.1 protein_id gnl|my_center|LOCUS_35190 13309 14208 gene locus_tag LOCUS_35200 13309 14208 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357253.1 protein_id gnl|my_center|LOCUS_35200 14195 15004 gene locus_tag LOCUS_35210 14195 15004 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357254.1 protein_id gnl|my_center|LOCUS_35210 15036 15437 gene locus_tag LOCUS_35220 15036 15437 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194089.1 protein_id gnl|my_center|LOCUS_35220 15557 16147 gene locus_tag LOCUS_35230 15557 16147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 16294 16818 gene locus_tag LOCUS_35240 16294 16818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 18110 16968 gene locus_tag LOCUS_35250 18110 16968 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774224.1 protein_id gnl|my_center|LOCUS_35250 19390 18428 gene locus_tag LOCUS_35260 19390 18428 CDS product DUF3644 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263485.1 protein_id gnl|my_center|LOCUS_35260 20436 19465 gene locus_tag LOCUS_35270 20436 19465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 21049 20438 gene locus_tag LOCUS_35280 21049 20438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 22136 21066 gene locus_tag LOCUS_35290 22136 21066 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989793.1 protein_id gnl|my_center|LOCUS_35290 22808 22152 gene locus_tag LOCUS_35300 22808 22152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 22967 23188 gene locus_tag LOCUS_35310 22967 23188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 23239 23391 gene locus_tag LOCUS_35320 23239 23391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 23457 23993 gene locus_tag LOCUS_35330 23457 23993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074799226.1 protein_id gnl|my_center|LOCUS_35330 23994 24239 gene locus_tag LOCUS_35340 23994 24239 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359946.1 protein_id gnl|my_center|LOCUS_35340 24241 24441 gene locus_tag LOCUS_35350 24241 24441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 24518 24856 gene locus_tag LOCUS_35360 24518 24856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 24943 25884 gene locus_tag LOCUS_35370 24943 25884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 25856 26650 gene locus_tag LOCUS_35380 25856 26650 CDS product PD-(D/E)XK nuclease-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025480718.1 protein_id gnl|my_center|LOCUS_35380 26666 27553 gene locus_tag LOCUS_35390 26666 27553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 27550 27813 gene locus_tag LOCUS_35400 27550 27813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 27810 28220 gene locus_tag LOCUS_35410 27810 28220 CDS product DUF1064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905958.1 protein_id gnl|my_center|LOCUS_35410 28217 28477 gene locus_tag LOCUS_35420 28217 28477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 28464 28754 gene locus_tag LOCUS_35430 28464 28754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 28757 28960 gene locus_tag LOCUS_35440 28757 28960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 28981 29982 gene locus_tag LOCUS_35450 28981 29982 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122014502.1 protein_id gnl|my_center|LOCUS_35450 29998 30309 gene locus_tag LOCUS_35460 29998 30309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 30335 30526 gene locus_tag LOCUS_35470 30335 30526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 30579 30884 gene locus_tag LOCUS_35480 30579 30884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 30917 31249 gene locus_tag LOCUS_35490 30917 31249 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965233.1 protein_id gnl|my_center|LOCUS_35490 31277 31486 gene locus_tag LOCUS_35500 31277 31486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 31483 31602 gene locus_tag LOCUS_35510 31483 31602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 31647 31970 gene locus_tag LOCUS_35520 31647 31970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 >Feature sequence37 536 2437 gene locus_tag LOCUS_35530 536 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 3121 2585 gene locus_tag LOCUS_35540 3121 2585 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844917.1 protein_id gnl|my_center|LOCUS_35540 4644 3193 gene locus_tag LOCUS_35550 4644 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 4939 5193 gene locus_tag LOCUS_35560 4939 5193 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948437.1 protein_id gnl|my_center|LOCUS_35560 5263 5433 gene locus_tag LOCUS_35570 5263 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 5889 5521 gene locus_tag LOCUS_35580 5889 5521 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288776.1 protein_id gnl|my_center|LOCUS_35580 5993 6916 gene locus_tag LOCUS_35590 5993 6916 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387471.1 protein_id gnl|my_center|LOCUS_35590 6953 7594 gene locus_tag LOCUS_35600 6953 7594 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642580.1 protein_id gnl|my_center|LOCUS_35600 8456 7644 gene locus_tag LOCUS_35610 8456 7644 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296669.1 protein_id gnl|my_center|LOCUS_35610 8756 9610 gene locus_tag LOCUS_35620 8756 9610 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296670.1 protein_id gnl|my_center|LOCUS_35620 9610 10497 gene locus_tag LOCUS_35630 9610 10497 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296671.1 protein_id gnl|my_center|LOCUS_35630 10513 10695 gene locus_tag LOCUS_35640 10513 10695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 11262 10792 gene locus_tag LOCUS_35650 11262 10792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 11444 11809 gene locus_tag LOCUS_35660 11444 11809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 11806 12081 gene locus_tag LOCUS_35670 11806 12081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 12620 13003 gene locus_tag LOCUS_35680 12620 13003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 13051 13659 gene locus_tag LOCUS_35690 13051 13659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 13712 14101 gene locus_tag LOCUS_35700 13712 14101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 14116 14520 gene locus_tag LOCUS_35710 14116 14520 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009912062.1 protein_id gnl|my_center|LOCUS_35710 14527 16344 gene locus_tag LOCUS_35720 14527 16344 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989525.1 protein_id gnl|my_center|LOCUS_35720 16341 17111 gene locus_tag LOCUS_35730 16341 17111 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732640.1 protein_id gnl|my_center|LOCUS_35730 17219 18082 gene locus_tag LOCUS_35740 17219 18082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876565.1 protein_id gnl|my_center|LOCUS_35740 18592 18185 gene locus_tag LOCUS_35750 18592 18185 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784700.1 protein_id gnl|my_center|LOCUS_35750 18831 19871 gene locus_tag LOCUS_35760 18831 19871 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296414.1 protein_id gnl|my_center|LOCUS_35760 19973 21274 gene locus_tag LOCUS_35770 gene celB 19973 21274 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748651.1 protein_id gnl|my_center|LOCUS_35770 21290 21748 gene locus_tag LOCUS_35780 21290 21748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 21745 23979 gene locus_tag LOCUS_35790 21745 23979 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674363.1 protein_id gnl|my_center|LOCUS_35790 24214 25080 gene locus_tag LOCUS_35800 24214 25080 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964831.1 protein_id gnl|my_center|LOCUS_35800 25081 26520 gene locus_tag LOCUS_35810 25081 26520 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922527.1 protein_id gnl|my_center|LOCUS_35810 26526 26840 gene locus_tag LOCUS_35820 26526 26840 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287582.1 protein_id gnl|my_center|LOCUS_35820 26854 27165 gene locus_tag LOCUS_35830 26854 27165 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355919.1 protein_id gnl|my_center|LOCUS_35830 27354 28220 gene locus_tag LOCUS_35840 27354 28220 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613346.1 protein_id gnl|my_center|LOCUS_35840 28831 29163 gene locus_tag LOCUS_35850 28831 29163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 29403 30014 gene locus_tag LOCUS_35860 29403 30014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 >Feature sequence38 673 128 gene locus_tag LOCUS_35870 673 128 CDS product ReoY family proteolytic degradation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289878.1 protein_id gnl|my_center|LOCUS_35870 1934 687 gene locus_tag LOCUS_35880 1934 687 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377424.1 protein_id gnl|my_center|LOCUS_35880 2987 1935 gene locus_tag LOCUS_35890 2987 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298135.1 protein_id gnl|my_center|LOCUS_35890 3844 3149 gene locus_tag LOCUS_35900 3844 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 4385 4110 gene locus_tag LOCUS_35910 4385 4110 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290178.1 protein_id gnl|my_center|LOCUS_35910 5924 4614 gene locus_tag LOCUS_35920 gene der 5924 4614 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296982.1 protein_id gnl|my_center|LOCUS_35920 7582 6362 gene locus_tag LOCUS_35930 gene rpsA 7582 6362 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294406.1 protein_id gnl|my_center|LOCUS_35930 8400 7729 gene locus_tag LOCUS_35940 gene cmk 8400 7729 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357612.1 protein_id gnl|my_center|LOCUS_35940 9108 8461 gene locus_tag LOCUS_35950 9108 8461 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294404.1 protein_id gnl|my_center|LOCUS_35950 10571 9177 gene locus_tag LOCUS_35960 10571 9177 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311164.1 protein_id gnl|my_center|LOCUS_35960 11557 10571 gene locus_tag LOCUS_35970 11557 10571 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294402.1 protein_id gnl|my_center|LOCUS_35970 11586 11798 gene locus_tag LOCUS_35980 11586 11798 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357617.1 protein_id gnl|my_center|LOCUS_35980 12450 11857 gene locus_tag LOCUS_35990 12450 11857 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382314.1 protein_id gnl|my_center|LOCUS_35990 13475 12759 gene locus_tag LOCUS_36000 13475 12759 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294391.1 protein_id gnl|my_center|LOCUS_36000 14056 13478 gene locus_tag LOCUS_36010 gene scpB 14056 13478 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357625.1 protein_id gnl|my_center|LOCUS_36010 14799 14053 gene locus_tag LOCUS_36020 14799 14053 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382313.1 protein_id gnl|my_center|LOCUS_36020 15166 14801 gene locus_tag LOCUS_36030 15166 14801 CDS product protein RibT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294387.1 protein_id gnl|my_center|LOCUS_36030 16071 15181 gene locus_tag LOCUS_36040 gene xerD 16071 15181 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294386.1 protein_id gnl|my_center|LOCUS_36040 16639 16184 gene locus_tag LOCUS_36050 16639 16184 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357640.1 protein_id gnl|my_center|LOCUS_36050 17607 16753 gene locus_tag LOCUS_36060 17607 16753 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361792.1 protein_id gnl|my_center|LOCUS_36060 19389 17689 gene locus_tag LOCUS_36070 19389 17689 CDS product cell division site-positioning protein MapZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382310.1 protein_id gnl|my_center|LOCUS_36070 20723 19614 gene locus_tag LOCUS_36080 gene rpoD 20723 19614 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360364.1 protein_id gnl|my_center|LOCUS_36080 22566 20746 gene locus_tag LOCUS_36090 gene dnaG 22566 20746 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289497.1 protein_id gnl|my_center|LOCUS_36090 23352 22717 gene locus_tag LOCUS_36100 23352 22717 CDS product lysozyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289460.1 protein_id gnl|my_center|LOCUS_36100 23536 24258 gene locus_tag LOCUS_36110 23536 24258 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289461.1 protein_id gnl|my_center|LOCUS_36110 24263 26842 gene locus_tag LOCUS_36120 gene mprF 24263 26842 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002300997.1 protein_id gnl|my_center|LOCUS_36120 27200 27946 gene locus_tag LOCUS_36130 27200 27946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 28975 27989 gene locus_tag LOCUS_36140 28975 27989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 >Feature sequence39 206 1627 gene locus_tag LOCUS_36150 206 1627 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387088.1 protein_id gnl|my_center|LOCUS_36150 1628 2359 gene locus_tag LOCUS_36160 1628 2359 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731935.1 protein_id gnl|my_center|LOCUS_36160 2753 5362 gene locus_tag LOCUS_36170 gene mgtA 2753 5362 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388982.1 protein_id gnl|my_center|LOCUS_36170 5745 6863 gene locus_tag LOCUS_36180 gene pdhA 5745 6863 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289692.1 protein_id gnl|my_center|LOCUS_36180 6866 7843 gene locus_tag LOCUS_36190 6866 7843 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289688.1 protein_id gnl|my_center|LOCUS_36190 7863 9518 gene locus_tag LOCUS_36200 7863 9518 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289687.1 protein_id gnl|my_center|LOCUS_36200 9526 10932 gene locus_tag LOCUS_36210 gene lpdA 9526 10932 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289686.1 protein_id gnl|my_center|LOCUS_36210 11381 11578 gene locus_tag LOCUS_36220 11381 11578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 11661 11930 gene locus_tag LOCUS_36230 11661 11930 CDS product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356679.1 protein_id gnl|my_center|LOCUS_36230 11993 12757 gene locus_tag LOCUS_36240 11993 12757 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356680.1 protein_id gnl|my_center|LOCUS_36240 12869 14710 gene locus_tag LOCUS_36250 gene typA 12869 14710 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288735.1 protein_id gnl|my_center|LOCUS_36250 14982 15368 gene locus_tag LOCUS_36260 14982 15368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 15416 16042 gene locus_tag LOCUS_36270 15416 16042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 16510 16812 gene locus_tag LOCUS_36280 16510 16812 CDS product YlaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356684.1 protein_id gnl|my_center|LOCUS_36280 16816 18006 gene locus_tag LOCUS_36290 16816 18006 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288740.1 protein_id gnl|my_center|LOCUS_36290 18012 21434 gene locus_tag LOCUS_36300 18012 21434 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288741.1 protein_id gnl|my_center|LOCUS_36300 21472 22584 gene locus_tag LOCUS_36310 21472 22584 CDS product CAP-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295486.1 protein_id gnl|my_center|LOCUS_36310 22581 23006 gene locus_tag LOCUS_36320 22581 23006 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305283.1 protein_id gnl|my_center|LOCUS_36320 22999 23340 gene locus_tag LOCUS_36330 22999 23340 CDS product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297107.1 protein_id gnl|my_center|LOCUS_36330 23500 24054 gene locus_tag LOCUS_36340 gene rsmD 23500 24054 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706551.1 protein_id gnl|my_center|LOCUS_36340 24056 24550 gene locus_tag LOCUS_36350 gene coaD 24056 24550 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295492.1 protein_id gnl|my_center|LOCUS_36350 24540 25583 gene locus_tag LOCUS_36360 24540 25583 CDS product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295493.1 protein_id gnl|my_center|LOCUS_36360 25689 26294 gene locus_tag LOCUS_36370 25689 26294 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922190.1 protein_id gnl|my_center|LOCUS_36370 27244 27636 gene locus_tag LOCUS_36380 27244 27636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 >Feature sequence40 47 1024 gene locus_tag LOCUS_36390 47 1024 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298803.1 protein_id gnl|my_center|LOCUS_36390 1692 3494 gene locus_tag LOCUS_36400 gene ltrA 1692 3494 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002335621.1 protein_id gnl|my_center|LOCUS_36400 3543 3935 gene locus_tag LOCUS_36410 3543 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 3980 5122 gene locus_tag LOCUS_36420 gene dcm 3980 5122 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286932.1 protein_id gnl|my_center|LOCUS_36420 5112 5252 gene locus_tag LOCUS_36430 5112 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36430 5252 5401 gene locus_tag LOCUS_36440 5252 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36440 5657 6841 gene locus_tag LOCUS_36450 gene mobT 5657 6841 CDS product MobT family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360076.1 protein_id gnl|my_center|LOCUS_36450 6929 7201 gene locus_tag LOCUS_36460 6929 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298822.1 protein_id gnl|my_center|LOCUS_36460 7214 7489 gene locus_tag LOCUS_36470 7214 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 7455 7643 gene locus_tag LOCUS_36480 7455 7643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 7770 8807 gene locus_tag LOCUS_36490 7770 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 8822 10519 gene locus_tag LOCUS_36500 8822 10519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 10512 10973 gene locus_tag LOCUS_36510 10512 10973 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188927153.1 protein_id gnl|my_center|LOCUS_36510 10986 11846 gene locus_tag LOCUS_36520 10986 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 11884 12273 gene locus_tag LOCUS_36530 11884 12273 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298826.1 protein_id gnl|my_center|LOCUS_36530 12260 14707 gene locus_tag LOCUS_36540 12260 14707 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002330910.1 protein_id gnl|my_center|LOCUS_36540 14712 16820 gene locus_tag LOCUS_36550 14712 16820 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297347.1 protein_id gnl|my_center|LOCUS_36550 16817 17821 gene locus_tag LOCUS_36560 16817 17821 CDS product bifunctional lysozyme/C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289057.1 protein_id gnl|my_center|LOCUS_36560 17840 18751 gene locus_tag LOCUS_36570 17840 18751 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122646621.1 protein_id gnl|my_center|LOCUS_36570 19171 19386 gene locus_tag LOCUS_36580 19171 19386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 19628 19413 gene locus_tag LOCUS_36590 19628 19413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288966.1 protein_id gnl|my_center|LOCUS_36590 21517 20399 gene locus_tag LOCUS_36600 21517 20399 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357746.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36600 21838 21518 gene locus_tag LOCUS_36610 21838 21518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36610 22428 22288 gene locus_tag LOCUS_36620 22428 22288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 23057 22386 gene locus_tag LOCUS_36630 23057 22386 CDS product AP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002397195.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36630 24857 23406 gene locus_tag LOCUS_36640 24857 23406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 26312 24969 gene locus_tag LOCUS_36650 26312 24969 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676360.1 protein_id gnl|my_center|LOCUS_36650 <27235 26446 gene locus_tag LOCUS_36660 <27235 26446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254524.1:Rib/alpha-like domain-containing protein >Feature sequence41 742 119 gene locus_tag LOCUS_36670 742 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 2470 1871 gene locus_tag LOCUS_36680 2470 1871 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287776.1 protein_id gnl|my_center|LOCUS_36680 3108 2659 gene locus_tag LOCUS_36690 3108 2659 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729316.1 protein_id gnl|my_center|LOCUS_36690 3886 3134 gene locus_tag LOCUS_36700 3886 3134 CDS product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931017.1 protein_id gnl|my_center|LOCUS_36700 4280 4852 gene locus_tag LOCUS_36710 4280 4852 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296332.1 protein_id gnl|my_center|LOCUS_36710 4894 4981 gene locus_tag LOCUS_t00430 4894 4981 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6076 5093 gene locus_tag LOCUS_36720 6076 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 6309 6542 gene locus_tag LOCUS_36730 6309 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362220.1 protein_id gnl|my_center|LOCUS_36730 6869 7252 gene locus_tag LOCUS_36740 6869 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 7294 7890 gene locus_tag LOCUS_36750 7294 7890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 8067 8849 gene locus_tag LOCUS_36760 8067 8849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706768.1 protein_id gnl|my_center|LOCUS_36760 8930 9430 gene locus_tag LOCUS_36770 8930 9430 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902172.1 protein_id gnl|my_center|LOCUS_36770 10284 9478 gene locus_tag LOCUS_36780 10284 9478 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355941.1 protein_id gnl|my_center|LOCUS_36780 10466 11668 gene locus_tag LOCUS_36790 10466 11668 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381323.1 protein_id gnl|my_center|LOCUS_36790 11953 11774 gene locus_tag LOCUS_36800 11953 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 12269 15526 gene locus_tag LOCUS_36810 gene dnaE 12269 15526 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311576.1 protein_id gnl|my_center|LOCUS_36810 15666 16628 gene locus_tag LOCUS_36820 gene pfkA 15666 16628 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355947.1 protein_id gnl|my_center|LOCUS_36820 16692 18476 gene locus_tag LOCUS_36830 gene pyk 16692 18476 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295355.1 protein_id gnl|my_center|LOCUS_36830 18892 19446 gene locus_tag LOCUS_36840 18892 19446 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295352.1 protein_id gnl|my_center|LOCUS_36840 19506 19685 gene locus_tag LOCUS_36850 gene rpmF 19506 19685 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290970.1 protein_id gnl|my_center|LOCUS_36850 20696 21394 gene locus_tag LOCUS_36860 20696 21394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 21828 23249 gene locus_tag LOCUS_36870 gene gndA 21828 23249 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355953.1 protein_id gnl|my_center|LOCUS_36870 23357 24043 gene locus_tag LOCUS_36880 23357 24043 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290973.1 protein_id gnl|my_center|LOCUS_36880 24040 25545 gene locus_tag LOCUS_36890 24040 25545 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298265.1 protein_id gnl|my_center|LOCUS_36890 >Feature sequence42 151 921 gene locus_tag LOCUS_36900 151 921 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363786.1 protein_id gnl|my_center|LOCUS_36900 1024 2268 gene locus_tag LOCUS_36910 1024 2268 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623651.1 protein_id gnl|my_center|LOCUS_36910 2315 2719 gene locus_tag LOCUS_36920 2315 2719 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966757.1 protein_id gnl|my_center|LOCUS_36920 2937 4613 gene locus_tag LOCUS_36930 gene kdpA 2937 4613 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377968.1 protein_id gnl|my_center|LOCUS_36930 4628 6658 gene locus_tag LOCUS_36940 gene kdpB 4628 6658 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377969.1 protein_id gnl|my_center|LOCUS_36940 6693 7223 gene locus_tag LOCUS_36950 6693 7223 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377970.1 protein_id gnl|my_center|LOCUS_36950 7292 9862 gene locus_tag LOCUS_36960 7292 9862 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088934995.1 protein_id gnl|my_center|LOCUS_36960 9873 10571 gene locus_tag LOCUS_36970 9873 10571 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358569.1 protein_id gnl|my_center|LOCUS_36970 10862 11161 gene locus_tag LOCUS_36980 10862 11161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 11137 11331 gene locus_tag LOCUS_36990 11137 11331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 11496 13289 gene locus_tag LOCUS_37000 11496 13289 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706563.1 protein_id gnl|my_center|LOCUS_37000 14793 13378 gene locus_tag LOCUS_37010 14793 13378 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704343.1 protein_id gnl|my_center|LOCUS_37010 15068 16873 gene locus_tag LOCUS_37020 gene glpO 15068 16873 CDS product type 1 glycerol-3-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379559.1 protein_id gnl|my_center|LOCUS_37020 16899 18407 gene locus_tag LOCUS_37030 gene glpK 16899 18407 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357138.1 protein_id gnl|my_center|LOCUS_37030 18502 19224 gene locus_tag LOCUS_37040 18502 19224 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641945.1 protein_id gnl|my_center|LOCUS_37040 19286 19822 gene locus_tag LOCUS_37050 19286 19822 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470149.1 protein_id gnl|my_center|LOCUS_37050 19855 20838 gene locus_tag LOCUS_37060 gene dhaK 19855 20838 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905235.1 protein_id gnl|my_center|LOCUS_37060 20937 21515 gene locus_tag LOCUS_37070 gene dhaL 20937 21515 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704296.1 protein_id gnl|my_center|LOCUS_37070 21526 21876 gene locus_tag LOCUS_37080 gene dhaM 21526 21876 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704317.1 protein_id gnl|my_center|LOCUS_37080 22036 23208 gene locus_tag LOCUS_37090 22036 23208 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861827.1 protein_id gnl|my_center|LOCUS_37090 23210 24088 gene locus_tag LOCUS_37100 23210 24088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 24069 24539 gene locus_tag LOCUS_37110 24069 24539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 >Feature sequence43 143 622 gene locus_tag LOCUS_37120 143 622 CDS product DUF1492 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464425.1 protein_id gnl|my_center|LOCUS_37120 1872 2129 gene locus_tag LOCUS_37130 1872 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366354.1 protein_id gnl|my_center|LOCUS_37130 2155 3024 gene locus_tag LOCUS_37140 2155 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 3005 4300 gene locus_tag LOCUS_37150 3005 4300 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_37150 4317 5735 gene locus_tag LOCUS_37160 4317 5735 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921892.1 protein_id gnl|my_center|LOCUS_37160 5707 6183 gene locus_tag LOCUS_37170 5707 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 6164 7402 gene locus_tag LOCUS_37180 6164 7402 CDS product minor capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928179.1 protein_id gnl|my_center|LOCUS_37180 7546 8202 gene locus_tag LOCUS_37190 7546 8202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 8220 9254 gene locus_tag LOCUS_37200 8220 9254 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047642.1 protein_id gnl|my_center|LOCUS_37200 9270 9617 gene locus_tag LOCUS_37210 9270 9617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 9742 9951 gene locus_tag LOCUS_37220 9742 9951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 9941 10480 gene locus_tag LOCUS_37230 9941 10480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 10477 10842 gene locus_tag LOCUS_37240 10477 10842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 10858 11295 gene locus_tag LOCUS_37250 10858 11295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 11367 11738 gene locus_tag LOCUS_37260 11367 11738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 11759 12118 gene locus_tag LOCUS_37270 11759 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 12122 16762 gene locus_tag LOCUS_37280 12122 16762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 16775 17134 gene locus_tag LOCUS_37290 16775 17134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 17143 19611 gene locus_tag LOCUS_37300 17143 19611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 19608 19733 gene locus_tag LOCUS_37310 19608 19733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 21097 19847 gene locus_tag LOCUS_37320 21097 19847 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002346915.1 protein_id gnl|my_center|LOCUS_37320 >Feature sequence44 2023 137 gene locus_tag LOCUS_37330 2023 137 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399157.1 protein_id gnl|my_center|LOCUS_37330 4244 2364 gene locus_tag LOCUS_37340 gene asnB 4244 2364 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906399.1 protein_id gnl|my_center|LOCUS_37340 5506 4475 gene locus_tag LOCUS_37350 5506 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295905.1 protein_id gnl|my_center|LOCUS_37350 6354 5506 gene locus_tag LOCUS_37360 6354 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 7602 6571 gene locus_tag LOCUS_37370 7602 6571 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921733.1 protein_id gnl|my_center|LOCUS_37370 8070 7888 gene locus_tag LOCUS_37380 8070 7888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295907.1 protein_id gnl|my_center|LOCUS_37380 10150 8126 gene locus_tag LOCUS_37390 10150 8126 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288183.1 protein_id gnl|my_center|LOCUS_37390 10217 10759 gene locus_tag LOCUS_37400 10217 10759 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295911.1 protein_id gnl|my_center|LOCUS_37400 11398 10739 gene locus_tag LOCUS_37410 11398 10739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 12299 11388 gene locus_tag LOCUS_37420 12299 11388 CDS product sce7725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295913.1 protein_id gnl|my_center|LOCUS_37420 13029 12304 gene locus_tag LOCUS_37430 13029 12304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298443.1 protein_id gnl|my_center|LOCUS_37430 14390 13065 gene locus_tag LOCUS_37440 14390 13065 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289757.1 protein_id gnl|my_center|LOCUS_37440 15346 14393 gene locus_tag LOCUS_37450 15346 14393 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289763.1 protein_id gnl|my_center|LOCUS_37450 16882 15347 gene locus_tag LOCUS_37460 16882 15347 CDS product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289765.1 protein_id gnl|my_center|LOCUS_37460 17008 17574 gene locus_tag LOCUS_37470 17008 17574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 17913 17614 gene locus_tag LOCUS_37480 17913 17614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 18229 17930 gene locus_tag LOCUS_37490 18229 17930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 19145 18240 gene locus_tag LOCUS_37500 19145 18240 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439096.1 protein_id gnl|my_center|LOCUS_37500 19464 19255 gene locus_tag LOCUS_37510 19464 19255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 20011 19652 gene locus_tag LOCUS_37520 20011 19652 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130423.1 protein_id gnl|my_center|LOCUS_37520 20148 20014 gene locus_tag LOCUS_37530 20148 20014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 20300 20145 gene locus_tag LOCUS_37540 20300 20145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 20955 20317 gene locus_tag LOCUS_37550 20955 20317 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226319270.1 protein_id gnl|my_center|LOCUS_37550 >Feature sequence45 774 142 gene locus_tag LOCUS_37560 774 142 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387338.1 protein_id gnl|my_center|LOCUS_37560 965 1366 gene locus_tag LOCUS_37570 965 1366 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286825.1 protein_id gnl|my_center|LOCUS_37570 1589 2242 gene locus_tag LOCUS_37580 1589 2242 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102173.1 protein_id gnl|my_center|LOCUS_37580 2740 2312 gene locus_tag LOCUS_37590 2740 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814944.1 protein_id gnl|my_center|LOCUS_37590 2939 2742 gene locus_tag LOCUS_37600 2939 2742 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438035.1 protein_id gnl|my_center|LOCUS_37600 4399 3065 gene locus_tag LOCUS_37610 4399 3065 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296179.1 protein_id gnl|my_center|LOCUS_37610 4855 5097 gene locus_tag LOCUS_37620 4855 5097 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131476.1 protein_id gnl|my_center|LOCUS_37620 6079 5138 gene locus_tag LOCUS_37630 6079 5138 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296177.1 protein_id gnl|my_center|LOCUS_37630 6355 7410 gene locus_tag LOCUS_37640 6355 7410 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296173.1 protein_id gnl|my_center|LOCUS_37640 7407 8297 gene locus_tag LOCUS_37650 gene murQ 7407 8297 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287094.1 protein_id gnl|my_center|LOCUS_37650 8310 10265 gene locus_tag LOCUS_37660 8310 10265 CDS product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287092.1 protein_id gnl|my_center|LOCUS_37660 10380 10697 gene locus_tag LOCUS_37670 10380 10697 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084855.1 protein_id gnl|my_center|LOCUS_37670 11590 10739 gene locus_tag LOCUS_37680 11590 10739 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287653.1 protein_id gnl|my_center|LOCUS_37680 11732 12367 gene locus_tag LOCUS_37690 11732 12367 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721665.1 protein_id gnl|my_center|LOCUS_37690 13210 12416 gene locus_tag LOCUS_37700 13210 12416 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131951.1 protein_id gnl|my_center|LOCUS_37700 14303 13296 gene locus_tag LOCUS_37710 14303 13296 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286379.1 protein_id gnl|my_center|LOCUS_37710 14984 14325 gene locus_tag LOCUS_37720 gene pgmB 14984 14325 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286375.1 protein_id gnl|my_center|LOCUS_37720 17262 14977 gene locus_tag LOCUS_37730 17262 14977 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286373.1 protein_id gnl|my_center|LOCUS_37730 17598 19781 gene locus_tag LOCUS_37740 17598 19781 CDS product PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379197.1 protein_id gnl|my_center|LOCUS_37740 19848 20621 gene locus_tag LOCUS_37750 19848 20621 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670818.1 protein_id gnl|my_center|LOCUS_37750 >Feature sequence46 1256 678 gene locus_tag LOCUS_37760 1256 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 1970 2545 gene locus_tag LOCUS_37770 gene amaP 1970 2545 CDS product alkaline shock response membrane anchor protein AmaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295947.1 protein_id gnl|my_center|LOCUS_37770 2601 2798 gene locus_tag LOCUS_37780 2601 2798 CDS product DUF2273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291274.1 protein_id gnl|my_center|LOCUS_37780 2812 3390 gene locus_tag LOCUS_37790 2812 3390 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356090.1 protein_id gnl|my_center|LOCUS_37790 3414 3659 gene locus_tag LOCUS_37800 3414 3659 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131476.1 protein_id gnl|my_center|LOCUS_37800 4145 5698 gene locus_tag LOCUS_37810 4145 5698 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966695.1 protein_id gnl|my_center|LOCUS_37810 5732 7069 gene locus_tag LOCUS_37820 5732 7069 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963854.1 protein_id gnl|my_center|LOCUS_37820 7184 7951 gene locus_tag LOCUS_37830 gene glvR 7184 7951 CDS product MurR/RpiR family transcriptional regulator GlvR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233607.1 protein_id gnl|my_center|LOCUS_37830 8021 8521 gene locus_tag LOCUS_37840 8021 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 8868 9068 gene locus_tag LOCUS_37850 8868 9068 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355647.1 protein_id gnl|my_center|LOCUS_37850 9146 9379 gene locus_tag LOCUS_37860 9146 9379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 9896 9426 gene locus_tag LOCUS_37870 9896 9426 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774189.1 protein_id gnl|my_center|LOCUS_37870 10227 9901 gene locus_tag LOCUS_37880 10227 9901 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399599.1 protein_id gnl|my_center|LOCUS_37880 10446 10835 gene locus_tag LOCUS_37890 10446 10835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 11137 11352 gene locus_tag LOCUS_37900 11137 11352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 11431 12108 gene locus_tag LOCUS_37910 11431 12108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 12130 12822 gene locus_tag LOCUS_37920 12130 12822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 13607 12879 gene locus_tag LOCUS_37930 13607 12879 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662263.1 protein_id gnl|my_center|LOCUS_37930 13909 13694 gene locus_tag LOCUS_37940 13909 13694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 14397 14828 gene locus_tag LOCUS_37950 14397 14828 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289110.1 protein_id gnl|my_center|LOCUS_37950 14850 15278 gene locus_tag LOCUS_37960 14850 15278 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706572.1 protein_id gnl|my_center|LOCUS_37960 15861 15301 gene locus_tag LOCUS_37970 15861 15301 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641446.1 protein_id gnl|my_center|LOCUS_37970 16265 16116 gene locus_tag LOCUS_37980 16265 16116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321680.1 protein_id gnl|my_center|LOCUS_37980 16559 17254 gene locus_tag LOCUS_37990 16559 17254 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748663.1 protein_id gnl|my_center|LOCUS_37990 17410 17838 gene locus_tag LOCUS_38000 17410 17838 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706572.1 protein_id gnl|my_center|LOCUS_38000 17954 18712 gene locus_tag LOCUS_38010 17954 18712 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357431.1 protein_id gnl|my_center|LOCUS_38010 >Feature sequence47 362 201 gene locus_tag LOCUS_38020 362 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 676 407 gene locus_tag LOCUS_38030 676 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 893 693 gene locus_tag LOCUS_38040 893 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 1028 1633 gene locus_tag LOCUS_38050 1028 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 1692 2837 gene locus_tag LOCUS_38060 1692 2837 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296502.1 protein_id gnl|my_center|LOCUS_38060 3221 2922 gene locus_tag LOCUS_38070 3221 2922 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290887.1 protein_id gnl|my_center|LOCUS_38070 3656 3237 gene locus_tag LOCUS_38080 gene ruvX 3656 3237 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296503.1 protein_id gnl|my_center|LOCUS_38080 3931 3662 gene locus_tag LOCUS_38090 gene ireB 3931 3662 CDS product regulatory phosphoprotein IreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357937.1 protein_id gnl|my_center|LOCUS_38090 4182 4649 gene locus_tag LOCUS_38100 4182 4649 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574643.1 protein_id gnl|my_center|LOCUS_38100 4806 5255 gene locus_tag LOCUS_38110 4806 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 5252 5665 gene locus_tag LOCUS_38120 5252 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 6458 5718 gene locus_tag LOCUS_38130 6458 5718 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229973.1 protein_id gnl|my_center|LOCUS_38130 6674 7429 gene locus_tag LOCUS_38140 6674 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 7410 8252 gene locus_tag LOCUS_38150 7410 8252 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812722.1 protein_id gnl|my_center|LOCUS_38150 9648 8308 gene locus_tag LOCUS_38160 gene glnA 9648 8308 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356929.1 protein_id gnl|my_center|LOCUS_38160 10077 9697 gene locus_tag LOCUS_38170 10077 9697 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388239.1 protein_id gnl|my_center|LOCUS_38170 10270 10443 gene locus_tag LOCUS_38180 10270 10443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 11734 10481 gene locus_tag LOCUS_38190 11734 10481 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989728.1 protein_id gnl|my_center|LOCUS_38190 12962 11718 gene locus_tag LOCUS_38200 gene hflX 12962 11718 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289406.1 protein_id gnl|my_center|LOCUS_38200 13982 13053 gene locus_tag LOCUS_38210 gene miaA 13982 13053 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366931.1 protein_id gnl|my_center|LOCUS_38210 14713 13979 gene locus_tag LOCUS_38220 14713 13979 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289404.1 protein_id gnl|my_center|LOCUS_38220 15290 14775 gene locus_tag LOCUS_38230 15290 14775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289403.1 protein_id gnl|my_center|LOCUS_38230 15578 16171 gene locus_tag LOCUS_38240 gene clpP 15578 16171 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289402.1 protein_id gnl|my_center|LOCUS_38240 >Feature sequence48 806 84 gene locus_tag LOCUS_38250 806 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38250 984 859 gene locus_tag LOCUS_38260 984 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38260 1334 1176 gene locus_tag LOCUS_38270 1334 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38270 2822 1788 gene locus_tag LOCUS_38280 2822 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 3994 2825 gene locus_tag LOCUS_38290 3994 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 4590 4111 gene locus_tag LOCUS_38300 gene rlmH 4590 4111 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329688.1 protein_id gnl|my_center|LOCUS_38300 5050 6348 gene locus_tag LOCUS_38310 5050 6348 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290101.1 protein_id gnl|my_center|LOCUS_38310 6641 6456 gene locus_tag LOCUS_38320 6641 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 7423 6812 gene locus_tag LOCUS_38330 7423 6812 CDS product DUF4479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287839.1 protein_id gnl|my_center|LOCUS_38330 7991 7536 gene locus_tag LOCUS_38340 7991 7536 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287838.1 protein_id gnl|my_center|LOCUS_38340 8318 8001 gene locus_tag LOCUS_38350 8318 8001 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355015.1 protein_id gnl|my_center|LOCUS_38350 8583 8918 gene locus_tag LOCUS_38360 8583 8918 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399791.1 protein_id gnl|my_center|LOCUS_38360 9850 8957 gene locus_tag LOCUS_38370 9850 8957 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361496.1 protein_id gnl|my_center|LOCUS_38370 10861 9941 gene locus_tag LOCUS_38380 gene rihC 10861 9941 CDS product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052500.1 protein_id gnl|my_center|LOCUS_38380 12406 10994 gene locus_tag LOCUS_38390 gene pepV 12406 10994 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371462.1 protein_id gnl|my_center|LOCUS_38390 12601 13440 gene locus_tag LOCUS_38400 12601 13440 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365767.1 protein_id gnl|my_center|LOCUS_38400 13443 13877 gene locus_tag LOCUS_38410 13443 13877 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289317.1 protein_id gnl|my_center|LOCUS_38410 15292 13919 gene locus_tag LOCUS_38420 gene celB 15292 13919 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285961.1 protein_id gnl|my_center|LOCUS_38420 15816 15307 gene locus_tag LOCUS_38430 15816 15307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375179.1 protein_id gnl|my_center|LOCUS_38430 >Feature sequence49 321 2363 gene locus_tag LOCUS_38440 321 2363 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989498.1 protein_id gnl|my_center|LOCUS_38440 2374 2991 gene locus_tag LOCUS_38450 2374 2991 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963716.1 protein_id gnl|my_center|LOCUS_38450 3038 3496 gene locus_tag LOCUS_38460 3038 3496 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892531.1 protein_id gnl|my_center|LOCUS_38460 3544 3822 gene locus_tag LOCUS_38470 3544 3822 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084022.1 protein_id gnl|my_center|LOCUS_38470 3847 5214 gene locus_tag LOCUS_38480 3847 5214 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120109.1 protein_id gnl|my_center|LOCUS_38480 5229 6374 gene locus_tag LOCUS_38490 gene dgoD 5229 6374 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528179.1 protein_id gnl|my_center|LOCUS_38490 6398 6889 gene locus_tag LOCUS_38500 6398 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 6886 7422 gene locus_tag LOCUS_38510 6886 7422 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359138.1 protein_id gnl|my_center|LOCUS_38510 7823 7491 gene locus_tag LOCUS_38520 7823 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 8554 7820 gene locus_tag LOCUS_38530 8554 7820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 8712 8846 gene locus_tag LOCUS_38540 8712 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38540 9126 11084 gene locus_tag LOCUS_38550 9126 11084 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989458.1 protein_id gnl|my_center|LOCUS_38550 11077 11529 gene locus_tag LOCUS_38560 11077 11529 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989459.1 protein_id gnl|my_center|LOCUS_38560 11531 11842 gene locus_tag LOCUS_38570 11531 11842 CDS product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422575.1 protein_id gnl|my_center|LOCUS_38570 11860 12960 gene locus_tag LOCUS_38580 11860 12960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38580 12960 13625 gene locus_tag LOCUS_38590 12960 13625 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704307.1 protein_id gnl|my_center|LOCUS_38590 13696 14343 gene locus_tag LOCUS_38600 gene fsa 13696 14343 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723193.1 protein_id gnl|my_center|LOCUS_38600 14417 15226 gene locus_tag LOCUS_38610 14417 15226 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989434.1 protein_id gnl|my_center|LOCUS_38610 >Feature sequence50 385 1011 gene locus_tag LOCUS_38620 385 1011 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364174.1 protein_id gnl|my_center|LOCUS_38620 1013 1489 gene locus_tag LOCUS_38630 1013 1489 CDS product DUF3013 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289091.1 protein_id gnl|my_center|LOCUS_38630 1581 2528 gene locus_tag LOCUS_38640 gene prmA 1581 2528 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289093.1 protein_id gnl|my_center|LOCUS_38640 2530 3273 gene locus_tag LOCUS_38650 2530 3273 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370972.1 protein_id gnl|my_center|LOCUS_38650 3347 5554 gene locus_tag LOCUS_38660 3347 5554 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289096.1 protein_id gnl|my_center|LOCUS_38660 5572 6018 gene locus_tag LOCUS_38670 gene dtd 5572 6018 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289097.1 protein_id gnl|my_center|LOCUS_38670 6622 8004 gene locus_tag LOCUS_38680 gene fumC 6622 8004 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456604.1 protein_id gnl|my_center|LOCUS_38680 7991 9160 gene locus_tag LOCUS_38690 7991 9160 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_38690 9263 9778 gene locus_tag LOCUS_38700 9263 9778 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262616.1 protein_id gnl|my_center|LOCUS_38700 9795 10139 gene locus_tag LOCUS_38710 9795 10139 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721726.1 protein_id gnl|my_center|LOCUS_38710 10244 10657 gene locus_tag LOCUS_38720 10244 10657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 10788 11528 gene locus_tag LOCUS_38730 10788 11528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 11675 12598 gene locus_tag LOCUS_38740 11675 12598 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963698.1 protein_id gnl|my_center|LOCUS_38740 12858 13817 gene locus_tag LOCUS_38750 12858 13817 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287225.1 protein_id gnl|my_center|LOCUS_38750 >Feature sequence51 781 149 gene locus_tag LOCUS_38760 781 149 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861779.1 protein_id gnl|my_center|LOCUS_38760 1385 846 gene locus_tag LOCUS_38770 1385 846 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965782.1 protein_id gnl|my_center|LOCUS_38770 1719 1552 gene locus_tag LOCUS_38780 1719 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 2300 1716 gene locus_tag LOCUS_38790 2300 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 2611 2297 gene locus_tag LOCUS_38800 2611 2297 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262570.1 protein_id gnl|my_center|LOCUS_38800 3069 4304 gene locus_tag LOCUS_38810 gene sstT 3069 4304 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294732.1 protein_id gnl|my_center|LOCUS_38810 4618 4430 gene locus_tag LOCUS_38820 4618 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 4735 5415 gene locus_tag LOCUS_38830 4735 5415 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434895.1 protein_id gnl|my_center|LOCUS_38830 5408 6397 gene locus_tag LOCUS_38840 5408 6397 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963846.1 protein_id gnl|my_center|LOCUS_38840 6482 7168 gene locus_tag LOCUS_38850 6482 7168 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963847.1 protein_id gnl|my_center|LOCUS_38850 7165 9723 gene locus_tag LOCUS_38860 7165 9723 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892169.1 protein_id gnl|my_center|LOCUS_38860 10581 9802 gene locus_tag LOCUS_38870 10581 9802 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360638.1 protein_id gnl|my_center|LOCUS_38870 12418 10661 gene locus_tag LOCUS_38880 12418 10661 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360637.1 protein_id gnl|my_center|LOCUS_38880 12943 13833 gene locus_tag LOCUS_38890 12943 13833 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369254.1 protein_id gnl|my_center|LOCUS_38890 >Feature sequence52 292 858 gene locus_tag LOCUS_38900 292 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38900 919 1539 gene locus_tag LOCUS_38910 919 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38910 2614 1838 gene locus_tag LOCUS_38920 2614 1838 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390209.1 protein_id gnl|my_center|LOCUS_38920 3720 2611 gene locus_tag LOCUS_38930 3720 2611 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390206.1 protein_id gnl|my_center|LOCUS_38930 4094 3801 gene locus_tag LOCUS_38940 4094 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 4626 6404 gene locus_tag LOCUS_38950 4626 6404 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364115.1 protein_id gnl|my_center|LOCUS_38950 6408 6887 gene locus_tag LOCUS_38960 6408 6887 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364114.1 protein_id gnl|my_center|LOCUS_38960 6910 7317 gene locus_tag LOCUS_38970 6910 7317 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390204.1 protein_id gnl|my_center|LOCUS_38970 7310 7885 gene locus_tag LOCUS_38980 7310 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 7907 8719 gene locus_tag LOCUS_38990 7907 8719 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364110.1 protein_id gnl|my_center|LOCUS_38990 8706 9521 gene locus_tag LOCUS_39000 8706 9521 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748785.1 protein_id gnl|my_center|LOCUS_39000 9840 11297 gene locus_tag LOCUS_39010 9840 11297 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010818874.1 protein_id gnl|my_center|LOCUS_39010 12594 12854 gene locus_tag LOCUS_39020 12594 12854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748793.1 protein_id gnl|my_center|LOCUS_39020 13128 13430 gene locus_tag LOCUS_39030 13128 13430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 >Feature sequence53 542 171 gene locus_tag LOCUS_39040 gene rplL 542 171 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294588.1 protein_id gnl|my_center|LOCUS_39040 1096 596 gene locus_tag LOCUS_39050 gene rplJ 1096 596 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291634.1 protein_id gnl|my_center|LOCUS_39050 2009 1320 gene locus_tag LOCUS_39060 gene rplA 2009 1320 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356425.1 protein_id gnl|my_center|LOCUS_39060 2536 2114 gene locus_tag LOCUS_39070 gene rplK 2536 2114 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291638.1 protein_id gnl|my_center|LOCUS_39070 2834 3508 gene locus_tag LOCUS_39080 gene sdaAB 2834 3508 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294585.1 protein_id gnl|my_center|LOCUS_39080 3580 4464 gene locus_tag LOCUS_39090 gene sdaAA 3580 4464 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294584.1 protein_id gnl|my_center|LOCUS_39090 5436 4507 gene locus_tag LOCUS_39100 5436 4507 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286843.1 protein_id gnl|my_center|LOCUS_39100 6353 5487 gene locus_tag LOCUS_39110 6353 5487 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364373.1 protein_id gnl|my_center|LOCUS_39110 7017 6343 gene locus_tag LOCUS_39120 7017 6343 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286846.1 protein_id gnl|my_center|LOCUS_39120 8337 7231 gene locus_tag LOCUS_39130 8337 7231 CDS product lactate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294583.1 protein_id gnl|my_center|LOCUS_39130 9279 8413 gene locus_tag LOCUS_39140 9279 8413 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387192.1 protein_id gnl|my_center|LOCUS_39140 10015 9464 gene locus_tag LOCUS_39150 gene nusG 10015 9464 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294580.1 protein_id gnl|my_center|LOCUS_39150 10273 10103 gene locus_tag LOCUS_39160 gene secE 10273 10103 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294579.1 protein_id gnl|my_center|LOCUS_39160 10450 10298 gene locus_tag LOCUS_39170 gene rpmG 10450 10298 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356408.1 protein_id gnl|my_center|LOCUS_39170 10742 11383 gene locus_tag LOCUS_39180 gene cbpA 10742 11383 CDS product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365057.1 protein_id gnl|my_center|LOCUS_39180 11926 11426 gene locus_tag LOCUS_39190 11926 11426 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294548.1 protein_id gnl|my_center|LOCUS_39190 >Feature sequence54 392 541 gene locus_tag LOCUS_39200 392 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 928 497 gene locus_tag LOCUS_39210 928 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 1558 944 gene locus_tag LOCUS_39220 1558 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359819.1 protein_id gnl|my_center|LOCUS_39220 1635 2024 gene locus_tag LOCUS_39230 1635 2024 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359820.1 protein_id gnl|my_center|LOCUS_39230 2011 3270 gene locus_tag LOCUS_39240 2011 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 3948 5654 gene locus_tag LOCUS_39250 gene ltrA 3948 5654 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002335621.1 protein_id gnl|my_center|LOCUS_39250 5893 7065 gene locus_tag LOCUS_39260 5893 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 7070 9193 gene locus_tag LOCUS_39270 7070 9193 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002330911.1 protein_id gnl|my_center|LOCUS_39270 9190 10194 gene locus_tag LOCUS_39280 9190 10194 CDS product bifunctional lysozyme/C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298830.1 protein_id gnl|my_center|LOCUS_39280 10213 11124 gene locus_tag LOCUS_39290 10213 11124 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774217.1 protein_id gnl|my_center|LOCUS_39290 >Feature sequence55 388 879 gene locus_tag LOCUS_39300 388 879 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295503.1 protein_id gnl|my_center|LOCUS_39300 2538 3104 gene locus_tag LOCUS_39310 2538 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 3201 4229 gene locus_tag LOCUS_39320 gene holA 3201 4229 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362655.1 protein_id gnl|my_center|LOCUS_39320 4697 5146 gene locus_tag LOCUS_39330 4697 5146 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356612.1 protein_id gnl|my_center|LOCUS_39330 5176 6012 gene locus_tag LOCUS_39340 5176 6012 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370486.1 protein_id gnl|my_center|LOCUS_39340 6005 7399 gene locus_tag LOCUS_39350 gene gltA 6005 7399 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387136.1 protein_id gnl|my_center|LOCUS_39350 7429 10959 gene locus_tag LOCUS_39360 gene nifJ 7429 10959 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714077.1 protein_id gnl|my_center|LOCUS_39360 >Feature sequence56 434 180 gene locus_tag LOCUS_39370 gene rpsT 434 180 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292188.1 protein_id gnl|my_center|LOCUS_39370 2582 699 gene locus_tag LOCUS_39380 2582 699 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289122.1 protein_id gnl|my_center|LOCUS_39380 3705 2872 gene locus_tag LOCUS_39390 3705 2872 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289121.1 protein_id gnl|my_center|LOCUS_39390 4536 3832 gene locus_tag LOCUS_39400 4536 3832 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289120.1 protein_id gnl|my_center|LOCUS_39400 5186 4560 gene locus_tag LOCUS_39410 5186 4560 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356716.1 protein_id gnl|my_center|LOCUS_39410 5485 7827 gene locus_tag LOCUS_39420 5485 7827 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289116.1 protein_id gnl|my_center|LOCUS_39420 8498 8007 gene locus_tag LOCUS_39430 8498 8007 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289115.1 protein_id gnl|my_center|LOCUS_39430 8714 9616 gene locus_tag LOCUS_39440 8714 9616 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289114.1 protein_id gnl|my_center|LOCUS_39440 9710 10051 gene locus_tag LOCUS_39450 9710 10051 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357660.1 protein_id gnl|my_center|LOCUS_39450 10394 10633 gene locus_tag LOCUS_39460 10394 10633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 >Feature sequence57 996 130 gene locus_tag LOCUS_39470 996 130 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288377.1 protein_id gnl|my_center|LOCUS_39470 2363 1071 gene locus_tag LOCUS_39480 2363 1071 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288375.1 protein_id gnl|my_center|LOCUS_39480 3899 2538 gene locus_tag LOCUS_39490 gene dnaB 3899 2538 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288373.1 protein_id gnl|my_center|LOCUS_39490 4478 4026 gene locus_tag LOCUS_39500 gene rplI 4478 4026 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288372.1 protein_id gnl|my_center|LOCUS_39500 6439 4475 gene locus_tag LOCUS_39510 6439 4475 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288371.1 protein_id gnl|my_center|LOCUS_39510 >Feature sequence58 583 867 gene locus_tag LOCUS_39520 583 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 864 1220 gene locus_tag LOCUS_39530 864 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 1220 1528 gene locus_tag LOCUS_39540 1220 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 1598 2410 gene locus_tag LOCUS_39550 1598 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 2412 2549 gene locus_tag LOCUS_39560 2412 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 2601 2885 gene locus_tag LOCUS_39570 2601 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 2925 3464 gene locus_tag LOCUS_39580 2925 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 4028 3510 gene locus_tag LOCUS_39590 4028 3510 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356034.1 protein_id gnl|my_center|LOCUS_39590 >Feature sequence59 570 130 gene locus_tag LOCUS_39600 gene mscL 570 130 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287431.1 protein_id gnl|my_center|LOCUS_39600 872 2134 gene locus_tag LOCUS_39610 872 2134 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287428.1 protein_id gnl|my_center|LOCUS_39610 2127 3419 gene locus_tag LOCUS_39620 2127 3419 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287425.1 protein_id gnl|my_center|LOCUS_39620 3421 4146 gene locus_tag LOCUS_39630 3421 4146 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569514.1 protein_id gnl|my_center|LOCUS_39630 >Feature sequence60 937 719 gene locus_tag LOCUS_39640 937 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297018.1 protein_id gnl|my_center|LOCUS_39640 3525 952 gene locus_tag LOCUS_39650 3525 952 CDS product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748642.1 protein_id gnl|my_center|LOCUS_39650 3730 3512 gene locus_tag LOCUS_39660 3730 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321927.1 protein_id gnl|my_center|LOCUS_39660 4224 3745 gene locus_tag LOCUS_39670 4224 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 >Feature sequence61 123 1226 gene locus_tag LOCUS_39680 123 1226 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930625.1 protein_id gnl|my_center|LOCUS_39680 1430 2371 gene locus_tag LOCUS_39690 1430 2371 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773450.1 protein_id gnl|my_center|LOCUS_39690 2476 3087 gene locus_tag LOCUS_39700 2476 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289506.1 protein_id gnl|my_center|LOCUS_39700 3257 3961 gene locus_tag LOCUS_39710 3257 3961 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774183.1 protein_id gnl|my_center|LOCUS_39710 >Feature sequence62 3 626 gene locus_tag LOCUS_39720 3 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 650 889 gene locus_tag LOCUS_39730 650 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 1645 1082 gene locus_tag LOCUS_39740 1645 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39740 1956 1738 gene locus_tag LOCUS_39750 1956 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 2265 3092 gene locus_tag LOCUS_39760 2265 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39760 3110 3688 gene locus_tag LOCUS_39770 3110 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 >Feature sequence63 304 717 gene locus_tag LOCUS_39780 304 717 CDS product DUF4231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305693.1 protein_id gnl|my_center|LOCUS_39780 1206 949 gene locus_tag LOCUS_39790 1206 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295273.1 protein_id gnl|my_center|LOCUS_39790 1369 2343 gene locus_tag LOCUS_39800 gene bsh 1369 2343 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287105.1 protein_id gnl|my_center|LOCUS_39800 3317 2481 gene locus_tag LOCUS_39810 3317 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39810 3643 3353 gene locus_tag LOCUS_39820 3643 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39820 >Feature sequence64 1277 138 gene locus_tag LOCUS_39830 1277 138 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367172.1 protein_id gnl|my_center|LOCUS_39830 1414 1581 gene locus_tag LOCUS_39840 1414 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002315615.1 protein_id gnl|my_center|LOCUS_39840 2950 1622 gene locus_tag LOCUS_39850 2950 1622 CDS product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286818.1 protein_id gnl|my_center|LOCUS_39850 3117 3569 gene locus_tag LOCUS_39860 3117 3569 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369264.1 protein_id gnl|my_center|LOCUS_39860 >Feature sequence65 392 1705 gene locus_tag LOCUS_39870 gene rsxC 392 1705 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869095.1 protein_id gnl|my_center|LOCUS_39870 1708 2694 gene locus_tag LOCUS_39880 1708 2694 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428487.1 protein_id gnl|my_center|LOCUS_39880 2839 3399 gene locus_tag LOCUS_39890 2839 3399 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304258.1 protein_id gnl|my_center|LOCUS_39890 >Feature sequence66 506 168 gene locus_tag LOCUS_39900 506 168 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287726.1 protein_id gnl|my_center|LOCUS_39900 915 2165 gene locus_tag LOCUS_39910 915 2165 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297404.1 protein_id gnl|my_center|LOCUS_39910 2415 2630 gene locus_tag LOCUS_39920 2415 2630 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296546.1 protein_id gnl|my_center|LOCUS_39920 >Feature sequence67 273 91 gene locus_tag LOCUS_39930 273 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 1519 332 gene locus_tag LOCUS_39940 1519 332 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021366129.1 protein_id gnl|my_center|LOCUS_39940 2178 1507 gene locus_tag LOCUS_39950 2178 1507 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860834.1 protein_id gnl|my_center|LOCUS_39950 >Feature sequence68 436 218 gene locus_tag LOCUS_39960 436 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 844 524 gene locus_tag LOCUS_39970 844 524 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721948.1 protein_id gnl|my_center|LOCUS_39970 1547 837 gene locus_tag LOCUS_39980 1547 837 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732337.1 protein_id gnl|my_center|LOCUS_39980 1830 2261 gene locus_tag LOCUS_39990 1830 2261 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131384.1 protein_id gnl|my_center|LOCUS_39990 >Feature sequence69 923 123 gene locus_tag LOCUS_40000 923 123 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948543.1 protein_id gnl|my_center|LOCUS_40000 1827 913 gene locus_tag LOCUS_40010 1827 913 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948544.1 protein_id gnl|my_center|LOCUS_40010 >Feature sequence70 453 250 gene locus_tag LOCUS_40020 453 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 962 426 gene locus_tag LOCUS_40030 962 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40030 1690 1550 gene locus_tag LOCUS_40040 1690 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 >Feature sequence71 719 138 gene locus_tag LOCUS_40050 gene pgsA 719 138 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365382.1 protein_id gnl|my_center|LOCUS_40050 1620 754 gene locus_tag LOCUS_40060 1620 754 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287423.1 protein_id gnl|my_center|LOCUS_40060 >Feature sequence72 61 744 gene locus_tag LOCUS_40070 61 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40070 >Feature sequence73 >Feature sequence74 >Feature sequence75 <1081 578 gene locus_tag LOCUS_40080 <1081 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_141741171.1:IS3 family transposase