>Feature sequence01 167 2236 gene locus_tag LOCUS_00010 167 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986568.1 protein_id gnl|my_center|LOCUS_00010 2233 3450 gene locus_tag LOCUS_00020 2233 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986567.1 protein_id gnl|my_center|LOCUS_00020 3450 5288 gene locus_tag LOCUS_00030 3450 5288 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986566.1 protein_id gnl|my_center|LOCUS_00030 5790 6395 gene locus_tag LOCUS_00040 5790 6395 CDS product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004120505.1 protein_id gnl|my_center|LOCUS_00040 7795 8106 gene locus_tag LOCUS_00050 7795 8106 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437624.1 protein_id gnl|my_center|LOCUS_00050 8169 9227 gene locus_tag LOCUS_00060 gene arsB 8169 9227 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462028.1 protein_id gnl|my_center|LOCUS_00060 9245 10240 gene locus_tag LOCUS_00070 9245 10240 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462034.1 protein_id gnl|my_center|LOCUS_00070 10325 10726 gene locus_tag LOCUS_00080 10325 10726 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272757.1 protein_id gnl|my_center|LOCUS_00080 10728 11150 gene locus_tag LOCUS_00090 10728 11150 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476020.1 protein_id gnl|my_center|LOCUS_00090 11636 11490 gene locus_tag LOCUS_00100 11636 11490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12140 12601 gene locus_tag LOCUS_00110 12140 12601 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459155.1 protein_id gnl|my_center|LOCUS_00110 12891 13262 gene locus_tag LOCUS_00120 12891 13262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13265 14050 gene locus_tag LOCUS_00130 13265 14050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14123 14287 gene locus_tag LOCUS_00140 14123 14287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14622 15140 gene locus_tag LOCUS_00150 14622 15140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 15128 15289 gene locus_tag LOCUS_00160 15128 15289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 15575 15793 gene locus_tag LOCUS_00170 15575 15793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 15824 16033 gene locus_tag LOCUS_00180 15824 16033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 16060 17436 gene locus_tag LOCUS_00190 16060 17436 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948760.1 protein_id gnl|my_center|LOCUS_00190 18284 17568 gene locus_tag LOCUS_00200 18284 17568 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860906.1 protein_id gnl|my_center|LOCUS_00200 19050 18295 gene locus_tag LOCUS_00210 19050 18295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 19951 19058 gene locus_tag LOCUS_00220 19951 19058 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860908.1 protein_id gnl|my_center|LOCUS_00220 20088 20783 gene locus_tag LOCUS_00230 20088 20783 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012994104.1 protein_id gnl|my_center|LOCUS_00230 20788 22083 gene locus_tag LOCUS_00240 20788 22083 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262199.1 protein_id gnl|my_center|LOCUS_00240 22735 22205 gene locus_tag LOCUS_00250 22735 22205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 23208 23933 gene locus_tag LOCUS_00260 23208 23933 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437537.1 protein_id gnl|my_center|LOCUS_00260 23933 24592 gene locus_tag LOCUS_00270 gene deoC 23933 24592 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836882.1 protein_id gnl|my_center|LOCUS_00270 24589 25350 gene locus_tag LOCUS_00280 gene lgt 24589 25350 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897834.1 protein_id gnl|my_center|LOCUS_00280 25391 26002 gene locus_tag LOCUS_00290 25391 26002 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_00290 25999 27183 gene locus_tag LOCUS_00300 25999 27183 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074555.1 protein_id gnl|my_center|LOCUS_00300 27180 27869 gene locus_tag LOCUS_00310 27180 27869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 27866 28660 gene locus_tag LOCUS_00320 gene rsmI 27866 28660 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947928.1 protein_id gnl|my_center|LOCUS_00320 28657 29601 gene locus_tag LOCUS_00330 28657 29601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 29610 31442 gene locus_tag LOCUS_00340 29610 31442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 31791 31492 gene locus_tag LOCUS_00350 31791 31492 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906152.1 protein_id gnl|my_center|LOCUS_00350 32398 31793 gene locus_tag LOCUS_00360 gene recX 32398 31793 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704972.1 protein_id gnl|my_center|LOCUS_00360 32516 32956 gene locus_tag LOCUS_00370 32516 32956 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162490285.1 protein_id gnl|my_center|LOCUS_00370 32961 34229 gene locus_tag LOCUS_00380 32961 34229 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963827.1 protein_id gnl|my_center|LOCUS_00380 34219 35661 gene locus_tag LOCUS_00390 34219 35661 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963828.1 protein_id gnl|my_center|LOCUS_00390 35666 36367 gene locus_tag LOCUS_00400 gene ispD 35666 36367 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860629.1 protein_id gnl|my_center|LOCUS_00400 36364 36840 gene locus_tag LOCUS_00410 gene ispF 36364 36840 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_00410 36841 37494 gene locus_tag LOCUS_00420 gene fsa 36841 37494 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722103.1 protein_id gnl|my_center|LOCUS_00420 37496 38461 gene locus_tag LOCUS_00430 gene glpX 37496 38461 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442341.1 protein_id gnl|my_center|LOCUS_00430 38458 39900 gene locus_tag LOCUS_00440 gene rho 38458 39900 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003708855.1 protein_id gnl|my_center|LOCUS_00440 40049 40252 gene locus_tag LOCUS_00450 gene rpmE 40049 40252 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_00450 40295 41125 gene locus_tag LOCUS_00460 gene prmC 40295 41125 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966169.1 protein_id gnl|my_center|LOCUS_00460 41134 42201 gene locus_tag LOCUS_00470 gene prfA 41134 42201 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_00470 42312 42854 gene locus_tag LOCUS_00480 gene rbr2 42312 42854 CDS product rubrerythrin-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966300.1 protein_id gnl|my_center|LOCUS_00480 43285 44073 gene locus_tag LOCUS_00490 gene rpsB 43285 44073 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 protein_id gnl|my_center|LOCUS_00490 44146 44790 gene locus_tag LOCUS_00500 gene tsf 44146 44790 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460416.1 protein_id gnl|my_center|LOCUS_00500 44808 45512 gene locus_tag LOCUS_00510 gene pyrH 44808 45512 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965095.1 protein_id gnl|my_center|LOCUS_00510 45522 46079 gene locus_tag LOCUS_00520 gene frr 45522 46079 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_00520 46126 46851 gene locus_tag LOCUS_00530 46126 46851 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_00530 46853 47635 gene locus_tag LOCUS_00540 46853 47635 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434000.1 protein_id gnl|my_center|LOCUS_00540 47646 48656 gene locus_tag LOCUS_00550 gene rseP 47646 48656 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430605.1 protein_id gnl|my_center|LOCUS_00550 48653 49708 gene locus_tag LOCUS_00560 gene ispG 48653 49708 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986795.1 protein_id gnl|my_center|LOCUS_00560 49713 53960 gene locus_tag LOCUS_00570 49713 53960 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438301.1 protein_id gnl|my_center|LOCUS_00570 54063 54524 gene locus_tag LOCUS_00580 54063 54524 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392560.1 protein_id gnl|my_center|LOCUS_00580 54536 55789 gene locus_tag LOCUS_00590 gene nusA 54536 55789 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460395.1 protein_id gnl|my_center|LOCUS_00590 55815 56078 gene locus_tag LOCUS_00600 55815 56078 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419469.1 protein_id gnl|my_center|LOCUS_00600 56104 58347 gene locus_tag LOCUS_00610 56104 58347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 58347 58700 gene locus_tag LOCUS_00620 gene rbfA 58347 58700 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_00620 58687 59670 gene locus_tag LOCUS_00630 58687 59670 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965110.1 protein_id gnl|my_center|LOCUS_00630 59667 60554 gene locus_tag LOCUS_00640 gene truB 59667 60554 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016546.1 protein_id gnl|my_center|LOCUS_00640 60551 61459 gene locus_tag LOCUS_00650 60551 61459 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965112.1 protein_id gnl|my_center|LOCUS_00650 61573 61839 gene locus_tag LOCUS_00660 gene rpsO 61573 61839 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220957.1 protein_id gnl|my_center|LOCUS_00660 61883 63991 gene locus_tag LOCUS_00670 gene pnp 61883 63991 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722460.1 protein_id gnl|my_center|LOCUS_00670 64049 64480 gene locus_tag LOCUS_00680 gene dut 64049 64480 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784036.1 protein_id gnl|my_center|LOCUS_00680 64520 66874 gene locus_tag LOCUS_00690 64520 66874 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965118.1 protein_id gnl|my_center|LOCUS_00690 66867 68183 gene locus_tag LOCUS_00700 gene rimO 66867 68183 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_00700 68180 68713 gene locus_tag LOCUS_00710 gene pgsA 68180 68713 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362543.1 protein_id gnl|my_center|LOCUS_00710 68722 69954 gene locus_tag LOCUS_00720 68722 69954 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_00720 69957 71024 gene locus_tag LOCUS_00730 gene recA 69957 71024 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428218.1 protein_id gnl|my_center|LOCUS_00730 71036 72010 gene locus_tag LOCUS_00740 71036 72010 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670942.1 protein_id gnl|my_center|LOCUS_00740 72010 73461 gene locus_tag LOCUS_00750 72010 73461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 73462 73695 gene locus_tag LOCUS_00760 73462 73695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 73701 74351 gene locus_tag LOCUS_00770 73701 74351 CDS product chromosome segregation ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273131.1 protein_id gnl|my_center|LOCUS_00770 74455 74766 gene locus_tag LOCUS_00780 74455 74766 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 protein_id gnl|my_center|LOCUS_00780 76506 74788 gene locus_tag LOCUS_00790 76506 74788 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_00790 77638 77000 gene locus_tag LOCUS_00800 77638 77000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 78628 77657 gene locus_tag LOCUS_00810 78628 77657 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_00810 80216 78681 gene locus_tag LOCUS_00820 gene rny 80216 78681 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_00820 80636 80340 gene locus_tag LOCUS_00830 80636 80340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 80839 81459 gene locus_tag LOCUS_00840 gene lexA 80839 81459 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_00840 82896 81610 gene locus_tag LOCUS_00850 82896 81610 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_00850 83902 82991 gene locus_tag LOCUS_00860 gene miaA 83902 82991 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_00860 85778 83904 gene locus_tag LOCUS_00870 gene mutL 85778 83904 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861409.1 protein_id gnl|my_center|LOCUS_00870 88384 85775 gene locus_tag LOCUS_00880 gene mutS 88384 85775 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047675.1 protein_id gnl|my_center|LOCUS_00880 89774 88374 gene locus_tag LOCUS_00890 gene miaB 89774 88374 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_00890 91231 89855 gene locus_tag LOCUS_00900 91231 89855 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_00900 92135 91233 gene locus_tag LOCUS_00910 92135 91233 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917329.1 protein_id gnl|my_center|LOCUS_00910 92594 92139 gene locus_tag LOCUS_00920 gene lspA 92594 92139 CDS product lipoprotein signal peptidase LspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642185.1 protein_id gnl|my_center|LOCUS_00920 93382 92564 gene locus_tag LOCUS_00930 93382 92564 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897805.1 protein_id gnl|my_center|LOCUS_00930 93825 93376 gene locus_tag LOCUS_00940 93825 93376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 94545 93835 gene locus_tag LOCUS_00950 94545 93835 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965420.1 protein_id gnl|my_center|LOCUS_00950 95820 94555 gene locus_tag LOCUS_00960 95820 94555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 96879 95872 gene locus_tag LOCUS_00970 96879 95872 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_00970 97466 96876 gene locus_tag LOCUS_00980 gene plsY 97466 96876 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_00980 98803 97463 gene locus_tag LOCUS_00990 gene der 98803 97463 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_00990 98911 99690 gene locus_tag LOCUS_01000 98911 99690 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_01000 99687 100133 gene locus_tag LOCUS_01010 99687 100133 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549820.1 protein_id gnl|my_center|LOCUS_01010 101328 100177 gene locus_tag LOCUS_01020 101328 100177 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811492.1 protein_id gnl|my_center|LOCUS_01020 102326 101355 gene locus_tag LOCUS_01030 102326 101355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 103137 102310 gene locus_tag LOCUS_01040 103137 102310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 103567 103145 gene locus_tag LOCUS_01050 103567 103145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 105360 103579 gene locus_tag LOCUS_01060 gene aspS 105360 103579 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_01060 107044 105509 gene locus_tag LOCUS_01070 107044 105509 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989880.1 protein_id gnl|my_center|LOCUS_01070 108375 107047 gene locus_tag LOCUS_01080 108375 107047 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048077.1 protein_id gnl|my_center|LOCUS_01080 108998 108372 gene locus_tag LOCUS_01090 108998 108372 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048078.1 protein_id gnl|my_center|LOCUS_01090 109455 109006 gene locus_tag LOCUS_01100 gene dtd 109455 109006 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048079.1 protein_id gnl|my_center|LOCUS_01100 111607 109460 gene locus_tag LOCUS_01110 111607 109460 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_01110 113381 111591 gene locus_tag LOCUS_01120 gene recJ 113381 111591 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943623.1 protein_id gnl|my_center|LOCUS_01120 117707 113568 gene locus_tag LOCUS_01130 117707 113568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 117988 118218 gene locus_tag LOCUS_01140 117988 118218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 118523 118248 gene locus_tag LOCUS_01150 118523 118248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 118796 118530 gene locus_tag LOCUS_01160 118796 118530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 120288 118936 gene locus_tag LOCUS_01170 gene scfB 120288 118936 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_01170 120485 120339 gene locus_tag LOCUS_01180 gene scfA 120485 120339 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_01180 120793 120494 gene locus_tag LOCUS_01190 gene yajC 120793 120494 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048085.1 protein_id gnl|my_center|LOCUS_01190 121975 120863 gene locus_tag LOCUS_01200 gene tgt 121975 120863 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_01200 123000 121981 gene locus_tag LOCUS_01210 gene queA 123000 121981 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_01210 124134 123013 gene locus_tag LOCUS_01220 124134 123013 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583956.1 protein_id gnl|my_center|LOCUS_01220 125137 124136 gene locus_tag LOCUS_01230 gene ruvB 125137 124136 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_01230 125726 125142 gene locus_tag LOCUS_01240 gene ruvA 125726 125142 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426582.1 protein_id gnl|my_center|LOCUS_01240 126220 125726 gene locus_tag LOCUS_01250 gene ruvC 126220 125726 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_01250 127020 126259 gene locus_tag LOCUS_01260 127020 126259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 128099 127104 gene locus_tag LOCUS_01270 gene asnA 128099 127104 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_01270 128806 128156 gene locus_tag LOCUS_01280 128806 128156 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964131.1 protein_id gnl|my_center|LOCUS_01280 130504 128864 gene locus_tag LOCUS_01290 130504 128864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 130923 130576 gene locus_tag LOCUS_01300 gene rplS 130923 130576 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 protein_id gnl|my_center|LOCUS_01300 131653 130910 gene locus_tag LOCUS_01310 gene trmD 131653 130910 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384686.1 protein_id gnl|my_center|LOCUS_01310 132153 131650 gene locus_tag LOCUS_01320 gene rimM 132153 131650 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699991.1 protein_id gnl|my_center|LOCUS_01320 132373 132140 gene locus_tag LOCUS_01330 132373 132140 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419342.1 protein_id gnl|my_center|LOCUS_01330 132694 132395 gene locus_tag LOCUS_01340 gene rpsP 132694 132395 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_01340 134081 132744 gene locus_tag LOCUS_01350 gene ffh 134081 132744 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362591.1 protein_id gnl|my_center|LOCUS_01350 134449 134093 gene locus_tag LOCUS_01360 134449 134093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 136125 134629 gene locus_tag LOCUS_01370 gene ftsY 136125 134629 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861159.1 protein_id gnl|my_center|LOCUS_01370 139656 136135 gene locus_tag LOCUS_01380 gene smc 139656 136135 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_01380 140710 139661 gene locus_tag LOCUS_01390 140710 139661 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438208.1 protein_id gnl|my_center|LOCUS_01390 141401 140703 gene locus_tag LOCUS_01400 gene rnc 141401 140703 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965055.1 protein_id gnl|my_center|LOCUS_01400 141633 141406 gene locus_tag LOCUS_01410 gene acpP 141633 141406 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882943.1 protein_id gnl|my_center|LOCUS_01410 142615 141623 gene locus_tag LOCUS_01420 gene plsX 142615 141623 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_01420 146329 142796 gene locus_tag LOCUS_01430 gene nifJ 146329 142796 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948832.1 protein_id gnl|my_center|LOCUS_01430 147458 146535 gene locus_tag LOCUS_01440 gene hprK 147458 146535 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_01440 149310 147448 gene locus_tag LOCUS_01450 gene uvrC 149310 147448 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436264.1 protein_id gnl|my_center|LOCUS_01450 151071 149311 gene locus_tag LOCUS_01460 151071 149311 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016401.1 protein_id gnl|my_center|LOCUS_01460 151407 151177 gene locus_tag LOCUS_01470 151407 151177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 151877 151479 gene locus_tag LOCUS_01480 151877 151479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 152125 151901 gene locus_tag LOCUS_01490 152125 151901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 152400 152227 gene locus_tag LOCUS_01500 152400 152227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 152942 152454 gene locus_tag LOCUS_01510 152942 152454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 153340 152996 gene locus_tag LOCUS_01520 153340 152996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 155145 153772 gene locus_tag LOCUS_01530 155145 153772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 155525 155142 gene locus_tag LOCUS_01540 155525 155142 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888340.1 protein_id gnl|my_center|LOCUS_01540 157757 155676 gene locus_tag LOCUS_01550 157757 155676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 158452 157754 gene locus_tag LOCUS_01560 158452 157754 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454566.1 protein_id gnl|my_center|LOCUS_01560 158892 158530 gene locus_tag LOCUS_01570 gene crcB 158892 158530 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227866.1 protein_id gnl|my_center|LOCUS_01570 159026 159181 gene locus_tag LOCUS_01580 159026 159181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01580 159435 160592 gene locus_tag LOCUS_01590 gene alr 159435 160592 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963814.1 protein_id gnl|my_center|LOCUS_01590 161016 160696 gene locus_tag LOCUS_01600 gene spoVG 161016 160696 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_01600 161180 162562 gene locus_tag LOCUS_01610 gene murC 161180 162562 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 protein_id gnl|my_center|LOCUS_01610 164967 162694 gene locus_tag LOCUS_01620 164967 162694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 166189 165131 gene locus_tag LOCUS_01630 166189 165131 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048364.1 protein_id gnl|my_center|LOCUS_01630 166738 166256 gene locus_tag LOCUS_01640 166738 166256 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_01640 169480 166997 gene locus_tag LOCUS_01650 169480 166997 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814229.1 protein_id gnl|my_center|LOCUS_01650 170133 169477 gene locus_tag LOCUS_01660 170133 169477 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861403.1 protein_id gnl|my_center|LOCUS_01660 171089 170217 gene locus_tag LOCUS_01670 171089 170217 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943877.1 protein_id gnl|my_center|LOCUS_01670 171598 171077 gene locus_tag LOCUS_01680 171598 171077 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459494.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01680 172195 173475 gene locus_tag LOCUS_01690 172195 173475 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761151.1 protein_id gnl|my_center|LOCUS_01690 174891 173662 gene locus_tag LOCUS_01700 174891 173662 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037328452.1 protein_id gnl|my_center|LOCUS_01700 176289 175012 gene locus_tag LOCUS_01710 176289 175012 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_01710 176411 177709 gene locus_tag LOCUS_01720 gene brnQ 176411 177709 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902388.1 protein_id gnl|my_center|LOCUS_01720 179113 177767 gene locus_tag LOCUS_01730 gene radA 179113 177767 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361473.1 protein_id gnl|my_center|LOCUS_01730 181565 179097 gene locus_tag LOCUS_01740 gene clpC 181565 179097 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 protein_id gnl|my_center|LOCUS_01740 182470 181562 gene locus_tag LOCUS_01750 182470 181562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 183041 182535 gene locus_tag LOCUS_01760 183041 182535 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357604.1 protein_id gnl|my_center|LOCUS_01760 183505 183053 gene locus_tag LOCUS_01770 183505 183053 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357349.1 protein_id gnl|my_center|LOCUS_01770 185847 183787 gene locus_tag LOCUS_01780 gene fusA 185847 183787 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_01780 185996 186640 gene locus_tag LOCUS_01790 185996 186640 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890711.1 protein_id gnl|my_center|LOCUS_01790 187055 186720 gene locus_tag LOCUS_01800 187055 186720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 188492 187068 gene locus_tag LOCUS_01810 188492 187068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814307.1 protein_id gnl|my_center|LOCUS_01810 189906 188485 gene locus_tag LOCUS_01820 189906 188485 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_01820 190603 189920 gene locus_tag LOCUS_01830 190603 189920 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356531.1 protein_id gnl|my_center|LOCUS_01830 192115 190670 gene locus_tag LOCUS_01840 gene guaB 192115 190670 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965988.1 protein_id gnl|my_center|LOCUS_01840 193084 192143 gene locus_tag LOCUS_01850 193084 192143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 193895 193065 gene locus_tag LOCUS_01860 gene cdaA 193895 193065 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420697.1 protein_id gnl|my_center|LOCUS_01860 194457 193897 gene locus_tag LOCUS_01870 194457 193897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 196683 194572 gene locus_tag LOCUS_01880 196683 194572 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047676.1 protein_id gnl|my_center|LOCUS_01880 197255 196668 gene locus_tag LOCUS_01890 197255 196668 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439452.1 protein_id gnl|my_center|LOCUS_01890 197882 197262 gene locus_tag LOCUS_01900 gene cmk 197882 197262 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439454.1 protein_id gnl|my_center|LOCUS_01900 199156 197966 gene locus_tag LOCUS_01910 199156 197966 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_01910 199706 199161 gene locus_tag LOCUS_01920 199706 199161 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948135.1 protein_id gnl|my_center|LOCUS_01920 200410 199703 gene locus_tag LOCUS_01930 200410 199703 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965156.1 protein_id gnl|my_center|LOCUS_01930 200952 200407 gene locus_tag LOCUS_01940 gene scpB 200952 200407 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402814.1 protein_id gnl|my_center|LOCUS_01940 201649 200903 gene locus_tag LOCUS_01950 201649 200903 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545170.1 protein_id gnl|my_center|LOCUS_01950 202260 201628 gene locus_tag LOCUS_01960 202260 201628 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902398.1 protein_id gnl|my_center|LOCUS_01960 203563 202262 gene locus_tag LOCUS_01970 203563 202262 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289207.1 protein_id gnl|my_center|LOCUS_01970 204363 203560 gene locus_tag LOCUS_01980 204363 203560 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965364.1 protein_id gnl|my_center|LOCUS_01980 204901 204356 gene locus_tag LOCUS_01990 204901 204356 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428379.1 protein_id gnl|my_center|LOCUS_01990 206563 204902 gene locus_tag LOCUS_02000 gene recN 206563 204902 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896126.1 protein_id gnl|my_center|LOCUS_02000 207371 206571 gene locus_tag LOCUS_02010 207371 206571 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_02010 208228 207371 gene locus_tag LOCUS_02020 208228 207371 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965380.1 protein_id gnl|my_center|LOCUS_02020 208436 208212 gene locus_tag LOCUS_02030 208436 208212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 209888 208437 gene locus_tag LOCUS_02040 209888 208437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 210288 209890 gene locus_tag LOCUS_02050 gene nusB 210288 209890 CDS product N utilization substance protein NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830249.1 protein_id gnl|my_center|LOCUS_02050 210671 210285 gene locus_tag LOCUS_02060 210671 210285 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_02060 211314 210946 gene locus_tag LOCUS_02070 211314 210946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02070 212090 211896 gene locus_tag LOCUS_02080 212090 211896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 212782 212090 gene locus_tag LOCUS_02090 212782 212090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 214067 213336 gene locus_tag LOCUS_02100 gene truA 214067 213336 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_02100 214861 214064 gene locus_tag LOCUS_02110 214861 214064 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860635.1 protein_id gnl|my_center|LOCUS_02110 215720 214854 gene locus_tag LOCUS_02120 215720 214854 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_02120 216535 215711 gene locus_tag LOCUS_02130 216535 215711 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_02130 217193 216591 gene locus_tag LOCUS_02140 217193 216591 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427435.1 protein_id gnl|my_center|LOCUS_02140 217347 217180 gene locus_tag LOCUS_02150 217347 217180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 217562 217347 gene locus_tag LOCUS_02160 217562 217347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 218242 217613 gene locus_tag LOCUS_02170 gene pyrE 218242 217613 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040248.1 protein_id gnl|my_center|LOCUS_02170 218946 218242 gene locus_tag LOCUS_02180 gene pyrF 218946 218242 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083500.1 protein_id gnl|my_center|LOCUS_02180 220069 218954 gene locus_tag LOCUS_02190 gene prfB 220069 218954 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177451831.1 protein_id gnl|my_center|LOCUS_02190 221509 220268 gene locus_tag LOCUS_02200 221509 220268 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903248.1 protein_id gnl|my_center|LOCUS_02200 223458 221521 gene locus_tag LOCUS_02210 223458 221521 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903247.1 protein_id gnl|my_center|LOCUS_02210 223769 224350 gene locus_tag LOCUS_02220 223769 224350 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107707.1 protein_id gnl|my_center|LOCUS_02220 224350 225369 gene locus_tag LOCUS_02230 224350 225369 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_02230 226055 225789 gene locus_tag LOCUS_02240 226055 225789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 228558 226132 gene locus_tag LOCUS_02250 228558 226132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 230627 228573 gene locus_tag LOCUS_02260 230627 228573 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_02260 231223 230624 gene locus_tag LOCUS_02270 231223 230624 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048232.1 protein_id gnl|my_center|LOCUS_02270 231532 232398 gene locus_tag LOCUS_02280 231532 232398 CDS product DUF4300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680836.1 protein_id gnl|my_center|LOCUS_02280 233265 232519 gene locus_tag LOCUS_02290 233265 232519 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438111.1 protein_id gnl|my_center|LOCUS_02290 234022 233354 gene locus_tag LOCUS_02300 234022 233354 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436876.1 protein_id gnl|my_center|LOCUS_02300 235348 234104 gene locus_tag LOCUS_02310 gene purD 235348 234104 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436062.1 protein_id gnl|my_center|LOCUS_02310 236868 235357 gene locus_tag LOCUS_02320 gene purH 236868 235357 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385254.1 protein_id gnl|my_center|LOCUS_02320 237472 236870 gene locus_tag LOCUS_02330 gene purN 237472 236870 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436064.1 protein_id gnl|my_center|LOCUS_02330 238487 237456 gene locus_tag LOCUS_02340 gene purM 238487 237456 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288011.1 protein_id gnl|my_center|LOCUS_02340 238975 238499 gene locus_tag LOCUS_02350 gene purE 238975 238499 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870121.1 protein_id gnl|my_center|LOCUS_02350 239665 238985 gene locus_tag LOCUS_02360 239665 238985 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808611.1 protein_id gnl|my_center|LOCUS_02360 241359 240127 gene locus_tag LOCUS_02370 241359 240127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 243683 241542 gene locus_tag LOCUS_02380 243683 241542 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423561.1 protein_id gnl|my_center|LOCUS_02380 244578 243661 gene locus_tag LOCUS_02390 244578 243661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 247643 244752 gene locus_tag LOCUS_02400 247643 244752 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_02400 247759 249297 gene locus_tag LOCUS_02410 247759 249297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 250338 249340 gene locus_tag LOCUS_02420 gene tsaD 250338 249340 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_02420 250777 250343 gene locus_tag LOCUS_02430 gene rimI 250777 250343 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434429.1 protein_id gnl|my_center|LOCUS_02430 251423 250749 gene locus_tag LOCUS_02440 gene tsaB 251423 250749 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002326250.1 protein_id gnl|my_center|LOCUS_02440 251862 251404 gene locus_tag LOCUS_02450 gene tsaE 251862 251404 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048261.1 protein_id gnl|my_center|LOCUS_02450 252379 251846 gene locus_tag LOCUS_02460 252379 251846 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767848.1 protein_id gnl|my_center|LOCUS_02460 254705 252462 gene locus_tag LOCUS_02470 254705 252462 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177619.1 protein_id gnl|my_center|LOCUS_02470 255238 254696 gene locus_tag LOCUS_02480 255238 254696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 255393 255965 gene locus_tag LOCUS_02490 255393 255965 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947081.1 protein_id gnl|my_center|LOCUS_02490 257138 256017 gene locus_tag LOCUS_02500 257138 256017 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_02500 258274 257141 gene locus_tag LOCUS_02510 258274 257141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 259116 258283 gene locus_tag LOCUS_02520 259116 258283 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922568.1 protein_id gnl|my_center|LOCUS_02520 260467 259121 gene locus_tag LOCUS_02530 gene glmM 260467 259121 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048332.1 protein_id gnl|my_center|LOCUS_02530 261794 260472 gene locus_tag LOCUS_02540 261794 260472 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986767.1 protein_id gnl|my_center|LOCUS_02540 261895 262401 gene locus_tag LOCUS_02550 261895 262401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 262413 263351 gene locus_tag LOCUS_02560 262413 263351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 267680 263403 gene locus_tag LOCUS_02570 267680 263403 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965697.1 protein_id gnl|my_center|LOCUS_02570 268170 268000 gene locus_tag LOCUS_02580 268170 268000 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_02580 270512 268437 gene locus_tag LOCUS_02590 270512 268437 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379416.1 protein_id gnl|my_center|LOCUS_02590 270748 270839 gene locus_tag LOCUS_t00010 270748 270839 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 270847 270923 gene locus_tag LOCUS_t00020 270847 270923 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 270931 271006 gene locus_tag LOCUS_t00030 270931 271006 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 271601 271077 gene locus_tag LOCUS_02600 271601 271077 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_02600 271682 272398 gene locus_tag LOCUS_02610 gene sfsA 271682 272398 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947913.1 protein_id gnl|my_center|LOCUS_02610 272371 272874 gene locus_tag LOCUS_02620 272371 272874 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966038.1 protein_id gnl|my_center|LOCUS_02620 274331 272994 gene locus_tag LOCUS_02630 gene mgtE 274331 272994 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002934126.1 protein_id gnl|my_center|LOCUS_02630 276174 274318 gene locus_tag LOCUS_02640 276174 274318 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949010.1 protein_id gnl|my_center|LOCUS_02640 276285 277079 gene locus_tag LOCUS_02650 276285 277079 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438030.1 protein_id gnl|my_center|LOCUS_02650 278673 277624 gene locus_tag LOCUS_02660 278673 277624 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017134.1 protein_id gnl|my_center|LOCUS_02660 279496 278666 gene locus_tag LOCUS_02670 279496 278666 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965364.1 protein_id gnl|my_center|LOCUS_02670 279599 280186 gene locus_tag LOCUS_02680 279599 280186 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460450.1 protein_id gnl|my_center|LOCUS_02680 281354 280284 gene locus_tag LOCUS_02690 281354 280284 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_02690 282431 281370 gene locus_tag LOCUS_02700 282431 281370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 283216 282551 gene locus_tag LOCUS_02710 283216 282551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 284062 283475 gene locus_tag LOCUS_02720 284062 283475 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945394.1 protein_id gnl|my_center|LOCUS_02720 284499 284071 gene locus_tag LOCUS_02730 284499 284071 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459277.1 protein_id gnl|my_center|LOCUS_02730 284752 285981 gene locus_tag LOCUS_02740 gene gltS 284752 285981 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015836.1 protein_id gnl|my_center|LOCUS_02740 287294 286089 gene locus_tag LOCUS_02750 287294 286089 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948034.1 protein_id gnl|my_center|LOCUS_02750 287672 288220 gene locus_tag LOCUS_02760 287672 288220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 288230 288565 gene locus_tag LOCUS_02770 288230 288565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 288594 289175 gene locus_tag LOCUS_02780 288594 289175 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829780.1 protein_id gnl|my_center|LOCUS_02780 291327 289606 gene locus_tag LOCUS_02790 291327 289606 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005399340.1 protein_id gnl|my_center|LOCUS_02790 293069 291324 gene locus_tag LOCUS_02800 293069 291324 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682081.1 protein_id gnl|my_center|LOCUS_02800 293848 293408 gene locus_tag LOCUS_02810 293848 293408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388465.1 protein_id gnl|my_center|LOCUS_02810 294330 293845 gene locus_tag LOCUS_02820 gene coaD 294330 293845 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080981.1 protein_id gnl|my_center|LOCUS_02820 294874 294308 gene locus_tag LOCUS_02830 gene rsmD 294874 294308 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 protein_id gnl|my_center|LOCUS_02830 296961 294928 gene locus_tag LOCUS_02840 gene recG 296961 294928 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_02840 298673 297009 gene locus_tag LOCUS_02850 298673 297009 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454872.1 protein_id gnl|my_center|LOCUS_02850 299040 298687 gene locus_tag LOCUS_02860 299040 298687 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395974.1 protein_id gnl|my_center|LOCUS_02860 299221 299412 gene locus_tag LOCUS_02870 gene rpmB 299221 299412 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_02870 300228 299590 gene locus_tag LOCUS_02880 300228 299590 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965038.1 protein_id gnl|my_center|LOCUS_02880 300869 300225 gene locus_tag LOCUS_02890 gene rpe 300869 300225 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986839.1 protein_id gnl|my_center|LOCUS_02890 301723 300869 gene locus_tag LOCUS_02900 gene rsgA 301723 300869 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986840.1 protein_id gnl|my_center|LOCUS_02900 303699 301723 gene locus_tag LOCUS_02910 gene pknB 303699 301723 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986841.1 protein_id gnl|my_center|LOCUS_02910 304423 303707 gene locus_tag LOCUS_02920 304423 303707 CDS product protein-serine/threonine phosphatase Stp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888486.1 protein_id gnl|my_center|LOCUS_02920 305442 304423 gene locus_tag LOCUS_02930 gene rlmN 305442 304423 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_02930 306835 305537 gene locus_tag LOCUS_02940 gene rsmB 306835 305537 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_02940 307524 306835 gene locus_tag LOCUS_02950 307524 306835 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416253.1 protein_id gnl|my_center|LOCUS_02950 308447 307524 gene locus_tag LOCUS_02960 gene fmt 308447 307524 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965030.1 protein_id gnl|my_center|LOCUS_02960 308926 308447 gene locus_tag LOCUS_02970 gene def 308926 308447 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965029.1 protein_id gnl|my_center|LOCUS_02970 311274 308935 gene locus_tag LOCUS_02980 gene priA 311274 308935 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861610.1 protein_id gnl|my_center|LOCUS_02980 312497 311304 gene locus_tag LOCUS_02990 gene coaBC 312497 311304 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_02990 312801 312499 gene locus_tag LOCUS_03000 312801 312499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 313418 312798 gene locus_tag LOCUS_03010 gene gmk 313418 312798 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_03010 314322 313447 gene locus_tag LOCUS_03020 314322 313447 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416240.1 protein_id gnl|my_center|LOCUS_03020 316784 314373 gene locus_tag LOCUS_03030 gene leuS 316784 314373 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830785.1 protein_id gnl|my_center|LOCUS_03030 318181 316793 gene locus_tag LOCUS_03040 gene asnS 318181 316793 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966534.1 protein_id gnl|my_center|LOCUS_03040 319559 318258 gene locus_tag LOCUS_03050 319559 318258 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_03050 320019 319561 gene locus_tag LOCUS_03060 gene nrdR 320019 319561 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_03060 >Feature sequence02 417 157 gene locus_tag LOCUS_03070 417 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 1398 466 gene locus_tag LOCUS_03080 gene dusB 1398 466 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_03080 2191 1409 gene locus_tag LOCUS_03090 2191 1409 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359441.1 protein_id gnl|my_center|LOCUS_03090 2432 2968 gene locus_tag LOCUS_03100 2432 2968 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963535.1 protein_id gnl|my_center|LOCUS_03100 3134 5527 gene locus_tag LOCUS_03110 3134 5527 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860956.1 protein_id gnl|my_center|LOCUS_03110 7713 5764 gene locus_tag LOCUS_03120 gene ftsH 7713 5764 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373798.1 protein_id gnl|my_center|LOCUS_03120 8264 7719 gene locus_tag LOCUS_03130 gene hpt 8264 7719 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966479.1 protein_id gnl|my_center|LOCUS_03130 9612 8254 gene locus_tag LOCUS_03140 gene tilS 9612 8254 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048376.1 protein_id gnl|my_center|LOCUS_03140 10008 9631 gene locus_tag LOCUS_03150 10008 9631 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391640.1 protein_id gnl|my_center|LOCUS_03150 10339 10025 gene locus_tag LOCUS_03160 10339 10025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 10614 10372 gene locus_tag LOCUS_03170 10614 10372 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421412.1 protein_id gnl|my_center|LOCUS_03170 10988 10710 gene locus_tag LOCUS_03180 10988 10710 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421415.1 protein_id gnl|my_center|LOCUS_03180 12040 11123 gene locus_tag LOCUS_03190 12040 11123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 12441 12100 gene locus_tag LOCUS_03200 gene rplQ 12441 12100 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421117.1 protein_id gnl|my_center|LOCUS_03200 13399 12452 gene locus_tag LOCUS_03210 13399 12452 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427733.1 protein_id gnl|my_center|LOCUS_03210 13821 13426 gene locus_tag LOCUS_03220 gene rpsK 13821 13426 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_03220 14196 13834 gene locus_tag LOCUS_03230 gene rpsM 14196 13834 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_03230 14563 14345 gene locus_tag LOCUS_03240 gene infA 14563 14345 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118443.1 protein_id gnl|my_center|LOCUS_03240 14836 14582 gene locus_tag LOCUS_03250 14836 14582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 15481 14840 gene locus_tag LOCUS_03260 15481 14840 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860634.1 protein_id gnl|my_center|LOCUS_03260 16772 15492 gene locus_tag LOCUS_03270 gene secY 16772 15492 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427725.1 protein_id gnl|my_center|LOCUS_03270 17221 16772 gene locus_tag LOCUS_03280 gene rplO 17221 16772 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_03280 17411 17235 gene locus_tag LOCUS_03290 gene rpmD 17411 17235 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201159.1 protein_id gnl|my_center|LOCUS_03290 17929 17423 gene locus_tag LOCUS_03300 gene rpsE 17929 17423 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421138.1 protein_id gnl|my_center|LOCUS_03300 18305 17943 gene locus_tag LOCUS_03310 gene rplR 18305 17943 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 protein_id gnl|my_center|LOCUS_03310 18857 18321 gene locus_tag LOCUS_03320 gene rplF 18857 18321 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_03320 19267 18872 gene locus_tag LOCUS_03330 gene rpsH 19267 18872 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_03330 19482 19297 gene locus_tag LOCUS_03340 19482 19297 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_03340 20039 19494 gene locus_tag LOCUS_03350 gene rplE 20039 19494 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435673.1 protein_id gnl|my_center|LOCUS_03350 20359 20051 gene locus_tag LOCUS_03360 gene rplX 20359 20051 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547687.1 protein_id gnl|my_center|LOCUS_03360 20742 20374 gene locus_tag LOCUS_03370 gene rplN 20742 20374 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829742.1 protein_id gnl|my_center|LOCUS_03370 21020 20766 gene locus_tag LOCUS_03380 gene rpsQ 21020 20766 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_03380 21231 21025 gene locus_tag LOCUS_03390 gene rpmC 21231 21025 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_03390 21652 21221 gene locus_tag LOCUS_03400 gene rplP 21652 21221 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393930.1 protein_id gnl|my_center|LOCUS_03400 22416 21670 gene locus_tag LOCUS_03410 gene rpsC 22416 21670 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421163.1 protein_id gnl|my_center|LOCUS_03410 22763 22428 gene locus_tag LOCUS_03420 gene rplV 22763 22428 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966407.1 protein_id gnl|my_center|LOCUS_03420 23059 22775 gene locus_tag LOCUS_03430 gene rpsS 23059 22775 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393933.1 protein_id gnl|my_center|LOCUS_03430 23902 23072 gene locus_tag LOCUS_03440 gene rplB 23902 23072 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_03440 24207 23920 gene locus_tag LOCUS_03450 gene rplW 24207 23920 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966410.1 protein_id gnl|my_center|LOCUS_03450 24830 24207 gene locus_tag LOCUS_03460 gene rplD 24830 24207 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_03460 25480 24848 gene locus_tag LOCUS_03470 gene rplC 25480 24848 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421173.1 protein_id gnl|my_center|LOCUS_03470 25856 25539 gene locus_tag LOCUS_03480 gene rpsJ 25856 25539 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118667.1 protein_id gnl|my_center|LOCUS_03480 26400 27197 gene locus_tag LOCUS_03490 gene etfB 26400 27197 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986693.1 protein_id gnl|my_center|LOCUS_03490 27206 28201 gene locus_tag LOCUS_03500 27206 28201 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048235.1 protein_id gnl|my_center|LOCUS_03500 29591 28425 gene locus_tag LOCUS_03510 29591 28425 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437815.1 protein_id gnl|my_center|LOCUS_03510 30823 29591 gene locus_tag LOCUS_03520 30823 29591 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_03520 31734 30832 gene locus_tag LOCUS_03530 gene ftsX 31734 30832 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_03530 32407 31709 gene locus_tag LOCUS_03540 gene ftsE 32407 31709 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815584.1 protein_id gnl|my_center|LOCUS_03540 32646 33830 gene locus_tag LOCUS_03550 32646 33830 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948371.1 protein_id gnl|my_center|LOCUS_03550 34639 34013 gene locus_tag LOCUS_03560 34639 34013 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_03560 36020 34629 gene locus_tag LOCUS_03570 36020 34629 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_03570 37789 36017 gene locus_tag LOCUS_03580 37789 36017 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 protein_id gnl|my_center|LOCUS_03580 38411 37770 gene locus_tag LOCUS_03590 38411 37770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 38726 38412 gene locus_tag LOCUS_03600 38726 38412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 39148 38726 gene locus_tag LOCUS_03610 39148 38726 CDS product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869272.1 protein_id gnl|my_center|LOCUS_03610 41091 39163 gene locus_tag LOCUS_03620 41091 39163 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_03620 42088 41081 gene locus_tag LOCUS_03630 42088 41081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 42404 42081 gene locus_tag LOCUS_03640 42404 42081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 43498 42806 gene locus_tag LOCUS_03650 43498 42806 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990639.1 protein_id gnl|my_center|LOCUS_03650 43841 43488 gene locus_tag LOCUS_03660 43841 43488 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963932.1 protein_id gnl|my_center|LOCUS_03660 44828 43860 gene locus_tag LOCUS_03670 44828 43860 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015658.1 protein_id gnl|my_center|LOCUS_03670 45605 44838 gene locus_tag LOCUS_03680 45605 44838 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015659.1 protein_id gnl|my_center|LOCUS_03680 46745 45609 gene locus_tag LOCUS_03690 46745 45609 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903799.1 protein_id gnl|my_center|LOCUS_03690 48173 46761 gene locus_tag LOCUS_03700 48173 46761 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903800.1 protein_id gnl|my_center|LOCUS_03700 48354 49793 gene locus_tag LOCUS_03710 48354 49793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 50070 49924 gene locus_tag LOCUS_03720 50070 49924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 52219 50057 gene locus_tag LOCUS_03730 gene feoB 52219 50057 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460242.1 protein_id gnl|my_center|LOCUS_03730 52462 52220 gene locus_tag LOCUS_03740 52462 52220 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_03740 52695 52465 gene locus_tag LOCUS_03750 52695 52465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 53156 52950 gene locus_tag LOCUS_03760 53156 52950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 53721 53140 gene locus_tag LOCUS_03770 53721 53140 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421194.1 protein_id gnl|my_center|LOCUS_03770 54437 53730 gene locus_tag LOCUS_03780 gene rlmB 54437 53730 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_03780 55195 54434 gene locus_tag LOCUS_03790 gene thyX 55195 54434 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421197.1 protein_id gnl|my_center|LOCUS_03790 55599 55192 gene locus_tag LOCUS_03800 55599 55192 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357282.1 protein_id gnl|my_center|LOCUS_03800 56981 55584 gene locus_tag LOCUS_03810 gene cysS 56981 55584 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_03810 57512 57018 gene locus_tag LOCUS_03820 57512 57018 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454674.1 protein_id gnl|my_center|LOCUS_03820 59430 58087 gene locus_tag LOCUS_03830 gene glmL 59430 58087 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015877.1 protein_id gnl|my_center|LOCUS_03830 60053 59427 gene locus_tag LOCUS_03840 60053 59427 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108450.1 protein_id gnl|my_center|LOCUS_03840 61741 60062 gene locus_tag LOCUS_03850 61741 60062 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966477.1 protein_id gnl|my_center|LOCUS_03850 62640 61747 gene locus_tag LOCUS_03860 gene ftcD 62640 61747 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681237.1 protein_id gnl|my_center|LOCUS_03860 64246 62708 gene locus_tag LOCUS_03870 gene hutH 64246 62708 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922740.1 protein_id gnl|my_center|LOCUS_03870 65417 64695 gene locus_tag LOCUS_03880 65417 64695 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724134.1 protein_id gnl|my_center|LOCUS_03880 66087 65410 gene locus_tag LOCUS_03890 66087 65410 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358158.1 protein_id gnl|my_center|LOCUS_03890 66999 66145 gene locus_tag LOCUS_03900 66999 66145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03900 67902 67108 gene locus_tag LOCUS_03910 67902 67108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 70720 67904 gene locus_tag LOCUS_03920 gene uvrA 70720 67904 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436266.1 protein_id gnl|my_center|LOCUS_03920 72724 70733 gene locus_tag LOCUS_03930 gene uvrB 72724 70733 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_03930 74361 72736 gene locus_tag LOCUS_03940 gene ggt 74361 72736 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436720.1 protein_id gnl|my_center|LOCUS_03940 75087 74572 gene locus_tag LOCUS_03950 75087 74572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 76677 75142 gene locus_tag LOCUS_03960 gene nhaC 76677 75142 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017141.1 protein_id gnl|my_center|LOCUS_03960 78406 77141 gene locus_tag LOCUS_03970 gene hutI 78406 77141 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836513.1 protein_id gnl|my_center|LOCUS_03970 78834 78613 gene locus_tag LOCUS_03980 78834 78613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 79177 78836 gene locus_tag LOCUS_03990 79177 78836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 79499 79284 gene locus_tag LOCUS_04000 79499 79284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 79756 81783 gene locus_tag LOCUS_04010 79756 81783 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836512.1 protein_id gnl|my_center|LOCUS_04010 81907 82029 gene locus_tag LOCUS_04020 81907 82029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 82026 82391 gene locus_tag LOCUS_04030 82026 82391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 82981 82604 gene locus_tag LOCUS_04040 82981 82604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 83673 83002 gene locus_tag LOCUS_04050 83673 83002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 84374 83865 gene locus_tag LOCUS_04060 gene apt 84374 83865 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081583.1 protein_id gnl|my_center|LOCUS_04060 84486 85913 gene locus_tag LOCUS_04070 gene nhaC 84486 85913 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 protein_id gnl|my_center|LOCUS_04070 85971 86732 gene locus_tag LOCUS_04080 85971 86732 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433833.1 protein_id gnl|my_center|LOCUS_04080 86918 88096 gene locus_tag LOCUS_04090 86918 88096 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016873.1 protein_id gnl|my_center|LOCUS_04090 88105 88899 gene locus_tag LOCUS_04100 88105 88899 CDS product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016874.1 protein_id gnl|my_center|LOCUS_04100 88899 89357 gene locus_tag LOCUS_04110 88899 89357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492212.1 protein_id gnl|my_center|LOCUS_04110 89826 89401 gene locus_tag LOCUS_04120 89826 89401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 90873 89827 gene locus_tag LOCUS_04130 90873 89827 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987090.1 protein_id gnl|my_center|LOCUS_04130 90947 91573 gene locus_tag LOCUS_04140 90947 91573 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861058.1 protein_id gnl|my_center|LOCUS_04140 93379 91592 gene locus_tag LOCUS_04150 93379 91592 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810317.1 protein_id gnl|my_center|LOCUS_04150 94311 93376 gene locus_tag LOCUS_04160 94311 93376 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461849.1 protein_id gnl|my_center|LOCUS_04160 94927 94322 gene locus_tag LOCUS_04170 94927 94322 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903437.1 protein_id gnl|my_center|LOCUS_04170 96669 95065 gene locus_tag LOCUS_04180 96669 95065 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287495.1 protein_id gnl|my_center|LOCUS_04180 97728 96787 gene locus_tag LOCUS_04190 97728 96787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 98620 97940 gene locus_tag LOCUS_04200 98620 97940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 99242 98613 gene locus_tag LOCUS_04210 99242 98613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 100783 99239 gene locus_tag LOCUS_04220 100783 99239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 102587 100971 gene locus_tag LOCUS_04230 102587 100971 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_04230 103342 102662 gene locus_tag LOCUS_04240 103342 102662 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416112.1 protein_id gnl|my_center|LOCUS_04240 103976 103347 gene locus_tag LOCUS_04250 gene phoU 103976 103347 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986850.1 protein_id gnl|my_center|LOCUS_04250 104731 103976 gene locus_tag LOCUS_04260 gene pstB 104731 103976 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536449.1 protein_id gnl|my_center|LOCUS_04260 105614 104733 gene locus_tag LOCUS_04270 gene pstA 105614 104733 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049767.1 protein_id gnl|my_center|LOCUS_04270 106524 105607 gene locus_tag LOCUS_04280 gene pstC 106524 105607 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595180.1 protein_id gnl|my_center|LOCUS_04280 107461 106535 gene locus_tag LOCUS_04290 107461 106535 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669493.1 protein_id gnl|my_center|LOCUS_04290 107854 107663 gene locus_tag LOCUS_04300 107854 107663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 108450 107941 gene locus_tag LOCUS_04310 108450 107941 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016072.1 protein_id gnl|my_center|LOCUS_04310 109303 108458 gene locus_tag LOCUS_04320 gene nadC 109303 108458 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016071.1 protein_id gnl|my_center|LOCUS_04320 110537 109275 gene locus_tag LOCUS_04330 110537 109275 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016070.1 protein_id gnl|my_center|LOCUS_04330 111456 110539 gene locus_tag LOCUS_04340 gene nadA 111456 110539 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016069.1 protein_id gnl|my_center|LOCUS_04340 112680 112528 gene locus_tag LOCUS_04350 112680 112528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 112892 112677 gene locus_tag LOCUS_04360 112892 112677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 113160 112939 gene locus_tag LOCUS_04370 113160 112939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 113719 113243 gene locus_tag LOCUS_04380 113719 113243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 114330 113734 gene locus_tag LOCUS_04390 114330 113734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 117458 114693 gene locus_tag LOCUS_04400 117458 114693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 118827 117937 gene locus_tag LOCUS_04410 118827 117937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 119972 118986 gene locus_tag LOCUS_04420 119972 118986 CDS product G5 and 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966270.1 protein_id gnl|my_center|LOCUS_04420 120904 120275 gene locus_tag LOCUS_04430 120904 120275 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949003.1 protein_id gnl|my_center|LOCUS_04430 121928 120894 gene locus_tag LOCUS_04440 121928 120894 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431793.1 protein_id gnl|my_center|LOCUS_04440 122341 121925 gene locus_tag LOCUS_04450 gene mscL 122341 121925 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814614.1 protein_id gnl|my_center|LOCUS_04450 122780 122361 gene locus_tag LOCUS_04460 122780 122361 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889849.1 protein_id gnl|my_center|LOCUS_04460 123355 122777 gene locus_tag LOCUS_04470 123355 122777 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889235.1 protein_id gnl|my_center|LOCUS_04470 123445 124335 gene locus_tag LOCUS_04480 123445 124335 CDS product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890749.1 protein_id gnl|my_center|LOCUS_04480 124699 126342 gene locus_tag LOCUS_04490 124699 126342 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904005.1 protein_id gnl|my_center|LOCUS_04490 126465 127805 gene locus_tag LOCUS_04500 126465 127805 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490912.1 protein_id gnl|my_center|LOCUS_04500 128566 127877 gene locus_tag LOCUS_04510 gene gloB 128566 127877 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052730.1 protein_id gnl|my_center|LOCUS_04510 130650 129028 gene locus_tag LOCUS_04520 gene groL 130650 129028 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_04520 130943 130662 gene locus_tag LOCUS_04530 130943 130662 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_04530 131585 131067 gene locus_tag LOCUS_04540 131585 131067 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_04540 133038 131743 gene locus_tag LOCUS_04550 133038 131743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 133441 134034 gene locus_tag LOCUS_04560 133441 134034 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902649.1 protein_id gnl|my_center|LOCUS_04560 135185 134091 gene locus_tag LOCUS_04570 135185 134091 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993582.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04570 135418 135143 gene locus_tag LOCUS_04580 135418 135143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04580 136713 135565 gene locus_tag LOCUS_04590 136713 135565 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902650.1 protein_id gnl|my_center|LOCUS_04590 138048 136726 gene locus_tag LOCUS_04600 138048 136726 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016225.1 protein_id gnl|my_center|LOCUS_04600 138887 138069 gene locus_tag LOCUS_04610 138887 138069 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902652.1 protein_id gnl|my_center|LOCUS_04610 140896 139127 gene locus_tag LOCUS_04620 140896 139127 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902654.1 protein_id gnl|my_center|LOCUS_04620 141705 140908 gene locus_tag LOCUS_04630 gene gctB 141705 140908 CDS product glutaconate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902656.1 protein_id gnl|my_center|LOCUS_04630 142676 141705 gene locus_tag LOCUS_04640 gene gctA 142676 141705 CDS product glutaconate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902658.1 protein_id gnl|my_center|LOCUS_04640 143883 142747 gene locus_tag LOCUS_04650 143883 142747 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_04650 144330 143899 gene locus_tag LOCUS_04660 144330 143899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 144694 144377 gene locus_tag LOCUS_04670 144694 144377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 145824 145258 gene locus_tag LOCUS_04680 145824 145258 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_04680 146104 145877 gene locus_tag LOCUS_04690 146104 145877 CDS product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925138.1 protein_id gnl|my_center|LOCUS_04690 146526 146176 gene locus_tag LOCUS_04700 146526 146176 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948232.1 protein_id gnl|my_center|LOCUS_04700 147313 146534 gene locus_tag LOCUS_04710 gene rsmA 147313 146534 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 protein_id gnl|my_center|LOCUS_04710 147929 147378 gene locus_tag LOCUS_04720 gene rnmV 147929 147378 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437901.1 protein_id gnl|my_center|LOCUS_04720 148690 147926 gene locus_tag LOCUS_04730 148690 147926 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_04730 150654 148699 gene locus_tag LOCUS_04740 gene metG 150654 148699 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861995.1 protein_id gnl|my_center|LOCUS_04740 152770 150998 gene locus_tag LOCUS_04750 152770 150998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 155534 152952 gene locus_tag LOCUS_04760 gene clpB 155534 152952 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_04760 156464 155544 gene locus_tag LOCUS_04770 156464 155544 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459679.1 protein_id gnl|my_center|LOCUS_04770 156798 157637 gene locus_tag LOCUS_04780 156798 157637 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902127.1 protein_id gnl|my_center|LOCUS_04780 158805 157999 gene locus_tag LOCUS_04790 158805 157999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 159002 161125 gene locus_tag LOCUS_04800 gene nrdD 159002 161125 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802773.1 protein_id gnl|my_center|LOCUS_04800 161125 161619 gene locus_tag LOCUS_04810 gene nrdG 161125 161619 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_04810 163159 161693 gene locus_tag LOCUS_04820 163159 161693 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272312.1 protein_id gnl|my_center|LOCUS_04820 164412 163168 gene locus_tag LOCUS_04830 164412 163168 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666204.1 protein_id gnl|my_center|LOCUS_04830 165100 164426 gene locus_tag LOCUS_04840 165100 164426 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922545.1 protein_id gnl|my_center|LOCUS_04840 165771 165100 gene locus_tag LOCUS_04850 165771 165100 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861637.1 protein_id gnl|my_center|LOCUS_04850 165905 166825 gene locus_tag LOCUS_04860 165905 166825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 >Feature sequence03 897 1544 gene locus_tag LOCUS_04870 897 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 1722 2720 gene locus_tag LOCUS_04880 1722 2720 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016665.1 protein_id gnl|my_center|LOCUS_04880 2730 3365 gene locus_tag LOCUS_04890 2730 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 3570 6311 gene locus_tag LOCUS_04900 3570 6311 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_04900 6308 6577 gene locus_tag LOCUS_04910 6308 6577 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966918.1 protein_id gnl|my_center|LOCUS_04910 6585 7040 gene locus_tag LOCUS_04920 6585 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 9072 7228 gene locus_tag LOCUS_04930 9072 7228 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_04930 10795 9059 gene locus_tag LOCUS_04940 10795 9059 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_04940 10972 11211 gene locus_tag LOCUS_04950 10972 11211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 11258 11803 gene locus_tag LOCUS_04960 11258 11803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 12235 11783 gene locus_tag LOCUS_04970 gene tadA 12235 11783 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169006.1 protein_id gnl|my_center|LOCUS_04970 12383 13267 gene locus_tag LOCUS_04980 12383 13267 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986891.1 protein_id gnl|my_center|LOCUS_04980 14662 13352 gene locus_tag LOCUS_04990 14662 13352 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438549.1 protein_id gnl|my_center|LOCUS_04990 14892 15161 gene locus_tag LOCUS_05000 14892 15161 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218494.1 protein_id gnl|my_center|LOCUS_05000 15171 16526 gene locus_tag LOCUS_05010 15171 16526 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861617.1 protein_id gnl|my_center|LOCUS_05010 17200 16646 gene locus_tag LOCUS_05020 17200 16646 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956957.1 protein_id gnl|my_center|LOCUS_05020 17894 17205 gene locus_tag LOCUS_05030 17894 17205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 17994 19121 gene locus_tag LOCUS_05040 17994 19121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 20447 19248 gene locus_tag LOCUS_05050 gene pepT 20447 19248 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682226.1 protein_id gnl|my_center|LOCUS_05050 20988 20566 gene locus_tag LOCUS_05060 20988 20566 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249520.1 protein_id gnl|my_center|LOCUS_05060 21544 21074 gene locus_tag LOCUS_05070 21544 21074 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665953.1 protein_id gnl|my_center|LOCUS_05070 21663 21947 gene locus_tag LOCUS_05080 gene rpsF 21663 21947 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966984.1 protein_id gnl|my_center|LOCUS_05080 21957 22457 gene locus_tag LOCUS_05090 gene ssb 21957 22457 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722552.1 protein_id gnl|my_center|LOCUS_05090 22469 22693 gene locus_tag LOCUS_05100 gene rpsR 22469 22693 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011182979.1 protein_id gnl|my_center|LOCUS_05100 22976 22713 gene locus_tag LOCUS_05110 22976 22713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 24376 23069 gene locus_tag LOCUS_05120 24376 23069 CDS product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016319.1 protein_id gnl|my_center|LOCUS_05120 26232 24568 gene locus_tag LOCUS_05130 26232 24568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 27140 26241 gene locus_tag LOCUS_05140 27140 26241 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986969.1 protein_id gnl|my_center|LOCUS_05140 27294 27821 gene locus_tag LOCUS_05150 gene raiA 27294 27821 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_05150 27997 29613 gene locus_tag LOCUS_05160 27997 29613 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292052.1 protein_id gnl|my_center|LOCUS_05160 30087 29770 gene locus_tag LOCUS_05170 30087 29770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 31596 30142 gene locus_tag LOCUS_05180 31596 30142 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890565.1 protein_id gnl|my_center|LOCUS_05180 31892 31816 gene locus_tag LOCUS_t00040 31892 31816 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 32080 32718 gene locus_tag LOCUS_05190 32080 32718 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_05190 32847 33323 gene locus_tag LOCUS_05200 32847 33323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 33394 33738 gene locus_tag LOCUS_tm00010 33394 33738 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 34391 35827 gene locus_tag LOCUS_05210 34391 35827 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546599.1 protein_id gnl|my_center|LOCUS_05210 35845 37167 gene locus_tag LOCUS_05220 35845 37167 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_05220 37335 40001 gene locus_tag LOCUS_05230 37335 40001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 40200 42719 gene locus_tag LOCUS_05240 gene mprF 40200 42719 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002300997.1 protein_id gnl|my_center|LOCUS_05240 43006 44367 gene locus_tag LOCUS_05250 gene purF 43006 44367 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425288.1 protein_id gnl|my_center|LOCUS_05250 44357 48028 gene locus_tag LOCUS_05260 44357 48028 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_05260 48203 49750 gene locus_tag LOCUS_05270 48203 49750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 49807 50214 gene locus_tag LOCUS_05280 49807 50214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 50367 50672 gene locus_tag LOCUS_05290 50367 50672 CDS product DUF4298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837143.1 protein_id gnl|my_center|LOCUS_05290 51095 50742 gene locus_tag LOCUS_05300 51095 50742 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228066.1 protein_id gnl|my_center|LOCUS_05300 51523 64941 gene locus_tag LOCUS_05310 51523 64941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 65150 67336 gene locus_tag LOCUS_05320 65150 67336 CDS product pilin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822370.1 protein_id gnl|my_center|LOCUS_05320 67474 68700 gene locus_tag LOCUS_05330 67474 68700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 68742 69662 gene locus_tag LOCUS_05340 68742 69662 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850398.1 protein_id gnl|my_center|LOCUS_05340 69646 70473 gene locus_tag LOCUS_05350 69646 70473 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027974.1 protein_id gnl|my_center|LOCUS_05350 70463 71284 gene locus_tag LOCUS_05360 70463 71284 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775391.1 protein_id gnl|my_center|LOCUS_05360 72874 71408 gene locus_tag LOCUS_05370 72874 71408 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346400.1 protein_id gnl|my_center|LOCUS_05370 73813 72884 gene locus_tag LOCUS_05380 gene glsA 73813 72884 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399984.1 protein_id gnl|my_center|LOCUS_05380 73958 74707 gene locus_tag LOCUS_05390 73958 74707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 75772 74939 gene locus_tag LOCUS_05400 75772 74939 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 protein_id gnl|my_center|LOCUS_05400 75900 76544 gene locus_tag LOCUS_05410 75900 76544 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920606.1 protein_id gnl|my_center|LOCUS_05410 78801 76912 gene locus_tag LOCUS_05420 78801 76912 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434478.1 protein_id gnl|my_center|LOCUS_05420 79993 79244 gene locus_tag LOCUS_05430 79993 79244 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246517.1 protein_id gnl|my_center|LOCUS_05430 80613 80062 gene locus_tag LOCUS_05440 80613 80062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 81676 80603 gene locus_tag LOCUS_05450 81676 80603 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880437.1 protein_id gnl|my_center|LOCUS_05450 83040 81685 gene locus_tag LOCUS_05460 83040 81685 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454913.1 protein_id gnl|my_center|LOCUS_05460 83243 83632 gene locus_tag LOCUS_05470 83243 83632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 83814 84089 gene locus_tag LOCUS_05480 83814 84089 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006512.1 protein_id gnl|my_center|LOCUS_05480 84079 84720 gene locus_tag LOCUS_05490 84079 84720 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694124.1 protein_id gnl|my_center|LOCUS_05490 85606 84812 gene locus_tag LOCUS_05500 85606 84812 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860835.1 protein_id gnl|my_center|LOCUS_05500 86492 85617 gene locus_tag LOCUS_05510 86492 85617 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905410.1 protein_id gnl|my_center|LOCUS_05510 86386 86583 gene locus_tag LOCUS_05520 86386 86583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 87949 86588 gene locus_tag LOCUS_05530 gene dnaB 87949 86588 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_05530 88403 87954 gene locus_tag LOCUS_05540 gene rplI 88403 87954 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724881.1 protein_id gnl|my_center|LOCUS_05540 90403 88406 gene locus_tag LOCUS_05550 90403 88406 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_05550 91332 90415 gene locus_tag LOCUS_05560 91332 90415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 92302 91460 gene locus_tag LOCUS_05570 92302 91460 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438997.1 protein_id gnl|my_center|LOCUS_05570 92527 93225 gene locus_tag LOCUS_05580 92527 93225 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861304.1 protein_id gnl|my_center|LOCUS_05580 94881 93310 gene locus_tag LOCUS_05590 94881 93310 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957212.1 protein_id gnl|my_center|LOCUS_05590 95122 95790 gene locus_tag LOCUS_05600 gene sdaAB 95122 95790 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356598.1 protein_id gnl|my_center|LOCUS_05600 95791 96672 gene locus_tag LOCUS_05610 gene sdaAA 95791 96672 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963993.1 protein_id gnl|my_center|LOCUS_05610 96678 97916 gene locus_tag LOCUS_05620 96678 97916 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861646.1 protein_id gnl|my_center|LOCUS_05620 98048 98782 gene locus_tag LOCUS_05630 98048 98782 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_05630 98822 99712 gene locus_tag LOCUS_05640 98822 99712 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710090.1 protein_id gnl|my_center|LOCUS_05640 99713 100540 gene locus_tag LOCUS_05650 99713 100540 CDS product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948819.1 protein_id gnl|my_center|LOCUS_05650 100635 101522 gene locus_tag LOCUS_05660 100635 101522 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627713.1 protein_id gnl|my_center|LOCUS_05660 103047 101581 gene locus_tag LOCUS_05670 103047 101581 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832531.1 protein_id gnl|my_center|LOCUS_05670 103356 103985 gene locus_tag LOCUS_05680 103356 103985 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_05680 104027 104902 gene locus_tag LOCUS_05690 104027 104902 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_05690 105138 106400 gene locus_tag LOCUS_05700 gene murA 105138 106400 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420721.1 protein_id gnl|my_center|LOCUS_05700 106400 107926 gene locus_tag LOCUS_05710 106400 107926 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_05710 107995 108924 gene locus_tag LOCUS_05720 107995 108924 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_05720 108932 109774 gene locus_tag LOCUS_05730 108932 109774 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_05730 109776 110732 gene locus_tag LOCUS_05740 109776 110732 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861634.1 protein_id gnl|my_center|LOCUS_05740 110737 111531 gene locus_tag LOCUS_05750 110737 111531 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048144.1 protein_id gnl|my_center|LOCUS_05750 111609 112157 gene locus_tag LOCUS_05760 111609 112157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 112150 112995 gene locus_tag LOCUS_05770 112150 112995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 113848 113087 gene locus_tag LOCUS_05780 113848 113087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 114410 113841 gene locus_tag LOCUS_05790 114410 113841 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_05790 116081 114516 gene locus_tag LOCUS_05800 116081 114516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 116217 117119 gene locus_tag LOCUS_05810 116217 117119 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461260.1 protein_id gnl|my_center|LOCUS_05810 117120 118058 gene locus_tag LOCUS_05820 117120 118058 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048420.1 protein_id gnl|my_center|LOCUS_05820 118654 118097 gene locus_tag LOCUS_05830 118654 118097 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_05830 119207 118647 gene locus_tag LOCUS_05840 119207 118647 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_05840 119286 120050 gene locus_tag LOCUS_05850 gene proC 119286 120050 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048171.1 protein_id gnl|my_center|LOCUS_05850 120070 120636 gene locus_tag LOCUS_05860 120070 120636 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987052.1 protein_id gnl|my_center|LOCUS_05860 120866 122014 gene locus_tag LOCUS_05870 120866 122014 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_05870 122024 123424 gene locus_tag LOCUS_05880 gene trkA 122024 123424 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_05880 123414 124868 gene locus_tag LOCUS_05890 123414 124868 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_05890 124868 126235 gene locus_tag LOCUS_05900 gene trkA 124868 126235 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_05900 126216 126911 gene locus_tag LOCUS_05910 126216 126911 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814489.1 protein_id gnl|my_center|LOCUS_05910 126978 127160 gene locus_tag LOCUS_05920 126978 127160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 127160 128020 gene locus_tag LOCUS_05930 127160 128020 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765640.1 protein_id gnl|my_center|LOCUS_05930 128191 128892 gene locus_tag LOCUS_05940 128191 128892 CDS product DUF5058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426729.1 protein_id gnl|my_center|LOCUS_05940 128903 129571 gene locus_tag LOCUS_05950 128903 129571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426728.1 protein_id gnl|my_center|LOCUS_05950 129580 130689 gene locus_tag LOCUS_05960 129580 130689 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861987.1 protein_id gnl|my_center|LOCUS_05960 130928 130767 gene locus_tag LOCUS_05970 130928 130767 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_05970 131099 131491 gene locus_tag LOCUS_05980 131099 131491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 133077 131686 gene locus_tag LOCUS_05990 133077 131686 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017035.1 protein_id gnl|my_center|LOCUS_05990 134311 133085 gene locus_tag LOCUS_06000 gene tyrS 134311 133085 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_06000 134513 135700 gene locus_tag LOCUS_06010 134513 135700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 135943 136200 gene locus_tag LOCUS_06020 135943 136200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 136222 136521 gene locus_tag LOCUS_06030 136222 136521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 136722 136991 gene locus_tag LOCUS_06040 136722 136991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 137651 137181 gene locus_tag LOCUS_06050 137651 137181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 138768 137581 gene locus_tag LOCUS_06060 138768 137581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 139116 138847 gene locus_tag LOCUS_06070 139116 138847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 139357 139139 gene locus_tag LOCUS_06080 139357 139139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 139684 139388 gene locus_tag LOCUS_06090 139684 139388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 140218 140096 gene locus_tag LOCUS_06100 140218 140096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 >Feature sequence04 1727 207 gene locus_tag LOCUS_06110 gene guaA 1727 207 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679432.1 protein_id gnl|my_center|LOCUS_06110 1948 4686 gene locus_tag LOCUS_06120 gene secA 1948 4686 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895216.1 protein_id gnl|my_center|LOCUS_06120 7233 5494 gene locus_tag LOCUS_06130 7233 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 7699 7400 gene locus_tag LOCUS_06140 7699 7400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 7906 9579 gene locus_tag LOCUS_06150 gene dnaX 7906 9579 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421622.1 protein_id gnl|my_center|LOCUS_06150 9588 9929 gene locus_tag LOCUS_06160 9588 9929 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_06160 9931 10533 gene locus_tag LOCUS_06170 gene recR 9931 10533 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_06170 10579 12468 gene locus_tag LOCUS_06180 gene ftsH 10579 12468 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272613.1 protein_id gnl|my_center|LOCUS_06180 12659 13960 gene locus_tag LOCUS_06190 12659 13960 CDS product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903271.1 protein_id gnl|my_center|LOCUS_06190 14595 14173 gene locus_tag LOCUS_06200 14595 14173 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564091.1 protein_id gnl|my_center|LOCUS_06200 14714 15805 gene locus_tag LOCUS_06210 14714 15805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 15805 16464 gene locus_tag LOCUS_06220 15805 16464 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948966.1 protein_id gnl|my_center|LOCUS_06220 16464 17255 gene locus_tag LOCUS_06230 16464 17255 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815052.1 protein_id gnl|my_center|LOCUS_06230 17519 17989 gene locus_tag LOCUS_06240 gene ybaK 17519 17989 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244878.1 protein_id gnl|my_center|LOCUS_06240 17992 19653 gene locus_tag LOCUS_06250 17992 19653 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989112.1 protein_id gnl|my_center|LOCUS_06250 19658 20566 gene locus_tag LOCUS_06260 19658 20566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 20575 21126 gene locus_tag LOCUS_06270 20575 21126 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545477.1 protein_id gnl|my_center|LOCUS_06270 21204 22229 gene locus_tag LOCUS_06280 21204 22229 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381159.1 protein_id gnl|my_center|LOCUS_06280 22219 24468 gene locus_tag LOCUS_06290 22219 24468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 24476 25159 gene locus_tag LOCUS_06300 24476 25159 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427805.1 protein_id gnl|my_center|LOCUS_06300 25159 25692 gene locus_tag LOCUS_06310 25159 25692 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963969.1 protein_id gnl|my_center|LOCUS_06310 25747 28098 gene locus_tag LOCUS_06320 gene ppsA 25747 28098 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846514.1 protein_id gnl|my_center|LOCUS_06320 28458 28156 gene locus_tag LOCUS_06330 28458 28156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 28747 28460 gene locus_tag LOCUS_06340 28747 28460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 29560 28763 gene locus_tag LOCUS_06350 29560 28763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 29772 31793 gene locus_tag LOCUS_06360 29772 31793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 31875 32933 gene locus_tag LOCUS_06370 31875 32933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 32977 33657 gene locus_tag LOCUS_06380 32977 33657 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_06380 33704 35899 gene locus_tag LOCUS_06390 gene pcrA 33704 35899 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002319708.1 protein_id gnl|my_center|LOCUS_06390 35911 37905 gene locus_tag LOCUS_06400 gene ligA 35911 37905 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048227.1 protein_id gnl|my_center|LOCUS_06400 37898 38179 gene locus_tag LOCUS_06410 37898 38179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 38188 39639 gene locus_tag LOCUS_06420 gene gatA 38188 39639 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048224.1 protein_id gnl|my_center|LOCUS_06420 39636 41066 gene locus_tag LOCUS_06430 gene gatB 39636 41066 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965957.1 protein_id gnl|my_center|LOCUS_06430 41286 41957 gene locus_tag LOCUS_06440 41286 41957 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_06440 41941 43377 gene locus_tag LOCUS_06450 41941 43377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 43676 44104 gene locus_tag LOCUS_06460 gene mraZ 43676 44104 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358778.1 protein_id gnl|my_center|LOCUS_06460 44104 45042 gene locus_tag LOCUS_06470 gene rsmH 44104 45042 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_06470 45044 45451 gene locus_tag LOCUS_06480 45044 45451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 45462 47873 gene locus_tag LOCUS_06490 45462 47873 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_06490 47889 48839 gene locus_tag LOCUS_06500 gene mraY 47889 48839 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358738.1 protein_id gnl|my_center|LOCUS_06500 48849 50168 gene locus_tag LOCUS_06510 gene murD 48849 50168 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_06510 50169 51281 gene locus_tag LOCUS_06520 gene spoVE 50169 51281 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_06520 51278 52357 gene locus_tag LOCUS_06530 gene murG 51278 52357 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893705.1 protein_id gnl|my_center|LOCUS_06530 52475 53197 gene locus_tag LOCUS_06540 52475 53197 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965424.1 protein_id gnl|my_center|LOCUS_06540 53314 54405 gene locus_tag LOCUS_06550 gene ftsZ 53314 54405 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386373.1 protein_id gnl|my_center|LOCUS_06550 55581 54442 gene locus_tag LOCUS_06560 55581 54442 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388463.1 protein_id gnl|my_center|LOCUS_06560 55683 56879 gene locus_tag LOCUS_06570 55683 56879 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_06570 56951 57490 gene locus_tag LOCUS_06580 56951 57490 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419111.1 protein_id gnl|my_center|LOCUS_06580 57493 57675 gene locus_tag LOCUS_06590 gene rpmF 57493 57675 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774376.1 protein_id gnl|my_center|LOCUS_06590 57794 58366 gene locus_tag LOCUS_06600 57794 58366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986295.1 protein_id gnl|my_center|LOCUS_06600 58375 58926 gene locus_tag LOCUS_06610 58375 58926 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986296.1 protein_id gnl|my_center|LOCUS_06610 59007 59876 gene locus_tag LOCUS_06620 59007 59876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 59951 60301 gene locus_tag LOCUS_06630 59951 60301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 60538 61800 gene locus_tag LOCUS_06640 gene gltS 60538 61800 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392508.1 protein_id gnl|my_center|LOCUS_06640 63151 61904 gene locus_tag LOCUS_06650 63151 61904 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_06650 65064 63238 gene locus_tag LOCUS_06660 gene glmS 65064 63238 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432446.1 protein_id gnl|my_center|LOCUS_06660 65357 66076 gene locus_tag LOCUS_06670 65357 66076 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706750.1 protein_id gnl|my_center|LOCUS_06670 66154 66903 gene locus_tag LOCUS_06680 66154 66903 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889131.1 protein_id gnl|my_center|LOCUS_06680 66911 68242 gene locus_tag LOCUS_06690 66911 68242 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454447.1 protein_id gnl|my_center|LOCUS_06690 68291 69745 gene locus_tag LOCUS_06700 68291 69745 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987157.1 protein_id gnl|my_center|LOCUS_06700 69760 70095 gene locus_tag LOCUS_06710 69760 70095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 70104 71012 gene locus_tag LOCUS_06720 70104 71012 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081416.1 protein_id gnl|my_center|LOCUS_06720 71009 71434 gene locus_tag LOCUS_06730 71009 71434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_06730 71640 72092 gene locus_tag LOCUS_06740 71640 72092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 72409 72152 gene locus_tag LOCUS_06750 72409 72152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 72568 73872 gene locus_tag LOCUS_06760 72568 73872 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665445.1 protein_id gnl|my_center|LOCUS_06760 74003 74284 gene locus_tag LOCUS_06770 74003 74284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 74934 74338 gene locus_tag LOCUS_06780 gene rpsD 74934 74338 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401493.1 protein_id gnl|my_center|LOCUS_06780 75165 76508 gene locus_tag LOCUS_06790 75165 76508 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595015.1 protein_id gnl|my_center|LOCUS_06790 77581 76616 gene locus_tag LOCUS_06800 77581 76616 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966891.1 protein_id gnl|my_center|LOCUS_06800 78609 77578 gene locus_tag LOCUS_06810 78609 77578 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099510.1 protein_id gnl|my_center|LOCUS_06810 79549 78620 gene locus_tag LOCUS_06820 79549 78620 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048146.1 protein_id gnl|my_center|LOCUS_06820 80486 79554 gene locus_tag LOCUS_06830 80486 79554 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966894.1 protein_id gnl|my_center|LOCUS_06830 82232 80547 gene locus_tag LOCUS_06840 82232 80547 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048148.1 protein_id gnl|my_center|LOCUS_06840 82475 83722 gene locus_tag LOCUS_06850 82475 83722 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459866.1 protein_id gnl|my_center|LOCUS_06850 83873 85393 gene locus_tag LOCUS_06860 83873 85393 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_06860 85394 86473 gene locus_tag LOCUS_06870 gene dprA 85394 86473 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583877.1 protein_id gnl|my_center|LOCUS_06870 86499 88580 gene locus_tag LOCUS_06880 gene topA 86499 88580 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047858.1 protein_id gnl|my_center|LOCUS_06880 88573 90015 gene locus_tag LOCUS_06890 88573 90015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 90012 91181 gene locus_tag LOCUS_06900 90012 91181 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891769.1 protein_id gnl|my_center|LOCUS_06900 91193 91570 gene locus_tag LOCUS_06910 91193 91570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 91830 92291 gene locus_tag LOCUS_06920 91830 92291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 92295 93569 gene locus_tag LOCUS_06930 92295 93569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 93596 94582 gene locus_tag LOCUS_06940 93596 94582 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_06940 94652 95998 gene locus_tag LOCUS_06950 94652 95998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 96010 96726 gene locus_tag LOCUS_06960 96010 96726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06960 96723 97307 gene locus_tag LOCUS_06970 96723 97307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06970 97376 97452 gene locus_tag LOCUS_t00050 97376 97452 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 97487 97573 gene locus_tag LOCUS_t00060 97487 97573 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 97723 98115 gene locus_tag LOCUS_06980 97723 98115 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416526.1 protein_id gnl|my_center|LOCUS_06980 98112 98612 gene locus_tag LOCUS_06990 98112 98612 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289378.1 protein_id gnl|my_center|LOCUS_06990 98623 99198 gene locus_tag LOCUS_07000 98623 99198 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868834.1 protein_id gnl|my_center|LOCUS_07000 99203 99919 gene locus_tag LOCUS_07010 gene radC 99203 99919 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360029.1 protein_id gnl|my_center|LOCUS_07010 99938 100486 gene locus_tag LOCUS_07020 99938 100486 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358147.1 protein_id gnl|my_center|LOCUS_07020 100473 101615 gene locus_tag LOCUS_07030 100473 101615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 101602 102045 gene locus_tag LOCUS_07040 101602 102045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 102029 102412 gene locus_tag LOCUS_07050 102029 102412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 102357 102860 gene locus_tag LOCUS_07060 102357 102860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 102857 103804 gene locus_tag LOCUS_07070 102857 103804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 103833 104390 gene locus_tag LOCUS_07080 gene efp 103833 104390 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_07080 104403 104711 gene locus_tag LOCUS_07090 104403 104711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 104772 106040 gene locus_tag LOCUS_07100 104772 106040 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861243.1 protein_id gnl|my_center|LOCUS_07100 106133 107887 gene locus_tag LOCUS_07110 106133 107887 CDS product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771340.1 protein_id gnl|my_center|LOCUS_07110 107902 108402 gene locus_tag LOCUS_07120 107902 108402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 110099 108465 gene locus_tag LOCUS_07130 110099 108465 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_07130 110190 111398 gene locus_tag LOCUS_07140 110190 111398 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048436.1 protein_id gnl|my_center|LOCUS_07140 111469 112746 gene locus_tag LOCUS_07150 111469 112746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454709.1 protein_id gnl|my_center|LOCUS_07150 112782 113186 gene locus_tag LOCUS_07160 112782 113186 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393584.1 protein_id gnl|my_center|LOCUS_07160 113424 116525 gene locus_tag LOCUS_07170 gene ileS 113424 116525 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454939.1 protein_id gnl|my_center|LOCUS_07170 116772 117134 gene locus_tag LOCUS_07180 116772 117134 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986162.1 protein_id gnl|my_center|LOCUS_07180 117137 118855 gene locus_tag LOCUS_07190 117137 118855 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680532.1 protein_id gnl|my_center|LOCUS_07190 118839 120497 gene locus_tag LOCUS_07200 118839 120497 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491245.1 protein_id gnl|my_center|LOCUS_07200 120503 121336 gene locus_tag LOCUS_07210 120503 121336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 121545 122975 gene locus_tag LOCUS_07220 121545 122975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 122965 123921 gene locus_tag LOCUS_07230 122965 123921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 123914 124840 gene locus_tag LOCUS_07240 gene isdE 123914 124840 CDS product heme ABC transporter substrate-binding protein IsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922615.1 protein_id gnl|my_center|LOCUS_07240 124827 125816 gene locus_tag LOCUS_07250 124827 125816 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002995381.1 protein_id gnl|my_center|LOCUS_07250 125806 126567 gene locus_tag LOCUS_07260 125806 126567 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964109.1 protein_id gnl|my_center|LOCUS_07260 126592 127113 gene locus_tag LOCUS_07270 126592 127113 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436147.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence05 419 1549 gene locus_tag LOCUS_07280 419 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 2819 1659 gene locus_tag LOCUS_07290 gene bioF 2819 1659 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968008.1 protein_id gnl|my_center|LOCUS_07290 3525 2812 gene locus_tag LOCUS_07300 3525 2812 CDS product 6-carboxyhexanoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496779.1 protein_id gnl|my_center|LOCUS_07300 4004 3522 gene locus_tag LOCUS_07310 4004 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 4481 4098 gene locus_tag LOCUS_07320 gene rplL 4481 4098 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393946.1 protein_id gnl|my_center|LOCUS_07320 5063 4527 gene locus_tag LOCUS_07330 gene rplJ 5063 4527 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700677.1 protein_id gnl|my_center|LOCUS_07330 5434 5988 gene locus_tag LOCUS_07340 gene thiT 5434 5988 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966211.1 protein_id gnl|my_center|LOCUS_07340 6778 6077 gene locus_tag LOCUS_07350 gene rplA 6778 6077 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_07350 7243 6818 gene locus_tag LOCUS_07360 gene rplK 7243 6818 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_07360 7833 7291 gene locus_tag LOCUS_07370 gene nusG 7833 7291 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_07370 8063 7848 gene locus_tag LOCUS_07380 8063 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 8222 8073 gene locus_tag LOCUS_07390 gene rpmG 8222 8073 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810204.1 protein_id gnl|my_center|LOCUS_07390 9299 8418 gene locus_tag LOCUS_07400 9299 8418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 11629 9332 gene locus_tag LOCUS_07410 11629 9332 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964979.1 protein_id gnl|my_center|LOCUS_07410 12143 11679 gene locus_tag LOCUS_07420 gene trmL 12143 11679 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356826.1 protein_id gnl|my_center|LOCUS_07420 13693 12137 gene locus_tag LOCUS_07430 13693 12137 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048336.1 protein_id gnl|my_center|LOCUS_07430 13787 14305 gene locus_tag LOCUS_07440 gene lepB 13787 14305 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965934.1 protein_id gnl|my_center|LOCUS_07440 14311 14631 gene locus_tag LOCUS_07450 14311 14631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 15881 14727 gene locus_tag LOCUS_07460 15881 14727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 16543 15878 gene locus_tag LOCUS_07470 16543 15878 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582912.1 protein_id gnl|my_center|LOCUS_07470 17016 16540 gene locus_tag LOCUS_07480 17016 16540 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003043263.1 protein_id gnl|my_center|LOCUS_07480 17428 18108 gene locus_tag LOCUS_07490 17428 18108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 18112 18318 gene locus_tag LOCUS_07500 18112 18318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 18616 18689 gene locus_tag LOCUS_t00070 18616 18689 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 19722 18781 gene locus_tag LOCUS_07510 19722 18781 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015798.1 protein_id gnl|my_center|LOCUS_07510 21015 19843 gene locus_tag LOCUS_07520 gene metK 21015 19843 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432462.1 protein_id gnl|my_center|LOCUS_07520 22294 21341 gene locus_tag LOCUS_07530 22294 21341 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898612.1 protein_id gnl|my_center|LOCUS_07530 22381 23289 gene locus_tag LOCUS_07540 22381 23289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 23322 23531 gene locus_tag LOCUS_07550 23322 23531 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519083.1 protein_id gnl|my_center|LOCUS_07550 23592 25601 gene locus_tag LOCUS_07560 23592 25601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 25658 26662 gene locus_tag LOCUS_07570 25658 26662 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261918.1 protein_id gnl|my_center|LOCUS_07570 28211 26946 gene locus_tag LOCUS_07580 gene gluD 28211 26946 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358881.1 protein_id gnl|my_center|LOCUS_07580 30585 29773 gene locus_tag LOCUS_07590 gene murI 30585 29773 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_07590 31863 30649 gene locus_tag LOCUS_07600 gene gltS 31863 30649 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 protein_id gnl|my_center|LOCUS_07600 32810 32109 gene locus_tag LOCUS_07610 32810 32109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 33342 32800 gene locus_tag LOCUS_07620 33342 32800 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964405.1 protein_id gnl|my_center|LOCUS_07620 35935 33344 gene locus_tag LOCUS_07630 gene addB 35935 33344 CDS product ATP-dependent deoxyribonuclease AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047444.1 protein_id gnl|my_center|LOCUS_07630 36905 35916 gene locus_tag LOCUS_07640 36905 35916 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_07640 36980 37705 gene locus_tag LOCUS_07650 36980 37705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 38908 37730 gene locus_tag LOCUS_07660 gene hydF 38908 37730 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108016.1 protein_id gnl|my_center|LOCUS_07660 40344 38905 gene locus_tag LOCUS_07670 gene hydG 40344 38905 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_07670 41381 40341 gene locus_tag LOCUS_07680 gene hydE 41381 40341 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433972.1 protein_id gnl|my_center|LOCUS_07680 41702 42952 gene locus_tag LOCUS_07690 41702 42952 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_07690 43986 43033 gene locus_tag LOCUS_07700 gene trxB 43986 43033 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416869.1 protein_id gnl|my_center|LOCUS_07700 44055 44942 gene locus_tag LOCUS_07710 44055 44942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 45533 45012 gene locus_tag LOCUS_07720 45533 45012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 46550 45534 gene locus_tag LOCUS_07730 gene fni 46550 45534 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990109.1 protein_id gnl|my_center|LOCUS_07730 47566 46598 gene locus_tag LOCUS_07740 47566 46598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 48417 47551 gene locus_tag LOCUS_07750 gene rapZ 48417 47551 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990001.1 protein_id gnl|my_center|LOCUS_07750 49338 48436 gene locus_tag LOCUS_07760 gene murB 49338 48436 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_07760 50546 49800 gene locus_tag LOCUS_07770 50546 49800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 51034 50558 gene locus_tag LOCUS_07780 51034 50558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 51996 51514 gene locus_tag LOCUS_07790 51996 51514 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403076.1 protein_id gnl|my_center|LOCUS_07790 54194 52092 gene locus_tag LOCUS_07800 54194 52092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 55116 54223 gene locus_tag LOCUS_07810 55116 54223 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_07810 56050 55118 gene locus_tag LOCUS_07820 56050 55118 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963623.1 protein_id gnl|my_center|LOCUS_07820 56340 56050 gene locus_tag LOCUS_07830 56340 56050 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384432.1 protein_id gnl|my_center|LOCUS_07830 56675 56349 gene locus_tag LOCUS_07840 gene darA 56675 56349 CDS product cyclic di-AMP receptor DarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242755.1 protein_id gnl|my_center|LOCUS_07840 57280 56672 gene locus_tag LOCUS_07850 gene tmk 57280 56672 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243137.1 protein_id gnl|my_center|LOCUS_07850 58629 57277 gene locus_tag LOCUS_07860 58629 57277 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947924.1 protein_id gnl|my_center|LOCUS_07860 59671 58691 gene locus_tag LOCUS_07870 59671 58691 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 protein_id gnl|my_center|LOCUS_07870 59731 59820 gene locus_tag LOCUS_t00080 59731 59820 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 60841 60089 gene locus_tag LOCUS_07880 60841 60089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 61664 60819 gene locus_tag LOCUS_07890 gene ispE 61664 60819 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545467.1 protein_id gnl|my_center|LOCUS_07890 62153 61887 gene locus_tag LOCUS_07900 62153 61887 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892135.1 protein_id gnl|my_center|LOCUS_07900 62444 63505 gene locus_tag LOCUS_07910 gene mnmA 62444 63505 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268273.1 protein_id gnl|my_center|LOCUS_07910 63529 64167 gene locus_tag LOCUS_07920 63529 64167 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_07920 64900 64220 gene locus_tag LOCUS_07930 64900 64220 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416671.1 protein_id gnl|my_center|LOCUS_07930 66212 64878 gene locus_tag LOCUS_07940 66212 64878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 67580 66273 gene locus_tag LOCUS_07950 67580 66273 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060595.1 protein_id gnl|my_center|LOCUS_07950 68443 67622 gene locus_tag LOCUS_07960 68443 67622 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776952.1 protein_id gnl|my_center|LOCUS_07960 69297 68440 gene locus_tag LOCUS_07970 69297 68440 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721883.1 protein_id gnl|my_center|LOCUS_07970 70399 69323 gene locus_tag LOCUS_07980 gene ugpC 70399 69323 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289507.1 protein_id gnl|my_center|LOCUS_07980 70648 70854 gene locus_tag LOCUS_07990 70648 70854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 71492 71037 gene locus_tag LOCUS_08000 gene smpB 71492 71037 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_08000 73587 71485 gene locus_tag LOCUS_08010 gene rnr 73587 71485 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_08010 74759 73587 gene locus_tag LOCUS_08020 74759 73587 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_08020 76318 74765 gene locus_tag LOCUS_08030 76318 74765 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405061.1 protein_id gnl|my_center|LOCUS_08030 77098 76328 gene locus_tag LOCUS_08040 77098 76328 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405060.1 protein_id gnl|my_center|LOCUS_08040 77516 77085 gene locus_tag LOCUS_08050 77516 77085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 77623 77862 gene locus_tag LOCUS_08060 77623 77862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 79566 78367 gene locus_tag LOCUS_08070 79566 78367 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119279.1 protein_id gnl|my_center|LOCUS_08070 80258 79575 gene locus_tag LOCUS_08080 gene bioD 80258 79575 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986727.1 protein_id gnl|my_center|LOCUS_08080 80829 80275 gene locus_tag LOCUS_08090 80829 80275 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986729.1 protein_id gnl|my_center|LOCUS_08090 81750 80983 gene locus_tag LOCUS_08100 81750 80983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 82436 81750 gene locus_tag LOCUS_08110 82436 81750 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963589.1 protein_id gnl|my_center|LOCUS_08110 82792 82433 gene locus_tag LOCUS_08120 82792 82433 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775014.1 protein_id gnl|my_center|LOCUS_08120 84127 83003 gene locus_tag LOCUS_08130 84127 83003 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131519.1 protein_id gnl|my_center|LOCUS_08130 84826 84221 gene locus_tag LOCUS_08140 84826 84221 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_08140 86448 85072 gene locus_tag LOCUS_08150 86448 85072 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964065.1 protein_id gnl|my_center|LOCUS_08150 86682 86599 gene locus_tag LOCUS_t00090 86682 86599 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 88636 87473 gene locus_tag LOCUS_08160 88636 87473 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066054433.1 protein_id gnl|my_center|LOCUS_08160 90043 88646 gene locus_tag LOCUS_08170 90043 88646 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966488.1 protein_id gnl|my_center|LOCUS_08170 90226 91125 gene locus_tag LOCUS_08180 90226 91125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 91587 92762 gene locus_tag LOCUS_08190 91587 92762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 93653 92844 gene locus_tag LOCUS_08200 93653 92844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 95014 93719 gene locus_tag LOCUS_08210 95014 93719 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048156.1 protein_id gnl|my_center|LOCUS_08210 97662 95011 gene locus_tag LOCUS_08220 97662 95011 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048157.1 protein_id gnl|my_center|LOCUS_08220 98151 97939 gene locus_tag LOCUS_08230 98151 97939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 99211 98219 gene locus_tag LOCUS_08240 gene trpS 99211 98219 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454934.1 protein_id gnl|my_center|LOCUS_08240 100499 99216 gene locus_tag LOCUS_08250 100499 99216 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583295.1 protein_id gnl|my_center|LOCUS_08250 100597 101253 gene locus_tag LOCUS_08260 100597 101253 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254956.1 protein_id gnl|my_center|LOCUS_08260 101255 101569 gene locus_tag LOCUS_08270 101255 101569 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876811.1 protein_id gnl|my_center|LOCUS_08270 101646 102608 gene locus_tag LOCUS_08280 101646 102608 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_08280 102652 103407 gene locus_tag LOCUS_08290 102652 103407 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892118.1 protein_id gnl|my_center|LOCUS_08290 103409 104191 gene locus_tag LOCUS_08300 103409 104191 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_08300 105034 104201 gene locus_tag LOCUS_08310 gene racE 105034 104201 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317207.1 protein_id gnl|my_center|LOCUS_08310 105282 105207 gene locus_tag LOCUS_t00100 105282 105207 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 106043 105375 gene locus_tag LOCUS_08320 106043 105375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 106202 106888 gene locus_tag LOCUS_08330 106202 106888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 107083 107493 gene locus_tag LOCUS_08340 107083 107493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 107509 108642 gene locus_tag LOCUS_08350 107509 108642 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016775.1 protein_id gnl|my_center|LOCUS_08350 108879 110201 gene locus_tag LOCUS_08360 108879 110201 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986280.1 protein_id gnl|my_center|LOCUS_08360 110191 111168 gene locus_tag LOCUS_08370 110191 111168 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357473.1 protein_id gnl|my_center|LOCUS_08370 111170 112351 gene locus_tag LOCUS_08380 111170 112351 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986281.1 protein_id gnl|my_center|LOCUS_08380 112348 114642 gene locus_tag LOCUS_08390 112348 114642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 114741 115247 gene locus_tag LOCUS_08400 114741 115247 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861585.1 protein_id gnl|my_center|LOCUS_08400 116224 115304 gene locus_tag LOCUS_08410 gene hslO 116224 115304 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965667.1 protein_id gnl|my_center|LOCUS_08410 117116 116391 gene locus_tag LOCUS_08420 117116 116391 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_08420 117850 117113 gene locus_tag LOCUS_08430 gene cobB 117850 117113 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846381.1 protein_id gnl|my_center|LOCUS_08430 118774 117860 gene locus_tag LOCUS_08440 118774 117860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 118904 119419 gene locus_tag LOCUS_08450 118904 119419 CDS product DUF4364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357273.1 protein_id gnl|my_center|LOCUS_08450 120711 119455 gene locus_tag LOCUS_08460 120711 119455 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583659.1 protein_id gnl|my_center|LOCUS_08460 121471 120689 gene locus_tag LOCUS_08470 gene proB 121471 120689 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287451.1 protein_id gnl|my_center|LOCUS_08470 121630 123951 gene locus_tag LOCUS_08480 121630 123951 CDS product bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202231.1 protein_id gnl|my_center|LOCUS_08480 125644 124292 gene locus_tag LOCUS_08490 125644 124292 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_08490 125797 126417 gene locus_tag LOCUS_08500 125797 126417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 127821 126604 gene locus_tag LOCUS_08510 127821 126604 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291561.1 protein_id gnl|my_center|LOCUS_08510 128106 127903 gene locus_tag LOCUS_08520 128106 127903 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814511.1 protein_id gnl|my_center|LOCUS_08520 128798 128568 gene locus_tag LOCUS_08530 128798 128568 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002334012.1 protein_id gnl|my_center|LOCUS_08530 >Feature sequence06 447 752 gene locus_tag LOCUS_08540 447 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08540 1816 992 gene locus_tag LOCUS_08550 1816 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 2018 1854 gene locus_tag LOCUS_08560 2018 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 4478 2244 gene locus_tag LOCUS_08570 4478 2244 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167180.1 protein_id gnl|my_center|LOCUS_08570 5538 4471 gene locus_tag LOCUS_08580 5538 4471 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008363445.1 protein_id gnl|my_center|LOCUS_08580 7178 5850 gene locus_tag LOCUS_08590 gene rlmD 7178 5850 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434581.1 protein_id gnl|my_center|LOCUS_08590 8000 7338 gene locus_tag LOCUS_08600 8000 7338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 8431 8949 gene locus_tag LOCUS_08610 8431 8949 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895862.1 protein_id gnl|my_center|LOCUS_08610 10545 9064 gene locus_tag LOCUS_08620 10545 9064 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048415.1 protein_id gnl|my_center|LOCUS_08620 12134 10548 gene locus_tag LOCUS_08630 12134 10548 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812114.1 protein_id gnl|my_center|LOCUS_08630 13317 12145 gene locus_tag LOCUS_08640 13317 12145 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421980.1 protein_id gnl|my_center|LOCUS_08640 14528 13314 gene locus_tag LOCUS_08650 gene dpaL 14528 13314 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812104.1 protein_id gnl|my_center|LOCUS_08650 14749 15420 gene locus_tag LOCUS_08660 14749 15420 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002040907.1 protein_id gnl|my_center|LOCUS_08660 16372 15506 gene locus_tag LOCUS_08670 16372 15506 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850504.1 protein_id gnl|my_center|LOCUS_08670 17115 16519 gene locus_tag LOCUS_08680 gene yihA 17115 16519 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_08680 19435 17102 gene locus_tag LOCUS_08690 gene lon 19435 17102 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435613.1 protein_id gnl|my_center|LOCUS_08690 20699 19482 gene locus_tag LOCUS_08700 gene clpX 20699 19482 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472282.1 protein_id gnl|my_center|LOCUS_08700 21292 20708 gene locus_tag LOCUS_08710 gene clpP 21292 20708 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_08710 22668 21310 gene locus_tag LOCUS_08720 gene tig 22668 21310 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_08720 22959 22738 gene locus_tag LOCUS_08730 22959 22738 CDS product PC4/YdbC family ssDNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925352.1 protein_id gnl|my_center|LOCUS_08730 24664 22961 gene locus_tag LOCUS_08740 24664 22961 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966455.1 protein_id gnl|my_center|LOCUS_08740 24889 27539 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccacgcacccataaagggtgcgac 27964 27671 gene locus_tag LOCUS_08750 gene cas2 27964 27671 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989044.1 protein_id gnl|my_center|LOCUS_08750 28997 27966 gene locus_tag LOCUS_08760 gene cas1c 28997 27966 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922509.1 protein_id gnl|my_center|LOCUS_08760 29647 28994 gene locus_tag LOCUS_08770 gene cas4 29647 28994 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162614534.1 protein_id gnl|my_center|LOCUS_08770 30503 29649 gene locus_tag LOCUS_08780 gene cas7c 30503 29649 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922510.1 protein_id gnl|my_center|LOCUS_08780 32439 30496 gene locus_tag LOCUS_08790 gene cas8c 32439 30496 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922511.1 protein_id gnl|my_center|LOCUS_08790 33157 32453 gene locus_tag LOCUS_08800 33157 32453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 35922 33355 gene locus_tag LOCUS_08810 35922 33355 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263668.1 protein_id gnl|my_center|LOCUS_08810 37042 36071 gene locus_tag LOCUS_08820 gene pta 37042 36071 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067215.1 protein_id gnl|my_center|LOCUS_08820 38069 37095 gene locus_tag LOCUS_08830 gene folP 38069 37095 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491579.1 protein_id gnl|my_center|LOCUS_08830 39124 38129 gene locus_tag LOCUS_08840 39124 38129 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948389.1 protein_id gnl|my_center|LOCUS_08840 39172 39588 gene locus_tag LOCUS_08850 39172 39588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 42150 40561 gene locus_tag LOCUS_08860 42150 40561 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015673.1 protein_id gnl|my_center|LOCUS_08860 42545 42258 gene locus_tag LOCUS_08870 42545 42258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 43728 42532 gene locus_tag LOCUS_08880 43728 42532 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438357.1 protein_id gnl|my_center|LOCUS_08880 44728 43754 gene locus_tag LOCUS_08890 44728 43754 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_08890 45713 44703 gene locus_tag LOCUS_08900 45713 44703 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429260.1 protein_id gnl|my_center|LOCUS_08900 46289 45717 gene locus_tag LOCUS_08910 46289 45717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 46525 47010 gene locus_tag LOCUS_08920 46525 47010 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978465.1 protein_id gnl|my_center|LOCUS_08920 47025 47732 gene locus_tag LOCUS_08930 gene yycF 47025 47732 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658889.1 protein_id gnl|my_center|LOCUS_08930 47729 49525 gene locus_tag LOCUS_08940 gene walK 47729 49525 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755367.1 protein_id gnl|my_center|LOCUS_08940 49512 50849 gene locus_tag LOCUS_08950 49512 50849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 50855 51703 gene locus_tag LOCUS_08960 50855 51703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 51751 52536 gene locus_tag LOCUS_08970 51751 52536 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_08970 52549 53295 gene locus_tag LOCUS_08980 gene surE 52549 53295 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948033.1 protein_id gnl|my_center|LOCUS_08980 53456 53896 gene locus_tag LOCUS_08990 53456 53896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 55296 53968 gene locus_tag LOCUS_09000 gene mgtE 55296 53968 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898141.1 protein_id gnl|my_center|LOCUS_09000 56724 55522 gene locus_tag LOCUS_09010 56724 55522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 56867 58198 gene locus_tag LOCUS_09020 56867 58198 CDS product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289416.1 protein_id gnl|my_center|LOCUS_09020 58226 58897 gene locus_tag LOCUS_09030 58226 58897 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109873.1 protein_id gnl|my_center|LOCUS_09030 59923 58982 gene locus_tag LOCUS_09040 gene msrB 59923 58982 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166942.1 protein_id gnl|my_center|LOCUS_09040 60229 60876 gene locus_tag LOCUS_09050 gene zinT 60229 60876 CDS product metal-binding protein ZinT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096631.1 protein_id gnl|my_center|LOCUS_09050 60949 62244 gene locus_tag LOCUS_09060 60949 62244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 62247 62921 gene locus_tag LOCUS_09070 62247 62921 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815055.1 protein_id gnl|my_center|LOCUS_09070 62908 63717 gene locus_tag LOCUS_09080 62908 63717 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815052.1 protein_id gnl|my_center|LOCUS_09080 63991 65994 gene locus_tag LOCUS_09090 63991 65994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 67953 66112 gene locus_tag LOCUS_09100 gene ftsH 67953 66112 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_09100 69085 68045 gene locus_tag LOCUS_09110 69085 68045 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681302.1 protein_id gnl|my_center|LOCUS_09110 71628 69100 gene locus_tag LOCUS_09120 71628 69100 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681315.1 protein_id gnl|my_center|LOCUS_09120 71627 71821 gene locus_tag LOCUS_09130 71627 71821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 73570 71834 gene locus_tag LOCUS_09140 73570 71834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 74688 73987 gene locus_tag LOCUS_09150 74688 73987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 75280 74705 gene locus_tag LOCUS_09160 75280 74705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 76088 75270 gene locus_tag LOCUS_09170 gene folK 76088 75270 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372525.1 protein_id gnl|my_center|LOCUS_09170 76578 76099 gene locus_tag LOCUS_09180 76578 76099 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966208.1 protein_id gnl|my_center|LOCUS_09180 77132 76578 gene locus_tag LOCUS_09190 gene folE 77132 76578 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380915.1 protein_id gnl|my_center|LOCUS_09190 77314 78675 gene locus_tag LOCUS_09200 77314 78675 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373551.1 protein_id gnl|my_center|LOCUS_09200 78761 78837 gene locus_tag LOCUS_t00110 78761 78837 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 79208 78897 gene locus_tag LOCUS_09210 gene cutA 79208 78897 CDS product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949143.1 protein_id gnl|my_center|LOCUS_09210 79296 79628 gene locus_tag LOCUS_09220 79296 79628 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391740.1 protein_id gnl|my_center|LOCUS_09220 80337 79921 gene locus_tag LOCUS_09230 80337 79921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 81227 80337 gene locus_tag LOCUS_09240 81227 80337 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490772.1 protein_id gnl|my_center|LOCUS_09240 82077 81232 gene locus_tag LOCUS_09250 82077 81232 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_09250 82825 82061 gene locus_tag LOCUS_09260 82825 82061 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_09260 83665 82970 gene locus_tag LOCUS_09270 gene rsmG 83665 82970 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048453.1 protein_id gnl|my_center|LOCUS_09270 85559 83652 gene locus_tag LOCUS_09280 gene mnmG 85559 83652 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_09280 86945 85566 gene locus_tag LOCUS_09290 gene mnmE 86945 85566 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898860.1 protein_id gnl|my_center|LOCUS_09290 87856 87029 gene locus_tag LOCUS_09300 87856 87029 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387430.1 protein_id gnl|my_center|LOCUS_09300 88599 87853 gene locus_tag LOCUS_09310 88599 87853 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359437.1 protein_id gnl|my_center|LOCUS_09310 88833 88618 gene locus_tag LOCUS_09320 gene yidD 88833 88618 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434233.1 protein_id gnl|my_center|LOCUS_09320 89165 88830 gene locus_tag LOCUS_09330 89165 88830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 89308 89174 gene locus_tag LOCUS_09340 gene rpmH 89308 89174 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948689.1 protein_id gnl|my_center|LOCUS_09340 89765 91114 gene locus_tag LOCUS_09350 gene dnaA 89765 91114 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420483.1 protein_id gnl|my_center|LOCUS_09350 91263 92357 gene locus_tag LOCUS_09360 gene dnaN 91263 92357 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420481.1 protein_id gnl|my_center|LOCUS_09360 92360 92572 gene locus_tag LOCUS_09370 92360 92572 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941132.1 protein_id gnl|my_center|LOCUS_09370 92569 93645 gene locus_tag LOCUS_09380 gene recF 92569 93645 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359456.1 protein_id gnl|my_center|LOCUS_09380 93659 95572 gene locus_tag LOCUS_09390 gene gyrB 93659 95572 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947898.1 protein_id gnl|my_center|LOCUS_09390 95582 98011 gene locus_tag LOCUS_09400 gene gyrA 95582 98011 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_09400 98020 98331 gene locus_tag LOCUS_09410 98020 98331 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429306.1 protein_id gnl|my_center|LOCUS_09410 98333 98683 gene locus_tag LOCUS_09420 98333 98683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 98693 99478 gene locus_tag LOCUS_09430 98693 99478 CDS product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420464.1 protein_id gnl|my_center|LOCUS_09430 99478 100119 gene locus_tag LOCUS_09440 99478 100119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 100248 100173 gene locus_tag LOCUS_t00120 100248 100173 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 100328 101815 gene locus_tag LOCUS_09450 gene glpK 100328 101815 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 protein_id gnl|my_center|LOCUS_09450 103336 101888 gene locus_tag LOCUS_09460 103336 101888 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015837.1 protein_id gnl|my_center|LOCUS_09460 104755 103346 gene locus_tag LOCUS_09470 104755 103346 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 protein_id gnl|my_center|LOCUS_09470 105047 106291 gene locus_tag LOCUS_09480 105047 106291 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_09480 107778 106348 gene locus_tag LOCUS_09490 107778 106348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 108856 107789 gene locus_tag LOCUS_09500 108856 107789 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861645.1 protein_id gnl|my_center|LOCUS_09500 >Feature sequence07 419 1045 gene locus_tag LOCUS_09510 419 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 1051 1308 gene locus_tag LOCUS_09520 1051 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 1485 1958 gene locus_tag LOCUS_09530 gene greA 1485 1958 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422204.1 protein_id gnl|my_center|LOCUS_09530 1969 3891 gene locus_tag LOCUS_09540 gene lysS 1969 3891 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861998.1 protein_id gnl|my_center|LOCUS_09540 4356 4967 gene locus_tag LOCUS_09550 4356 4967 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166986.1 protein_id gnl|my_center|LOCUS_09550 4960 5943 gene locus_tag LOCUS_09560 4960 5943 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448020.1 protein_id gnl|my_center|LOCUS_09560 6136 6330 gene locus_tag LOCUS_09570 6136 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 6382 6606 gene locus_tag LOCUS_09580 6382 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 7756 6737 gene locus_tag LOCUS_09590 7756 6737 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680378.1 protein_id gnl|my_center|LOCUS_09590 8259 7768 gene locus_tag LOCUS_09600 8259 7768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 8584 8730 gene locus_tag LOCUS_09610 8584 8730 CDS product CD1871A family CXXC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889347.1 protein_id gnl|my_center|LOCUS_09610 9461 9607 gene locus_tag LOCUS_09620 9461 9607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 9579 10139 gene locus_tag LOCUS_09630 gene resA 9579 10139 CDS product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742200.1 protein_id gnl|my_center|LOCUS_09630 10332 11945 gene locus_tag LOCUS_09640 gene hcp 10332 11945 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681572.1 protein_id gnl|my_center|LOCUS_09640 12259 13263 gene locus_tag LOCUS_09650 12259 13263 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016565.1 protein_id gnl|my_center|LOCUS_09650 13264 13914 gene locus_tag LOCUS_09660 13264 13914 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189862.1 protein_id gnl|my_center|LOCUS_09660 13973 14821 gene locus_tag LOCUS_09670 13973 14821 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461467.1 protein_id gnl|my_center|LOCUS_09670 15025 16113 gene locus_tag LOCUS_09680 15025 16113 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870212.1 protein_id gnl|my_center|LOCUS_09680 16123 16962 gene locus_tag LOCUS_09690 16123 16962 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770467.1 protein_id gnl|my_center|LOCUS_09690 16962 17741 gene locus_tag LOCUS_09700 16962 17741 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479788.1 protein_id gnl|my_center|LOCUS_09700 17738 18742 gene locus_tag LOCUS_09710 17738 18742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263897.1 protein_id gnl|my_center|LOCUS_09710 18751 19662 gene locus_tag LOCUS_09720 18751 19662 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095006144.1 protein_id gnl|my_center|LOCUS_09720 19813 20265 gene locus_tag LOCUS_09730 19813 20265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 21475 20573 gene locus_tag LOCUS_09740 21475 20573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 21839 22549 gene locus_tag LOCUS_09750 21839 22549 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359485.1 protein_id gnl|my_center|LOCUS_09750 22574 24082 gene locus_tag LOCUS_09760 22574 24082 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048829.1 protein_id gnl|my_center|LOCUS_09760 24201 24626 gene locus_tag LOCUS_09770 24201 24626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 24763 25275 gene locus_tag LOCUS_09780 24763 25275 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901748.1 protein_id gnl|my_center|LOCUS_09780 25518 25321 gene locus_tag LOCUS_09790 25518 25321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 28423 25532 gene locus_tag LOCUS_09800 28423 25532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 28616 29905 gene locus_tag LOCUS_09810 gene hflX 28616 29905 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895824.1 protein_id gnl|my_center|LOCUS_09810 29898 30530 gene locus_tag LOCUS_09820 29898 30530 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895825.1 protein_id gnl|my_center|LOCUS_09820 30548 31267 gene locus_tag LOCUS_09830 gene nadE 30548 31267 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808614.1 protein_id gnl|my_center|LOCUS_09830 31362 31541 gene locus_tag LOCUS_09840 31362 31541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 31836 32267 gene locus_tag LOCUS_09850 31836 32267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 32377 32814 gene locus_tag LOCUS_09860 32377 32814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 33433 35379 gene locus_tag LOCUS_09870 33433 35379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 35381 36040 gene locus_tag LOCUS_09880 35381 36040 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748775.1 protein_id gnl|my_center|LOCUS_09880 36457 37437 gene locus_tag LOCUS_09890 36457 37437 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439336.1 protein_id gnl|my_center|LOCUS_09890 37465 38349 gene locus_tag LOCUS_09900 37465 38349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948810.1 protein_id gnl|my_center|LOCUS_09900 38336 39085 gene locus_tag LOCUS_09910 38336 39085 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901801.1 protein_id gnl|my_center|LOCUS_09910 39168 39656 gene locus_tag LOCUS_09920 39168 39656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 39666 39932 gene locus_tag LOCUS_09930 39666 39932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 40903 40064 gene locus_tag LOCUS_09940 40903 40064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 42146 40893 gene locus_tag LOCUS_09950 42146 40893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 42396 43484 gene locus_tag LOCUS_09960 gene ychF 42396 43484 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_09960 43493 44317 gene locus_tag LOCUS_09970 43493 44317 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986912.1 protein_id gnl|my_center|LOCUS_09970 44318 45166 gene locus_tag LOCUS_09980 gene ylqF 44318 45166 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965068.1 protein_id gnl|my_center|LOCUS_09980 45156 45773 gene locus_tag LOCUS_09990 gene rnhB 45156 45773 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245658.1 protein_id gnl|my_center|LOCUS_09990 45767 46126 gene locus_tag LOCUS_10000 45767 46126 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438259.1 protein_id gnl|my_center|LOCUS_10000 46252 46998 gene locus_tag LOCUS_10010 gene sufC 46252 46998 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_10010 46999 48411 gene locus_tag LOCUS_10020 gene sufB 46999 48411 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_10020 48419 49468 gene locus_tag LOCUS_10030 gene sufD 48419 49468 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966564.1 protein_id gnl|my_center|LOCUS_10030 49470 50711 gene locus_tag LOCUS_10040 49470 50711 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_10040 50701 51156 gene locus_tag LOCUS_10050 50701 51156 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_10050 51168 51563 gene locus_tag LOCUS_10060 51168 51563 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_10060 51571 52698 gene locus_tag LOCUS_10070 gene nifS 51571 52698 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_10070 52703 53986 gene locus_tag LOCUS_10080 52703 53986 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359094.1 protein_id gnl|my_center|LOCUS_10080 54064 56676 gene locus_tag LOCUS_10090 gene alaS 54064 56676 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986885.1 protein_id gnl|my_center|LOCUS_10090 56724 56978 gene locus_tag LOCUS_10100 56724 56978 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_10100 57036 57452 gene locus_tag LOCUS_10110 gene ruvX 57036 57452 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440635.1 protein_id gnl|my_center|LOCUS_10110 57462 57704 gene locus_tag LOCUS_10120 57462 57704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 57713 58171 gene locus_tag LOCUS_10130 57713 58171 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385810.1 protein_id gnl|my_center|LOCUS_10130 58171 59832 gene locus_tag LOCUS_10140 58171 59832 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861169.1 protein_id gnl|my_center|LOCUS_10140 59875 60531 gene locus_tag LOCUS_10150 59875 60531 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986882.1 protein_id gnl|my_center|LOCUS_10150 60518 61747 gene locus_tag LOCUS_10160 60518 61747 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_10160 61737 62354 gene locus_tag LOCUS_10170 gene udk 61737 62354 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225916.1 protein_id gnl|my_center|LOCUS_10170 62458 63045 gene locus_tag LOCUS_10180 gene infC 62458 63045 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860916.1 protein_id gnl|my_center|LOCUS_10180 63057 63248 gene locus_tag LOCUS_10190 gene rpmI 63057 63248 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222418.1 protein_id gnl|my_center|LOCUS_10190 63261 63611 gene locus_tag LOCUS_10200 gene rplT 63261 63611 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386545.1 protein_id gnl|my_center|LOCUS_10200 63675 65003 gene locus_tag LOCUS_10210 63675 65003 CDS product Trk family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888508.1 protein_id gnl|my_center|LOCUS_10210 65006 65656 gene locus_tag LOCUS_10220 65006 65656 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418257.1 protein_id gnl|my_center|LOCUS_10220 65816 66904 gene locus_tag LOCUS_10230 65816 66904 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 protein_id gnl|my_center|LOCUS_10230 66950 67468 gene locus_tag LOCUS_10240 66950 67468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 67522 68268 gene locus_tag LOCUS_10250 67522 68268 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965655.1 protein_id gnl|my_center|LOCUS_10250 68265 68951 gene locus_tag LOCUS_10260 68265 68951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439005.1 protein_id gnl|my_center|LOCUS_10260 69244 69065 gene locus_tag LOCUS_10270 69244 69065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 69567 69217 gene locus_tag LOCUS_10280 69567 69217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 70350 72260 gene locus_tag LOCUS_10290 gene thrS 70350 72260 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_10290 72488 72793 gene locus_tag LOCUS_10300 gene rplU 72488 72793 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270907.1 protein_id gnl|my_center|LOCUS_10300 72793 73131 gene locus_tag LOCUS_10310 72793 73131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 73124 73420 gene locus_tag LOCUS_10320 gene rpmA 73124 73420 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964571.1 protein_id gnl|my_center|LOCUS_10320 73560 74828 gene locus_tag LOCUS_10330 gene obgE 73560 74828 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_10330 74837 75124 gene locus_tag LOCUS_10340 gene yhbY 74837 75124 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 protein_id gnl|my_center|LOCUS_10340 75124 75732 gene locus_tag LOCUS_10350 gene nadD 75124 75732 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841927.1 protein_id gnl|my_center|LOCUS_10350 75722 76294 gene locus_tag LOCUS_10360 gene yqeK 75722 76294 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_10360 76291 77169 gene locus_tag LOCUS_10370 76291 77169 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582789.1 protein_id gnl|my_center|LOCUS_10370 77178 77528 gene locus_tag LOCUS_10380 gene rsfS 77178 77528 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229971.1 protein_id gnl|my_center|LOCUS_10380 77531 77908 gene locus_tag LOCUS_10390 77531 77908 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_10390 77960 78259 gene locus_tag LOCUS_10400 77960 78259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 78367 81024 gene locus_tag LOCUS_10410 gene polA 78367 81024 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896068.1 protein_id gnl|my_center|LOCUS_10410 81011 81604 gene locus_tag LOCUS_10420 gene coaE 81011 81604 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495251.1 protein_id gnl|my_center|LOCUS_10420 81890 81648 gene locus_tag LOCUS_10430 81890 81648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 82545 81892 gene locus_tag LOCUS_10440 82545 81892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 82685 82760 gene locus_tag LOCUS_t00130 82685 82760 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 82917 83939 gene locus_tag LOCUS_10450 gene pheS 82917 83939 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436795.1 protein_id gnl|my_center|LOCUS_10450 83950 86325 gene locus_tag LOCUS_10460 gene pheT 83950 86325 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_10460 86336 86887 gene locus_tag LOCUS_10470 86336 86887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 86874 89216 gene locus_tag LOCUS_10480 86874 89216 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048131.1 protein_id gnl|my_center|LOCUS_10480 89209 91581 gene locus_tag LOCUS_10490 89209 91581 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_10490 91591 93300 gene locus_tag LOCUS_10500 gene argS 91591 93300 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_10500 93305 94066 gene locus_tag LOCUS_10510 93305 94066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 94067 95167 gene locus_tag LOCUS_10520 94067 95167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965633.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence08 845 306 gene locus_tag LOCUS_10530 845 306 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_10530 1521 934 gene locus_tag LOCUS_10540 1521 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1680 2627 gene locus_tag LOCUS_10550 1680 2627 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476400.1 protein_id gnl|my_center|LOCUS_10550 2624 3169 gene locus_tag LOCUS_10560 2624 3169 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476401.1 protein_id gnl|my_center|LOCUS_10560 3456 3779 gene locus_tag LOCUS_10570 3456 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015807.1 protein_id gnl|my_center|LOCUS_10570 3766 5715 gene locus_tag LOCUS_10580 3766 5715 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015806.1 protein_id gnl|my_center|LOCUS_10580 5726 6196 gene locus_tag LOCUS_10590 5726 6196 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904262.1 protein_id gnl|my_center|LOCUS_10590 6206 6754 gene locus_tag LOCUS_10600 6206 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 6772 7764 gene locus_tag LOCUS_10610 6772 7764 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986935.1 protein_id gnl|my_center|LOCUS_10610 7757 8071 gene locus_tag LOCUS_10620 7757 8071 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367214.1 protein_id gnl|my_center|LOCUS_10620 8101 9870 gene locus_tag LOCUS_10630 8101 9870 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033047490.1 protein_id gnl|my_center|LOCUS_10630 9863 11305 gene locus_tag LOCUS_10640 9863 11305 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015800.1 protein_id gnl|my_center|LOCUS_10640 11308 12000 gene locus_tag LOCUS_10650 11308 12000 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015799.1 protein_id gnl|my_center|LOCUS_10650 12508 12975 gene locus_tag LOCUS_10660 12508 12975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 13072 13446 gene locus_tag LOCUS_10670 13072 13446 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895748.1 protein_id gnl|my_center|LOCUS_10670 13640 13521 gene locus_tag LOCUS_10680 13640 13521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 13711 14238 gene locus_tag LOCUS_10690 13711 14238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 17537 14334 gene locus_tag LOCUS_10700 gene carB 17537 14334 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_10700 17814 18950 gene locus_tag LOCUS_10710 17814 18950 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221227.1 protein_id gnl|my_center|LOCUS_10710 18937 19425 gene locus_tag LOCUS_10720 18937 19425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 19427 19975 gene locus_tag LOCUS_10730 19427 19975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 19969 21360 gene locus_tag LOCUS_10740 19969 21360 CDS product IctB family putative bicarbonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143733.1 protein_id gnl|my_center|LOCUS_10740 21364 22467 gene locus_tag LOCUS_10750 gene csaB 21364 22467 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241591.1 protein_id gnl|my_center|LOCUS_10750 23839 22550 gene locus_tag LOCUS_10760 23839 22550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 23915 26185 gene locus_tag LOCUS_10770 23915 26185 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157831.1 protein_id gnl|my_center|LOCUS_10770 26157 27185 gene locus_tag LOCUS_10780 gene holA 26157 27185 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430958.1 protein_id gnl|my_center|LOCUS_10780 27253 27531 gene locus_tag LOCUS_10790 gene rpsT 27253 27531 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_10790 28754 27612 gene locus_tag LOCUS_10800 gene hemW 28754 27612 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099423.1 protein_id gnl|my_center|LOCUS_10800 30549 28738 gene locus_tag LOCUS_10810 gene lepA 30549 28738 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_10810 31138 30605 gene locus_tag LOCUS_10820 gene lepB 31138 30605 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_10820 31385 32407 gene locus_tag LOCUS_10830 gene hrcA 31385 32407 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964592.1 protein_id gnl|my_center|LOCUS_10830 32416 32958 gene locus_tag LOCUS_10840 32416 32958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 32985 34814 gene locus_tag LOCUS_10850 gene dnaK 32985 34814 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430934.1 protein_id gnl|my_center|LOCUS_10850 34956 36083 gene locus_tag LOCUS_10860 gene dnaJ 34956 36083 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_10860 36157 37065 gene locus_tag LOCUS_10870 gene prmA 36157 37065 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385115.1 protein_id gnl|my_center|LOCUS_10870 37058 37747 gene locus_tag LOCUS_10880 37058 37747 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456176.1 protein_id gnl|my_center|LOCUS_10880 37747 39045 gene locus_tag LOCUS_10890 gene mtaB 37747 39045 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_10890 39046 39429 gene locus_tag LOCUS_10900 39046 39429 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061260.1 protein_id gnl|my_center|LOCUS_10900 39431 39769 gene locus_tag LOCUS_10910 39431 39769 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047999.1 protein_id gnl|my_center|LOCUS_10910 39949 40800 gene locus_tag LOCUS_10920 39949 40800 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389614.1 protein_id gnl|my_center|LOCUS_10920 40827 41582 gene locus_tag LOCUS_10930 40827 41582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 41671 41850 gene locus_tag LOCUS_10940 gene rpsU 41671 41850 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357777.1 protein_id gnl|my_center|LOCUS_10940 41866 42309 gene locus_tag LOCUS_10950 41866 42309 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430905.1 protein_id gnl|my_center|LOCUS_10950 42494 43213 gene locus_tag LOCUS_10960 42494 43213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 43222 44214 gene locus_tag LOCUS_10970 gene floA 43222 44214 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_10970 44214 44795 gene locus_tag LOCUS_10980 44214 44795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 44877 45911 gene locus_tag LOCUS_10990 44877 45911 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_10990 45895 46341 gene locus_tag LOCUS_11000 gene ybeY 45895 46341 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430894.1 protein_id gnl|my_center|LOCUS_11000 46346 47053 gene locus_tag LOCUS_11010 46346 47053 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358036.1 protein_id gnl|my_center|LOCUS_11010 47054 47467 gene locus_tag LOCUS_11020 47054 47467 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357963.1 protein_id gnl|my_center|LOCUS_11020 47454 48359 gene locus_tag LOCUS_11030 gene era 47454 48359 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_11030 48343 49047 gene locus_tag LOCUS_11040 gene recO 48343 49047 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487015.1 protein_id gnl|my_center|LOCUS_11040 49059 49943 gene locus_tag LOCUS_11050 gene glyQ 49059 49943 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416656.1 protein_id gnl|my_center|LOCUS_11050 49936 52008 gene locus_tag LOCUS_11060 gene glyS 49936 52008 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861551.1 protein_id gnl|my_center|LOCUS_11060 52021 52650 gene locus_tag LOCUS_11070 52021 52650 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583757.1 protein_id gnl|my_center|LOCUS_11070 52667 53488 gene locus_tag LOCUS_11080 52667 53488 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454708.1 protein_id gnl|my_center|LOCUS_11080 53493 54506 gene locus_tag LOCUS_11090 53493 54506 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_11090 54507 56300 gene locus_tag LOCUS_11100 gene dnaG 54507 56300 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_11100 56290 57378 gene locus_tag LOCUS_11110 gene rpoD 56290 57378 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_11110 57375 58067 gene locus_tag LOCUS_11120 57375 58067 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047989.1 protein_id gnl|my_center|LOCUS_11120 58048 58824 gene locus_tag LOCUS_11130 58048 58824 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_11130 59410 59201 gene locus_tag LOCUS_11140 59410 59201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 59343 60467 gene locus_tag LOCUS_11150 59343 60467 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434503.1 protein_id gnl|my_center|LOCUS_11150 60947 67594 gene locus_tag LOCUS_11160 60947 67594 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750101.1 protein_id gnl|my_center|LOCUS_11160 68454 68158 gene locus_tag LOCUS_11170 68454 68158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 70462 68435 gene locus_tag LOCUS_11180 70462 68435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262810.1 protein_id gnl|my_center|LOCUS_11180 71579 70497 gene locus_tag LOCUS_11190 71579 70497 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011578509.1 protein_id gnl|my_center|LOCUS_11190 73678 71639 gene locus_tag LOCUS_11200 73678 71639 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045361.1 protein_id gnl|my_center|LOCUS_11200 75496 74504 gene locus_tag LOCUS_11210 75496 74504 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122904.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence09 493 2091 gene locus_tag LOCUS_11220 493 2091 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430205.1 protein_id gnl|my_center|LOCUS_11220 2254 3477 gene locus_tag LOCUS_11230 2254 3477 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016781.1 protein_id gnl|my_center|LOCUS_11230 3486 4211 gene locus_tag LOCUS_11240 3486 4211 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016780.1 protein_id gnl|my_center|LOCUS_11240 4246 4842 gene locus_tag LOCUS_11250 4246 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 4882 5568 gene locus_tag LOCUS_11260 4882 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 6062 5598 gene locus_tag LOCUS_11270 6062 5598 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_11270 6993 6124 gene locus_tag LOCUS_11280 6993 6124 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439497.1 protein_id gnl|my_center|LOCUS_11280 8179 7154 gene locus_tag LOCUS_11290 8179 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 9621 8188 gene locus_tag LOCUS_11300 9621 8188 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_11300 10311 9673 gene locus_tag LOCUS_11310 10311 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 10556 11179 gene locus_tag LOCUS_11320 10556 11179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 11172 12521 gene locus_tag LOCUS_11330 11172 12521 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_11330 12614 13813 gene locus_tag LOCUS_11340 12614 13813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 13803 15329 gene locus_tag LOCUS_11350 13803 15329 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033562369.1 protein_id gnl|my_center|LOCUS_11350 15806 15456 gene locus_tag LOCUS_11360 15806 15456 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218967.1 protein_id gnl|my_center|LOCUS_11360 17650 16445 gene locus_tag LOCUS_11370 17650 16445 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869039.1 protein_id gnl|my_center|LOCUS_11370 18433 17669 gene locus_tag LOCUS_11380 18433 17669 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_11380 19260 18442 gene locus_tag LOCUS_11390 19260 18442 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362794.1 protein_id gnl|my_center|LOCUS_11390 19551 21005 gene locus_tag LOCUS_11400 19551 21005 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964320.1 protein_id gnl|my_center|LOCUS_11400 21036 21902 gene locus_tag LOCUS_11410 21036 21902 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986530.1 protein_id gnl|my_center|LOCUS_11410 21923 22831 gene locus_tag LOCUS_11420 21923 22831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 22844 24058 gene locus_tag LOCUS_11430 22844 24058 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667244.1 protein_id gnl|my_center|LOCUS_11430 24471 24127 gene locus_tag LOCUS_11440 24471 24127 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080895.1 protein_id gnl|my_center|LOCUS_11440 24617 25837 gene locus_tag LOCUS_11450 24617 25837 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294192.1 protein_id gnl|my_center|LOCUS_11450 26089 25838 gene locus_tag LOCUS_11460 26089 25838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 25983 26465 gene locus_tag LOCUS_11470 25983 26465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 26465 27439 gene locus_tag LOCUS_11480 26465 27439 CDS product osmoprotectant ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355743.1 protein_id gnl|my_center|LOCUS_11480 27432 28076 gene locus_tag LOCUS_11490 27432 28076 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640359.1 protein_id gnl|my_center|LOCUS_11490 29424 28123 gene locus_tag LOCUS_11500 29424 28123 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016800.1 protein_id gnl|my_center|LOCUS_11500 29736 31766 gene locus_tag LOCUS_11510 29736 31766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 31756 32439 gene locus_tag LOCUS_11520 31756 32439 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855103.1 protein_id gnl|my_center|LOCUS_11520 32439 33692 gene locus_tag LOCUS_11530 32439 33692 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943646.1 protein_id gnl|my_center|LOCUS_11530 33850 34989 gene locus_tag LOCUS_11540 33850 34989 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963530.1 protein_id gnl|my_center|LOCUS_11540 35082 37277 gene locus_tag LOCUS_11550 35082 37277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 37409 37879 gene locus_tag LOCUS_11560 37409 37879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 37888 38109 gene locus_tag LOCUS_11570 37888 38109 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974621.1 protein_id gnl|my_center|LOCUS_11570 38099 38578 gene locus_tag LOCUS_11580 38099 38578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 38745 40229 gene locus_tag LOCUS_11590 38745 40229 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903237.1 protein_id gnl|my_center|LOCUS_11590 40386 41693 gene locus_tag LOCUS_11600 gene hisS 40386 41693 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966027.1 protein_id gnl|my_center|LOCUS_11600 42022 43845 gene locus_tag LOCUS_11610 gene typA 42022 43845 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964991.1 protein_id gnl|my_center|LOCUS_11610 43864 45327 gene locus_tag LOCUS_11620 gene cls 43864 45327 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243311.1 protein_id gnl|my_center|LOCUS_11620 45329 45868 gene locus_tag LOCUS_11630 45329 45868 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_11630 45877 46092 gene locus_tag LOCUS_11640 45877 46092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 46218 46973 gene locus_tag LOCUS_11650 46218 46973 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144264.1 protein_id gnl|my_center|LOCUS_11650 47430 47050 gene locus_tag LOCUS_11660 47430 47050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 47921 47439 gene locus_tag LOCUS_11670 gene rlmH 47921 47439 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435703.1 protein_id gnl|my_center|LOCUS_11670 48418 47918 gene locus_tag LOCUS_11680 gene tpx 48418 47918 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223506.1 protein_id gnl|my_center|LOCUS_11680 48575 48988 gene locus_tag LOCUS_11690 48575 48988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 49007 49402 gene locus_tag LOCUS_11700 49007 49402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 49447 50112 gene locus_tag LOCUS_11710 49447 50112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 52311 50458 gene locus_tag LOCUS_11720 gene htpG 52311 50458 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986521.1 protein_id gnl|my_center|LOCUS_11720 52574 53266 gene locus_tag LOCUS_11730 52574 53266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420704.1 protein_id gnl|my_center|LOCUS_11730 53277 53495 gene locus_tag LOCUS_11740 53277 53495 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_11740 53507 54571 gene locus_tag LOCUS_11750 53507 54571 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432442.1 protein_id gnl|my_center|LOCUS_11750 54571 55323 gene locus_tag LOCUS_11760 54571 55323 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420710.1 protein_id gnl|my_center|LOCUS_11760 55323 56525 gene locus_tag LOCUS_11770 55323 56525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 57680 56649 gene locus_tag LOCUS_11780 57680 56649 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922741.1 protein_id gnl|my_center|LOCUS_11780 58642 57689 gene locus_tag LOCUS_11790 58642 57689 CDS product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817430.1 protein_id gnl|my_center|LOCUS_11790 58896 59531 gene locus_tag LOCUS_11800 58896 59531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 59556 59855 gene locus_tag LOCUS_11810 59556 59855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 60279 61622 gene locus_tag LOCUS_11820 60279 61622 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence10 531 3551 gene locus_tag LOCUS_11830 531 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 3707 3928 gene locus_tag LOCUS_11840 3707 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 4010 4159 gene locus_tag LOCUS_11850 4010 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 4184 4972 gene locus_tag LOCUS_11860 4184 4972 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434723.1 protein_id gnl|my_center|LOCUS_11860 4959 6233 gene locus_tag LOCUS_11870 4959 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 6391 8148 gene locus_tag LOCUS_11880 6391 8148 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888006.1 protein_id gnl|my_center|LOCUS_11880 8641 9414 gene locus_tag LOCUS_11890 8641 9414 CDS product LamB/YcsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016390.1 protein_id gnl|my_center|LOCUS_11890 9425 10621 gene locus_tag LOCUS_11900 9425 10621 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016389.1 protein_id gnl|my_center|LOCUS_11900 10638 11384 gene locus_tag LOCUS_11910 gene pxpB 10638 11384 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494307.1 protein_id gnl|my_center|LOCUS_11910 11377 12321 gene locus_tag LOCUS_11920 11377 12321 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016387.1 protein_id gnl|my_center|LOCUS_11920 12318 13115 gene locus_tag LOCUS_11930 12318 13115 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886407.1 protein_id gnl|my_center|LOCUS_11930 13247 14521 gene locus_tag LOCUS_11940 13247 14521 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435637.1 protein_id gnl|my_center|LOCUS_11940 14904 15809 gene locus_tag LOCUS_11950 14904 15809 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548290.1 protein_id gnl|my_center|LOCUS_11950 15957 17807 gene locus_tag LOCUS_11960 15957 17807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 17971 19026 gene locus_tag LOCUS_11970 17971 19026 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947984.1 protein_id gnl|my_center|LOCUS_11970 19036 19467 gene locus_tag LOCUS_11980 gene rpiB 19036 19467 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966164.1 protein_id gnl|my_center|LOCUS_11980 19469 20095 gene locus_tag LOCUS_11990 gene upp 19469 20095 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027487.1 protein_id gnl|my_center|LOCUS_11990 20105 21133 gene locus_tag LOCUS_12000 20105 21133 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356585.1 protein_id gnl|my_center|LOCUS_12000 21135 22238 gene locus_tag LOCUS_12010 gene wecB 21135 22238 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947987.1 protein_id gnl|my_center|LOCUS_12010 22308 22721 gene locus_tag LOCUS_12020 22308 22721 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276952.1 protein_id gnl|my_center|LOCUS_12020 22736 23923 gene locus_tag LOCUS_12030 22736 23923 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888868.1 protein_id gnl|my_center|LOCUS_12030 23930 24706 gene locus_tag LOCUS_12040 23930 24706 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_12040 24708 25553 gene locus_tag LOCUS_12050 24708 25553 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390868.1 protein_id gnl|my_center|LOCUS_12050 26239 27645 gene locus_tag LOCUS_12060 26239 27645 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_12060 28427 27780 gene locus_tag LOCUS_12070 28427 27780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 28887 28420 gene locus_tag LOCUS_12080 gene ribE 28887 28420 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963913.1 protein_id gnl|my_center|LOCUS_12080 30161 28956 gene locus_tag LOCUS_12090 30161 28956 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456640.1 protein_id gnl|my_center|LOCUS_12090 30818 30174 gene locus_tag LOCUS_12100 gene ribE 30818 30174 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987155.1 protein_id gnl|my_center|LOCUS_12100 31926 30811 gene locus_tag LOCUS_12110 gene ribD 31926 30811 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943609.1 protein_id gnl|my_center|LOCUS_12110 32677 32138 gene locus_tag LOCUS_12120 gene gmk 32677 32138 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546551.1 protein_id gnl|my_center|LOCUS_12120 32789 33700 gene locus_tag LOCUS_12130 gene pyrB 32789 33700 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965942.1 protein_id gnl|my_center|LOCUS_12130 33697 34128 gene locus_tag LOCUS_12140 33697 34128 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_12140 34131 34832 gene locus_tag LOCUS_12150 34131 34832 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434506.1 protein_id gnl|my_center|LOCUS_12150 34822 35727 gene locus_tag LOCUS_12160 34822 35727 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048207.1 protein_id gnl|my_center|LOCUS_12160 35812 36930 gene locus_tag LOCUS_12170 35812 36930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 37130 37855 gene locus_tag LOCUS_12180 37130 37855 CDS product DUF5058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680854.1 protein_id gnl|my_center|LOCUS_12180 37858 38568 gene locus_tag LOCUS_12190 37858 38568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 38580 39497 gene locus_tag LOCUS_12200 gene glsA 38580 39497 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417962.1 protein_id gnl|my_center|LOCUS_12200 39533 40906 gene locus_tag LOCUS_12210 39533 40906 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006194892.1 protein_id gnl|my_center|LOCUS_12210 40925 42325 gene locus_tag LOCUS_12220 40925 42325 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972982.1 protein_id gnl|my_center|LOCUS_12220 42327 43505 gene locus_tag LOCUS_12230 42327 43505 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861090.1 protein_id gnl|my_center|LOCUS_12230 43916 44749 gene locus_tag LOCUS_12240 gene panC 43916 44749 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948190.1 protein_id gnl|my_center|LOCUS_12240 44751 45707 gene locus_tag LOCUS_12250 44751 45707 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399225.1 protein_id gnl|my_center|LOCUS_12250 46492 45767 gene locus_tag LOCUS_12260 46492 45767 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015795.1 protein_id gnl|my_center|LOCUS_12260 47264 46476 gene locus_tag LOCUS_12270 47264 46476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 49282 47261 gene locus_tag LOCUS_12280 49282 47261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 49719 49279 gene locus_tag LOCUS_12290 gene aroQ 49719 49279 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903558.1 protein_id gnl|my_center|LOCUS_12290 51211 49700 gene locus_tag LOCUS_12300 51211 49700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 52293 51199 gene locus_tag LOCUS_12310 gene aroC 52293 51199 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_12310 53518 52283 gene locus_tag LOCUS_12320 gene aroA 53518 52283 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_12320 54554 53502 gene locus_tag LOCUS_12330 gene aroB 54554 53502 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358508.1 protein_id gnl|my_center|LOCUS_12330 55893 54691 gene locus_tag LOCUS_12340 gene megL 55893 54691 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 protein_id gnl|my_center|LOCUS_12340 57306 55921 gene locus_tag LOCUS_12350 57306 55921 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949050.1 protein_id gnl|my_center|LOCUS_12350 57608 57937 gene locus_tag LOCUS_12360 57608 57937 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261939.1 protein_id gnl|my_center|LOCUS_12360 57924 58664 gene locus_tag LOCUS_12370 57924 58664 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296505.1 protein_id gnl|my_center|LOCUS_12370 58804 59445 gene locus_tag LOCUS_12380 gene trmB 58804 59445 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965915.1 protein_id gnl|my_center|LOCUS_12380 59508 60473 gene locus_tag LOCUS_12390 gene bioB 59508 60473 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_12390 >Feature sequence11 96 169 gene locus_tag LOCUS_t00140 96 169 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 175 251 gene locus_tag LOCUS_t00150 175 251 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 266 341 gene locus_tag LOCUS_t00160 266 341 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 354 429 gene locus_tag LOCUS_t00170 354 429 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 450 538 gene locus_tag LOCUS_t00180 450 538 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 598 673 gene locus_tag LOCUS_t00190 598 673 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 938 1894 gene locus_tag LOCUS_12400 gene tdcB 938 1894 CDS product bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815409.1 protein_id gnl|my_center|LOCUS_12400 1909 3090 gene locus_tag LOCUS_12410 1909 3090 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867899.1 protein_id gnl|my_center|LOCUS_12410 5026 3311 gene locus_tag LOCUS_12420 5026 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860733.1 protein_id gnl|my_center|LOCUS_12420 5927 5019 gene locus_tag LOCUS_12430 5927 5019 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434205.1 protein_id gnl|my_center|LOCUS_12430 6154 6273 gene locus_tag LOCUS_12440 6154 6273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 6527 7813 gene locus_tag LOCUS_12450 gene serS 6527 7813 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_12450 8037 10736 gene locus_tag LOCUS_12460 8037 10736 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948276.1 protein_id gnl|my_center|LOCUS_12460 11069 10782 gene locus_tag LOCUS_12470 11069 10782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 11187 12194 gene locus_tag LOCUS_12480 11187 12194 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948306.1 protein_id gnl|my_center|LOCUS_12480 12301 12681 gene locus_tag LOCUS_12490 12301 12681 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_12490 12678 13517 gene locus_tag LOCUS_12500 12678 13517 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897173.1 protein_id gnl|my_center|LOCUS_12500 13514 14134 gene locus_tag LOCUS_12510 13514 14134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 14131 14769 gene locus_tag LOCUS_12520 14131 14769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 14921 16246 gene locus_tag LOCUS_12530 14921 16246 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_12530 16434 17996 gene locus_tag LOCUS_12540 16434 17996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 18013 19488 gene locus_tag LOCUS_12550 gene gltX 18013 19488 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435581.1 protein_id gnl|my_center|LOCUS_12550 19686 20870 gene locus_tag LOCUS_12560 19686 20870 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583493.1 protein_id gnl|my_center|LOCUS_12560 20867 21610 gene locus_tag LOCUS_12570 gene tpiA 20867 21610 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963550.1 protein_id gnl|my_center|LOCUS_12570 21607 23109 gene locus_tag LOCUS_12580 gene gpmI 21607 23109 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_12580 23118 24413 gene locus_tag LOCUS_12590 gene eno 23118 24413 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727923.1 protein_id gnl|my_center|LOCUS_12590 24410 24808 gene locus_tag LOCUS_12600 24410 24808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 25005 26504 gene locus_tag LOCUS_12610 gene murJ 25005 26504 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886330.1 protein_id gnl|my_center|LOCUS_12610 26575 26898 gene locus_tag LOCUS_12620 26575 26898 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321527.1 protein_id gnl|my_center|LOCUS_12620 27055 30804 gene locus_tag LOCUS_12630 gene rpoB 27055 30804 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436174.1 protein_id gnl|my_center|LOCUS_12630 30844 34431 gene locus_tag LOCUS_12640 gene rpoC 30844 34431 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429485.1 protein_id gnl|my_center|LOCUS_12640 34714 35460 gene locus_tag LOCUS_12650 34714 35460 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496750.1 protein_id gnl|my_center|LOCUS_12650 35457 36512 gene locus_tag LOCUS_12660 35457 36512 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529319.1 protein_id gnl|my_center|LOCUS_12660 36525 38186 gene locus_tag LOCUS_12670 36525 38186 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529320.1 protein_id gnl|my_center|LOCUS_12670 38170 39204 gene locus_tag LOCUS_12680 38170 39204 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 protein_id gnl|my_center|LOCUS_12680 39194 39931 gene locus_tag LOCUS_12690 39194 39931 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895939.1 protein_id gnl|my_center|LOCUS_12690 40359 40772 gene locus_tag LOCUS_12700 gene rpsL 40359 40772 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893867.1 protein_id gnl|my_center|LOCUS_12700 40863 41333 gene locus_tag LOCUS_12710 gene rpsG 40863 41333 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421180.1 protein_id gnl|my_center|LOCUS_12710 41349 43424 gene locus_tag LOCUS_12720 gene fusA 41349 43424 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724965.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence12 1395 316 gene locus_tag LOCUS_12730 1395 316 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134908.1 protein_id gnl|my_center|LOCUS_12730 1952 1482 gene locus_tag LOCUS_12740 1952 1482 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674090.1 protein_id gnl|my_center|LOCUS_12740 2674 2048 gene locus_tag LOCUS_12750 2674 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 3657 2758 gene locus_tag LOCUS_12760 3657 2758 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_12760 4126 4710 gene locus_tag LOCUS_12770 4126 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4866 6293 gene locus_tag LOCUS_12780 4866 6293 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681245.1 protein_id gnl|my_center|LOCUS_12780 6679 6416 gene locus_tag LOCUS_12790 6679 6416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 7718 6882 gene locus_tag LOCUS_12800 7718 6882 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287519.1 protein_id gnl|my_center|LOCUS_12800 8311 7715 gene locus_tag LOCUS_12810 8311 7715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 9513 8719 gene locus_tag LOCUS_12820 9513 8719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 11985 9550 gene locus_tag LOCUS_12830 11985 9550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 12650 11982 gene locus_tag LOCUS_12840 12650 11982 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948859.1 protein_id gnl|my_center|LOCUS_12840 13445 13311 gene locus_tag LOCUS_12850 13445 13311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 13752 13426 gene locus_tag LOCUS_12860 13752 13426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 15943 13940 gene locus_tag LOCUS_12870 15943 13940 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_12870 16196 15972 gene locus_tag LOCUS_12880 16196 15972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 16431 17450 gene locus_tag LOCUS_12890 gene gap 16431 17450 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948756.1 protein_id gnl|my_center|LOCUS_12890 19335 17539 gene locus_tag LOCUS_12900 19335 17539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 21340 19793 gene locus_tag LOCUS_12910 gene citF 21340 19793 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017113.1 protein_id gnl|my_center|LOCUS_12910 22229 21330 gene locus_tag LOCUS_12920 gene citE 22229 21330 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898727.1 protein_id gnl|my_center|LOCUS_12920 22515 22234 gene locus_tag LOCUS_12930 gene citD 22515 22234 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263227.1 protein_id gnl|my_center|LOCUS_12930 23823 22534 gene locus_tag LOCUS_12940 23823 22534 CDS product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003394.1 protein_id gnl|my_center|LOCUS_12940 24608 24096 gene locus_tag LOCUS_12950 gene citX 24608 24096 CDS product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016309.1 protein_id gnl|my_center|LOCUS_12950 25587 24595 gene locus_tag LOCUS_12960 gene citC 25587 24595 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263235.1 protein_id gnl|my_center|LOCUS_12960 26404 25580 gene locus_tag LOCUS_12970 gene citG 26404 25580 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017110.1 protein_id gnl|my_center|LOCUS_12970 27746 26538 gene locus_tag LOCUS_12980 gene ilvA 27746 26538 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858758.1 protein_id gnl|my_center|LOCUS_12980 27972 27748 gene locus_tag LOCUS_12990 27972 27748 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704318.1 protein_id gnl|my_center|LOCUS_12990 28837 27959 gene locus_tag LOCUS_13000 28837 27959 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982833.1 protein_id gnl|my_center|LOCUS_13000 29919 28834 gene locus_tag LOCUS_13010 29919 28834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 31965 30016 gene locus_tag LOCUS_13020 gene tkt 31965 30016 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964657.1 protein_id gnl|my_center|LOCUS_13020 32729 31977 gene locus_tag LOCUS_13030 32729 31977 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702613.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence13 10661 9648 gene locus_tag LOCUS_13040 10661 9648 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448020.1 protein_id gnl|my_center|LOCUS_13040 11259 10633 gene locus_tag LOCUS_13050 11259 10633 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166986.1 protein_id gnl|my_center|LOCUS_13050 13402 11696 gene locus_tag LOCUS_13060 13402 11696 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861365.1 protein_id gnl|my_center|LOCUS_13060 14636 13740 gene locus_tag LOCUS_13070 14636 13740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 16213 14651 gene locus_tag LOCUS_13080 16213 14651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13080 16458 16213 gene locus_tag LOCUS_13090 16458 16213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 19013 16473 gene locus_tag LOCUS_13100 19013 16473 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861362.1 protein_id gnl|my_center|LOCUS_13100 19982 19023 gene locus_tag LOCUS_13110 19982 19023 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861113.1 protein_id gnl|my_center|LOCUS_13110 22449 19972 gene locus_tag LOCUS_13120 22449 19972 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861361.1 protein_id gnl|my_center|LOCUS_13120 22793 22446 gene locus_tag LOCUS_13130 22793 22446 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861360.1 protein_id gnl|my_center|LOCUS_13130 22954 22793 gene locus_tag LOCUS_13140 22954 22793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 23787 22966 gene locus_tag LOCUS_13150 23787 22966 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426087.1 protein_id gnl|my_center|LOCUS_13150 24046 23831 gene locus_tag LOCUS_13160 24046 23831 CDS product Maff2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861358.1 protein_id gnl|my_center|LOCUS_13160 24370 24050 gene locus_tag LOCUS_13170 24370 24050 CDS product single-strand DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005541371.1 protein_id gnl|my_center|LOCUS_13170 24923 24576 gene locus_tag LOCUS_13180 24923 24576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 26844 25072 gene locus_tag LOCUS_13190 26844 25072 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010247013.1 protein_id gnl|my_center|LOCUS_13190 27076 26915 gene locus_tag LOCUS_13200 27076 26915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 27414 27130 gene locus_tag LOCUS_13210 27414 27130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 27766 27407 gene locus_tag LOCUS_13220 27766 27407 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461083.1 protein_id gnl|my_center|LOCUS_13220 28313 27822 gene locus_tag LOCUS_13230 28313 27822 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861354.1 protein_id gnl|my_center|LOCUS_13230 29185 28328 gene locus_tag LOCUS_13240 29185 28328 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860782.1 protein_id gnl|my_center|LOCUS_13240 30183 29200 gene locus_tag LOCUS_13250 30183 29200 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368732.1 protein_id gnl|my_center|LOCUS_13250 30559 30269 gene locus_tag LOCUS_13260 30559 30269 CDS product CD1845 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860780.1 protein_id gnl|my_center|LOCUS_13260 30852 30625 gene locus_tag LOCUS_13270 30852 30625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 31765 30905 gene locus_tag LOCUS_13280 31765 30905 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860822.1 protein_id gnl|my_center|LOCUS_13280 32234 31767 gene locus_tag LOCUS_13290 32234 31767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence14 356 1225 gene locus_tag LOCUS_13300 356 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 2055 1333 gene locus_tag LOCUS_13310 2055 1333 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361352.1 protein_id gnl|my_center|LOCUS_13310 2839 2042 gene locus_tag LOCUS_13320 2839 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 3654 2848 gene locus_tag LOCUS_13330 3654 2848 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047707.1 protein_id gnl|my_center|LOCUS_13330 4339 5559 gene locus_tag LOCUS_13340 4339 5559 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_13340 5561 6931 gene locus_tag LOCUS_13350 gene argH 5561 6931 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_13350 7167 7445 gene locus_tag LOCUS_13360 7167 7445 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894377.1 protein_id gnl|my_center|LOCUS_13360 7463 10396 gene locus_tag LOCUS_13370 7463 10396 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016941.1 protein_id gnl|my_center|LOCUS_13370 10411 11757 gene locus_tag LOCUS_13380 10411 11757 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090934236.1 protein_id gnl|my_center|LOCUS_13380 13056 11818 gene locus_tag LOCUS_13390 13056 11818 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906398.1 protein_id gnl|my_center|LOCUS_13390 14099 13137 gene locus_tag LOCUS_13400 14099 13137 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_13400 14198 15088 gene locus_tag LOCUS_13410 14198 15088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 15085 15840 gene locus_tag LOCUS_13420 gene map 15085 15840 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724059.1 protein_id gnl|my_center|LOCUS_13420 16061 16666 gene locus_tag LOCUS_13430 16061 16666 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547484.1 protein_id gnl|my_center|LOCUS_13430 16675 17277 gene locus_tag LOCUS_13440 16675 17277 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763837.1 protein_id gnl|my_center|LOCUS_13440 17338 18408 gene locus_tag LOCUS_13450 17338 18408 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948815.1 protein_id gnl|my_center|LOCUS_13450 18398 19321 gene locus_tag LOCUS_13460 18398 19321 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722579.1 protein_id gnl|my_center|LOCUS_13460 19302 19805 gene locus_tag LOCUS_13470 19302 19805 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723593.1 protein_id gnl|my_center|LOCUS_13470 20630 19851 gene locus_tag LOCUS_13480 gene appF 20630 19851 CDS product oligopeptide ABC transporter ATP-binding protein AppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232964.1 protein_id gnl|my_center|LOCUS_13480 21597 20608 gene locus_tag LOCUS_13490 21597 20608 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966459.1 protein_id gnl|my_center|LOCUS_13490 22409 21594 gene locus_tag LOCUS_13500 22409 21594 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_13500 23352 22411 gene locus_tag LOCUS_13510 23352 22411 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086014.1 protein_id gnl|my_center|LOCUS_13510 24865 23345 gene locus_tag LOCUS_13520 24865 23345 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017097.1 protein_id gnl|my_center|LOCUS_13520 25049 25330 gene locus_tag LOCUS_13530 25049 25330 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257138.1 protein_id gnl|my_center|LOCUS_13530 25342 25986 gene locus_tag LOCUS_13540 gene nth 25342 25986 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387915.1 protein_id gnl|my_center|LOCUS_13540 25991 27373 gene locus_tag LOCUS_13550 25991 27373 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986179.1 protein_id gnl|my_center|LOCUS_13550 27440 28012 gene locus_tag LOCUS_13560 27440 28012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 28003 28830 gene locus_tag LOCUS_13570 28003 28830 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986367.1 protein_id gnl|my_center|LOCUS_13570 28817 30370 gene locus_tag LOCUS_13580 gene rlmD 28817 30370 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914581.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence15 2266 533 gene locus_tag LOCUS_13590 2266 533 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065725.1 protein_id gnl|my_center|LOCUS_13590 4004 2268 gene locus_tag LOCUS_13600 4004 2268 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048173276.1 protein_id gnl|my_center|LOCUS_13600 5452 3998 gene locus_tag LOCUS_13610 5452 3998 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860798.1 protein_id gnl|my_center|LOCUS_13610 6126 5449 gene locus_tag LOCUS_13620 6126 5449 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681182.1 protein_id gnl|my_center|LOCUS_13620 6716 6123 gene locus_tag LOCUS_13630 6716 6123 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860796.1 protein_id gnl|my_center|LOCUS_13630 7653 6751 gene locus_tag LOCUS_13640 7653 6751 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417631.1 protein_id gnl|my_center|LOCUS_13640 8852 7776 gene locus_tag LOCUS_13650 8852 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 11542 8873 gene locus_tag LOCUS_13660 11542 8873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 16294 11543 gene locus_tag LOCUS_13670 16294 11543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 17894 16308 gene locus_tag LOCUS_13680 17894 16308 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272471.1 protein_id gnl|my_center|LOCUS_13680 18586 17897 gene locus_tag LOCUS_13690 18586 17897 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986906.1 protein_id gnl|my_center|LOCUS_13690 19322 18561 gene locus_tag LOCUS_13700 19322 18561 CDS product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460628.1 protein_id gnl|my_center|LOCUS_13700 20410 19424 gene locus_tag LOCUS_13710 gene aroF 20410 19424 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583420.1 protein_id gnl|my_center|LOCUS_13710 20854 20429 gene locus_tag LOCUS_13720 gene aroQ 20854 20429 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964217.1 protein_id gnl|my_center|LOCUS_13720 22073 20832 gene locus_tag LOCUS_13730 22073 20832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 23176 22085 gene locus_tag LOCUS_13740 gene aroC 23176 22085 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_13740 24437 23163 gene locus_tag LOCUS_13750 gene aroA 24437 23163 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_13750 25498 24443 gene locus_tag LOCUS_13760 gene aroB 25498 24443 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964212.1 protein_id gnl|my_center|LOCUS_13760 26838 25498 gene locus_tag LOCUS_13770 26838 25498 CDS product salicylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143153455.1 protein_id gnl|my_center|LOCUS_13770 27352 26969 gene locus_tag LOCUS_13780 27352 26969 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964778.1 protein_id gnl|my_center|LOCUS_13780 27802 28170 gene locus_tag LOCUS_13790 gene mobC 27802 28170 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860794.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence16 2252 507 gene locus_tag LOCUS_13800 2252 507 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_13800 2401 4002 gene locus_tag LOCUS_13810 gene murJ 2401 4002 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454106.1 protein_id gnl|my_center|LOCUS_13810 4124 4936 gene locus_tag LOCUS_13820 4124 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 5063 5533 gene locus_tag LOCUS_13830 5063 5533 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896384.1 protein_id gnl|my_center|LOCUS_13830 5770 6231 gene locus_tag LOCUS_13840 5770 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 8036 6273 gene locus_tag LOCUS_13850 8036 6273 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681271.1 protein_id gnl|my_center|LOCUS_13850 9843 8059 gene locus_tag LOCUS_13860 9843 8059 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681271.1 protein_id gnl|my_center|LOCUS_13860 11689 9956 gene locus_tag LOCUS_13870 gene pyk 11689 9956 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_13870 12651 11698 gene locus_tag LOCUS_13880 gene pfkA 12651 11698 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429132.1 protein_id gnl|my_center|LOCUS_13880 16095 12667 gene locus_tag LOCUS_13890 16095 12667 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_13890 16534 16268 gene locus_tag LOCUS_13900 16534 16268 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250307.1 protein_id gnl|my_center|LOCUS_13900 17471 16536 gene locus_tag LOCUS_13910 gene whiA 17471 16536 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357358.1 protein_id gnl|my_center|LOCUS_13910 18762 17680 gene locus_tag LOCUS_13920 18762 17680 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892066.1 protein_id gnl|my_center|LOCUS_13920 22291 18812 gene locus_tag LOCUS_13930 gene mfd 22291 18812 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048383.1 protein_id gnl|my_center|LOCUS_13930 22869 22300 gene locus_tag LOCUS_13940 gene pth 22869 22300 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_13940 23829 22879 gene locus_tag LOCUS_13950 23829 22879 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359343.1 protein_id gnl|my_center|LOCUS_13950 25218 23839 gene locus_tag LOCUS_13960 gene glmU 25218 23839 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898727.1 protein_id gnl|my_center|LOCUS_13960 25701 26591 gene locus_tag LOCUS_13970 gene cysK 25701 26591 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948015.1 protein_id gnl|my_center|LOCUS_13970 26584 27135 gene locus_tag LOCUS_13980 gene cysE 26584 27135 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948016.1 protein_id gnl|my_center|LOCUS_13980 27155 27985 gene locus_tag LOCUS_13990 27155 27985 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence17 96 170 gene locus_tag LOCUS_t00200 96 170 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 178 254 gene locus_tag LOCUS_t00210 178 254 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 297 383 gene locus_tag LOCUS_t00220 297 383 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1335 424 gene locus_tag LOCUS_14000 1335 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1458 2603 gene locus_tag LOCUS_14010 1458 2603 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 protein_id gnl|my_center|LOCUS_14010 2612 3799 gene locus_tag LOCUS_14020 gene thiI 2612 3799 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_14020 3783 4352 gene locus_tag LOCUS_14030 3783 4352 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202196.1 protein_id gnl|my_center|LOCUS_14030 4362 5180 gene locus_tag LOCUS_14040 4362 5180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 6084 6623 gene locus_tag LOCUS_14050 6084 6623 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_14050 6634 7668 gene locus_tag LOCUS_14060 6634 7668 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437017.1 protein_id gnl|my_center|LOCUS_14060 7665 8501 gene locus_tag LOCUS_14070 7665 8501 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_14070 8498 9283 gene locus_tag LOCUS_14080 8498 9283 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_14080 9280 10323 gene locus_tag LOCUS_14090 9280 10323 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459712.1 protein_id gnl|my_center|LOCUS_14090 10407 11435 gene locus_tag LOCUS_14100 10407 11435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 11575 12672 gene locus_tag LOCUS_14110 11575 12672 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725771.1 protein_id gnl|my_center|LOCUS_14110 12792 14324 gene locus_tag LOCUS_14120 12792 14324 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289202.1 protein_id gnl|my_center|LOCUS_14120 14311 15438 gene locus_tag LOCUS_14130 14311 15438 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655968.1 protein_id gnl|my_center|LOCUS_14130 15431 16390 gene locus_tag LOCUS_14140 15431 16390 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008856.1 protein_id gnl|my_center|LOCUS_14140 16707 18041 gene locus_tag LOCUS_14150 gene rsxC 16707 18041 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_14150 18054 19037 gene locus_tag LOCUS_14160 18054 19037 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_14160 19038 19622 gene locus_tag LOCUS_14170 19038 19622 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020708.1 protein_id gnl|my_center|LOCUS_14170 19633 20229 gene locus_tag LOCUS_14180 19633 20229 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_14180 20229 20807 gene locus_tag LOCUS_14190 gene rsxA 20229 20807 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_14190 20817 21734 gene locus_tag LOCUS_14200 20817 21734 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_14200 22042 21869 gene locus_tag LOCUS_14210 22042 21869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 22551 22051 gene locus_tag LOCUS_14220 22551 22051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14220 22865 22731 gene locus_tag LOCUS_14230 22865 22731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 23373 23110 gene locus_tag LOCUS_14240 23373 23110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 23906 23439 gene locus_tag LOCUS_14250 23906 23439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14250 24659 24345 gene locus_tag LOCUS_14260 24659 24345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 25786 24890 gene locus_tag LOCUS_14270 gene dapA 25786 24890 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878410.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence18 338 3763 gene locus_tag LOCUS_14280 338 3763 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048255.1 protein_id gnl|my_center|LOCUS_14280 3835 4128 gene locus_tag LOCUS_14290 3835 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 4281 6464 gene locus_tag LOCUS_14300 4281 6464 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434402.1 protein_id gnl|my_center|LOCUS_14300 6445 7047 gene locus_tag LOCUS_14310 6445 7047 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357235.1 protein_id gnl|my_center|LOCUS_14310 7967 7044 gene locus_tag LOCUS_14320 7967 7044 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048320.1 protein_id gnl|my_center|LOCUS_14320 8051 8743 gene locus_tag LOCUS_14330 8051 8743 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454566.1 protein_id gnl|my_center|LOCUS_14330 8743 9960 gene locus_tag LOCUS_14340 8743 9960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 10082 12154 gene locus_tag LOCUS_14350 10082 12154 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 protein_id gnl|my_center|LOCUS_14350 12163 13761 gene locus_tag LOCUS_14360 12163 13761 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_14360 14723 13920 gene locus_tag LOCUS_14370 14723 13920 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418878.1 protein_id gnl|my_center|LOCUS_14370 14799 15701 gene locus_tag LOCUS_14380 14799 15701 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861083.1 protein_id gnl|my_center|LOCUS_14380 16004 16564 gene locus_tag LOCUS_14390 16004 16564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 16580 17074 gene locus_tag LOCUS_14400 16580 17074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 17148 18041 gene locus_tag LOCUS_14410 17148 18041 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977671.1 protein_id gnl|my_center|LOCUS_14410 18052 19065 gene locus_tag LOCUS_14420 gene ccpA 18052 19065 CDS product LacI family transcriptional regulator CcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888871.1 protein_id gnl|my_center|LOCUS_14420 19058 19597 gene locus_tag LOCUS_14430 19058 19597 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829810.1 protein_id gnl|my_center|LOCUS_14430 19649 20464 gene locus_tag LOCUS_14440 19649 20464 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_14440 20731 21009 gene locus_tag LOCUS_14450 20731 21009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14450 >Feature sequence19 427 263 gene locus_tag LOCUS_14460 427 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 1013 621 gene locus_tag LOCUS_14470 gene rpsI 1013 621 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_14470 1454 1026 gene locus_tag LOCUS_14480 gene rplM 1454 1026 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260793.1 protein_id gnl|my_center|LOCUS_14480 3087 1582 gene locus_tag LOCUS_14490 3087 1582 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_14490 3374 3102 gene locus_tag LOCUS_14500 3374 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 3500 4144 gene locus_tag LOCUS_14510 3500 4144 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545137.1 protein_id gnl|my_center|LOCUS_14510 4656 4150 gene locus_tag LOCUS_14520 4656 4150 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230797.1 protein_id gnl|my_center|LOCUS_14520 5171 4665 gene locus_tag LOCUS_14530 5171 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 6322 5180 gene locus_tag LOCUS_14540 6322 5180 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071622.1 protein_id gnl|my_center|LOCUS_14540 7503 6496 gene locus_tag LOCUS_14550 7503 6496 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048184.1 protein_id gnl|my_center|LOCUS_14550 8318 7518 gene locus_tag LOCUS_14560 8318 7518 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048185.1 protein_id gnl|my_center|LOCUS_14560 9479 8337 gene locus_tag LOCUS_14570 9479 8337 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048186.1 protein_id gnl|my_center|LOCUS_14570 10304 9870 gene locus_tag LOCUS_14580 10304 9870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 12685 10766 gene locus_tag LOCUS_14590 12685 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 14029 12932 gene locus_tag LOCUS_14600 14029 12932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 15222 14092 gene locus_tag LOCUS_14610 15222 14092 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521224.1 protein_id gnl|my_center|LOCUS_14610 15350 15703 gene locus_tag LOCUS_14620 15350 15703 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081116.1 protein_id gnl|my_center|LOCUS_14620 16961 15789 gene locus_tag LOCUS_14630 16961 15789 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679610.1 protein_id gnl|my_center|LOCUS_14630 18715 16970 gene locus_tag LOCUS_14640 18715 16970 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_14640 20414 18708 gene locus_tag LOCUS_14650 20414 18708 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966556.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence20 900 112 gene locus_tag LOCUS_14660 900 112 CDS product phage antirepressor KilAC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148557.1 protein_id gnl|my_center|LOCUS_14660 2833 911 gene locus_tag LOCUS_14670 2833 911 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 protein_id gnl|my_center|LOCUS_14670 3017 2817 gene locus_tag LOCUS_14680 3017 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 3578 3027 gene locus_tag LOCUS_14690 3578 3027 CDS product DUF2815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399690.1 protein_id gnl|my_center|LOCUS_14690 4692 3580 gene locus_tag LOCUS_14700 4692 3580 CDS product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144597911.1 protein_id gnl|my_center|LOCUS_14700 4988 4692 gene locus_tag LOCUS_14710 4988 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 5181 4930 gene locus_tag LOCUS_14720 5181 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 5854 5267 gene locus_tag LOCUS_14730 5854 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 6336 7172 gene locus_tag LOCUS_14740 6336 7172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 7193 9970 gene locus_tag LOCUS_14750 7193 9970 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941424.1 protein_id gnl|my_center|LOCUS_14750 9967 10170 gene locus_tag LOCUS_14760 9967 10170 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985621.1 protein_id gnl|my_center|LOCUS_14760 10198 10854 gene locus_tag LOCUS_14770 10198 10854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 12378 10876 gene locus_tag LOCUS_14780 12378 10876 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223735.1 protein_id gnl|my_center|LOCUS_14780 13611 12838 gene locus_tag LOCUS_14790 13611 12838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 14579 13659 gene locus_tag LOCUS_14800 14579 13659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 16109 14982 gene locus_tag LOCUS_14810 16109 14982 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681320.1 protein_id gnl|my_center|LOCUS_14810 16363 16106 gene locus_tag LOCUS_14820 16363 16106 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681321.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence21 1066 689 gene locus_tag LOCUS_14830 1066 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1273 1076 gene locus_tag LOCUS_14840 1273 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 1980 1363 gene locus_tag LOCUS_14850 1980 1363 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062173042.1 protein_id gnl|my_center|LOCUS_14850 2402 2187 gene locus_tag LOCUS_14860 2402 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14860 2762 2505 gene locus_tag LOCUS_14870 2762 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 5218 2783 gene locus_tag LOCUS_14880 5218 2783 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861226.1 protein_id gnl|my_center|LOCUS_14880 5726 5211 gene locus_tag LOCUS_14890 5726 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 7253 5796 gene locus_tag LOCUS_14900 7253 5796 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775555.1 protein_id gnl|my_center|LOCUS_14900 8900 7272 gene locus_tag LOCUS_14910 8900 7272 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775554.1 protein_id gnl|my_center|LOCUS_14910 10526 8901 gene locus_tag LOCUS_14920 10526 8901 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775553.1 protein_id gnl|my_center|LOCUS_14920 10892 10632 gene locus_tag LOCUS_14930 10892 10632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 11699 11298 gene locus_tag LOCUS_14940 11699 11298 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426191.1 protein_id gnl|my_center|LOCUS_14940 <13288 12250 gene locus_tag LOCUS_14950 <13288 12250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860801.1:MATE family efflux transporter >Feature sequence22 2332 443 gene locus_tag LOCUS_14960 2332 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 2801 2439 gene locus_tag LOCUS_14970 2801 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 5968 2903 gene locus_tag LOCUS_14980 5968 2903 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286502.1 protein_id gnl|my_center|LOCUS_14980 6792 6055 gene locus_tag LOCUS_14990 6792 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 7925 6888 gene locus_tag LOCUS_15000 7925 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 8324 8091 gene locus_tag LOCUS_15010 8324 8091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 8661 8428 gene locus_tag LOCUS_15020 8661 8428 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113289.1 protein_id gnl|my_center|LOCUS_15020 8915 8751 gene locus_tag LOCUS_15030 8915 8751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 9289 8933 gene locus_tag LOCUS_15040 9289 8933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 9888 9292 gene locus_tag LOCUS_15050 9888 9292 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905720.1 protein_id gnl|my_center|LOCUS_15050 10057 9878 gene locus_tag LOCUS_15060 10057 9878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 10376 10050 gene locus_tag LOCUS_15070 10376 10050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 10749 10369 gene locus_tag LOCUS_15080 10749 10369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 11078 10746 gene locus_tag LOCUS_15090 11078 10746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 11350 11078 gene locus_tag LOCUS_15100 11350 11078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 12551 11361 gene locus_tag LOCUS_15110 12551 11361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence23 700 38 gene locus_tag LOCUS_15120 700 38 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434705.1 protein_id gnl|my_center|LOCUS_15120 2347 782 gene locus_tag LOCUS_15130 2347 782 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108806778.1 protein_id gnl|my_center|LOCUS_15130 2753 2337 gene locus_tag LOCUS_15140 2753 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 4308 2746 gene locus_tag LOCUS_15150 4308 2746 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461951.1 protein_id gnl|my_center|LOCUS_15150 4577 4368 gene locus_tag LOCUS_15160 4577 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 6377 4950 gene locus_tag LOCUS_15170 6377 4950 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679287.1 protein_id gnl|my_center|LOCUS_15170 7054 6365 gene locus_tag LOCUS_15180 7054 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 7637 7047 gene locus_tag LOCUS_15190 7637 7047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 9381 7648 gene locus_tag LOCUS_15200 9381 7648 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462084.1 protein_id gnl|my_center|LOCUS_15200 11113 9383 gene locus_tag LOCUS_15210 11113 9383 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462083.1 protein_id gnl|my_center|LOCUS_15210 11809 11171 gene locus_tag LOCUS_15220 11809 11171 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679289.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence24 55 1032 gene locus_tag LOCUS_15230 55 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1133 1822 gene locus_tag LOCUS_15240 1133 1822 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888282.1 protein_id gnl|my_center|LOCUS_15240 1809 4304 gene locus_tag LOCUS_15250 1809 4304 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860821.1 protein_id gnl|my_center|LOCUS_15250 4685 5092 gene locus_tag LOCUS_15260 gene vanZ1 4685 5092 CDS product glycopeptide resistance protein VanZ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889012.1 protein_id gnl|my_center|LOCUS_15260 5749 6135 gene locus_tag LOCUS_15270 5749 6135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 6475 6834 gene locus_tag LOCUS_15280 6475 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15280 7526 8293 gene locus_tag LOCUS_15290 7526 8293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 8455 9867 gene locus_tag LOCUS_15300 8455 9867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence25 188 526 gene locus_tag LOCUS_15310 188 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1166 2464 gene locus_tag LOCUS_15320 1166 2464 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107170.1 protein_id gnl|my_center|LOCUS_15320 3046 4404 gene locus_tag LOCUS_15330 3046 4404 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_15330 4549 4671 gene locus_tag LOCUS_15340 4549 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 4696 5046 gene locus_tag LOCUS_15350 4696 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15350 5417 6151 gene locus_tag LOCUS_15360 5417 6151 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775278.1 protein_id gnl|my_center|LOCUS_15360 6148 7668 gene locus_tag LOCUS_15370 6148 7668 CDS product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775664.1 protein_id gnl|my_center|LOCUS_15370 7797 8279 gene locus_tag LOCUS_15380 7797 8279 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259155.1 protein_id gnl|my_center|LOCUS_15380 8434 9657 gene locus_tag LOCUS_15390 8434 9657 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545988.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence26 653 195 gene locus_tag LOCUS_15400 653 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1600 1217 gene locus_tag LOCUS_15410 gene mobC 1600 1217 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069996669.1 protein_id gnl|my_center|LOCUS_15410 2512 2204 gene locus_tag LOCUS_15420 2512 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 3762 2533 gene locus_tag LOCUS_15430 3762 2533 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905095.1 protein_id gnl|my_center|LOCUS_15430 6069 3919 gene locus_tag LOCUS_15440 gene comA 6069 3919 CDS product peptide cleavage/export ABC transporter ComA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668317.1 protein_id gnl|my_center|LOCUS_15440 6237 6410 gene locus_tag LOCUS_15450 6237 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 6443 6622 gene locus_tag LOCUS_15460 6443 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 6690 7022 gene locus_tag LOCUS_15470 6690 7022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 7489 7154 gene locus_tag LOCUS_15480 7489 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 8571 7603 gene locus_tag LOCUS_15490 8571 7603 CDS product replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145511.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence27 1923 187 gene locus_tag LOCUS_15500 1923 187 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462084.1 protein_id gnl|my_center|LOCUS_15500 3637 1916 gene locus_tag LOCUS_15510 3637 1916 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462083.1 protein_id gnl|my_center|LOCUS_15510 5100 3649 gene locus_tag LOCUS_15520 5100 3649 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986592.1 protein_id gnl|my_center|LOCUS_15520 5773 5102 gene locus_tag LOCUS_15530 5773 5102 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681182.1 protein_id gnl|my_center|LOCUS_15530 6360 5770 gene locus_tag LOCUS_15540 6360 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 7404 6427 gene locus_tag LOCUS_15550 7404 6427 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945452.1 protein_id gnl|my_center|LOCUS_15550 7998 7414 gene locus_tag LOCUS_15560 7998 7414 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956720.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence28 202 789 gene locus_tag LOCUS_15570 202 789 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287520.1 protein_id gnl|my_center|LOCUS_15570 786 1622 gene locus_tag LOCUS_15580 786 1622 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775600.1 protein_id gnl|my_center|LOCUS_15580 1863 2024 gene locus_tag LOCUS_15590 1863 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15590 2129 3949 gene locus_tag LOCUS_15600 2129 3949 CDS product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974286.1 protein_id gnl|my_center|LOCUS_15600 3968 4735 gene locus_tag LOCUS_15610 3968 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 4732 6018 gene locus_tag LOCUS_15620 4732 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 6011 6742 gene locus_tag LOCUS_15630 6011 6742 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989414.1 protein_id gnl|my_center|LOCUS_15630 7288 6821 gene locus_tag LOCUS_15640 7288 6821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15640 >Feature sequence29 72 404 gene locus_tag LOCUS_15650 72 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 614 769 gene locus_tag LOCUS_15660 614 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 903 1211 gene locus_tag LOCUS_15670 903 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1461 1655 gene locus_tag LOCUS_15680 1461 1655 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885335.1 protein_id gnl|my_center|LOCUS_15680 1814 2227 gene locus_tag LOCUS_15690 1814 2227 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183734.1 protein_id gnl|my_center|LOCUS_15690 2208 3581 gene locus_tag LOCUS_15700 2208 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 3750 4985 gene locus_tag LOCUS_15710 3750 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 5265 5567 gene locus_tag LOCUS_15720 5265 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 5827 5483 gene locus_tag LOCUS_15730 5827 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 5802 6053 gene locus_tag LOCUS_15740 5802 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 6069 6269 gene locus_tag LOCUS_15750 6069 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 6505 6978 gene locus_tag LOCUS_15760 gene tnpA 6505 6978 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966797.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence30 468 178 gene locus_tag LOCUS_15770 468 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 722 588 gene locus_tag LOCUS_15780 722 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 2755 725 gene locus_tag LOCUS_15790 2755 725 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986650.1 protein_id gnl|my_center|LOCUS_15790 3512 2742 gene locus_tag LOCUS_15800 3512 2742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_15800 4630 3614 gene locus_tag LOCUS_15810 4630 3614 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_15810 5289 4627 gene locus_tag LOCUS_15820 5289 4627 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_15820 5517 5308 gene locus_tag LOCUS_15830 5517 5308 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890274.1 protein_id gnl|my_center|LOCUS_15830 <7134 5617 gene locus_tag LOCUS_15840 <7134 5617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860792.1:DEAD/DEAH box helicase family protein >Feature sequence31 299 613 gene locus_tag LOCUS_15850 299 613 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420682.1 protein_id gnl|my_center|LOCUS_15850 629 1015 gene locus_tag LOCUS_15860 629 1015 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324558.1 protein_id gnl|my_center|LOCUS_15860 1055 2449 gene locus_tag LOCUS_15870 1055 2449 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813488.1 protein_id gnl|my_center|LOCUS_15870 2682 3830 gene locus_tag LOCUS_15880 gene mobT 2682 3830 CDS product MobT family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398284.1 protein_id gnl|my_center|LOCUS_15880 3873 4094 gene locus_tag LOCUS_15890 3873 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009056.1 protein_id gnl|my_center|LOCUS_15890 4211 4708 gene locus_tag LOCUS_15900 4211 4708 CDS product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324555.1 protein_id gnl|my_center|LOCUS_15900 4867 4739 gene locus_tag LOCUS_15910 4867 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 4836 5114 gene locus_tag LOCUS_15920 4836 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 >Feature sequence32 <1 687 gene locus_tag LOCUS_15930 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010905926.1:phage tail tape measure protein 691 1395 gene locus_tag LOCUS_15940 691 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1410 1640 gene locus_tag LOCUS_15950 1410 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1790 2185 gene locus_tag LOCUS_15960 1790 2185 CDS product DUF1617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965185.1 protein_id gnl|my_center|LOCUS_15960 2226 6203 gene locus_tag LOCUS_15970 2226 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 >Feature sequence33 20 364 gene locus_tag LOCUS_15980 20 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 522 683 gene locus_tag LOCUS_15990 522 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 762 2381 gene locus_tag LOCUS_16000 gene tndX 762 2381 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_16000 2378 2527 gene locus_tag LOCUS_16010 2378 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 3083 4753 gene locus_tag LOCUS_16020 gene ltrA 3083 4753 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138832.1 protein_id gnl|my_center|LOCUS_16020 4995 5915 gene locus_tag LOCUS_16030 4995 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16030 >Feature sequence34 295 173 gene locus_tag LOCUS_16040 295 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 705 499 gene locus_tag LOCUS_16050 705 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1210 830 gene locus_tag LOCUS_16060 1210 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1560 1213 gene locus_tag LOCUS_16070 1560 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 2337 1822 gene locus_tag LOCUS_16080 2337 1822 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987071.1 protein_id gnl|my_center|LOCUS_16080 3190 2585 gene locus_tag LOCUS_16090 3190 2585 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698199.1 protein_id gnl|my_center|LOCUS_16090 4709 3162 gene locus_tag LOCUS_16100 4709 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 5650 4997 gene locus_tag LOCUS_16110 5650 4997 CDS product single-strand DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861368.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence35 782 192 gene locus_tag LOCUS_16120 782 192 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 protein_id gnl|my_center|LOCUS_16120 1229 1528 gene locus_tag LOCUS_16130 1229 1528 CDS product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647661.1 protein_id gnl|my_center|LOCUS_16130 1545 2261 gene locus_tag LOCUS_16140 1545 2261 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461832.1 protein_id gnl|my_center|LOCUS_16140 2258 3289 gene locus_tag LOCUS_16150 2258 3289 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461831.1 protein_id gnl|my_center|LOCUS_16150 3286 4035 gene locus_tag LOCUS_16160 3286 4035 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184185.1 protein_id gnl|my_center|LOCUS_16160 4292 5275 gene locus_tag LOCUS_16170 4292 5275 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948306.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence36 4442 3840 gene locus_tag LOCUS_16180 4442 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence37 177 914 gene locus_tag LOCUS_16190 177 914 CDS product replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145511.1 protein_id gnl|my_center|LOCUS_16190 1042 1338 gene locus_tag LOCUS_16200 1042 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 2092 3771 gene locus_tag LOCUS_16210 2092 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 3850 4092 gene locus_tag LOCUS_16220 3850 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 4116 4433 gene locus_tag LOCUS_16230 4116 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592458.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence38 192 1916 gene locus_tag LOCUS_16240 192 1916 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202746.1 protein_id gnl|my_center|LOCUS_16240 1942 2532 gene locus_tag LOCUS_16250 1942 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 2532 3260 gene locus_tag LOCUS_16260 2532 3260 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922610.1 protein_id gnl|my_center|LOCUS_16260 3257 4648 gene locus_tag LOCUS_16270 3257 4648 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986592.1 protein_id gnl|my_center|LOCUS_16270 >Feature sequence39 <1 1729 gene locus_tag LOCUS_16280 <1 1729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989532.1:Cna B-type domain-containing protein 2162 2383 gene locus_tag LOCUS_16290 2162 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 2845 3144 gene locus_tag LOCUS_16300 2845 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 3193 3384 gene locus_tag LOCUS_16310 3193 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 3422 3790 gene locus_tag LOCUS_16320 3422 3790 CDS product EXLDI protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262962.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence40 164 898 gene locus_tag LOCUS_16330 164 898 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860736.1 protein_id gnl|my_center|LOCUS_16330 900 2846 gene locus_tag LOCUS_16340 900 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 3194 4357 gene locus_tag LOCUS_16350 3194 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16350 >Feature sequence41 1419 1138 gene locus_tag LOCUS_16360 1419 1138 CDS product VRR-NUC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714182.1 protein_id gnl|my_center|LOCUS_16360 3780 1552 gene locus_tag LOCUS_16370 3780 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence42 >Feature sequence43 1288 173 gene locus_tag LOCUS_16380 1288 173 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948247.1 protein_id gnl|my_center|LOCUS_16380 2372 1275 gene locus_tag LOCUS_16390 2372 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 3312 2374 gene locus_tag LOCUS_16400 3312 2374 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015509966.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence44 495 280 gene locus_tag LOCUS_16410 495 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1789 539 gene locus_tag LOCUS_16420 1789 539 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_16420 2571 1789 gene locus_tag LOCUS_16430 2571 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 3185 2577 gene locus_tag LOCUS_16440 3185 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence45 536 177 gene locus_tag LOCUS_16450 536 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 2034 670 gene locus_tag LOCUS_16460 2034 670 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021363290.1 protein_id gnl|my_center|LOCUS_16460 2827 2420 gene locus_tag LOCUS_16470 2827 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 >Feature sequence46 114 1925 gene locus_tag LOCUS_16480 114 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 2280 2420 gene locus_tag LOCUS_16490 2280 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 2407 2574 gene locus_tag LOCUS_16500 2407 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 2611 2871 gene locus_tag LOCUS_16510 2611 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16510 >Feature sequence47 >Feature sequence48 <1 1215 gene locus_tag LOCUS_16520 <1 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393824.1:copper amine oxidase N-terminal domain-containing protein 1230 2087 gene locus_tag LOCUS_16530 1230 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence49 2 490 gene locus_tag LOCUS_16540 2 490 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368971.1 protein_id gnl|my_center|LOCUS_16540 490 1179 gene locus_tag LOCUS_16550 490 1179 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141952.1 protein_id gnl|my_center|LOCUS_16550 1173 2537 gene locus_tag LOCUS_16560 1173 2537 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229353.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence50 316 930 gene locus_tag LOCUS_16570 316 930 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582751.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence51 278 451 gene locus_tag LOCUS_16580 278 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 663 2252 gene locus_tag LOCUS_16590 663 2252 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443313.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence52 <1 1467 gene locus_tag LOCUS_16600 <1 1467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005399341.1:ABC transporter ATP-binding protein >Feature sequence53 >Feature sequence54 44 400 gene locus_tag LOCUS_16610 gene mobC 44 400 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860794.1 protein_id gnl|my_center|LOCUS_16610 393 1538 gene locus_tag LOCUS_16620 393 1538 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861371.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16620 >Feature sequence55 249 1889 gene locus_tag LOCUS_16630 249 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence56 1720 86 gene locus_tag LOCUS_16640 1720 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 >Feature sequence57 256 990 gene locus_tag LOCUS_16650 256 990 CDS product phage antirepressor KilAC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922216.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence58 860 459 gene locus_tag LOCUS_16660 860 459 CDS product holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721755.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence59 >Feature sequence60 >Feature sequence61 370 951 gene locus_tag LOCUS_16670 370 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 980 1354 gene locus_tag LOCUS_16680 980 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 >Feature sequence62 221 358 gene locus_tag LOCUS_16690 221 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence63 1 675 gene locus_tag LOCUS_16700 1 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 662 787 gene locus_tag LOCUS_16710 662 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 910 1593 gene locus_tag LOCUS_16720 910 1593 CDS product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642728.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence64 163 471 gene locus_tag LOCUS_16730 163 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16730 808 957 gene locus_tag LOCUS_16740 808 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence65 927 82 gene locus_tag LOCUS_16750 927 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence66 1076 549 gene locus_tag LOCUS_16760 1076 549 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861354.1 protein_id gnl|my_center|LOCUS_16760 1436 1263 gene locus_tag LOCUS_16770 1436 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence67 561 226 gene locus_tag LOCUS_16780 561 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence68 468 121 gene locus_tag LOCUS_16790 468 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 744 469 gene locus_tag LOCUS_16800 744 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 <1495 889 gene locus_tag LOCUS_16810 <1495 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_137615044.1:phage major capsid protein >Feature sequence69 260 421 gene locus_tag LOCUS_16820 260 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368174.1 protein_id gnl|my_center|LOCUS_16820 >Feature sequence70 >Feature sequence71 >Feature sequence72 >Feature sequence73 201 560 gene locus_tag LOCUS_16830 201 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence74 >Feature sequence75 >Feature sequence76 >Feature sequence77 127 1092 gene locus_tag LOCUS_16840 127 1092 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964535.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence78 104 1090 gene locus_tag LOCUS_16850 104 1090 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055164393.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence79 138 10 gene locus_tag LOCUS_16860 138 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 <1109 187 gene locus_tag LOCUS_16870 <1109 187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681209.1:ABC transporter ATP-binding protein >Feature sequence80 <1 820 gene locus_tag LOCUS_16880 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000031832.1:recombinase family protein >Feature sequence81