>Feature sequence01 702 932 gene locus_tag LOCUS_00010 702 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1017 2237 gene locus_tag LOCUS_00020 1017 2237 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087297.1 protein_id gnl|my_center|LOCUS_00020 2393 3604 gene locus_tag LOCUS_00030 2393 3604 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287705.1 protein_id gnl|my_center|LOCUS_00030 5105 3900 gene locus_tag LOCUS_00040 5105 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5845 5135 gene locus_tag LOCUS_00050 5845 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5970 6818 gene locus_tag LOCUS_00060 5970 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8375 7104 gene locus_tag LOCUS_00070 8375 7104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9674 8733 gene locus_tag LOCUS_00080 9674 8733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10149 11012 gene locus_tag LOCUS_00090 10149 11012 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966200.1 protein_id gnl|my_center|LOCUS_00090 11085 13535 gene locus_tag LOCUS_00100 11085 13535 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582697.1 protein_id gnl|my_center|LOCUS_00100 13647 14162 gene locus_tag LOCUS_00110 13647 14162 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965709.1 protein_id gnl|my_center|LOCUS_00110 14604 15581 gene locus_tag LOCUS_00120 14604 15581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15545 16252 gene locus_tag LOCUS_00130 15545 16252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 17612 16332 gene locus_tag LOCUS_00140 gene serS 17612 16332 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_00140 17999 17805 gene locus_tag LOCUS_00150 17999 17805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18098 19015 gene locus_tag LOCUS_00160 18098 19015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19243 19743 gene locus_tag LOCUS_00170 19243 19743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 20781 20041 gene locus_tag LOCUS_00180 20781 20041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21916 20867 gene locus_tag LOCUS_00190 21916 20867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22105 23289 gene locus_tag LOCUS_00200 22105 23289 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429271.1 protein_id gnl|my_center|LOCUS_00200 23308 24312 gene locus_tag LOCUS_00210 gene trpS 23308 24312 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694505.1 protein_id gnl|my_center|LOCUS_00210 24487 25134 gene locus_tag LOCUS_00220 gene plsY 24487 25134 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383394.1 protein_id gnl|my_center|LOCUS_00220 26009 25299 gene locus_tag LOCUS_00230 26009 25299 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948375.1 protein_id gnl|my_center|LOCUS_00230 27163 26039 gene locus_tag LOCUS_00240 gene prfB 27163 26039 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_00240 28098 27292 gene locus_tag LOCUS_00250 gene thiD 28098 27292 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_00250 28745 28095 gene locus_tag LOCUS_00260 28745 28095 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_00260 29412 28771 gene locus_tag LOCUS_00270 gene thiE 29412 28771 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436488.1 protein_id gnl|my_center|LOCUS_00270 30217 29399 gene locus_tag LOCUS_00280 gene thiM 30217 29399 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_00280 31539 30235 gene locus_tag LOCUS_00290 gene thiC 31539 30235 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966296.1 protein_id gnl|my_center|LOCUS_00290 32624 31905 gene locus_tag LOCUS_00300 32624 31905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 33436 32621 gene locus_tag LOCUS_00310 33436 32621 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403518.1 protein_id gnl|my_center|LOCUS_00310 34233 33433 gene locus_tag LOCUS_00320 34233 33433 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477868.1 protein_id gnl|my_center|LOCUS_00320 37393 34637 gene locus_tag LOCUS_00330 gene secA 37393 34637 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_00330 37704 39908 gene locus_tag LOCUS_00340 37704 39908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 40142 41332 gene locus_tag LOCUS_00350 40142 41332 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_00350 41429 42196 gene locus_tag LOCUS_00360 gene tpiA 41429 42196 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_00360 42317 43855 gene locus_tag LOCUS_00370 gene gpmI 42317 43855 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_00370 45175 43967 gene locus_tag LOCUS_00380 45175 43967 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582790.1 protein_id gnl|my_center|LOCUS_00380 46400 45276 gene locus_tag LOCUS_00390 gene hemW 46400 45276 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729894.1 protein_id gnl|my_center|LOCUS_00390 47682 46633 gene locus_tag LOCUS_00400 47682 46633 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262047.1 protein_id gnl|my_center|LOCUS_00400 48513 47806 gene locus_tag LOCUS_00410 48513 47806 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_00410 48794 48958 gene locus_tag LOCUS_00420 48794 48958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 48958 49635 gene locus_tag LOCUS_00430 48958 49635 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020493338.1 protein_id gnl|my_center|LOCUS_00430 49632 50897 gene locus_tag LOCUS_00440 49632 50897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 50923 52017 gene locus_tag LOCUS_00450 50923 52017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 52211 54637 gene locus_tag LOCUS_00460 52211 54637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 56257 54809 gene locus_tag LOCUS_00470 56257 54809 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108604.1 protein_id gnl|my_center|LOCUS_00470 56967 56425 gene locus_tag LOCUS_00480 56967 56425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 57590 57012 gene locus_tag LOCUS_00490 57590 57012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 58337 57747 gene locus_tag LOCUS_00500 gene lexA 58337 57747 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930693.1 protein_id gnl|my_center|LOCUS_00500 59000 60760 gene locus_tag LOCUS_00510 gene pyk 59000 60760 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_00510 60797 61378 gene locus_tag LOCUS_00520 gene yfbR 60797 61378 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098110.1 protein_id gnl|my_center|LOCUS_00520 61611 62159 gene locus_tag LOCUS_00530 61611 62159 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876339.1 protein_id gnl|my_center|LOCUS_00530 62180 63862 gene locus_tag LOCUS_00540 62180 63862 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_00540 64889 64617 gene locus_tag LOCUS_00550 64889 64617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 64983 65189 gene locus_tag LOCUS_00560 64983 65189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 66190 65186 gene locus_tag LOCUS_00570 66190 65186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 67865 66264 gene locus_tag LOCUS_00580 67865 66264 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067976.1 protein_id gnl|my_center|LOCUS_00580 68638 67937 gene locus_tag LOCUS_00590 68638 67937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 69063 70538 gene locus_tag LOCUS_00600 gene hemL 69063 70538 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095641.1 protein_id gnl|my_center|LOCUS_00600 70600 71829 gene locus_tag LOCUS_00610 70600 71829 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682124.1 protein_id gnl|my_center|LOCUS_00610 72304 73101 gene locus_tag LOCUS_00620 72304 73101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 73526 75586 gene locus_tag LOCUS_00630 73526 75586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 77225 75693 gene locus_tag LOCUS_00640 77225 75693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 77859 77293 gene locus_tag LOCUS_00650 77859 77293 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068193.1 protein_id gnl|my_center|LOCUS_00650 79299 78001 gene locus_tag LOCUS_00660 79299 78001 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941270.1 protein_id gnl|my_center|LOCUS_00660 81077 79605 gene locus_tag LOCUS_00670 gene guaB 81077 79605 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264083.1 protein_id gnl|my_center|LOCUS_00670 81450 81298 gene locus_tag LOCUS_00680 81450 81298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 83992 81926 gene locus_tag LOCUS_00690 gene fusA 83992 81926 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_00690 85275 84322 gene locus_tag LOCUS_00700 85275 84322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 85489 85695 gene locus_tag LOCUS_00710 85489 85695 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_00710 85772 86848 gene locus_tag LOCUS_00720 gene prfA 85772 86848 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_00720 86884 87909 gene locus_tag LOCUS_00730 86884 87909 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393872.1 protein_id gnl|my_center|LOCUS_00730 88004 88621 gene locus_tag LOCUS_00740 gene coaE 88004 88621 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014305.1 protein_id gnl|my_center|LOCUS_00740 88672 89259 gene locus_tag LOCUS_00750 88672 89259 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048036.1 protein_id gnl|my_center|LOCUS_00750 89256 90674 gene locus_tag LOCUS_00760 89256 90674 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861085.1 protein_id gnl|my_center|LOCUS_00760 90981 91400 gene locus_tag LOCUS_00770 90981 91400 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861328.1 protein_id gnl|my_center|LOCUS_00770 92130 91924 gene locus_tag LOCUS_00780 92130 91924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 92912 92424 gene locus_tag LOCUS_00790 92912 92424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 93219 92926 gene locus_tag LOCUS_00800 93219 92926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 94308 93649 gene locus_tag LOCUS_00810 94308 93649 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393295.1 protein_id gnl|my_center|LOCUS_00810 95013 94390 gene locus_tag LOCUS_00820 95013 94390 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_00820 95614 95153 gene locus_tag LOCUS_00830 95614 95153 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357651.1 protein_id gnl|my_center|LOCUS_00830 95715 95987 gene locus_tag LOCUS_00840 95715 95987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 96014 96406 gene locus_tag LOCUS_00850 96014 96406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 96408 96992 gene locus_tag LOCUS_00860 96408 96992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 97887 97051 gene locus_tag LOCUS_00870 97887 97051 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479618.1 protein_id gnl|my_center|LOCUS_00870 98627 97884 gene locus_tag LOCUS_00880 gene znuC 98627 97884 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768460.1 protein_id gnl|my_center|LOCUS_00880 99567 98617 gene locus_tag LOCUS_00890 99567 98617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 99765 100808 gene locus_tag LOCUS_00900 99765 100808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 100845 101024 gene locus_tag LOCUS_00910 100845 101024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 101233 102306 gene locus_tag LOCUS_00920 101233 102306 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161413.1 protein_id gnl|my_center|LOCUS_00920 102347 102889 gene locus_tag LOCUS_00930 102347 102889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 102816 104321 gene locus_tag LOCUS_00940 gene argS 102816 104321 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462258.1 protein_id gnl|my_center|LOCUS_00940 104574 104407 gene locus_tag LOCUS_00950 104574 104407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 105912 104701 gene locus_tag LOCUS_00960 105912 104701 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_00960 107169 105931 gene locus_tag LOCUS_00970 107169 105931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 107493 108701 gene locus_tag LOCUS_00980 gene ytvI 107493 108701 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902953.1 protein_id gnl|my_center|LOCUS_00980 108917 108711 gene locus_tag LOCUS_00990 108917 108711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 109057 109524 gene locus_tag LOCUS_01000 gene spoVT 109057 109524 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966490.1 protein_id gnl|my_center|LOCUS_01000 109719 109934 gene locus_tag LOCUS_01010 109719 109934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 109952 110683 gene locus_tag LOCUS_01020 109952 110683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 111209 110787 gene locus_tag LOCUS_01030 111209 110787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 112460 111366 gene locus_tag LOCUS_01040 112460 111366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 113724 112687 gene locus_tag LOCUS_01050 113724 112687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 114373 113834 gene locus_tag LOCUS_01060 114373 113834 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807782.1 protein_id gnl|my_center|LOCUS_01060 115502 114597 gene locus_tag LOCUS_01070 gene argF 115502 114597 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_01070 116705 115530 gene locus_tag LOCUS_01080 116705 115530 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861434.1 protein_id gnl|my_center|LOCUS_01080 117596 116742 gene locus_tag LOCUS_01090 gene argB 117596 116742 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435171.1 protein_id gnl|my_center|LOCUS_01090 118875 117652 gene locus_tag LOCUS_01100 gene argJ 118875 117652 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_01100 119186 118902 gene locus_tag LOCUS_01110 119186 118902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810433.1 protein_id gnl|my_center|LOCUS_01110 120268 119234 gene locus_tag LOCUS_01120 gene argC 120268 119234 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_01120 121663 120284 gene locus_tag LOCUS_01130 gene argH 121663 120284 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_01130 123010 121784 gene locus_tag LOCUS_01140 123010 121784 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_01140 123304 123810 gene locus_tag LOCUS_01150 123304 123810 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_01150 124085 124336 gene locus_tag LOCUS_01160 124085 124336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 124391 124660 gene locus_tag LOCUS_01170 124391 124660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 126714 124942 gene locus_tag LOCUS_01180 126714 124942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807777.1 protein_id gnl|my_center|LOCUS_01180 127809 126892 gene locus_tag LOCUS_01190 127809 126892 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_01190 128583 127840 gene locus_tag LOCUS_01200 128583 127840 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_01200 128776 129753 gene locus_tag LOCUS_01210 128776 129753 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_01210 129900 130712 gene locus_tag LOCUS_01220 129900 130712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 131198 130794 gene locus_tag LOCUS_01230 131198 130794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01230 131995 131150 gene locus_tag LOCUS_01240 131995 131150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01240 133020 132067 gene locus_tag LOCUS_01250 133020 132067 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715339.1 protein_id gnl|my_center|LOCUS_01250 133774 133394 gene locus_tag LOCUS_01260 133774 133394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 134369 133836 gene locus_tag LOCUS_01270 gene rplJ 134369 133836 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643933.1 protein_id gnl|my_center|LOCUS_01270 135360 134659 gene locus_tag LOCUS_01280 gene rplA 135360 134659 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_01280 135841 135416 gene locus_tag LOCUS_01290 gene rplK 135841 135416 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_01290 136536 135985 gene locus_tag LOCUS_01300 gene nusG 136536 135985 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_01300 136971 136567 gene locus_tag LOCUS_01310 136971 136567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 137138 136989 gene locus_tag LOCUS_01320 gene rpmG 137138 136989 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_01320 137589 137804 gene locus_tag LOCUS_01330 137589 137804 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721916.1 protein_id gnl|my_center|LOCUS_01330 138817 137894 gene locus_tag LOCUS_01340 138817 137894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 139232 139014 gene locus_tag LOCUS_01350 139232 139014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 139938 139309 gene locus_tag LOCUS_01360 139938 139309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 140165 139971 gene locus_tag LOCUS_01370 140165 139971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01370 141273 140107 gene locus_tag LOCUS_01380 141273 140107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01380 142663 141434 gene locus_tag LOCUS_01390 142663 141434 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462194.1 protein_id gnl|my_center|LOCUS_01390 145589 142953 gene locus_tag LOCUS_01400 gene ppdK 145589 142953 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_01400 145904 147286 gene locus_tag LOCUS_01410 gene glmU 145904 147286 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706816.1 protein_id gnl|my_center|LOCUS_01410 147399 148019 gene locus_tag LOCUS_01420 gene pth 147399 148019 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_01420 148056 148781 gene locus_tag LOCUS_01430 148056 148781 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760203.1 protein_id gnl|my_center|LOCUS_01430 148827 152303 gene locus_tag LOCUS_01440 gene mfd 148827 152303 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966492.1 protein_id gnl|my_center|LOCUS_01440 154410 152449 gene locus_tag LOCUS_01450 154410 152449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 154612 155430 gene locus_tag LOCUS_01460 154612 155430 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129898.1 protein_id gnl|my_center|LOCUS_01460 156430 155585 gene locus_tag LOCUS_01470 156430 155585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 156922 156548 gene locus_tag LOCUS_01480 156922 156548 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966283.1 protein_id gnl|my_center|LOCUS_01480 159608 157119 gene locus_tag LOCUS_01490 159608 157119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 160272 159580 gene locus_tag LOCUS_01500 160272 159580 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_01500 162228 160498 gene locus_tag LOCUS_01510 162228 160498 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948922.1 protein_id gnl|my_center|LOCUS_01510 162440 163804 gene locus_tag LOCUS_01520 gene mnmE 162440 163804 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966994.1 protein_id gnl|my_center|LOCUS_01520 163844 165790 gene locus_tag LOCUS_01530 gene mnmG 163844 165790 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_01530 165783 166496 gene locus_tag LOCUS_01540 gene rsmG 165783 166496 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462328.1 protein_id gnl|my_center|LOCUS_01540 166617 167477 gene locus_tag LOCUS_01550 gene noc 166617 167477 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_01550 167980 168762 gene locus_tag LOCUS_01560 167980 168762 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_01560 168762 169643 gene locus_tag LOCUS_01570 168762 169643 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_01570 169690 171771 gene locus_tag LOCUS_01580 169690 171771 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964362.1 protein_id gnl|my_center|LOCUS_01580 171970 172236 gene locus_tag LOCUS_01590 171970 172236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 173950 172430 gene locus_tag LOCUS_01600 173950 172430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 176639 174135 gene locus_tag LOCUS_01610 gene gyrA 176639 174135 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_01610 178724 176727 gene locus_tag LOCUS_01620 gene gyrB 178724 176727 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435993.1 protein_id gnl|my_center|LOCUS_01620 179089 178805 gene locus_tag LOCUS_01630 179089 178805 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359336.1 protein_id gnl|my_center|LOCUS_01630 180219 179125 gene locus_tag LOCUS_01640 gene recF 180219 179125 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963333.1 protein_id gnl|my_center|LOCUS_01640 180473 180216 gene locus_tag LOCUS_01650 gene yaaA 180473 180216 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420479.1 protein_id gnl|my_center|LOCUS_01650 181604 180495 gene locus_tag LOCUS_01660 gene dnaN 181604 180495 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420481.1 protein_id gnl|my_center|LOCUS_01660 183225 181927 gene locus_tag LOCUS_01670 gene dnaA 183225 181927 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_01670 183224 183409 gene locus_tag LOCUS_01680 183224 183409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 183571 183705 gene locus_tag LOCUS_01690 gene rpmH 183571 183705 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640225.1 protein_id gnl|my_center|LOCUS_01690 183785 184141 gene locus_tag LOCUS_01700 gene rnpA 183785 184141 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429302.1 protein_id gnl|my_center|LOCUS_01700 184500 185456 gene locus_tag LOCUS_01710 184500 185456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 185495 186337 gene locus_tag LOCUS_01720 185495 186337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 186687 187769 gene locus_tag LOCUS_01730 gene serC 186687 187769 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_01730 187814 188980 gene locus_tag LOCUS_01740 187814 188980 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490251.1 protein_id gnl|my_center|LOCUS_01740 189305 190744 gene locus_tag LOCUS_01750 189305 190744 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_01750 191714 190815 gene locus_tag LOCUS_01760 191714 190815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 191930 193216 gene locus_tag LOCUS_01770 191930 193216 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_01770 193230 193958 gene locus_tag LOCUS_01780 193230 193958 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_01780 195154 194096 gene locus_tag LOCUS_01790 195154 194096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 196506 195313 gene locus_tag LOCUS_01800 196506 195313 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964056.1 protein_id gnl|my_center|LOCUS_01800 197035 196520 gene locus_tag LOCUS_01810 197035 196520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 197511 197092 gene locus_tag LOCUS_01820 197511 197092 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583652.1 protein_id gnl|my_center|LOCUS_01820 197887 197528 gene locus_tag LOCUS_01830 197887 197528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 198030 198221 gene locus_tag LOCUS_01840 198030 198221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 >Feature sequence02 391 161 gene locus_tag LOCUS_01850 391 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 827 405 gene locus_tag LOCUS_01860 827 405 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047623.1 protein_id gnl|my_center|LOCUS_01860 1605 817 gene locus_tag LOCUS_01870 1605 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 2485 1562 gene locus_tag LOCUS_01880 2485 1562 CDS product DUF4373 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714058.1 protein_id gnl|my_center|LOCUS_01880 3224 2457 gene locus_tag LOCUS_01890 3224 2457 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390536.1 protein_id gnl|my_center|LOCUS_01890 4024 3221 gene locus_tag LOCUS_01900 4024 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 4572 4021 gene locus_tag LOCUS_01910 4572 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 5071 4652 gene locus_tag LOCUS_01920 5071 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 6986 5073 gene locus_tag LOCUS_01930 6986 5073 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700554.1 protein_id gnl|my_center|LOCUS_01930 7155 6961 gene locus_tag LOCUS_01940 7155 6961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 7600 7280 gene locus_tag LOCUS_01950 7600 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 7841 7614 gene locus_tag LOCUS_01960 7841 7614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 8076 7846 gene locus_tag LOCUS_01970 8076 7846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 8186 8046 gene locus_tag LOCUS_01980 8186 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 8418 8170 gene locus_tag LOCUS_01990 8418 8170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 8572 8405 gene locus_tag LOCUS_02000 8572 8405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 8727 8587 gene locus_tag LOCUS_02010 8727 8587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 8813 9139 gene locus_tag LOCUS_02020 8813 9139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 9268 9128 gene locus_tag LOCUS_02030 9268 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 9501 9773 gene locus_tag LOCUS_02040 9501 9773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 9776 10147 gene locus_tag LOCUS_02050 9776 10147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 10668 10450 gene locus_tag LOCUS_02060 10668 10450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 11230 11934 gene locus_tag LOCUS_02070 11230 11934 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039550.1 protein_id gnl|my_center|LOCUS_02070 11953 13752 gene locus_tag LOCUS_02080 11953 13752 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082541.1 protein_id gnl|my_center|LOCUS_02080 13887 14432 gene locus_tag LOCUS_02090 13887 14432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267784.1 protein_id gnl|my_center|LOCUS_02090 16140 14791 gene locus_tag LOCUS_02100 16140 14791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 17168 16218 gene locus_tag LOCUS_02110 17168 16218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 17516 17683 gene locus_tag LOCUS_02120 17516 17683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 17744 18454 gene locus_tag LOCUS_02130 17744 18454 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436372.1 protein_id gnl|my_center|LOCUS_02130 18435 19256 gene locus_tag LOCUS_02140 18435 19256 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436375.1 protein_id gnl|my_center|LOCUS_02140 19331 19936 gene locus_tag LOCUS_02150 19331 19936 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_02150 20115 20729 gene locus_tag LOCUS_02160 gene cap8M 20115 20729 CDS product type 8 capsular polysaccharide synthesis protein Cap8M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825098.1 protein_id gnl|my_center|LOCUS_02160 20920 23967 gene locus_tag LOCUS_02170 gene lacZ 20920 23967 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_02170 24780 24211 gene locus_tag LOCUS_02180 24780 24211 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_02180 24991 25929 gene locus_tag LOCUS_02190 24991 25929 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966760.1 protein_id gnl|my_center|LOCUS_02190 25993 26268 gene locus_tag LOCUS_02200 25993 26268 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760147.1 protein_id gnl|my_center|LOCUS_02200 28040 26574 gene locus_tag LOCUS_02210 28040 26574 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392674.1 protein_id gnl|my_center|LOCUS_02210 28229 29128 gene locus_tag LOCUS_02220 28229 29128 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814117.1 protein_id gnl|my_center|LOCUS_02220 30220 29228 gene locus_tag LOCUS_02230 30220 29228 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289735.1 protein_id gnl|my_center|LOCUS_02230 31272 31796 gene locus_tag LOCUS_02240 gene infC 31272 31796 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808206.1 protein_id gnl|my_center|LOCUS_02240 31814 32011 gene locus_tag LOCUS_02250 gene rpmI 31814 32011 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545453.1 protein_id gnl|my_center|LOCUS_02250 32056 32412 gene locus_tag LOCUS_02260 gene rplT 32056 32412 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132352.1 protein_id gnl|my_center|LOCUS_02260 32493 33308 gene locus_tag LOCUS_02270 32493 33308 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475968.1 protein_id gnl|my_center|LOCUS_02270 33328 34536 gene locus_tag LOCUS_02280 gene dprA 33328 34536 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_02280 34659 36806 gene locus_tag LOCUS_02290 gene topA 34659 36806 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_02290 36828 38150 gene locus_tag LOCUS_02300 gene trmFO 36828 38150 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357486.1 protein_id gnl|my_center|LOCUS_02300 38192 39199 gene locus_tag LOCUS_02310 gene plsX 38192 39199 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047867.1 protein_id gnl|my_center|LOCUS_02310 39261 39947 gene locus_tag LOCUS_02320 gene rnc 39261 39947 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_02320 39944 40960 gene locus_tag LOCUS_02330 39944 40960 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942867.1 protein_id gnl|my_center|LOCUS_02330 41047 44616 gene locus_tag LOCUS_02340 gene smc 41047 44616 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460497.1 protein_id gnl|my_center|LOCUS_02340 44935 45870 gene locus_tag LOCUS_02350 44935 45870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 45907 46209 gene locus_tag LOCUS_02360 45907 46209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 46226 46843 gene locus_tag LOCUS_02370 46226 46843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 46840 47241 gene locus_tag LOCUS_02380 46840 47241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 47265 48503 gene locus_tag LOCUS_02390 47265 48503 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679466.1 protein_id gnl|my_center|LOCUS_02390 48496 50070 gene locus_tag LOCUS_02400 48496 50070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 50133 50486 gene locus_tag LOCUS_02410 gene rsfS 50133 50486 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880811.1 protein_id gnl|my_center|LOCUS_02410 50545 52959 gene locus_tag LOCUS_02420 gene leuS 50545 52959 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 protein_id gnl|my_center|LOCUS_02420 53472 56123 gene locus_tag LOCUS_02430 53472 56123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 56140 56478 gene locus_tag LOCUS_02440 56140 56478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 56492 57139 gene locus_tag LOCUS_02450 56492 57139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 57674 59380 gene locus_tag LOCUS_02460 gene leuA 57674 59380 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963596.1 protein_id gnl|my_center|LOCUS_02460 59424 60503 gene locus_tag LOCUS_02470 gene leuB 59424 60503 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_02470 61981 60656 gene locus_tag LOCUS_02480 61981 60656 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296769.1 protein_id gnl|my_center|LOCUS_02480 62311 62021 gene locus_tag LOCUS_02490 62311 62021 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263028.1 protein_id gnl|my_center|LOCUS_02490 62733 63194 gene locus_tag LOCUS_02500 62733 63194 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568036.1 protein_id gnl|my_center|LOCUS_02500 63830 63198 gene locus_tag LOCUS_02510 63830 63198 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903260.1 protein_id gnl|my_center|LOCUS_02510 63972 65030 gene locus_tag LOCUS_02520 63972 65030 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092074.1 protein_id gnl|my_center|LOCUS_02520 65071 66177 gene locus_tag LOCUS_02530 65071 66177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 66218 67066 gene locus_tag LOCUS_02540 66218 67066 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203489.1 protein_id gnl|my_center|LOCUS_02540 67070 68035 gene locus_tag LOCUS_02550 67070 68035 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098117.1 protein_id gnl|my_center|LOCUS_02550 68944 68183 gene locus_tag LOCUS_02560 68944 68183 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245688.1 protein_id gnl|my_center|LOCUS_02560 69279 69941 gene locus_tag LOCUS_02570 gene rpe 69279 69941 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989821.1 protein_id gnl|my_center|LOCUS_02570 69965 71683 gene locus_tag LOCUS_02580 gene ptsP 69965 71683 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_02580 71699 71977 gene locus_tag LOCUS_02590 71699 71977 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_02590 72910 73365 gene locus_tag LOCUS_02600 72910 73365 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006477376.1 protein_id gnl|my_center|LOCUS_02600 73440 74597 gene locus_tag LOCUS_02610 73440 74597 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813035.1 protein_id gnl|my_center|LOCUS_02610 74669 74971 gene locus_tag LOCUS_02620 74669 74971 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_02620 74964 76916 gene locus_tag LOCUS_02630 74964 76916 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956923.1 protein_id gnl|my_center|LOCUS_02630 78424 77063 gene locus_tag LOCUS_02640 78424 77063 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461201.1 protein_id gnl|my_center|LOCUS_02640 79610 78588 gene locus_tag LOCUS_02650 gene galE 79610 78588 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_02650 79715 80389 gene locus_tag LOCUS_02660 79715 80389 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_02660 80412 81263 gene locus_tag LOCUS_02670 gene rsmA 80412 81263 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 protein_id gnl|my_center|LOCUS_02670 81524 81658 gene locus_tag LOCUS_02680 81524 81658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 81639 81794 gene locus_tag LOCUS_02690 81639 81794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 82875 82144 gene locus_tag LOCUS_02700 82875 82144 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662263.1 protein_id gnl|my_center|LOCUS_02700 84117 83014 gene locus_tag LOCUS_02710 84117 83014 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986532.1 protein_id gnl|my_center|LOCUS_02710 85055 84375 gene locus_tag LOCUS_02720 85055 84375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 85310 86596 gene locus_tag LOCUS_02730 85310 86596 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247133.1 protein_id gnl|my_center|LOCUS_02730 90212 86679 gene locus_tag LOCUS_02740 gene addA 90212 86679 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233100.1 protein_id gnl|my_center|LOCUS_02740 93564 90205 gene locus_tag LOCUS_02750 gene addB 93564 90205 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_02750 93873 95306 gene locus_tag LOCUS_02760 93873 95306 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948739.1 protein_id gnl|my_center|LOCUS_02760 95345 96601 gene locus_tag LOCUS_02770 95345 96601 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948740.1 protein_id gnl|my_center|LOCUS_02770 96668 97039 gene locus_tag LOCUS_02780 96668 97039 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399582.1 protein_id gnl|my_center|LOCUS_02780 97041 98471 gene locus_tag LOCUS_02790 97041 98471 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993891.1 protein_id gnl|my_center|LOCUS_02790 100232 98580 gene locus_tag LOCUS_02800 100232 98580 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047743.1 protein_id gnl|my_center|LOCUS_02800 101509 100229 gene locus_tag LOCUS_02810 101509 100229 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047742.1 protein_id gnl|my_center|LOCUS_02810 102098 101526 gene locus_tag LOCUS_02820 102098 101526 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361269.1 protein_id gnl|my_center|LOCUS_02820 102386 102255 gene locus_tag LOCUS_02830 102386 102255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 102649 103860 gene locus_tag LOCUS_02840 102649 103860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 104066 105343 gene locus_tag LOCUS_02850 104066 105343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 105578 106369 gene locus_tag LOCUS_02860 105578 106369 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_02860 106442 106585 gene locus_tag LOCUS_02870 106442 106585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 107361 106654 gene locus_tag LOCUS_02880 107361 106654 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948182.1 protein_id gnl|my_center|LOCUS_02880 107763 109031 gene locus_tag LOCUS_02890 107763 109031 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393641.1 protein_id gnl|my_center|LOCUS_02890 109028 109723 gene locus_tag LOCUS_02900 109028 109723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 109901 110527 gene locus_tag LOCUS_02910 109901 110527 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287965.1 protein_id gnl|my_center|LOCUS_02910 111763 110609 gene locus_tag LOCUS_02920 gene pheA 111763 110609 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546845.1 protein_id gnl|my_center|LOCUS_02920 112859 111756 gene locus_tag LOCUS_02930 gene aroC 112859 111756 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_02930 114117 112840 gene locus_tag LOCUS_02940 gene aroA 114117 112840 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_02940 115325 114231 gene locus_tag LOCUS_02950 gene aroB 115325 114231 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964212.1 protein_id gnl|my_center|LOCUS_02950 116401 115367 gene locus_tag LOCUS_02960 gene aroF 116401 115367 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_02960 117242 116664 gene locus_tag LOCUS_02970 117242 116664 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942669.1 protein_id gnl|my_center|LOCUS_02970 118081 117239 gene locus_tag LOCUS_02980 118081 117239 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_02980 118355 118582 gene locus_tag LOCUS_02990 gene acpP 118355 118582 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_02990 118566 118922 gene locus_tag LOCUS_03000 118566 118922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 119579 118812 gene locus_tag LOCUS_03010 119579 118812 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673992.1 protein_id gnl|my_center|LOCUS_03010 120496 119576 gene locus_tag LOCUS_03020 120496 119576 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860718.1 protein_id gnl|my_center|LOCUS_03020 120696 120493 gene locus_tag LOCUS_03030 120696 120493 CDS product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562727.1 protein_id gnl|my_center|LOCUS_03030 122085 120703 gene locus_tag LOCUS_03040 122085 120703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 122521 122123 gene locus_tag LOCUS_03050 122521 122123 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963919.1 protein_id gnl|my_center|LOCUS_03050 122777 123829 gene locus_tag LOCUS_03060 122777 123829 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966740.1 protein_id gnl|my_center|LOCUS_03060 125315 123882 gene locus_tag LOCUS_03070 125315 123882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 126429 125344 gene locus_tag LOCUS_03080 126429 125344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 126650 127282 gene locus_tag LOCUS_03090 126650 127282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 128496 127570 gene locus_tag LOCUS_03100 128496 127570 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894437.1 protein_id gnl|my_center|LOCUS_03100 129176 128493 gene locus_tag LOCUS_03110 129176 128493 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017182.1 protein_id gnl|my_center|LOCUS_03110 129309 130229 gene locus_tag LOCUS_03120 129309 130229 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281520.1 protein_id gnl|my_center|LOCUS_03120 130342 131013 gene locus_tag LOCUS_03130 130342 131013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 131530 131129 gene locus_tag LOCUS_03140 131530 131129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 133379 131595 gene locus_tag LOCUS_03150 gene aspS 133379 131595 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_03150 134740 133379 gene locus_tag LOCUS_03160 gene hisS 134740 133379 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048076.1 protein_id gnl|my_center|LOCUS_03160 135084 142433 gene locus_tag LOCUS_03170 135084 142433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 142488 142670 gene locus_tag LOCUS_03180 142488 142670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 142733 142876 gene locus_tag LOCUS_03190 142733 142876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 142869 143813 gene locus_tag LOCUS_03200 142869 143813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 143810 145087 gene locus_tag LOCUS_03210 143810 145087 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861628.1 protein_id gnl|my_center|LOCUS_03210 145207 146277 gene locus_tag LOCUS_03220 gene lgt 145207 146277 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722614.1 protein_id gnl|my_center|LOCUS_03220 146261 147118 gene locus_tag LOCUS_03230 gene folD 146261 147118 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_03230 147159 147368 gene locus_tag LOCUS_03240 147159 147368 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767912.1 protein_id gnl|my_center|LOCUS_03240 147891 147679 gene locus_tag LOCUS_03250 147891 147679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 148094 147822 gene locus_tag LOCUS_03260 148094 147822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 148295 148140 gene locus_tag LOCUS_03270 148295 148140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 148539 148850 gene locus_tag LOCUS_03280 gene rplU 148539 148850 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270907.1 protein_id gnl|my_center|LOCUS_03280 148854 149180 gene locus_tag LOCUS_03290 148854 149180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 149173 149457 gene locus_tag LOCUS_03300 gene rpmA 149173 149457 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_03300 149752 151035 gene locus_tag LOCUS_03310 149752 151035 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_03310 151182 151973 gene locus_tag LOCUS_03320 151182 151973 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048403.1 protein_id gnl|my_center|LOCUS_03320 152053 152535 gene locus_tag LOCUS_03330 gene rlmH 152053 152535 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811533.1 protein_id gnl|my_center|LOCUS_03330 153070 155304 gene locus_tag LOCUS_03340 gene pflB 153070 155304 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437454.1 protein_id gnl|my_center|LOCUS_03340 155301 156023 gene locus_tag LOCUS_03350 gene pflA 155301 156023 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048195.1 protein_id gnl|my_center|LOCUS_03350 156095 156682 gene locus_tag LOCUS_03360 156095 156682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 156742 157533 gene locus_tag LOCUS_03370 156742 157533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 158089 157775 gene locus_tag LOCUS_03380 158089 157775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 158830 160596 gene locus_tag LOCUS_03390 gene aspS 158830 160596 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 protein_id gnl|my_center|LOCUS_03390 160664 160951 gene locus_tag LOCUS_03400 gene gatC 160664 160951 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933493.1 protein_id gnl|my_center|LOCUS_03400 160974 162455 gene locus_tag LOCUS_03410 gene gatA 160974 162455 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_03410 162574 164004 gene locus_tag LOCUS_03420 gene gatB 162574 164004 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966259.1 protein_id gnl|my_center|LOCUS_03420 164301 165350 gene locus_tag LOCUS_03430 164301 165350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 165486 166079 gene locus_tag LOCUS_03440 165486 166079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 166234 167316 gene locus_tag LOCUS_03450 gene nusA 166234 167316 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_03450 167349 167621 gene locus_tag LOCUS_03460 167349 167621 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_03460 167662 167985 gene locus_tag LOCUS_03470 167662 167985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 167972 170362 gene locus_tag LOCUS_03480 167972 170362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 170407 170766 gene locus_tag LOCUS_03490 gene rbfA 170407 170766 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670660.1 protein_id gnl|my_center|LOCUS_03490 170756 171709 gene locus_tag LOCUS_03500 170756 171709 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_03500 171710 172609 gene locus_tag LOCUS_03510 gene truB 171710 172609 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100522.1 protein_id gnl|my_center|LOCUS_03510 172646 173578 gene locus_tag LOCUS_03520 172646 173578 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918589.1 protein_id gnl|my_center|LOCUS_03520 173571 174266 gene locus_tag LOCUS_03530 173571 174266 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617304.1 protein_id gnl|my_center|LOCUS_03530 174493 174756 gene locus_tag LOCUS_03540 gene rpsO 174493 174756 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857482.1 protein_id gnl|my_center|LOCUS_03540 174965 175690 gene locus_tag LOCUS_03550 174965 175690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 175644 176972 gene locus_tag LOCUS_03560 175644 176972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 177439 177068 gene locus_tag LOCUS_03570 177439 177068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 177645 177460 gene locus_tag LOCUS_03580 177645 177460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 178882 178262 gene locus_tag LOCUS_03590 178882 178262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 179773 179036 gene locus_tag LOCUS_03600 179773 179036 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437537.1 protein_id gnl|my_center|LOCUS_03600 183625 180134 gene locus_tag LOCUS_03610 183625 180134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 188278 183761 gene locus_tag LOCUS_03620 188278 183761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 189142 189507 gene locus_tag LOCUS_03630 189142 189507 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393779.1 protein_id gnl|my_center|LOCUS_03630 189521 190873 gene locus_tag LOCUS_03640 gene ffh 189521 190873 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_03640 190968 191213 gene locus_tag LOCUS_03650 gene rpsP 190968 191213 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_03650 191242 191475 gene locus_tag LOCUS_03660 191242 191475 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419342.1 protein_id gnl|my_center|LOCUS_03660 >Feature sequence03 850 149 gene locus_tag LOCUS_03670 850 149 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948716.1 protein_id gnl|my_center|LOCUS_03670 985 1170 gene locus_tag LOCUS_03680 985 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 1187 1483 gene locus_tag LOCUS_03690 1187 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 1651 1726 gene locus_tag LOCUS_t00010 1651 1726 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3100 1907 gene locus_tag LOCUS_03700 3100 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 4402 3320 gene locus_tag LOCUS_03710 4402 3320 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989793.1 protein_id gnl|my_center|LOCUS_03710 4877 5065 gene locus_tag LOCUS_03720 4877 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03720 5821 6114 gene locus_tag LOCUS_03730 5821 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 6156 7841 gene locus_tag LOCUS_03740 6156 7841 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860625.1 protein_id gnl|my_center|LOCUS_03740 8187 8402 gene locus_tag LOCUS_03750 8187 8402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 8359 9489 gene locus_tag LOCUS_03760 gene tgt 8359 9489 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965580.1 protein_id gnl|my_center|LOCUS_03760 11256 9646 gene locus_tag LOCUS_03770 gene spoVB 11256 9646 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198301.1 protein_id gnl|my_center|LOCUS_03770 11490 11759 gene locus_tag LOCUS_03780 11490 11759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 11963 13870 gene locus_tag LOCUS_03790 gene malL 11963 13870 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_03790 13889 14380 gene locus_tag LOCUS_03800 13889 14380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 14527 15288 gene locus_tag LOCUS_03810 14527 15288 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789184.1 protein_id gnl|my_center|LOCUS_03810 15386 16015 gene locus_tag LOCUS_03820 gene upp 15386 16015 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_03820 16100 16747 gene locus_tag LOCUS_03830 16100 16747 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964964.1 protein_id gnl|my_center|LOCUS_03830 16761 16976 gene locus_tag LOCUS_03840 16761 16976 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380890.1 protein_id gnl|my_center|LOCUS_03840 16982 17335 gene locus_tag LOCUS_03850 16982 17335 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963739.1 protein_id gnl|my_center|LOCUS_03850 17412 17768 gene locus_tag LOCUS_03860 17412 17768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03860 17793 18206 gene locus_tag LOCUS_03870 17793 18206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 20745 18310 gene locus_tag LOCUS_03880 20745 18310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 21124 24264 gene locus_tag LOCUS_03890 gene ileS 21124 24264 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_03890 25469 24381 gene locus_tag LOCUS_03900 25469 24381 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_03900 25669 26172 gene locus_tag LOCUS_03910 25669 26172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 26407 26544 gene locus_tag LOCUS_03920 gene scfA 26407 26544 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_03920 26650 28029 gene locus_tag LOCUS_03930 gene scfB 26650 28029 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_03930 28174 28821 gene locus_tag LOCUS_03940 28174 28821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 29804 28812 gene locus_tag LOCUS_03950 29804 28812 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_03950 30753 30007 gene locus_tag LOCUS_03960 30753 30007 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_03960 31672 30746 gene locus_tag LOCUS_03970 31672 30746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 32483 32037 gene locus_tag LOCUS_03980 32483 32037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 33172 32480 gene locus_tag LOCUS_03990 33172 32480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 33774 33169 gene locus_tag LOCUS_04000 gene scpB 33774 33169 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_04000 34526 33771 gene locus_tag LOCUS_04010 34526 33771 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382313.1 protein_id gnl|my_center|LOCUS_04010 35215 34541 gene locus_tag LOCUS_04020 35215 34541 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372445.1 protein_id gnl|my_center|LOCUS_04020 36162 35299 gene locus_tag LOCUS_04030 gene prmC 36162 35299 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_04030 37151 36159 gene locus_tag LOCUS_04040 37151 36159 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_04040 38583 37144 gene locus_tag LOCUS_04050 38583 37144 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_04050 39332 38628 gene locus_tag LOCUS_04060 39332 38628 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142165.1 protein_id gnl|my_center|LOCUS_04060 40899 39472 gene locus_tag LOCUS_04070 40899 39472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 42247 40943 gene locus_tag LOCUS_04080 42247 40943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 43178 42219 gene locus_tag LOCUS_04090 gene cdaA 43178 42219 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808428.1 protein_id gnl|my_center|LOCUS_04090 44472 43318 gene locus_tag LOCUS_04100 44472 43318 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943290.1 protein_id gnl|my_center|LOCUS_04100 44702 44469 gene locus_tag LOCUS_04110 44702 44469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 45256 44783 gene locus_tag LOCUS_04120 gene ispF 45256 44783 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404396.1 protein_id gnl|my_center|LOCUS_04120 46043 45294 gene locus_tag LOCUS_04130 gene ispD 46043 45294 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942744.1 protein_id gnl|my_center|LOCUS_04130 46358 47350 gene locus_tag LOCUS_04140 46358 47350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 47364 48176 gene locus_tag LOCUS_04150 47364 48176 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956754.1 protein_id gnl|my_center|LOCUS_04150 48228 49004 gene locus_tag LOCUS_04160 48228 49004 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681582.1 protein_id gnl|my_center|LOCUS_04160 49144 49455 gene locus_tag LOCUS_04170 49144 49455 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986587.1 protein_id gnl|my_center|LOCUS_04170 49442 50176 gene locus_tag LOCUS_04180 49442 50176 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681925.1 protein_id gnl|my_center|LOCUS_04180 50173 50910 gene locus_tag LOCUS_04190 50173 50910 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956797.1 protein_id gnl|my_center|LOCUS_04190 52348 51122 gene locus_tag LOCUS_04200 gene tyrS 52348 51122 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_04200 55052 52854 gene locus_tag LOCUS_04210 55052 52854 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_04210 56520 55057 gene locus_tag LOCUS_04220 56520 55057 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_04220 56787 56545 gene locus_tag LOCUS_04230 56787 56545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 56861 57583 gene locus_tag LOCUS_04240 gene nagB 56861 57583 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228092.1 protein_id gnl|my_center|LOCUS_04240 58432 57659 gene locus_tag LOCUS_04250 58432 57659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 59712 58867 gene locus_tag LOCUS_04260 59712 58867 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_04260 60705 59773 gene locus_tag LOCUS_04270 60705 59773 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_04270 61217 60702 gene locus_tag LOCUS_04280 61217 60702 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141164.1 protein_id gnl|my_center|LOCUS_04280 61358 62413 gene locus_tag LOCUS_04290 gene rfbB 61358 62413 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_04290 62525 62668 gene locus_tag LOCUS_04300 62525 62668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 62726 63199 gene locus_tag LOCUS_04310 62726 63199 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574643.1 protein_id gnl|my_center|LOCUS_04310 65388 63562 gene locus_tag LOCUS_04320 65388 63562 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680887.1 protein_id gnl|my_center|LOCUS_04320 67181 65385 gene locus_tag LOCUS_04330 67181 65385 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680888.1 protein_id gnl|my_center|LOCUS_04330 68530 67508 gene locus_tag LOCUS_04340 68530 67508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 68735 68496 gene locus_tag LOCUS_04350 68735 68496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 70326 68716 gene locus_tag LOCUS_04360 70326 68716 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_04360 71328 70336 gene locus_tag LOCUS_04370 71328 70336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 72098 71325 gene locus_tag LOCUS_04380 72098 71325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 73238 72111 gene locus_tag LOCUS_04390 gene acdA 73238 72111 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242719.1 protein_id gnl|my_center|LOCUS_04390 74905 73298 gene locus_tag LOCUS_04400 74905 73298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 76079 74922 gene locus_tag LOCUS_04410 76079 74922 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169508.1 protein_id gnl|my_center|LOCUS_04410 77073 76069 gene locus_tag LOCUS_04420 77073 76069 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124880.1 protein_id gnl|my_center|LOCUS_04420 78932 77295 gene locus_tag LOCUS_04430 78932 77295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 80196 78958 gene locus_tag LOCUS_04440 80196 78958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 80912 80211 gene locus_tag LOCUS_04450 80912 80211 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403380.1 protein_id gnl|my_center|LOCUS_04450 82863 80923 gene locus_tag LOCUS_04460 82863 80923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 84178 82865 gene locus_tag LOCUS_04470 84178 82865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 90053 84183 gene locus_tag LOCUS_04480 90053 84183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 93741 90094 gene locus_tag LOCUS_04490 93741 90094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 97815 93745 gene locus_tag LOCUS_04500 97815 93745 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957802.1 protein_id gnl|my_center|LOCUS_04500 99107 97866 gene locus_tag LOCUS_04510 99107 97866 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024453.1 protein_id gnl|my_center|LOCUS_04510 100366 99149 gene locus_tag LOCUS_04520 100366 99149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 100750 100394 gene locus_tag LOCUS_04530 100750 100394 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101061.1 protein_id gnl|my_center|LOCUS_04530 111871 100787 gene locus_tag LOCUS_04540 111871 100787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 115617 111868 gene locus_tag LOCUS_04550 115617 111868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 116905 115622 gene locus_tag LOCUS_04560 116905 115622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 123347 116943 gene locus_tag LOCUS_04570 123347 116943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 124073 123357 gene locus_tag LOCUS_04580 124073 123357 CDS product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172947.1 protein_id gnl|my_center|LOCUS_04580 125205 124165 gene locus_tag LOCUS_04590 125205 124165 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084425603.1 protein_id gnl|my_center|LOCUS_04590 126101 125247 gene locus_tag LOCUS_04600 126101 125247 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226597.1 protein_id gnl|my_center|LOCUS_04600 126367 126128 gene locus_tag LOCUS_04610 126367 126128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 130642 126386 gene locus_tag LOCUS_04620 130642 126386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04620 131049 130771 gene locus_tag LOCUS_04630 131049 130771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 132604 131015 gene locus_tag LOCUS_04640 132604 131015 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751387.1 protein_id gnl|my_center|LOCUS_04640 132873 132619 gene locus_tag LOCUS_04650 132873 132619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 133534 132902 gene locus_tag LOCUS_04660 133534 132902 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182762.1 protein_id gnl|my_center|LOCUS_04660 134001 133606 gene locus_tag LOCUS_04670 134001 133606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 135049 134324 gene locus_tag LOCUS_04680 135049 134324 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966831.1 protein_id gnl|my_center|LOCUS_04680 135822 135109 gene locus_tag LOCUS_04690 gene accD 135822 135109 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966832.1 protein_id gnl|my_center|LOCUS_04690 136428 136282 gene locus_tag LOCUS_04700 136428 136282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 136838 136539 gene locus_tag LOCUS_04710 136838 136539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 138185 137154 gene locus_tag LOCUS_04720 gene queA 138185 137154 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_04720 138344 138508 gene locus_tag LOCUS_04730 138344 138508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 138777 139856 gene locus_tag LOCUS_04740 gene asd 138777 139856 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963351.1 protein_id gnl|my_center|LOCUS_04740 139924 140817 gene locus_tag LOCUS_04750 gene dapA 139924 140817 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422063.1 protein_id gnl|my_center|LOCUS_04750 140867 141625 gene locus_tag LOCUS_04760 gene dapB 140867 141625 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_04760 141642 142103 gene locus_tag LOCUS_04770 141642 142103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 142832 143188 gene locus_tag LOCUS_04780 142832 143188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 143285 144472 gene locus_tag LOCUS_04790 143285 144472 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068707.1 protein_id gnl|my_center|LOCUS_04790 145802 144534 gene locus_tag LOCUS_04800 gene eno 145802 144534 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815650.1 protein_id gnl|my_center|LOCUS_04800 145975 146967 gene locus_tag LOCUS_04810 145975 146967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 148299 147142 gene locus_tag LOCUS_04820 gene fucO 148299 147142 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013588.1 protein_id gnl|my_center|LOCUS_04820 148601 148374 gene locus_tag LOCUS_04830 148601 148374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 148674 149366 gene locus_tag LOCUS_04840 148674 149366 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721280.1 protein_id gnl|my_center|LOCUS_04840 149882 149454 gene locus_tag LOCUS_04850 149882 149454 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938903.1 protein_id gnl|my_center|LOCUS_04850 151209 149905 gene locus_tag LOCUS_04860 151209 149905 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_04860 151810 151232 gene locus_tag LOCUS_04870 151810 151232 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393759.1 protein_id gnl|my_center|LOCUS_04870 153547 151814 gene locus_tag LOCUS_04880 gene iorA 153547 151814 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_04880 154894 153593 gene locus_tag LOCUS_04890 154894 153593 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393761.1 protein_id gnl|my_center|LOCUS_04890 156718 155210 gene locus_tag LOCUS_04900 156718 155210 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_04900 157362 156892 gene locus_tag LOCUS_04910 157362 156892 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902885.1 protein_id gnl|my_center|LOCUS_04910 157607 157359 gene locus_tag LOCUS_04920 157607 157359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 158659 157670 gene locus_tag LOCUS_04930 158659 157670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 160484 158607 gene locus_tag LOCUS_04940 160484 158607 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_04940 162116 160584 gene locus_tag LOCUS_04950 162116 160584 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454621.1 protein_id gnl|my_center|LOCUS_04950 163728 162340 gene locus_tag LOCUS_04960 163728 162340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 165589 163835 gene locus_tag LOCUS_04970 gene argS 165589 163835 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921188.1 protein_id gnl|my_center|LOCUS_04970 166462 165593 gene locus_tag LOCUS_04980 gene whiA 166462 165593 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357358.1 protein_id gnl|my_center|LOCUS_04980 167444 166587 gene locus_tag LOCUS_04990 gene rapZ 167444 166587 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_04990 168402 167494 gene locus_tag LOCUS_05000 gene murB 168402 167494 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_05000 169518 168571 gene locus_tag LOCUS_05010 gene glcK 169518 168571 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_05010 169745 169545 gene locus_tag LOCUS_05020 169745 169545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 170625 169657 gene locus_tag LOCUS_05030 gene hprK 170625 169657 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_05030 170973 172187 gene locus_tag LOCUS_05040 170973 172187 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814817.1 protein_id gnl|my_center|LOCUS_05040 172253 173572 gene locus_tag LOCUS_05050 172253 173572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 174860 173838 gene locus_tag LOCUS_05060 174860 173838 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141484866.1 protein_id gnl|my_center|LOCUS_05060 175461 174964 gene locus_tag LOCUS_05070 175461 174964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 175759 175532 gene locus_tag LOCUS_05080 175759 175532 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459191.1 protein_id gnl|my_center|LOCUS_05080 175955 176161 gene locus_tag LOCUS_05090 175955 176161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 >Feature sequence04 171 1457 gene locus_tag LOCUS_05100 171 1457 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_05100 1596 1919 gene locus_tag LOCUS_05110 1596 1919 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393007.1 protein_id gnl|my_center|LOCUS_05110 2020 2463 gene locus_tag LOCUS_05120 gene spoIIAB 2020 2463 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_05120 2447 3124 gene locus_tag LOCUS_05130 gene sigF 2447 3124 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_05130 3611 3402 gene locus_tag LOCUS_05140 3611 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05140 3851 3627 gene locus_tag LOCUS_05150 3851 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05150 3988 4869 gene locus_tag LOCUS_05160 3988 4869 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_05160 4995 5612 gene locus_tag LOCUS_05170 4995 5612 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_05170 5664 6206 gene locus_tag LOCUS_05180 5664 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 6438 7319 gene locus_tag LOCUS_05190 6438 7319 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_05190 7309 8541 gene locus_tag LOCUS_05200 7309 8541 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_05200 8629 9294 gene locus_tag LOCUS_05210 gene cmk 8629 9294 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700259.1 protein_id gnl|my_center|LOCUS_05210 9291 9935 gene locus_tag LOCUS_05220 9291 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 9923 11959 gene locus_tag LOCUS_05230 9923 11959 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965152.1 protein_id gnl|my_center|LOCUS_05230 12096 12845 gene locus_tag LOCUS_05240 12096 12845 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207242.1 protein_id gnl|my_center|LOCUS_05240 12842 13150 gene locus_tag LOCUS_05250 12842 13150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 13277 15001 gene locus_tag LOCUS_05260 13277 15001 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196552.1 protein_id gnl|my_center|LOCUS_05260 15384 15217 gene locus_tag LOCUS_05270 15384 15217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 15689 15369 gene locus_tag LOCUS_05280 15689 15369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 16073 15828 gene locus_tag LOCUS_05290 16073 15828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 16406 16227 gene locus_tag LOCUS_05300 16406 16227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 17024 17227 gene locus_tag LOCUS_05310 17024 17227 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_05310 17888 19795 gene locus_tag LOCUS_05320 gene htpG 17888 19795 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966587.1 protein_id gnl|my_center|LOCUS_05320 20510 19956 gene locus_tag LOCUS_05330 20510 19956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 21672 20632 gene locus_tag LOCUS_05340 21672 20632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 22309 21776 gene locus_tag LOCUS_05350 22309 21776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 22822 22373 gene locus_tag LOCUS_05360 22822 22373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 23646 23104 gene locus_tag LOCUS_05370 23646 23104 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_05370 24141 23755 gene locus_tag LOCUS_05380 24141 23755 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392341.1 protein_id gnl|my_center|LOCUS_05380 24353 25348 gene locus_tag LOCUS_05390 24353 25348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810730.1 protein_id gnl|my_center|LOCUS_05390 26262 25354 gene locus_tag LOCUS_05400 26262 25354 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812722.1 protein_id gnl|my_center|LOCUS_05400 27002 26259 gene locus_tag LOCUS_05410 27002 26259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 27262 28515 gene locus_tag LOCUS_05420 27262 28515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 28844 30007 gene locus_tag LOCUS_05430 28844 30007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 30076 31227 gene locus_tag LOCUS_05440 30076 31227 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_05440 31583 31350 gene locus_tag LOCUS_05450 31583 31350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 31741 33354 gene locus_tag LOCUS_05460 gene mrdA 31741 33354 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545126.1 protein_id gnl|my_center|LOCUS_05460 33651 33436 gene locus_tag LOCUS_05470 33651 33436 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286251.1 protein_id gnl|my_center|LOCUS_05470 33765 34319 gene locus_tag LOCUS_05480 33765 34319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 34805 37444 gene locus_tag LOCUS_05490 gene alaS 34805 37444 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_05490 37495 37833 gene locus_tag LOCUS_05500 37495 37833 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_05500 37876 38415 gene locus_tag LOCUS_05510 37876 38415 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_05510 38457 40661 gene locus_tag LOCUS_05520 38457 40661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 40690 41742 gene locus_tag LOCUS_05530 gene holA 40690 41742 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279906.1 protein_id gnl|my_center|LOCUS_05530 41809 42396 gene locus_tag LOCUS_05540 gene rnmV 41809 42396 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832196.1 protein_id gnl|my_center|LOCUS_05540 42538 43791 gene locus_tag LOCUS_05550 42538 43791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 44023 45177 gene locus_tag LOCUS_05560 gene glxK 44023 45177 CDS product glycerate 3-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706333.1 protein_id gnl|my_center|LOCUS_05560 45332 45775 gene locus_tag LOCUS_05570 45332 45775 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355539.1 protein_id gnl|my_center|LOCUS_05570 45778 46362 gene locus_tag LOCUS_05580 45778 46362 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889321.1 protein_id gnl|my_center|LOCUS_05580 46384 46938 gene locus_tag LOCUS_05590 46384 46938 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233562.1 protein_id gnl|my_center|LOCUS_05590 47027 49327 gene locus_tag LOCUS_05600 47027 49327 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259692.1 protein_id gnl|my_center|LOCUS_05600 50226 51719 gene locus_tag LOCUS_05610 50226 51719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 54421 51815 gene locus_tag LOCUS_05620 gene clpB 54421 51815 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365367.1 protein_id gnl|my_center|LOCUS_05620 54975 54544 gene locus_tag LOCUS_05630 54975 54544 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948529.1 protein_id gnl|my_center|LOCUS_05630 55263 56510 gene locus_tag LOCUS_05640 55263 56510 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184189.1 protein_id gnl|my_center|LOCUS_05640 56625 58067 gene locus_tag LOCUS_05650 56625 58067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 58190 59638 gene locus_tag LOCUS_05660 58190 59638 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965885.1 protein_id gnl|my_center|LOCUS_05660 59991 60194 gene locus_tag LOCUS_05670 59991 60194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 61378 61959 gene locus_tag LOCUS_05680 61378 61959 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939526.1 protein_id gnl|my_center|LOCUS_05680 61996 63651 gene locus_tag LOCUS_05690 61996 63651 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762692.1 protein_id gnl|my_center|LOCUS_05690 64134 64397 gene locus_tag LOCUS_05700 64134 64397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 64604 64529 gene locus_tag LOCUS_t00020 64604 64529 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 65024 64734 gene locus_tag LOCUS_05710 65024 64734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 65284 64988 gene locus_tag LOCUS_05720 65284 64988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 65429 65635 gene locus_tag LOCUS_05730 65429 65635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 65841 68669 gene locus_tag LOCUS_05740 65841 68669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 69578 68745 gene locus_tag LOCUS_05750 69578 68745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 69838 70278 gene locus_tag LOCUS_05760 69838 70278 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047979.1 protein_id gnl|my_center|LOCUS_05760 70321 70824 gene locus_tag LOCUS_05770 70321 70824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 70965 71339 gene locus_tag LOCUS_05780 70965 71339 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_05780 71375 72238 gene locus_tag LOCUS_05790 71375 72238 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_05790 72235 72861 gene locus_tag LOCUS_05800 72235 72861 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459560.1 protein_id gnl|my_center|LOCUS_05800 73178 73384 gene locus_tag LOCUS_05810 73178 73384 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519083.1 protein_id gnl|my_center|LOCUS_05810 73492 74241 gene locus_tag LOCUS_05820 73492 74241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 74268 75053 gene locus_tag LOCUS_05830 74268 75053 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905742.1 protein_id gnl|my_center|LOCUS_05830 75053 76834 gene locus_tag LOCUS_05840 75053 76834 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_05840 77076 78044 gene locus_tag LOCUS_05850 77076 78044 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_05850 78117 78608 gene locus_tag LOCUS_05860 78117 78608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 78877 80085 gene locus_tag LOCUS_05870 78877 80085 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_05870 80269 80658 gene locus_tag LOCUS_05880 80269 80658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 80704 81984 gene locus_tag LOCUS_05890 80704 81984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 82561 82064 gene locus_tag LOCUS_05900 82561 82064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 82911 83429 gene locus_tag LOCUS_05910 gene nuoE 82911 83429 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_05910 83426 85174 gene locus_tag LOCUS_05920 gene nuoF 83426 85174 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_05920 85331 88813 gene locus_tag LOCUS_05930 85331 88813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 89335 90519 gene locus_tag LOCUS_05940 89335 90519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 90512 91249 gene locus_tag LOCUS_05950 90512 91249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 91387 92934 gene locus_tag LOCUS_05960 91387 92934 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942447.1 protein_id gnl|my_center|LOCUS_05960 92961 93497 gene locus_tag LOCUS_05970 92961 93497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 93741 94118 gene locus_tag LOCUS_05980 93741 94118 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_05980 94648 94130 gene locus_tag LOCUS_05990 94648 94130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 95252 94701 gene locus_tag LOCUS_06000 95252 94701 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081283.1 protein_id gnl|my_center|LOCUS_06000 96034 95306 gene locus_tag LOCUS_06010 96034 95306 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393245.1 protein_id gnl|my_center|LOCUS_06010 98413 96143 gene locus_tag LOCUS_06020 98413 96143 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048080.1 protein_id gnl|my_center|LOCUS_06020 100460 98388 gene locus_tag LOCUS_06030 gene recJ 100460 98388 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_06030 100799 101383 gene locus_tag LOCUS_06040 100799 101383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 101413 101718 gene locus_tag LOCUS_06050 101413 101718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 102031 102804 gene locus_tag LOCUS_06060 102031 102804 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956859.1 protein_id gnl|my_center|LOCUS_06060 103054 104331 gene locus_tag LOCUS_06070 103054 104331 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_06070 104549 105139 gene locus_tag LOCUS_06080 104549 105139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 106229 105237 gene locus_tag LOCUS_06090 106229 105237 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834041.1 protein_id gnl|my_center|LOCUS_06090 106755 107831 gene locus_tag LOCUS_06100 gene pyrB 106755 107831 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_06100 107794 108402 gene locus_tag LOCUS_06110 107794 108402 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878933.1 protein_id gnl|my_center|LOCUS_06110 108427 108747 gene locus_tag LOCUS_06120 gene trxA 108427 108747 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393175.1 protein_id gnl|my_center|LOCUS_06120 108830 109672 gene locus_tag LOCUS_06130 108830 109672 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990036.1 protein_id gnl|my_center|LOCUS_06130 109754 110695 gene locus_tag LOCUS_06140 109754 110695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145860136.1 protein_id gnl|my_center|LOCUS_06140 110698 111348 gene locus_tag LOCUS_06150 110698 111348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 111380 112423 gene locus_tag LOCUS_06160 111380 112423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 112614 114026 gene locus_tag LOCUS_06170 gene miaB 112614 114026 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965143.1 protein_id gnl|my_center|LOCUS_06170 114233 114640 gene locus_tag LOCUS_06180 114233 114640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 114766 117399 gene locus_tag LOCUS_06190 gene mutS 114766 117399 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047675.1 protein_id gnl|my_center|LOCUS_06190 117446 118948 gene locus_tag LOCUS_06200 117446 118948 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272361.1 protein_id gnl|my_center|LOCUS_06200 119008 121011 gene locus_tag LOCUS_06210 gene mutL 119008 121011 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020571.1 protein_id gnl|my_center|LOCUS_06210 121057 122016 gene locus_tag LOCUS_06220 gene miaA 121057 122016 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_06220 122013 123371 gene locus_tag LOCUS_06230 122013 123371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 123349 124074 gene locus_tag LOCUS_06240 123349 124074 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_06240 124096 124575 gene locus_tag LOCUS_06250 124096 124575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 124618 125736 gene locus_tag LOCUS_06260 124618 125736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 125866 126426 gene locus_tag LOCUS_06270 gene lspA 125866 126426 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130994.1 protein_id gnl|my_center|LOCUS_06270 126419 127354 gene locus_tag LOCUS_06280 126419 127354 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_06280 127335 128192 gene locus_tag LOCUS_06290 127335 128192 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704075.1 protein_id gnl|my_center|LOCUS_06290 128452 129297 gene locus_tag LOCUS_06300 128452 129297 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_06300 129299 130246 gene locus_tag LOCUS_06310 129299 130246 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_06310 130393 130902 gene locus_tag LOCUS_06320 130393 130902 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_06320 131029 132057 gene locus_tag LOCUS_06330 131029 132057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 132643 132119 gene locus_tag LOCUS_06340 gene thpR 132643 132119 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400025.1 protein_id gnl|my_center|LOCUS_06340 134245 132653 gene locus_tag LOCUS_06350 134245 132653 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 protein_id gnl|my_center|LOCUS_06350 134919 134242 gene locus_tag LOCUS_06360 134919 134242 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044679.1 protein_id gnl|my_center|LOCUS_06360 135260 135790 gene locus_tag LOCUS_06370 135260 135790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 135861 136769 gene locus_tag LOCUS_06380 135861 136769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 136770 137378 gene locus_tag LOCUS_06390 136770 137378 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571283.1 protein_id gnl|my_center|LOCUS_06390 137365 138567 gene locus_tag LOCUS_06400 137365 138567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 138756 138938 gene locus_tag LOCUS_06410 138756 138938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 139003 139242 gene locus_tag LOCUS_06420 139003 139242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 139268 139468 gene locus_tag LOCUS_06430 139268 139468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 139468 139917 gene locus_tag LOCUS_06440 139468 139917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 139914 140672 gene locus_tag LOCUS_06450 139914 140672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 140669 141331 gene locus_tag LOCUS_06460 140669 141331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 141500 141724 gene locus_tag LOCUS_06470 141500 141724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 141721 142002 gene locus_tag LOCUS_06480 141721 142002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 142014 142163 gene locus_tag LOCUS_06490 142014 142163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 142148 142456 gene locus_tag LOCUS_06500 142148 142456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 142475 143176 gene locus_tag LOCUS_06510 142475 143176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 143163 143534 gene locus_tag LOCUS_06520 143163 143534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 143515 143877 gene locus_tag LOCUS_06530 143515 143877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 143992 144237 gene locus_tag LOCUS_06540 143992 144237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 144241 144477 gene locus_tag LOCUS_06550 144241 144477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 144867 145766 gene locus_tag LOCUS_06560 144867 145766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 145763 146566 gene locus_tag LOCUS_06570 145763 146566 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596591.1 protein_id gnl|my_center|LOCUS_06570 146571 147491 gene locus_tag LOCUS_06580 146571 147491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 147503 148246 gene locus_tag LOCUS_06590 147503 148246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 148250 148459 gene locus_tag LOCUS_06600 148250 148459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 148425 148727 gene locus_tag LOCUS_06610 148425 148727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 148747 149100 gene locus_tag LOCUS_06620 148747 149100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 149090 149311 gene locus_tag LOCUS_06630 149090 149311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 149439 149840 gene locus_tag LOCUS_06640 149439 149840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 149854 150243 gene locus_tag LOCUS_06650 149854 150243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 150236 151900 gene locus_tag LOCUS_06660 150236 151900 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225426974.1 protein_id gnl|my_center|LOCUS_06660 152202 153290 gene locus_tag LOCUS_06670 152202 153290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 153295 154056 gene locus_tag LOCUS_06680 153295 154056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 154082 155296 gene locus_tag LOCUS_06690 154082 155296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 155371 155634 gene locus_tag LOCUS_06700 155371 155634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 155618 155884 gene locus_tag LOCUS_06710 155618 155884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 155881 156288 gene locus_tag LOCUS_06720 155881 156288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 156290 156673 gene locus_tag LOCUS_06730 156290 156673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 156670 157236 gene locus_tag LOCUS_06740 156670 157236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 157299 157655 gene locus_tag LOCUS_06750 157299 157655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 157658 157933 gene locus_tag LOCUS_06760 157658 157933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 >Feature sequence05 758 552 gene locus_tag LOCUS_06770 758 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 952 1386 gene locus_tag LOCUS_06780 952 1386 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137628160.1 protein_id gnl|my_center|LOCUS_06780 1391 1843 gene locus_tag LOCUS_06790 1391 1843 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092482714.1 protein_id gnl|my_center|LOCUS_06790 1995 3011 gene locus_tag LOCUS_06800 1995 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 3933 3049 gene locus_tag LOCUS_06810 3933 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 5883 4228 gene locus_tag LOCUS_06820 5883 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 6697 6017 gene locus_tag LOCUS_06830 6697 6017 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_06830 8494 6800 gene locus_tag LOCUS_06840 8494 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 8881 8570 gene locus_tag LOCUS_06850 gene trxA 8881 8570 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393175.1 protein_id gnl|my_center|LOCUS_06850 9671 9000 gene locus_tag LOCUS_06860 9671 9000 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_06860 10051 9725 gene locus_tag LOCUS_06870 10051 9725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 10459 10884 gene locus_tag LOCUS_06880 10459 10884 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461281.1 protein_id gnl|my_center|LOCUS_06880 13022 11289 gene locus_tag LOCUS_06890 13022 11289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 13766 13056 gene locus_tag LOCUS_06900 13766 13056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 15124 13814 gene locus_tag LOCUS_06910 15124 13814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068300.1 protein_id gnl|my_center|LOCUS_06910 15508 15182 gene locus_tag LOCUS_06920 15508 15182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06920 15835 15512 gene locus_tag LOCUS_06930 gene hisI 15835 15512 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721356.1 protein_id gnl|my_center|LOCUS_06930 16610 15891 gene locus_tag LOCUS_06940 gene hisA 16610 15891 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989518.1 protein_id gnl|my_center|LOCUS_06940 17231 16653 gene locus_tag LOCUS_06950 gene hisB 17231 16653 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674505.1 protein_id gnl|my_center|LOCUS_06950 18301 17240 gene locus_tag LOCUS_06960 gene hisC 18301 17240 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889400.1 protein_id gnl|my_center|LOCUS_06960 19587 18304 gene locus_tag LOCUS_06970 gene hisD 19587 18304 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964255.1 protein_id gnl|my_center|LOCUS_06970 20225 19584 gene locus_tag LOCUS_06980 gene hisG 20225 19584 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964254.1 protein_id gnl|my_center|LOCUS_06980 21454 20222 gene locus_tag LOCUS_06990 21454 20222 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949109.1 protein_id gnl|my_center|LOCUS_06990 22138 21512 gene locus_tag LOCUS_07000 22138 21512 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811525.1 protein_id gnl|my_center|LOCUS_07000 23103 22561 gene locus_tag LOCUS_07010 23103 22561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 24700 23234 gene locus_tag LOCUS_07020 24700 23234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 29024 24720 gene locus_tag LOCUS_07030 29024 24720 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_07030 30114 29065 gene locus_tag LOCUS_07040 gene ispG 30114 29065 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861462.1 protein_id gnl|my_center|LOCUS_07040 31171 30167 gene locus_tag LOCUS_07050 gene rseP 31171 30167 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_07050 32430 31273 gene locus_tag LOCUS_07060 32430 31273 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142249.1 protein_id gnl|my_center|LOCUS_07060 33418 32573 gene locus_tag LOCUS_07070 gene cdsA 33418 32573 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231924.1 protein_id gnl|my_center|LOCUS_07070 34235 33510 gene locus_tag LOCUS_07080 34235 33510 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_07080 34963 34403 gene locus_tag LOCUS_07090 gene frr 34963 34403 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430598.1 protein_id gnl|my_center|LOCUS_07090 35679 34969 gene locus_tag LOCUS_07100 gene pyrH 35679 34969 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_07100 35872 36399 gene locus_tag LOCUS_07110 35872 36399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 36525 37112 gene locus_tag LOCUS_07120 36525 37112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 37346 37792 gene locus_tag LOCUS_07130 37346 37792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 37821 40556 gene locus_tag LOCUS_07140 37821 40556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 40574 41320 gene locus_tag LOCUS_07150 40574 41320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 41485 41943 gene locus_tag LOCUS_07160 41485 41943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 41985 42698 gene locus_tag LOCUS_07170 41985 42698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 42773 43504 gene locus_tag LOCUS_07180 42773 43504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 43657 45996 gene locus_tag LOCUS_07190 43657 45996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 46706 46062 gene locus_tag LOCUS_07200 46706 46062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 47430 46750 gene locus_tag LOCUS_07210 47430 46750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 47713 48090 gene locus_tag LOCUS_07220 47713 48090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 48126 48563 gene locus_tag LOCUS_07230 48126 48563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 48529 48696 gene locus_tag LOCUS_07240 48529 48696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 49096 48866 gene locus_tag LOCUS_07250 49096 48866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 50298 49840 gene locus_tag LOCUS_07260 50298 49840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 50504 54292 gene locus_tag LOCUS_07270 50504 54292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 54368 55159 gene locus_tag LOCUS_07280 54368 55159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 55160 58957 gene locus_tag LOCUS_07290 55160 58957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 58971 59363 gene locus_tag LOCUS_07300 58971 59363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 59360 59770 gene locus_tag LOCUS_07310 59360 59770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 59791 59985 gene locus_tag LOCUS_07320 59791 59985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 60026 61225 gene locus_tag LOCUS_07330 60026 61225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 61225 62658 gene locus_tag LOCUS_07340 61225 62658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 62791 63132 gene locus_tag LOCUS_07350 62791 63132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 63157 63591 gene locus_tag LOCUS_07360 63157 63591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 63608 64405 gene locus_tag LOCUS_07370 63608 64405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 65571 64549 gene locus_tag LOCUS_07380 65571 64549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 66801 65908 gene locus_tag LOCUS_07390 66801 65908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 66997 67842 gene locus_tag LOCUS_07400 66997 67842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 68508 68047 gene locus_tag LOCUS_07410 gene nrdR 68508 68047 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_07410 69436 68651 gene locus_tag LOCUS_07420 69436 68651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 69666 69950 gene locus_tag LOCUS_07430 69666 69950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 70768 70019 gene locus_tag LOCUS_07440 70768 70019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 71276 70818 gene locus_tag LOCUS_07450 71276 70818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 71598 71302 gene locus_tag LOCUS_07460 71598 71302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 72915 71653 gene locus_tag LOCUS_07470 72915 71653 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205413.1 protein_id gnl|my_center|LOCUS_07470 73680 73156 gene locus_tag LOCUS_07480 73680 73156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 73925 74110 gene locus_tag LOCUS_07490 73925 74110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 74605 74531 gene locus_tag LOCUS_t00030 74605 74531 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 74746 74670 gene locus_tag LOCUS_t00040 74746 74670 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 74828 74752 gene locus_tag LOCUS_t00050 74828 74752 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 74919 74846 gene locus_tag LOCUS_t00060 74919 74846 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 75033 74960 gene locus_tag LOCUS_t00070 75033 74960 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 76521 75208 gene locus_tag LOCUS_07500 gene clpX 76521 75208 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_07500 77131 76550 gene locus_tag LOCUS_07510 gene clpP 77131 76550 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_07510 78717 77368 gene locus_tag LOCUS_07520 gene tig 78717 77368 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_07520 79550 78849 gene locus_tag LOCUS_07530 79550 78849 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_07530 79733 79909 gene locus_tag LOCUS_07540 79733 79909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 81481 79979 gene locus_tag LOCUS_07550 gene thrC 81481 79979 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_07550 82807 81767 gene locus_tag LOCUS_07560 82807 81767 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_07560 83215 82844 gene locus_tag LOCUS_07570 83215 82844 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392503.1 protein_id gnl|my_center|LOCUS_07570 83873 83256 gene locus_tag LOCUS_07580 83873 83256 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_07580 84805 83927 gene locus_tag LOCUS_07590 gene ylqF 84805 83927 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047861.1 protein_id gnl|my_center|LOCUS_07590 85435 84830 gene locus_tag LOCUS_07600 gene lepB 85435 84830 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_07600 86060 85488 gene locus_tag LOCUS_07610 86060 85488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 86467 86123 gene locus_tag LOCUS_07620 gene rplS 86467 86123 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_07620 87117 87482 gene locus_tag LOCUS_07630 87117 87482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 91214 87648 gene locus_tag LOCUS_07640 gene nifJ 91214 87648 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_07640 91746 93188 gene locus_tag LOCUS_07650 91746 93188 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_07650 94392 93268 gene locus_tag LOCUS_07660 94392 93268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 96015 94441 gene locus_tag LOCUS_07670 96015 94441 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_07670 96403 96176 gene locus_tag LOCUS_07680 96403 96176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 98091 96574 gene locus_tag LOCUS_07690 98091 96574 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_07690 98927 98262 gene locus_tag LOCUS_07700 98927 98262 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596541.1 protein_id gnl|my_center|LOCUS_07700 100518 99109 gene locus_tag LOCUS_07710 100518 99109 CDS product DUF4832 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767298.1 protein_id gnl|my_center|LOCUS_07710 100774 102207 gene locus_tag LOCUS_07720 gene melB 100774 102207 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028072.1 protein_id gnl|my_center|LOCUS_07720 102469 103821 gene locus_tag LOCUS_07730 102469 103821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 104110 104775 gene locus_tag LOCUS_07740 104110 104775 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861403.1 protein_id gnl|my_center|LOCUS_07740 104772 107387 gene locus_tag LOCUS_07750 104772 107387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 108375 107668 gene locus_tag LOCUS_07760 108375 107668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 109642 108377 gene locus_tag LOCUS_07770 109642 108377 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_07770 110432 109650 gene locus_tag LOCUS_07780 110432 109650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 111453 110425 gene locus_tag LOCUS_07790 111453 110425 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811665.1 protein_id gnl|my_center|LOCUS_07790 112461 111454 gene locus_tag LOCUS_07800 112461 111454 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_07800 112685 115549 gene locus_tag LOCUS_07810 112685 115549 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106612643.1 protein_id gnl|my_center|LOCUS_07810 118284 115651 gene locus_tag LOCUS_07820 118284 115651 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948276.1 protein_id gnl|my_center|LOCUS_07820 118513 118256 gene locus_tag LOCUS_07830 118513 118256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 119174 118518 gene locus_tag LOCUS_07840 119174 118518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 120281 119940 gene locus_tag LOCUS_07850 gene rplQ 120281 119940 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_07850 121260 120310 gene locus_tag LOCUS_07860 gene rpoA 121260 120310 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569643.1 protein_id gnl|my_center|LOCUS_07860 121965 121339 gene locus_tag LOCUS_07870 gene rpsD 121965 121339 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_07870 122398 121991 gene locus_tag LOCUS_07880 gene rpsK 122398 121991 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_07880 122782 122414 gene locus_tag LOCUS_07890 gene rpsM 122782 122414 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966388.1 protein_id gnl|my_center|LOCUS_07890 123173 122955 gene locus_tag LOCUS_07900 gene infA 123173 122955 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_07900 123446 123177 gene locus_tag LOCUS_07910 123446 123177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 124207 123458 gene locus_tag LOCUS_07920 gene map 124207 123458 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_07920 124842 124210 gene locus_tag LOCUS_07930 124842 124210 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_07930 126335 124986 gene locus_tag LOCUS_07940 gene secY 126335 124986 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_07940 126780 126337 gene locus_tag LOCUS_07950 gene rplO 126780 126337 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966393.1 protein_id gnl|my_center|LOCUS_07950 126978 126799 gene locus_tag LOCUS_07960 gene rpmD 126978 126799 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357637.1 protein_id gnl|my_center|LOCUS_07960 127493 126993 gene locus_tag LOCUS_07970 gene rpsE 127493 126993 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554646.1 protein_id gnl|my_center|LOCUS_07970 127870 127511 gene locus_tag LOCUS_07980 gene rplR 127870 127511 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356218.1 protein_id gnl|my_center|LOCUS_07980 128440 127895 gene locus_tag LOCUS_07990 gene rplF 128440 127895 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810135.1 protein_id gnl|my_center|LOCUS_07990 128855 128457 gene locus_tag LOCUS_08000 gene rpsH 128855 128457 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 protein_id gnl|my_center|LOCUS_08000 129068 128883 gene locus_tag LOCUS_08010 129068 128883 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459104.1 protein_id gnl|my_center|LOCUS_08010 129620 129081 gene locus_tag LOCUS_08020 gene rplE 129620 129081 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_08020 129967 129638 gene locus_tag LOCUS_08030 gene rplX 129967 129638 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_08030 130352 129984 gene locus_tag LOCUS_08040 gene rplN 130352 129984 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_08040 130639 130382 gene locus_tag LOCUS_08050 gene rpsQ 130639 130382 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_08050 130861 130658 gene locus_tag LOCUS_08060 gene rpmC 130861 130658 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_08060 131286 130861 gene locus_tag LOCUS_08070 gene rplP 131286 130861 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421160.1 protein_id gnl|my_center|LOCUS_08070 131957 131286 gene locus_tag LOCUS_08080 gene rpsC 131957 131286 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810152.1 protein_id gnl|my_center|LOCUS_08080 132312 131977 gene locus_tag LOCUS_08090 gene rplV 132312 131977 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048353.1 protein_id gnl|my_center|LOCUS_08090 132616 132338 gene locus_tag LOCUS_08100 gene rpsS 132616 132338 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_08100 133521 132640 gene locus_tag LOCUS_08110 gene rplB 133521 132640 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_08110 133853 133557 gene locus_tag LOCUS_08120 gene rplW 133853 133557 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_08120 134473 133850 gene locus_tag LOCUS_08130 gene rplD 134473 133850 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966411.1 protein_id gnl|my_center|LOCUS_08130 135125 134490 gene locus_tag LOCUS_08140 gene rplC 135125 134490 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966412.1 protein_id gnl|my_center|LOCUS_08140 135507 135196 gene locus_tag LOCUS_08150 gene rpsJ 135507 135196 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118667.1 protein_id gnl|my_center|LOCUS_08150 136361 136080 gene locus_tag LOCUS_08160 136361 136080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 136724 136443 gene locus_tag LOCUS_08170 136724 136443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 137112 136834 gene locus_tag LOCUS_08180 137112 136834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 137407 137129 gene locus_tag LOCUS_08190 137407 137129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 138785 137424 gene locus_tag LOCUS_08200 138785 137424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 141705 139120 gene locus_tag LOCUS_08210 141705 139120 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_08210 142057 141722 gene locus_tag LOCUS_08220 142057 141722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 144646 142265 gene locus_tag LOCUS_08230 144646 142265 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527693.1 protein_id gnl|my_center|LOCUS_08230 147099 144706 gene locus_tag LOCUS_08240 147099 144706 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836501.1 protein_id gnl|my_center|LOCUS_08240 147536 147928 gene locus_tag LOCUS_08250 147536 147928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 149350 148052 gene locus_tag LOCUS_08260 149350 148052 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288357.1 protein_id gnl|my_center|LOCUS_08260 150124 149474 gene locus_tag LOCUS_08270 150124 149474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 150306 150521 gene locus_tag LOCUS_08280 150306 150521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 150778 152208 gene locus_tag LOCUS_08290 150778 152208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 152474 152334 gene locus_tag LOCUS_08300 152474 152334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 >Feature sequence06 241 897 gene locus_tag LOCUS_08310 241 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 1504 962 gene locus_tag LOCUS_08320 1504 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 2271 2122 gene locus_tag LOCUS_08330 2271 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 2770 2845 gene locus_tag LOCUS_t00080 2770 2845 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3250 4116 gene locus_tag LOCUS_08340 3250 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 4767 4225 gene locus_tag LOCUS_08350 4767 4225 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843675.1 protein_id gnl|my_center|LOCUS_08350 5242 4826 gene locus_tag LOCUS_08360 5242 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 6093 5386 gene locus_tag LOCUS_08370 6093 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 7961 6132 gene locus_tag LOCUS_08380 gene glmS 7961 6132 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_08380 8298 8095 gene locus_tag LOCUS_08390 8298 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 8714 8854 gene locus_tag LOCUS_08400 8714 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 8860 10425 gene locus_tag LOCUS_08410 8860 10425 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 protein_id gnl|my_center|LOCUS_08410 10525 12387 gene locus_tag LOCUS_08420 10525 12387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 12659 14041 gene locus_tag LOCUS_08430 12659 14041 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_08430 15151 14183 gene locus_tag LOCUS_08440 15151 14183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 15578 15297 gene locus_tag LOCUS_08450 15578 15297 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461672.1 protein_id gnl|my_center|LOCUS_08450 16340 15720 gene locus_tag LOCUS_08460 16340 15720 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387193.1 protein_id gnl|my_center|LOCUS_08460 16982 16758 gene locus_tag LOCUS_08470 16982 16758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 18746 17022 gene locus_tag LOCUS_08480 18746 17022 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_08480 19114 18974 gene locus_tag LOCUS_08490 19114 18974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 19115 20644 gene locus_tag LOCUS_08500 19115 20644 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_08500 21486 20653 gene locus_tag LOCUS_08510 gene rlmA 21486 20653 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072721.1 protein_id gnl|my_center|LOCUS_08510 22772 21579 gene locus_tag LOCUS_08520 gene dnaJ 22772 21579 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964595.1 protein_id gnl|my_center|LOCUS_08520 24844 22994 gene locus_tag LOCUS_08530 gene dnaK 24844 22994 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_08530 25527 24940 gene locus_tag LOCUS_08540 25527 24940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 26634 25579 gene locus_tag LOCUS_08550 gene hrcA 26634 25579 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_08550 27114 28610 gene locus_tag LOCUS_08560 27114 28610 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_08560 28749 29435 gene locus_tag LOCUS_08570 28749 29435 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 protein_id gnl|my_center|LOCUS_08570 29512 29937 gene locus_tag LOCUS_08580 29512 29937 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912113.1 protein_id gnl|my_center|LOCUS_08580 29953 31434 gene locus_tag LOCUS_08590 29953 31434 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_08590 31451 33211 gene locus_tag LOCUS_08600 gene fucI 31451 33211 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_08600 33379 33576 gene locus_tag LOCUS_08610 33379 33576 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111744.1 protein_id gnl|my_center|LOCUS_08610 33580 34044 gene locus_tag LOCUS_08620 33580 34044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 34168 35079 gene locus_tag LOCUS_08630 34168 35079 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058142.1 protein_id gnl|my_center|LOCUS_08630 35076 36326 gene locus_tag LOCUS_08640 35076 36326 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839941.1 protein_id gnl|my_center|LOCUS_08640 37259 36384 gene locus_tag LOCUS_08650 37259 36384 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_08650 38855 37272 gene locus_tag LOCUS_08660 38855 37272 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861711.1 protein_id gnl|my_center|LOCUS_08660 39449 38919 gene locus_tag LOCUS_08670 39449 38919 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118797.1 protein_id gnl|my_center|LOCUS_08670 40225 39446 gene locus_tag LOCUS_08680 40225 39446 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567984.1 protein_id gnl|my_center|LOCUS_08680 40833 40405 gene locus_tag LOCUS_08690 40833 40405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 41526 41110 gene locus_tag LOCUS_08700 41526 41110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 41802 43187 gene locus_tag LOCUS_08710 41802 43187 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948912.1 protein_id gnl|my_center|LOCUS_08710 43189 43701 gene locus_tag LOCUS_08720 43189 43701 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_08720 43793 44860 gene locus_tag LOCUS_08730 gene mutY 43793 44860 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243838.1 protein_id gnl|my_center|LOCUS_08730 45200 46252 gene locus_tag LOCUS_08740 45200 46252 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052107.1 protein_id gnl|my_center|LOCUS_08740 46294 46917 gene locus_tag LOCUS_08750 46294 46917 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812798.1 protein_id gnl|my_center|LOCUS_08750 46946 47515 gene locus_tag LOCUS_08760 46946 47515 CDS product maltose acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026426.1 protein_id gnl|my_center|LOCUS_08760 47620 48063 gene locus_tag LOCUS_08770 47620 48063 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972158.1 protein_id gnl|my_center|LOCUS_08770 48090 48953 gene locus_tag LOCUS_08780 48090 48953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 49142 50077 gene locus_tag LOCUS_08790 49142 50077 CDS product CorA family divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428624.1 protein_id gnl|my_center|LOCUS_08790 50422 50348 gene locus_tag LOCUS_t00090 50422 50348 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 51648 50719 gene locus_tag LOCUS_08800 51648 50719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 52823 51888 gene locus_tag LOCUS_08810 52823 51888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 53368 54135 gene locus_tag LOCUS_08820 53368 54135 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_08820 54164 54556 gene locus_tag LOCUS_08830 54164 54556 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_08830 54553 55221 gene locus_tag LOCUS_08840 54553 55221 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386325.1 protein_id gnl|my_center|LOCUS_08840 55254 56786 gene locus_tag LOCUS_08850 55254 56786 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993891.1 protein_id gnl|my_center|LOCUS_08850 57003 58856 gene locus_tag LOCUS_08860 57003 58856 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814523.1 protein_id gnl|my_center|LOCUS_08860 60215 58971 gene locus_tag LOCUS_08870 60215 58971 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389459.1 protein_id gnl|my_center|LOCUS_08870 61603 60242 gene locus_tag LOCUS_08880 61603 60242 CDS product Trk family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888508.1 protein_id gnl|my_center|LOCUS_08880 61937 62629 gene locus_tag LOCUS_08890 61937 62629 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_08890 62658 63662 gene locus_tag LOCUS_08900 62658 63662 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_08900 64169 63738 gene locus_tag LOCUS_08910 64169 63738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 65201 64326 gene locus_tag LOCUS_08920 gene galU 65201 64326 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 protein_id gnl|my_center|LOCUS_08920 66179 65226 gene locus_tag LOCUS_08930 66179 65226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 67467 66367 gene locus_tag LOCUS_08940 67467 66367 CDS product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392810.1 protein_id gnl|my_center|LOCUS_08940 67665 69269 gene locus_tag LOCUS_08950 67665 69269 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812114.1 protein_id gnl|my_center|LOCUS_08950 70850 69519 gene locus_tag LOCUS_08960 70850 69519 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108981.1 protein_id gnl|my_center|LOCUS_08960 71806 71033 gene locus_tag LOCUS_08970 71806 71033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 72106 72885 gene locus_tag LOCUS_08980 gene rlmB 72106 72885 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966431.1 protein_id gnl|my_center|LOCUS_08980 73019 75766 gene locus_tag LOCUS_08990 73019 75766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 76036 76287 gene locus_tag LOCUS_09000 76036 76287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 77303 76380 gene locus_tag LOCUS_09010 77303 76380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 77791 77315 gene locus_tag LOCUS_09020 77791 77315 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837153.1 protein_id gnl|my_center|LOCUS_09020 78323 77796 gene locus_tag LOCUS_09030 gene dcd 78323 77796 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_09030 79321 78494 gene locus_tag LOCUS_09040 79321 78494 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462186.1 protein_id gnl|my_center|LOCUS_09040 79977 79318 gene locus_tag LOCUS_09050 79977 79318 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582846.1 protein_id gnl|my_center|LOCUS_09050 80464 79991 gene locus_tag LOCUS_09060 80464 79991 CDS product LURP-one-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775190.1 protein_id gnl|my_center|LOCUS_09060 80936 80490 gene locus_tag LOCUS_09070 80936 80490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 82302 80968 gene locus_tag LOCUS_09080 82302 80968 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015963.1 protein_id gnl|my_center|LOCUS_09080 83046 82321 gene locus_tag LOCUS_09090 gene tsaA 83046 82321 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_09090 84681 83617 gene locus_tag LOCUS_09100 84681 83617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 86470 84668 gene locus_tag LOCUS_09110 86470 84668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 88123 86486 gene locus_tag LOCUS_09120 gene rlmD 88123 86486 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914581.1 protein_id gnl|my_center|LOCUS_09120 88304 88380 gene locus_tag LOCUS_t00100 88304 88380 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 88742 90043 gene locus_tag LOCUS_09130 88742 90043 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787705.1 protein_id gnl|my_center|LOCUS_09130 90050 91183 gene locus_tag LOCUS_09140 90050 91183 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390206.1 protein_id gnl|my_center|LOCUS_09140 93016 91334 gene locus_tag LOCUS_09150 93016 91334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 93366 93073 gene locus_tag LOCUS_09160 93366 93073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 93516 94610 gene locus_tag LOCUS_09170 gene ychF 93516 94610 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_09170 95013 94690 gene locus_tag LOCUS_09180 95013 94690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 95144 96856 gene locus_tag LOCUS_09190 95144 96856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 96951 98279 gene locus_tag LOCUS_09200 96951 98279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 98313 99074 gene locus_tag LOCUS_09210 98313 99074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 100132 99281 gene locus_tag LOCUS_09220 100132 99281 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_09220 100801 100250 gene locus_tag LOCUS_09230 100801 100250 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228042.1 protein_id gnl|my_center|LOCUS_09230 101423 100884 gene locus_tag LOCUS_09240 101423 100884 CDS product TIGR04002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888217.1 protein_id gnl|my_center|LOCUS_09240 102887 101511 gene locus_tag LOCUS_09250 102887 101511 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108266.1 protein_id gnl|my_center|LOCUS_09250 104206 103028 gene locus_tag LOCUS_09260 gene alr 104206 103028 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_09260 104576 106396 gene locus_tag LOCUS_09270 gene typA 104576 106396 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_09270 106510 107316 gene locus_tag LOCUS_09280 106510 107316 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_09280 107547 109208 gene locus_tag LOCUS_09290 107547 109208 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_09290 109213 110877 gene locus_tag LOCUS_09300 109213 110877 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_09300 110925 111575 gene locus_tag LOCUS_09310 110925 111575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 111884 112477 gene locus_tag LOCUS_09320 111884 112477 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_09320 112474 113898 gene locus_tag LOCUS_09330 112474 113898 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930806.1 protein_id gnl|my_center|LOCUS_09330 114696 114043 gene locus_tag LOCUS_09340 114696 114043 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742110.1 protein_id gnl|my_center|LOCUS_09340 115801 114989 gene locus_tag LOCUS_09350 115801 114989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 116855 115845 gene locus_tag LOCUS_09360 116855 115845 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 protein_id gnl|my_center|LOCUS_09360 117727 116858 gene locus_tag LOCUS_09370 117727 116858 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_09370 119096 117834 gene locus_tag LOCUS_09380 119096 117834 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086334.1 protein_id gnl|my_center|LOCUS_09380 119881 119114 gene locus_tag LOCUS_09390 119881 119114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 120164 119922 gene locus_tag LOCUS_09400 120164 119922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 121915 120584 gene locus_tag LOCUS_09410 gene glnA 121915 120584 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392808.1 protein_id gnl|my_center|LOCUS_09410 123386 122124 gene locus_tag LOCUS_09420 123386 122124 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_09420 123664 124161 gene locus_tag LOCUS_09430 123664 124161 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_09430 124194 125048 gene locus_tag LOCUS_09440 124194 125048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 125045 126433 gene locus_tag LOCUS_09450 125045 126433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074554.1 protein_id gnl|my_center|LOCUS_09450 126450 128645 gene locus_tag LOCUS_09460 126450 128645 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462224.1 protein_id gnl|my_center|LOCUS_09460 128840 129505 gene locus_tag LOCUS_09470 128840 129505 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_09470 129536 130555 gene locus_tag LOCUS_09480 129536 130555 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_09480 130737 131504 gene locus_tag LOCUS_09490 130737 131504 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_09490 131494 133515 gene locus_tag LOCUS_09500 131494 133515 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986650.1 protein_id gnl|my_center|LOCUS_09500 133549 134031 gene locus_tag LOCUS_09510 133549 134031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 134447 135154 gene locus_tag LOCUS_09520 134447 135154 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_09520 135176 136486 gene locus_tag LOCUS_09530 135176 136486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 136682 139285 gene locus_tag LOCUS_09540 136682 139285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 139957 139361 gene locus_tag LOCUS_09550 139957 139361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 141048 140185 gene locus_tag LOCUS_09560 141048 140185 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049769562.1 protein_id gnl|my_center|LOCUS_09560 142722 141337 gene locus_tag LOCUS_09570 142722 141337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 144495 143320 gene locus_tag LOCUS_09580 144495 143320 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_09580 145046 145414 gene locus_tag LOCUS_09590 145046 145414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 146111 145398 gene locus_tag LOCUS_09600 146111 145398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 146355 146164 gene locus_tag LOCUS_09610 146355 146164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 147208 146477 gene locus_tag LOCUS_09620 147208 146477 CDS product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090697.1 protein_id gnl|my_center|LOCUS_09620 147383 147610 gene locus_tag LOCUS_09630 147383 147610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 147617 147808 gene locus_tag LOCUS_09640 147617 147808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 148047 147841 gene locus_tag LOCUS_09650 148047 147841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 148046 148300 gene locus_tag LOCUS_09660 148046 148300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 148558 148229 gene locus_tag LOCUS_09670 148558 148229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 148633 148920 gene locus_tag LOCUS_09680 148633 148920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 148917 149147 gene locus_tag LOCUS_09690 148917 149147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 149147 149290 gene locus_tag LOCUS_09700 149147 149290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 149287 149676 gene locus_tag LOCUS_09710 149287 149676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 149891 150133 gene locus_tag LOCUS_09720 149891 150133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 150147 150467 gene locus_tag LOCUS_09730 150147 150467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 150471 150836 gene locus_tag LOCUS_09740 150471 150836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 150981 151175 gene locus_tag LOCUS_09750 150981 151175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 151165 151392 gene locus_tag LOCUS_09760 151165 151392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 >Feature sequence07 1139 396 gene locus_tag LOCUS_09770 1139 396 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184185.1 protein_id gnl|my_center|LOCUS_09770 2178 1174 gene locus_tag LOCUS_09780 2178 1174 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461831.1 protein_id gnl|my_center|LOCUS_09780 2990 2220 gene locus_tag LOCUS_09790 2990 2220 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461832.1 protein_id gnl|my_center|LOCUS_09790 3249 2959 gene locus_tag LOCUS_09800 3249 2959 CDS product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461833.1 protein_id gnl|my_center|LOCUS_09800 3699 4400 gene locus_tag LOCUS_09810 gene sigI 3699 4400 CDS product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965076.1 protein_id gnl|my_center|LOCUS_09810 4397 5983 gene locus_tag LOCUS_09820 4397 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 6197 7606 gene locus_tag LOCUS_09830 6197 7606 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053727.1 protein_id gnl|my_center|LOCUS_09830 8289 7702 gene locus_tag LOCUS_09840 8289 7702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 9228 8350 gene locus_tag LOCUS_09850 9228 8350 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_09850 10221 10131 gene locus_tag LOCUS_t00110 10221 10131 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10372 10284 gene locus_tag LOCUS_t00120 10372 10284 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10815 10501 gene locus_tag LOCUS_09860 10815 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 10993 12228 gene locus_tag LOCUS_09870 10993 12228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 12796 12281 gene locus_tag LOCUS_09880 12796 12281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 13512 12937 gene locus_tag LOCUS_09890 13512 12937 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865105.1 protein_id gnl|my_center|LOCUS_09890 13679 14284 gene locus_tag LOCUS_09900 13679 14284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 17618 14376 gene locus_tag LOCUS_09910 17618 14376 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201938.1 protein_id gnl|my_center|LOCUS_09910 19799 17865 gene locus_tag LOCUS_09920 19799 17865 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964368.1 protein_id gnl|my_center|LOCUS_09920 20166 19984 gene locus_tag LOCUS_09930 20166 19984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 21653 20208 gene locus_tag LOCUS_09940 21653 20208 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974991.1 protein_id gnl|my_center|LOCUS_09940 22055 26016 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccacgcacccgcgtggggtgcgac 26497 26207 gene locus_tag LOCUS_09950 gene cas2 26497 26207 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989044.1 protein_id gnl|my_center|LOCUS_09950 27613 26582 gene locus_tag LOCUS_09960 gene cas1c 27613 26582 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_09960 28293 27610 gene locus_tag LOCUS_09970 gene cas4 28293 27610 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_09970 29180 28296 gene locus_tag LOCUS_09980 gene cas7c 29180 28296 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_09980 30962 29181 gene locus_tag LOCUS_09990 gene cas8c 30962 29181 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176708.1 protein_id gnl|my_center|LOCUS_09990 31618 30959 gene locus_tag LOCUS_10000 gene cas5c 31618 30959 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176707.1 protein_id gnl|my_center|LOCUS_10000 31897 31652 gene locus_tag LOCUS_10010 31897 31652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 33810 32002 gene locus_tag LOCUS_10020 33810 32002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10020 34642 34073 gene locus_tag LOCUS_10030 34642 34073 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851996.1 protein_id gnl|my_center|LOCUS_10030 35160 34909 gene locus_tag LOCUS_10040 35160 34909 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965244.1 protein_id gnl|my_center|LOCUS_10040 35394 35984 gene locus_tag LOCUS_10050 35394 35984 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811072.1 protein_id gnl|my_center|LOCUS_10050 36018 36542 gene locus_tag LOCUS_10060 36018 36542 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947935.1 protein_id gnl|my_center|LOCUS_10060 36708 37529 gene locus_tag LOCUS_10070 36708 37529 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047707.1 protein_id gnl|my_center|LOCUS_10070 37628 38311 gene locus_tag LOCUS_10080 37628 38311 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_10080 38298 39020 gene locus_tag LOCUS_10090 38298 39020 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986547.1 protein_id gnl|my_center|LOCUS_10090 39674 39123 gene locus_tag LOCUS_10100 39674 39123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 39890 40282 gene locus_tag LOCUS_10110 39890 40282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 40870 40989 gene locus_tag LOCUS_10120 40870 40989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 41035 41184 gene locus_tag LOCUS_10130 41035 41184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 41842 41195 gene locus_tag LOCUS_10140 41842 41195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 42320 41835 gene locus_tag LOCUS_10150 42320 41835 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459411.1 protein_id gnl|my_center|LOCUS_10150 43448 42465 gene locus_tag LOCUS_10160 43448 42465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 44487 43525 gene locus_tag LOCUS_10170 44487 43525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 45038 44556 gene locus_tag LOCUS_10180 45038 44556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 45570 46079 gene locus_tag LOCUS_10190 45570 46079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 46089 46715 gene locus_tag LOCUS_10200 46089 46715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 48590 46845 gene locus_tag LOCUS_10210 48590 46845 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681003.1 protein_id gnl|my_center|LOCUS_10210 49041 48637 gene locus_tag LOCUS_10220 49041 48637 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582450.1 protein_id gnl|my_center|LOCUS_10220 50301 49057 gene locus_tag LOCUS_10230 50301 49057 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680998.1 protein_id gnl|my_center|LOCUS_10230 52131 50419 gene locus_tag LOCUS_10240 52131 50419 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971525.1 protein_id gnl|my_center|LOCUS_10240 52198 52350 gene locus_tag LOCUS_10250 52198 52350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 52352 53842 gene locus_tag LOCUS_10260 52352 53842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 53882 54613 gene locus_tag LOCUS_10270 53882 54613 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014894892.1 protein_id gnl|my_center|LOCUS_10270 54665 56032 gene locus_tag LOCUS_10280 54665 56032 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108604.1 protein_id gnl|my_center|LOCUS_10280 56189 58000 gene locus_tag LOCUS_10290 56189 58000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 58226 58579 gene locus_tag LOCUS_10300 gene spoVAE 58226 58579 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811048.1 protein_id gnl|my_center|LOCUS_10300 58838 59503 gene locus_tag LOCUS_10310 58838 59503 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_10310 59500 60345 gene locus_tag LOCUS_10320 59500 60345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 60230 61849 gene locus_tag LOCUS_10330 60230 61849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 62136 63572 gene locus_tag LOCUS_10340 gene proS 62136 63572 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450718.1 protein_id gnl|my_center|LOCUS_10340 63723 64418 gene locus_tag LOCUS_10350 63723 64418 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861224.1 protein_id gnl|my_center|LOCUS_10350 64523 66184 gene locus_tag LOCUS_10360 gene malL 64523 66184 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_10360 66209 67216 gene locus_tag LOCUS_10370 66209 67216 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434897.1 protein_id gnl|my_center|LOCUS_10370 67261 68037 gene locus_tag LOCUS_10380 gene tam 67261 68037 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286597.1 protein_id gnl|my_center|LOCUS_10380 68150 68791 gene locus_tag LOCUS_10390 gene ytaF 68150 68791 CDS product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861469.1 protein_id gnl|my_center|LOCUS_10390 69523 68792 gene locus_tag LOCUS_10400 69523 68792 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129648.1 protein_id gnl|my_center|LOCUS_10400 71537 69795 gene locus_tag LOCUS_10410 71537 69795 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_10410 73348 71558 gene locus_tag LOCUS_10420 gene nuoF 73348 71558 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_10420 73736 73365 gene locus_tag LOCUS_10430 73736 73365 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_10430 74287 73733 gene locus_tag LOCUS_10440 74287 73733 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583282.1 protein_id gnl|my_center|LOCUS_10440 74788 74291 gene locus_tag LOCUS_10450 74788 74291 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082449.1 protein_id gnl|my_center|LOCUS_10450 75129 76580 gene locus_tag LOCUS_10460 75129 76580 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_10460 76592 77638 gene locus_tag LOCUS_10470 76592 77638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083206.1 protein_id gnl|my_center|LOCUS_10470 78230 77994 gene locus_tag LOCUS_10480 78230 77994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 78899 78657 gene locus_tag LOCUS_10490 78899 78657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 79138 78902 gene locus_tag LOCUS_10500 79138 78902 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359683.1 protein_id gnl|my_center|LOCUS_10500 80135 79485 gene locus_tag LOCUS_10510 80135 79485 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966256.1 protein_id gnl|my_center|LOCUS_10510 81284 80187 gene locus_tag LOCUS_10520 81284 80187 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_10520 82170 81319 gene locus_tag LOCUS_10530 82170 81319 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668002.1 protein_id gnl|my_center|LOCUS_10530 83266 82205 gene locus_tag LOCUS_10540 gene uxuA 83266 82205 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082566.1 protein_id gnl|my_center|LOCUS_10540 84318 83296 gene locus_tag LOCUS_10550 84318 83296 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095327.1 protein_id gnl|my_center|LOCUS_10550 85528 84353 gene locus_tag LOCUS_10560 85528 84353 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_10560 86423 85557 gene locus_tag LOCUS_10570 86423 85557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 86671 87384 gene locus_tag LOCUS_10580 86671 87384 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_10580 87381 88118 gene locus_tag LOCUS_10590 87381 88118 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680890.1 protein_id gnl|my_center|LOCUS_10590 88230 90068 gene locus_tag LOCUS_10600 88230 90068 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682372.1 protein_id gnl|my_center|LOCUS_10600 90061 91956 gene locus_tag LOCUS_10610 90061 91956 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680887.1 protein_id gnl|my_center|LOCUS_10610 92051 92206 gene locus_tag LOCUS_10620 92051 92206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 93787 92324 gene locus_tag LOCUS_10630 93787 92324 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949007.1 protein_id gnl|my_center|LOCUS_10630 94419 94667 gene locus_tag LOCUS_10640 94419 94667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 94945 97221 gene locus_tag LOCUS_10650 94945 97221 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107432.1 protein_id gnl|my_center|LOCUS_10650 97299 97574 gene locus_tag LOCUS_10660 97299 97574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 97703 97969 gene locus_tag LOCUS_10670 97703 97969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 100442 98055 gene locus_tag LOCUS_10680 100442 98055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 102010 102675 gene locus_tag LOCUS_10690 gene rpe 102010 102675 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_10690 103254 102676 gene locus_tag LOCUS_10700 103254 102676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 103525 104412 gene locus_tag LOCUS_10710 103525 104412 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339118.1 protein_id gnl|my_center|LOCUS_10710 104405 105619 gene locus_tag LOCUS_10720 104405 105619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 105616 106209 gene locus_tag LOCUS_10730 105616 106209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 106281 107555 gene locus_tag LOCUS_10740 106281 107555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 108082 107678 gene locus_tag LOCUS_10750 gene mgsA 108082 107678 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_10750 108888 108154 gene locus_tag LOCUS_10760 gene minD 108888 108154 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016205.1 protein_id gnl|my_center|LOCUS_10760 110986 108914 gene locus_tag LOCUS_10770 110986 108914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 111693 111142 gene locus_tag LOCUS_10780 111693 111142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 112621 111740 gene locus_tag LOCUS_10790 gene mreC 112621 111740 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964556.1 protein_id gnl|my_center|LOCUS_10790 113685 112669 gene locus_tag LOCUS_10800 113685 112669 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_10800 114462 113878 gene locus_tag LOCUS_10810 114462 113878 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_10810 115000 114563 gene locus_tag LOCUS_10820 gene dut 115000 114563 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808844.1 protein_id gnl|my_center|LOCUS_10820 117216 115150 gene locus_tag LOCUS_10830 117216 115150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 117578 117219 gene locus_tag LOCUS_10840 117578 117219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 117971 120379 gene locus_tag LOCUS_10850 117971 120379 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141000.1 protein_id gnl|my_center|LOCUS_10850 120596 121066 gene locus_tag LOCUS_10860 120596 121066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 121068 122810 gene locus_tag LOCUS_10870 121068 122810 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143661.1 protein_id gnl|my_center|LOCUS_10870 122800 124122 gene locus_tag LOCUS_10880 122800 124122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10880 124115 124450 gene locus_tag LOCUS_10890 124115 124450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10890 125803 124520 gene locus_tag LOCUS_10900 125803 124520 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054367.1 protein_id gnl|my_center|LOCUS_10900 126477 127043 gene locus_tag LOCUS_10910 126477 127043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10910 126991 127401 gene locus_tag LOCUS_10920 126991 127401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10920 127401 127670 gene locus_tag LOCUS_10930 127401 127670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 127674 127805 gene locus_tag LOCUS_10940 127674 127805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 128285 128440 gene locus_tag LOCUS_10950 128285 128440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 128498 129154 gene locus_tag LOCUS_10960 128498 129154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 129151 129330 gene locus_tag LOCUS_10970 129151 129330 CDS product cysteine-rich KTR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012962334.1 protein_id gnl|my_center|LOCUS_10970 129340 130419 gene locus_tag LOCUS_10980 gene rsgA 129340 130419 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861937.1 protein_id gnl|my_center|LOCUS_10980 130425 131141 gene locus_tag LOCUS_10990 130425 131141 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439170.1 protein_id gnl|my_center|LOCUS_10990 131653 133608 gene locus_tag LOCUS_11000 131653 133608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 133634 134122 gene locus_tag LOCUS_11010 133634 134122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11010 134444 135343 gene locus_tag LOCUS_11020 134444 135343 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018365292.1 protein_id gnl|my_center|LOCUS_11020 135398 136009 gene locus_tag LOCUS_11030 135398 136009 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267179.1 protein_id gnl|my_center|LOCUS_11030 136029 136442 gene locus_tag LOCUS_11040 136029 136442 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022471380.1 protein_id gnl|my_center|LOCUS_11040 136502 136966 gene locus_tag LOCUS_11050 136502 136966 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888463.1 protein_id gnl|my_center|LOCUS_11050 136999 137340 gene locus_tag LOCUS_11060 136999 137340 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032497467.1 protein_id gnl|my_center|LOCUS_11060 137456 137620 gene locus_tag LOCUS_11070 137456 137620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 137640 138281 gene locus_tag LOCUS_11080 gene catA 137640 138281 CDS product type A chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986550.1 protein_id gnl|my_center|LOCUS_11080 138318 138866 gene locus_tag LOCUS_11090 138318 138866 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458874.1 protein_id gnl|my_center|LOCUS_11090 139488 139342 gene locus_tag LOCUS_11100 139488 139342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 139477 139638 gene locus_tag LOCUS_11110 139477 139638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 139964 140521 gene locus_tag LOCUS_11120 139964 140521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 140643 140969 gene locus_tag LOCUS_11130 140643 140969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 140966 141136 gene locus_tag LOCUS_11140 140966 141136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 141133 141564 gene locus_tag LOCUS_11150 141133 141564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 141561 141899 gene locus_tag LOCUS_11160 141561 141899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 142027 142188 gene locus_tag LOCUS_11170 142027 142188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 143249 142167 gene locus_tag LOCUS_11180 143249 142167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 143531 143364 gene locus_tag LOCUS_11190 143531 143364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 144099 144025 gene locus_tag LOCUS_t00130 144099 144025 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 144707 144135 gene locus_tag LOCUS_11200 144707 144135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 145039 145341 gene locus_tag LOCUS_11210 145039 145341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 145365 146312 gene locus_tag LOCUS_11220 145365 146312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 146330 146788 gene locus_tag LOCUS_11230 146330 146788 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656744.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence08 3587 1803 gene locus_tag LOCUS_11240 3587 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 5901 3589 gene locus_tag LOCUS_11250 5901 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 8031 5935 gene locus_tag LOCUS_11260 8031 5935 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_11260 9405 8056 gene locus_tag LOCUS_11270 9405 8056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 11127 9571 gene locus_tag LOCUS_11280 11127 9571 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_11280 12098 11124 gene locus_tag LOCUS_11290 12098 11124 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861263.1 protein_id gnl|my_center|LOCUS_11290 14122 12263 gene locus_tag LOCUS_11300 14122 12263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 14733 14119 gene locus_tag LOCUS_11310 14733 14119 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948833.1 protein_id gnl|my_center|LOCUS_11310 17185 15041 gene locus_tag LOCUS_11320 17185 15041 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109145.1 protein_id gnl|my_center|LOCUS_11320 17562 17960 gene locus_tag LOCUS_11330 17562 17960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 17957 18406 gene locus_tag LOCUS_11340 17957 18406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11340 19100 18510 gene locus_tag LOCUS_11350 19100 18510 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434301.1 protein_id gnl|my_center|LOCUS_11350 19778 19149 gene locus_tag LOCUS_11360 gene fmnP 19778 19149 CDS product riboflavin transporter FmnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399159.1 protein_id gnl|my_center|LOCUS_11360 22003 20090 gene locus_tag LOCUS_11370 22003 20090 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_11370 24732 22168 gene locus_tag LOCUS_11380 24732 22168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 30497 25035 gene locus_tag LOCUS_11390 30497 25035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 30968 30765 gene locus_tag LOCUS_11400 30968 30765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 32310 31105 gene locus_tag LOCUS_11410 gene ftsZ 32310 31105 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965000.1 protein_id gnl|my_center|LOCUS_11410 33497 32517 gene locus_tag LOCUS_11420 33497 32517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 34755 33475 gene locus_tag LOCUS_11430 gene murA 34755 33475 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420721.1 protein_id gnl|my_center|LOCUS_11430 36010 34886 gene locus_tag LOCUS_11440 gene murG 36010 34886 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460696.1 protein_id gnl|my_center|LOCUS_11440 37347 36070 gene locus_tag LOCUS_11450 gene spoVE 37347 36070 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753520.1 protein_id gnl|my_center|LOCUS_11450 38422 37385 gene locus_tag LOCUS_11460 gene mraY 38422 37385 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965426.1 protein_id gnl|my_center|LOCUS_11460 39780 38419 gene locus_tag LOCUS_11470 39780 38419 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272578.1 protein_id gnl|my_center|LOCUS_11470 41245 39800 gene locus_tag LOCUS_11480 41245 39800 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_11480 43789 41495 gene locus_tag LOCUS_11490 43789 41495 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_11490 44631 43984 gene locus_tag LOCUS_11500 44631 43984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 45628 44696 gene locus_tag LOCUS_11510 gene rsmH 45628 44696 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_11510 46239 45679 gene locus_tag LOCUS_11520 46239 45679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 47519 46704 gene locus_tag LOCUS_11530 47519 46704 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582683.1 protein_id gnl|my_center|LOCUS_11530 47782 48837 gene locus_tag LOCUS_11540 47782 48837 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393885.1 protein_id gnl|my_center|LOCUS_11540 48917 50008 gene locus_tag LOCUS_11550 gene alr 48917 50008 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_11550 50213 50088 gene locus_tag LOCUS_11560 50213 50088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 51040 50543 gene locus_tag LOCUS_11570 gene greA 51040 50543 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422204.1 protein_id gnl|my_center|LOCUS_11570 51914 51165 gene locus_tag LOCUS_11580 51914 51165 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969220.1 protein_id gnl|my_center|LOCUS_11580 52926 51928 gene locus_tag LOCUS_11590 52926 51928 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227186.1 protein_id gnl|my_center|LOCUS_11590 53688 52960 gene locus_tag LOCUS_11600 53688 52960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 53804 54232 gene locus_tag LOCUS_11610 53804 54232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 54229 56082 gene locus_tag LOCUS_11620 54229 56082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 58606 56165 gene locus_tag LOCUS_11630 58606 56165 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582697.1 protein_id gnl|my_center|LOCUS_11630 59278 58727 gene locus_tag LOCUS_11640 59278 58727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 59750 61588 gene locus_tag LOCUS_11650 59750 61588 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680888.1 protein_id gnl|my_center|LOCUS_11650 61695 63524 gene locus_tag LOCUS_11660 61695 63524 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671827.1 protein_id gnl|my_center|LOCUS_11660 64069 63728 gene locus_tag LOCUS_11670 64069 63728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 64285 64085 gene locus_tag LOCUS_11680 64285 64085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 64450 64791 gene locus_tag LOCUS_11690 64450 64791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 65044 67749 gene locus_tag LOCUS_11700 65044 67749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 67873 69675 gene locus_tag LOCUS_11710 67873 69675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 70142 70990 gene locus_tag LOCUS_11720 70142 70990 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828081.1 protein_id gnl|my_center|LOCUS_11720 70987 71697 gene locus_tag LOCUS_11730 70987 71697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 73687 71906 gene locus_tag LOCUS_11740 73687 71906 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_11740 74896 73889 gene locus_tag LOCUS_11750 gene tsaD 74896 73889 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_11750 76556 74934 gene locus_tag LOCUS_11760 76556 74934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990774.1 protein_id gnl|my_center|LOCUS_11760 77268 76549 gene locus_tag LOCUS_11770 77268 76549 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021134.1 protein_id gnl|my_center|LOCUS_11770 77726 77283 gene locus_tag LOCUS_11780 gene rimI 77726 77283 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966125.1 protein_id gnl|my_center|LOCUS_11780 78623 77739 gene locus_tag LOCUS_11790 78623 77739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 81239 78630 gene locus_tag LOCUS_11800 gene polA 81239 78630 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393341.1 protein_id gnl|my_center|LOCUS_11800 82703 81825 gene locus_tag LOCUS_11810 82703 81825 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810616.1 protein_id gnl|my_center|LOCUS_11810 85382 82857 gene locus_tag LOCUS_11820 85382 82857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 86130 85654 gene locus_tag LOCUS_11830 86130 85654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 90201 87625 gene locus_tag LOCUS_11840 90201 87625 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107276.1 protein_id gnl|my_center|LOCUS_11840 91521 90247 gene locus_tag LOCUS_11850 91521 90247 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625279.1 protein_id gnl|my_center|LOCUS_11850 91698 92633 gene locus_tag LOCUS_11860 91698 92633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 93569 92943 gene locus_tag LOCUS_11870 93569 92943 CDS product RecX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404862.1 protein_id gnl|my_center|LOCUS_11870 94705 93566 gene locus_tag LOCUS_11880 gene recA 94705 93566 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_11880 95304 95071 gene locus_tag LOCUS_11890 95304 95071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 96129 95461 gene locus_tag LOCUS_11900 96129 95461 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891221.1 protein_id gnl|my_center|LOCUS_11900 97517 96144 gene locus_tag LOCUS_11910 97517 96144 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422669.1 protein_id gnl|my_center|LOCUS_11910 99282 97519 gene locus_tag LOCUS_11920 99282 97519 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426762.1 protein_id gnl|my_center|LOCUS_11920 99737 99423 gene locus_tag LOCUS_11930 99737 99423 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367214.1 protein_id gnl|my_center|LOCUS_11930 100701 99730 gene locus_tag LOCUS_11940 100701 99730 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439726.1 protein_id gnl|my_center|LOCUS_11940 101325 100732 gene locus_tag LOCUS_11950 101325 100732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 101862 101392 gene locus_tag LOCUS_11960 101862 101392 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_11960 103974 101992 gene locus_tag LOCUS_11970 103974 101992 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898067.1 protein_id gnl|my_center|LOCUS_11970 104311 103961 gene locus_tag LOCUS_11980 104311 103961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 104535 105089 gene locus_tag LOCUS_11990 104535 105089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 106234 105413 gene locus_tag LOCUS_12000 106234 105413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 108118 106436 gene locus_tag LOCUS_12010 108118 106436 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777117.1 protein_id gnl|my_center|LOCUS_12010 108360 109067 gene locus_tag LOCUS_12020 108360 109067 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989603.1 protein_id gnl|my_center|LOCUS_12020 109488 110867 gene locus_tag LOCUS_12030 109488 110867 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_12030 110886 111353 gene locus_tag LOCUS_12040 110886 111353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 111369 111797 gene locus_tag LOCUS_12050 111369 111797 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_12050 111814 112959 gene locus_tag LOCUS_12060 111814 112959 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_12060 114309 113080 gene locus_tag LOCUS_12070 114309 113080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 117047 114405 gene locus_tag LOCUS_12080 117047 114405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 117786 117103 gene locus_tag LOCUS_12090 117786 117103 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861403.1 protein_id gnl|my_center|LOCUS_12090 118263 117916 gene locus_tag LOCUS_12100 118263 117916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 120236 118563 gene locus_tag LOCUS_12110 120236 118563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 121851 120457 gene locus_tag LOCUS_12120 121851 120457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 123285 121870 gene locus_tag LOCUS_12130 123285 121870 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_12130 123862 123401 gene locus_tag LOCUS_12140 123862 123401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 124317 125675 gene locus_tag LOCUS_12150 gene yeeO 124317 125675 CDS product toxic metabolite efflux MATE transporter YeeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943916.1 protein_id gnl|my_center|LOCUS_12150 127324 126329 gene locus_tag LOCUS_12160 127324 126329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 128492 127542 gene locus_tag LOCUS_12170 128492 127542 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_12170 128951 128520 gene locus_tag LOCUS_12180 128951 128520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 130248 128977 gene locus_tag LOCUS_12190 gene obgE 130248 128977 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_12190 130553 131527 gene locus_tag LOCUS_12200 130553 131527 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_12200 131514 132020 gene locus_tag LOCUS_12210 gene ybeY 131514 132020 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259163.1 protein_id gnl|my_center|LOCUS_12210 132126 132620 gene locus_tag LOCUS_12220 132126 132620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 132866 133759 gene locus_tag LOCUS_12230 gene era 132866 133759 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_12230 133785 134675 gene locus_tag LOCUS_12240 133785 134675 CDS product aminoglycoside 6-adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816862.1 protein_id gnl|my_center|LOCUS_12240 134812 134979 gene locus_tag LOCUS_12250 134812 134979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 134930 135670 gene locus_tag LOCUS_12260 134930 135670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 135748 138144 gene locus_tag LOCUS_12270 135748 138144 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048130.1 protein_id gnl|my_center|LOCUS_12270 139106 138546 gene locus_tag LOCUS_12280 139106 138546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12280 139730 139128 gene locus_tag LOCUS_12290 139730 139128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12290 140627 139851 gene locus_tag LOCUS_12300 140627 139851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 141212 140751 gene locus_tag LOCUS_12310 gene def 141212 140751 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986757.1 protein_id gnl|my_center|LOCUS_12310 <141837 141288 gene locus_tag LOCUS_12320 <141837 141288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813688.1:M23 family metallopeptidase >Feature sequence09 209 499 gene locus_tag LOCUS_12330 209 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 613 1440 gene locus_tag LOCUS_12340 613 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1629 1889 gene locus_tag LOCUS_12350 1629 1889 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_12350 1911 2276 gene locus_tag LOCUS_12360 1911 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 2269 2478 gene locus_tag LOCUS_12370 2269 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 2683 2534 gene locus_tag LOCUS_12380 2683 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 2973 2680 gene locus_tag LOCUS_12390 2973 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 3376 3101 gene locus_tag LOCUS_12400 3376 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 3772 3975 gene locus_tag LOCUS_12410 3772 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 4018 4860 gene locus_tag LOCUS_12420 gene dinD 4018 4860 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297973.1 protein_id gnl|my_center|LOCUS_12420 5839 5246 gene locus_tag LOCUS_12430 5839 5246 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002661.1 protein_id gnl|my_center|LOCUS_12430 6061 6888 gene locus_tag LOCUS_12440 gene rhaD 6061 6888 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924506.1 protein_id gnl|my_center|LOCUS_12440 7858 7100 gene locus_tag LOCUS_12450 7858 7100 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861832.1 protein_id gnl|my_center|LOCUS_12450 8466 8113 gene locus_tag LOCUS_12460 8466 8113 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440040.1 protein_id gnl|my_center|LOCUS_12460 9251 8478 gene locus_tag LOCUS_12470 9251 8478 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440042.1 protein_id gnl|my_center|LOCUS_12470 10777 9530 gene locus_tag LOCUS_12480 10777 9530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 11302 11000 gene locus_tag LOCUS_12490 11302 11000 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986755.1 protein_id gnl|my_center|LOCUS_12490 12300 11344 gene locus_tag LOCUS_12500 12300 11344 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_12500 12473 13414 gene locus_tag LOCUS_12510 12473 13414 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812829.1 protein_id gnl|my_center|LOCUS_12510 13777 13523 gene locus_tag LOCUS_12520 13777 13523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 14873 13950 gene locus_tag LOCUS_12530 14873 13950 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860715.1 protein_id gnl|my_center|LOCUS_12530 16698 15526 gene locus_tag LOCUS_12540 16698 15526 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_12540 17935 16826 gene locus_tag LOCUS_12550 17935 16826 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_12550 19594 18017 gene locus_tag LOCUS_12560 gene glpK 19594 18017 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_12560 21670 19937 gene locus_tag LOCUS_12570 21670 19937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 21897 23093 gene locus_tag LOCUS_12580 21897 23093 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966091.1 protein_id gnl|my_center|LOCUS_12580 23293 23090 gene locus_tag LOCUS_12590 23293 23090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 23808 23290 gene locus_tag LOCUS_12600 23808 23290 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965853.1 protein_id gnl|my_center|LOCUS_12600 24269 25771 gene locus_tag LOCUS_12610 24269 25771 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456609.1 protein_id gnl|my_center|LOCUS_12610 27500 25902 gene locus_tag LOCUS_12620 27500 25902 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095406.1 protein_id gnl|my_center|LOCUS_12620 28061 27546 gene locus_tag LOCUS_12630 28061 27546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 28577 29497 gene locus_tag LOCUS_12640 gene prmA 28577 29497 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385115.1 protein_id gnl|my_center|LOCUS_12640 29737 30171 gene locus_tag LOCUS_12650 29737 30171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 30959 30291 gene locus_tag LOCUS_12660 30959 30291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 31995 30997 gene locus_tag LOCUS_12670 31995 30997 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932715.1 protein_id gnl|my_center|LOCUS_12670 32907 32032 gene locus_tag LOCUS_12680 32907 32032 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766237.1 protein_id gnl|my_center|LOCUS_12680 33252 34535 gene locus_tag LOCUS_12690 33252 34535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 34917 34690 gene locus_tag LOCUS_12700 34917 34690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 35322 35693 gene locus_tag LOCUS_12710 35322 35693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 35690 37357 gene locus_tag LOCUS_12720 gene ilvB 35690 37357 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938671.1 protein_id gnl|my_center|LOCUS_12720 37396 37923 gene locus_tag LOCUS_12730 gene ilvN 37396 37923 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212817.1 protein_id gnl|my_center|LOCUS_12730 38063 39682 gene locus_tag LOCUS_12740 gene cimA 38063 39682 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966451.1 protein_id gnl|my_center|LOCUS_12740 39697 40956 gene locus_tag LOCUS_12750 gene leuC 39697 40956 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_12750 40980 41465 gene locus_tag LOCUS_12760 gene leuD 40980 41465 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_12760 41694 43436 gene locus_tag LOCUS_12770 41694 43436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 43668 44357 gene locus_tag LOCUS_12780 43668 44357 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966496.1 protein_id gnl|my_center|LOCUS_12780 44485 45999 gene locus_tag LOCUS_12790 44485 45999 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966495.1 protein_id gnl|my_center|LOCUS_12790 46121 47626 gene locus_tag LOCUS_12800 46121 47626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 48138 47752 gene locus_tag LOCUS_12810 48138 47752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 49445 48195 gene locus_tag LOCUS_12820 gene hflX 49445 48195 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224262.1 protein_id gnl|my_center|LOCUS_12820 49715 50635 gene locus_tag LOCUS_12830 gene nadA 49715 50635 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454668.1 protein_id gnl|my_center|LOCUS_12830 50666 52135 gene locus_tag LOCUS_12840 gene nadB 50666 52135 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870479.1 protein_id gnl|my_center|LOCUS_12840 52192 53049 gene locus_tag LOCUS_12850 gene nadC 52192 53049 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_12850 54566 53166 gene locus_tag LOCUS_12860 gene cls 54566 53166 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243311.1 protein_id gnl|my_center|LOCUS_12860 55481 54687 gene locus_tag LOCUS_12870 55481 54687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 56766 55522 gene locus_tag LOCUS_12880 56766 55522 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_12880 57560 56763 gene locus_tag LOCUS_12890 gene proB 57560 56763 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_12890 57955 58365 gene locus_tag LOCUS_12900 57955 58365 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_12900 58362 60473 gene locus_tag LOCUS_12910 58362 60473 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 protein_id gnl|my_center|LOCUS_12910 60688 61260 gene locus_tag LOCUS_12920 60688 61260 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869257.1 protein_id gnl|my_center|LOCUS_12920 62263 61265 gene locus_tag LOCUS_12930 gene spoIID 62263 61265 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243408.1 protein_id gnl|my_center|LOCUS_12930 62414 63829 gene locus_tag LOCUS_12940 62414 63829 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_12940 63973 64887 gene locus_tag LOCUS_12950 63973 64887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 64964 65890 gene locus_tag LOCUS_12960 64964 65890 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966232.1 protein_id gnl|my_center|LOCUS_12960 65927 66787 gene locus_tag LOCUS_12970 gene queG 65927 66787 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438992.1 protein_id gnl|my_center|LOCUS_12970 66784 68124 gene locus_tag LOCUS_12980 66784 68124 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808143.1 protein_id gnl|my_center|LOCUS_12980 68219 68542 gene locus_tag LOCUS_12990 68219 68542 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631989.1 protein_id gnl|my_center|LOCUS_12990 68557 69444 gene locus_tag LOCUS_13000 68557 69444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 69475 70338 gene locus_tag LOCUS_13010 69475 70338 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_13010 70930 70442 gene locus_tag LOCUS_13020 70930 70442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 71204 73423 gene locus_tag LOCUS_13030 71204 73423 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 protein_id gnl|my_center|LOCUS_13030 73420 75279 gene locus_tag LOCUS_13040 73420 75279 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_13040 75923 75393 gene locus_tag LOCUS_13050 75923 75393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 76474 77733 gene locus_tag LOCUS_13060 76474 77733 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_13060 77773 78555 gene locus_tag LOCUS_13070 77773 78555 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582599.1 protein_id gnl|my_center|LOCUS_13070 80140 78824 gene locus_tag LOCUS_13080 80140 78824 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427463.1 protein_id gnl|my_center|LOCUS_13080 82376 80346 gene locus_tag LOCUS_13090 82376 80346 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271984.1 protein_id gnl|my_center|LOCUS_13090 82909 82376 gene locus_tag LOCUS_13100 82909 82376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 83277 83107 gene locus_tag LOCUS_13110 83277 83107 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_13110 83598 84620 gene locus_tag LOCUS_13120 83598 84620 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141484866.1 protein_id gnl|my_center|LOCUS_13120 86245 85238 gene locus_tag LOCUS_13130 86245 85238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 86804 86196 gene locus_tag LOCUS_13140 86804 86196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 89998 87572 gene locus_tag LOCUS_13150 89998 87572 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_13150 90836 90165 gene locus_tag LOCUS_13160 90836 90165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 91386 91033 gene locus_tag LOCUS_13170 91386 91033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13170 91930 91346 gene locus_tag LOCUS_13180 91930 91346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13180 92750 91953 gene locus_tag LOCUS_13190 92750 91953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 93672 92743 gene locus_tag LOCUS_13200 93672 92743 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948486.1 protein_id gnl|my_center|LOCUS_13200 94523 93825 gene locus_tag LOCUS_13210 94523 93825 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948485.1 protein_id gnl|my_center|LOCUS_13210 94883 94653 gene locus_tag LOCUS_13220 94883 94653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 96035 94905 gene locus_tag LOCUS_13230 96035 94905 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991766.1 protein_id gnl|my_center|LOCUS_13230 96938 96255 gene locus_tag LOCUS_13240 96938 96255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 97784 96954 gene locus_tag LOCUS_13250 97784 96954 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_13250 98650 97784 gene locus_tag LOCUS_13260 98650 97784 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567523.1 protein_id gnl|my_center|LOCUS_13260 100115 98757 gene locus_tag LOCUS_13270 100115 98757 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_13270 100306 101424 gene locus_tag LOCUS_13280 gene ugpC 100306 101424 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861561.1 protein_id gnl|my_center|LOCUS_13280 101466 101693 gene locus_tag LOCUS_13290 101466 101693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 101863 102306 gene locus_tag LOCUS_13300 101863 102306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 102296 103066 gene locus_tag LOCUS_13310 102296 103066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 103637 104200 gene locus_tag LOCUS_13320 103637 104200 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_13320 104353 106128 gene locus_tag LOCUS_13330 104353 106128 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_13330 106296 106487 gene locus_tag LOCUS_13340 106296 106487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 108500 107031 gene locus_tag LOCUS_13350 108500 107031 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095406.1 protein_id gnl|my_center|LOCUS_13350 109907 108519 gene locus_tag LOCUS_13360 109907 108519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 111715 110234 gene locus_tag LOCUS_13370 111715 110234 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679112.1 protein_id gnl|my_center|LOCUS_13370 112827 111802 gene locus_tag LOCUS_13380 112827 111802 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948346.1 protein_id gnl|my_center|LOCUS_13380 112985 115147 gene locus_tag LOCUS_13390 112985 115147 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_13390 115152 116237 gene locus_tag LOCUS_13400 115152 116237 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_13400 120178 116360 gene locus_tag LOCUS_13410 120178 116360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 120520 123558 gene locus_tag LOCUS_13420 gene ebgA 120520 123558 CDS product beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706828.1 protein_id gnl|my_center|LOCUS_13420 123743 124618 gene locus_tag LOCUS_13430 123743 124618 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_13430 124825 125952 gene locus_tag LOCUS_13440 124825 125952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 126000 127346 gene locus_tag LOCUS_13450 126000 127346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 127336 128247 gene locus_tag LOCUS_13460 gene pstA 127336 128247 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432350.1 protein_id gnl|my_center|LOCUS_13460 128283 129041 gene locus_tag LOCUS_13470 gene pstB 128283 129041 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_13470 129064 129744 gene locus_tag LOCUS_13480 gene phoU 129064 129744 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545517.1 protein_id gnl|my_center|LOCUS_13480 129962 132016 gene locus_tag LOCUS_13490 129962 132016 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620752.1 protein_id gnl|my_center|LOCUS_13490 132090 132275 gene locus_tag LOCUS_13500 132090 132275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 132347 133042 gene locus_tag LOCUS_13510 132347 133042 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_13510 133063 134781 gene locus_tag LOCUS_13520 133063 134781 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965008.1 protein_id gnl|my_center|LOCUS_13520 135426 135929 gene locus_tag LOCUS_13530 135426 135929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence10 457 182 gene locus_tag LOCUS_13540 457 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13540 1554 736 gene locus_tag LOCUS_13550 1554 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 2288 1620 gene locus_tag LOCUS_13560 2288 1620 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233736.1 protein_id gnl|my_center|LOCUS_13560 3001 2414 gene locus_tag LOCUS_13570 3001 2414 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443760.1 protein_id gnl|my_center|LOCUS_13570 3234 4922 gene locus_tag LOCUS_13580 3234 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 5013 5600 gene locus_tag LOCUS_13590 5013 5600 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943659.1 protein_id gnl|my_center|LOCUS_13590 5944 5720 gene locus_tag LOCUS_13600 5944 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 6319 5954 gene locus_tag LOCUS_13610 6319 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 7061 6348 gene locus_tag LOCUS_13620 7061 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 7485 8336 gene locus_tag LOCUS_13630 7485 8336 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230236.1 protein_id gnl|my_center|LOCUS_13630 8475 9779 gene locus_tag LOCUS_13640 8475 9779 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_13640 9822 10280 gene locus_tag LOCUS_13650 gene dtd 9822 10280 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173028.1 protein_id gnl|my_center|LOCUS_13650 10337 10993 gene locus_tag LOCUS_13660 10337 10993 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442291.1 protein_id gnl|my_center|LOCUS_13660 11034 12503 gene locus_tag LOCUS_13670 11034 12503 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_13670 12527 13456 gene locus_tag LOCUS_13680 12527 13456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 13558 13926 gene locus_tag LOCUS_13690 13558 13926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 14034 15833 gene locus_tag LOCUS_13700 gene spoVB 14034 15833 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812078.1 protein_id gnl|my_center|LOCUS_13700 15877 16686 gene locus_tag LOCUS_13710 15877 16686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 16743 17021 gene locus_tag LOCUS_13720 gene hbs 16743 17021 CDS product non-specific DNA-binding protein Hbs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153447.1 protein_id gnl|my_center|LOCUS_13720 17189 17431 gene locus_tag LOCUS_13730 17189 17431 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421412.1 protein_id gnl|my_center|LOCUS_13730 17554 19458 gene locus_tag LOCUS_13740 17554 19458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 20313 19522 gene locus_tag LOCUS_13750 20313 19522 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083383.1 protein_id gnl|my_center|LOCUS_13750 20589 23000 gene locus_tag LOCUS_13760 20589 23000 CDS product DUF6067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202412.1 protein_id gnl|my_center|LOCUS_13760 25472 23628 gene locus_tag LOCUS_13770 25472 23628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 26405 25476 gene locus_tag LOCUS_13780 26405 25476 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965621.1 protein_id gnl|my_center|LOCUS_13780 29108 26661 gene locus_tag LOCUS_13790 29108 26661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 29359 30225 gene locus_tag LOCUS_13800 gene metF 29359 30225 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_13800 30255 32633 gene locus_tag LOCUS_13810 30255 32633 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_13810 33608 32757 gene locus_tag LOCUS_13820 33608 32757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 33866 35314 gene locus_tag LOCUS_13830 33866 35314 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966721.1 protein_id gnl|my_center|LOCUS_13830 35369 36907 gene locus_tag LOCUS_13840 35369 36907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 37086 37451 gene locus_tag LOCUS_13850 37086 37451 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816592.1 protein_id gnl|my_center|LOCUS_13850 37451 38158 gene locus_tag LOCUS_13860 37451 38158 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_13860 38143 38970 gene locus_tag LOCUS_13870 38143 38970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816588.1 protein_id gnl|my_center|LOCUS_13870 39008 39139 gene locus_tag LOCUS_13880 39008 39139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 39349 41718 gene locus_tag LOCUS_13890 39349 41718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 42071 45184 gene locus_tag LOCUS_13900 42071 45184 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989870.1 protein_id gnl|my_center|LOCUS_13900 46076 45345 gene locus_tag LOCUS_13910 gene deoD 46076 45345 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_13910 46756 46091 gene locus_tag LOCUS_13920 gene deoC 46756 46091 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453154.1 protein_id gnl|my_center|LOCUS_13920 47848 46931 gene locus_tag LOCUS_13930 47848 46931 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966649.1 protein_id gnl|my_center|LOCUS_13930 48877 47960 gene locus_tag LOCUS_13940 48877 47960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 49165 49662 gene locus_tag LOCUS_13950 49165 49662 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_13950 52276 50624 gene locus_tag LOCUS_13960 52276 50624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 52592 52365 gene locus_tag LOCUS_13970 52592 52365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 52961 52620 gene locus_tag LOCUS_13980 52961 52620 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051599.1 protein_id gnl|my_center|LOCUS_13980 53147 55591 gene locus_tag LOCUS_13990 53147 55591 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_13990 55575 55814 gene locus_tag LOCUS_14000 55575 55814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 57788 55695 gene locus_tag LOCUS_14010 57788 55695 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048698132.1 protein_id gnl|my_center|LOCUS_14010 60793 57800 gene locus_tag LOCUS_14020 60793 57800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 61092 63716 gene locus_tag LOCUS_14030 61092 63716 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_14030 64383 64099 gene locus_tag LOCUS_14040 64383 64099 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595964.1 protein_id gnl|my_center|LOCUS_14040 64916 64422 gene locus_tag LOCUS_14050 64916 64422 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454674.1 protein_id gnl|my_center|LOCUS_14050 65046 65207 gene locus_tag LOCUS_14060 65046 65207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 65197 65529 gene locus_tag LOCUS_14070 65197 65529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 65593 66006 gene locus_tag LOCUS_14080 65593 66006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 66627 66025 gene locus_tag LOCUS_14090 66627 66025 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_14090 66890 68611 gene locus_tag LOCUS_14100 66890 68611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 68729 69052 gene locus_tag LOCUS_14110 68729 69052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 70280 69186 gene locus_tag LOCUS_14120 70280 69186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 70481 71377 gene locus_tag LOCUS_14130 70481 71377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 71391 71540 gene locus_tag LOCUS_14140 71391 71540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 71564 73129 gene locus_tag LOCUS_14150 71564 73129 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920215.1 protein_id gnl|my_center|LOCUS_14150 73126 74604 gene locus_tag LOCUS_14160 73126 74604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 74601 76040 gene locus_tag LOCUS_14170 74601 76040 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456609.1 protein_id gnl|my_center|LOCUS_14170 76057 78444 gene locus_tag LOCUS_14180 76057 78444 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582697.1 protein_id gnl|my_center|LOCUS_14180 78566 78658 gene locus_tag LOCUS_t00140 78566 78658 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 78870 79820 gene locus_tag LOCUS_14190 78870 79820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 81335 80763 gene locus_tag LOCUS_14200 81335 80763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 82315 81419 gene locus_tag LOCUS_14210 82315 81419 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_14210 82609 82824 gene locus_tag LOCUS_14220 82609 82824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 84124 83675 gene locus_tag LOCUS_14230 gene rnhA 84124 83675 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937992.1 protein_id gnl|my_center|LOCUS_14230 85410 84172 gene locus_tag LOCUS_14240 85410 84172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 85900 85400 gene locus_tag LOCUS_14250 85900 85400 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140187.1 protein_id gnl|my_center|LOCUS_14250 86135 88468 gene locus_tag LOCUS_14260 86135 88468 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966263.1 protein_id gnl|my_center|LOCUS_14260 88934 90742 gene locus_tag LOCUS_14270 88934 90742 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_14270 90786 92789 gene locus_tag LOCUS_14280 90786 92789 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_14280 92841 93137 gene locus_tag LOCUS_14290 92841 93137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 93232 94602 gene locus_tag LOCUS_14300 93232 94602 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966975.1 protein_id gnl|my_center|LOCUS_14300 94592 95953 gene locus_tag LOCUS_14310 gene tilS 94592 95953 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243704.1 protein_id gnl|my_center|LOCUS_14310 95956 96498 gene locus_tag LOCUS_14320 gene hpt 95956 96498 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966479.1 protein_id gnl|my_center|LOCUS_14320 96547 98553 gene locus_tag LOCUS_14330 gene ftsH 96547 98553 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_14330 98862 100853 gene locus_tag LOCUS_14340 gene gyrB 98862 100853 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_14340 100909 103152 gene locus_tag LOCUS_14350 gene gyrA 100909 103152 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656784.1 protein_id gnl|my_center|LOCUS_14350 103192 103986 gene locus_tag LOCUS_14360 103192 103986 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_14360 104332 104057 gene locus_tag LOCUS_14370 104332 104057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 104649 104347 gene locus_tag LOCUS_14380 104649 104347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 104964 104788 gene locus_tag LOCUS_14390 104964 104788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 105368 105189 gene locus_tag LOCUS_14400 105368 105189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 107336 105618 gene locus_tag LOCUS_14410 107336 105618 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392558.1 protein_id gnl|my_center|LOCUS_14410 107686 108081 gene locus_tag LOCUS_14420 107686 108081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 109044 108139 gene locus_tag LOCUS_14430 109044 108139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 109639 109100 gene locus_tag LOCUS_14440 109639 109100 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814019.1 protein_id gnl|my_center|LOCUS_14440 109855 110271 gene locus_tag LOCUS_14450 109855 110271 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_14450 110580 111479 gene locus_tag LOCUS_14460 110580 111479 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_14460 111454 113790 gene locus_tag LOCUS_14470 111454 113790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 113923 114297 gene locus_tag LOCUS_14480 gene ytrA 113923 114297 CDS product GntR family transcriptional regulator YtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229121.1 protein_id gnl|my_center|LOCUS_14480 114294 115193 gene locus_tag LOCUS_14490 114294 115193 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922156.1 protein_id gnl|my_center|LOCUS_14490 115227 117569 gene locus_tag LOCUS_14500 115227 117569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 118330 119316 gene locus_tag LOCUS_14510 118330 119316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 119951 121033 gene locus_tag LOCUS_14520 119951 121033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 121165 121632 gene locus_tag LOCUS_14530 121165 121632 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964672.1 protein_id gnl|my_center|LOCUS_14530 122405 121731 gene locus_tag LOCUS_14540 gene pyrE 122405 121731 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_14540 124140 122455 gene locus_tag LOCUS_14550 124140 122455 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_14550 125624 124278 gene locus_tag LOCUS_14560 125624 124278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 126006 126290 gene locus_tag LOCUS_14570 gene groES 126006 126290 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965991.1 protein_id gnl|my_center|LOCUS_14570 126334 127971 gene locus_tag LOCUS_14580 gene groL 126334 127971 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_14580 128913 128518 gene locus_tag LOCUS_14590 128913 128518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 129956 129036 gene locus_tag LOCUS_14600 129956 129036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 130495 129953 gene locus_tag LOCUS_14610 130495 129953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 >Feature sequence11 188 1717 gene locus_tag LOCUS_14620 188 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 2002 4233 gene locus_tag LOCUS_14630 2002 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 4536 4300 gene locus_tag LOCUS_14640 4536 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 6442 4613 gene locus_tag LOCUS_14650 6442 4613 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_14650 8396 6432 gene locus_tag LOCUS_14660 8396 6432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_14660 8611 8450 gene locus_tag LOCUS_14670 8611 8450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 9195 8980 gene locus_tag LOCUS_14680 9195 8980 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355647.1 protein_id gnl|my_center|LOCUS_14680 9662 9859 gene locus_tag LOCUS_14690 9662 9859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 10556 10035 gene locus_tag LOCUS_14700 10556 10035 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902046.1 protein_id gnl|my_center|LOCUS_14700 10877 12385 gene locus_tag LOCUS_14710 10877 12385 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837092.1 protein_id gnl|my_center|LOCUS_14710 12632 12763 gene locus_tag LOCUS_14720 12632 12763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 13179 13439 gene locus_tag LOCUS_14730 13179 13439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 14044 13736 gene locus_tag LOCUS_14740 14044 13736 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944876.1 protein_id gnl|my_center|LOCUS_14740 14921 14247 gene locus_tag LOCUS_14750 14921 14247 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878142.1 protein_id gnl|my_center|LOCUS_14750 15730 14918 gene locus_tag LOCUS_14760 15730 14918 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_14760 16745 15705 gene locus_tag LOCUS_14770 16745 15705 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_14770 17538 16831 gene locus_tag LOCUS_14780 17538 16831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 17961 17773 gene locus_tag LOCUS_14790 17961 17773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 18415 18155 gene locus_tag LOCUS_14800 gene rpsT 18415 18155 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_14800 18593 19486 gene locus_tag LOCUS_14810 gene gpr 18593 19486 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964587.1 protein_id gnl|my_center|LOCUS_14810 19618 20814 gene locus_tag LOCUS_14820 19618 20814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 20828 21166 gene locus_tag LOCUS_14830 20828 21166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 23879 21390 gene locus_tag LOCUS_14840 23879 21390 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391709.1 protein_id gnl|my_center|LOCUS_14840 24123 23914 gene locus_tag LOCUS_14850 24123 23914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 24282 24440 gene locus_tag LOCUS_14860 24282 24440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 24701 25600 gene locus_tag LOCUS_14870 24701 25600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 25626 26768 gene locus_tag LOCUS_14880 25626 26768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 26801 27343 gene locus_tag LOCUS_14890 gene folE 26801 27343 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429416.1 protein_id gnl|my_center|LOCUS_14890 27370 28233 gene locus_tag LOCUS_14900 gene folP 27370 28233 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438639.1 protein_id gnl|my_center|LOCUS_14900 28226 28594 gene locus_tag LOCUS_14910 gene folB 28226 28594 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759754.1 protein_id gnl|my_center|LOCUS_14910 28591 29082 gene locus_tag LOCUS_14920 gene folK 28591 29082 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733323.1 protein_id gnl|my_center|LOCUS_14920 29395 29171 gene locus_tag LOCUS_14930 29395 29171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 29441 29959 gene locus_tag LOCUS_14940 29441 29959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 29857 30063 gene locus_tag LOCUS_14950 29857 30063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 30139 30456 gene locus_tag LOCUS_14960 30139 30456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 31404 30535 gene locus_tag LOCUS_14970 31404 30535 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459581.1 protein_id gnl|my_center|LOCUS_14970 31956 31456 gene locus_tag LOCUS_14980 31956 31456 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814644.1 protein_id gnl|my_center|LOCUS_14980 32843 31995 gene locus_tag LOCUS_14990 32843 31995 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_14990 33123 33308 gene locus_tag LOCUS_15000 33123 33308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 33486 34553 gene locus_tag LOCUS_15010 33486 34553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 35567 34623 gene locus_tag LOCUS_15020 35567 34623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 36648 35623 gene locus_tag LOCUS_15030 36648 35623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 38487 36676 gene locus_tag LOCUS_15040 gene lepA 38487 36676 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_15040 38705 39589 gene locus_tag LOCUS_15050 38705 39589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 41407 39854 gene locus_tag LOCUS_15060 41407 39854 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147894.1 protein_id gnl|my_center|LOCUS_15060 42369 41635 gene locus_tag LOCUS_15070 42369 41635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 43134 42415 gene locus_tag LOCUS_15080 43134 42415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 44921 43317 gene locus_tag LOCUS_15090 44921 43317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 45180 46586 gene locus_tag LOCUS_15100 gene rmuC 45180 46586 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527474.1 protein_id gnl|my_center|LOCUS_15100 46617 47330 gene locus_tag LOCUS_15110 46617 47330 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460301.1 protein_id gnl|my_center|LOCUS_15110 47422 47757 gene locus_tag LOCUS_15120 gene azlD 47422 47757 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_15120 49119 47698 gene locus_tag LOCUS_15130 49119 47698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 49550 49116 gene locus_tag LOCUS_15140 49550 49116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 49716 50186 gene locus_tag LOCUS_15150 49716 50186 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966110.1 protein_id gnl|my_center|LOCUS_15150 50170 51606 gene locus_tag LOCUS_15160 50170 51606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 51629 52315 gene locus_tag LOCUS_15170 51629 52315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 52330 52647 gene locus_tag LOCUS_15180 52330 52647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 52644 53078 gene locus_tag LOCUS_15190 52644 53078 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942936.1 protein_id gnl|my_center|LOCUS_15190 54442 53147 gene locus_tag LOCUS_15200 54442 53147 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957028.1 protein_id gnl|my_center|LOCUS_15200 54667 54775 gene locus_tag LOCUS_r00010 54667 54775 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 55492 54854 gene locus_tag LOCUS_15210 55492 54854 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_15210 56044 56493 gene locus_tag LOCUS_15220 56044 56493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 56504 57097 gene locus_tag LOCUS_15230 gene lepB 56504 57097 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917214.1 protein_id gnl|my_center|LOCUS_15230 57111 61424 gene locus_tag LOCUS_15240 57111 61424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 61512 63020 gene locus_tag LOCUS_15250 61512 63020 CDS product isopeptide-forming domain-containing fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837257.1 protein_id gnl|my_center|LOCUS_15250 63126 63941 gene locus_tag LOCUS_15260 63126 63941 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775508.1 protein_id gnl|my_center|LOCUS_15260 63964 64719 gene locus_tag LOCUS_15270 63964 64719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 64706 65365 gene locus_tag LOCUS_15280 64706 65365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 65783 66553 gene locus_tag LOCUS_15290 65783 66553 CDS product DUF5058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680854.1 protein_id gnl|my_center|LOCUS_15290 66722 66567 gene locus_tag LOCUS_15300 66722 66567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 66742 67404 gene locus_tag LOCUS_15310 66742 67404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673400.1 protein_id gnl|my_center|LOCUS_15310 67634 68734 gene locus_tag LOCUS_15320 gene mnmA 67634 68734 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_15320 69627 69064 gene locus_tag LOCUS_15330 69627 69064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 70936 69620 gene locus_tag LOCUS_15340 gene murD 70936 69620 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989879.1 protein_id gnl|my_center|LOCUS_15340 72305 70917 gene locus_tag LOCUS_15350 gene murL 72305 70917 CDS product UDP-N-acetyl-alpha-D-muramoyl-L-alanyl-L-glutamate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 protein_id gnl|my_center|LOCUS_15350 74180 72513 gene locus_tag LOCUS_15360 74180 72513 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809743.1 protein_id gnl|my_center|LOCUS_15360 74315 75025 gene locus_tag LOCUS_15370 74315 75025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 75358 76509 gene locus_tag LOCUS_15380 75358 76509 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_15380 76789 77670 gene locus_tag LOCUS_15390 76789 77670 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626888.1 protein_id gnl|my_center|LOCUS_15390 77685 78704 gene locus_tag LOCUS_15400 77685 78704 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797307.1 protein_id gnl|my_center|LOCUS_15400 78709 79482 gene locus_tag LOCUS_15410 78709 79482 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_15410 79565 80278 gene locus_tag LOCUS_15420 79565 80278 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_15420 81867 80398 gene locus_tag LOCUS_15430 81867 80398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 83065 81953 gene locus_tag LOCUS_15440 83065 81953 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964085.1 protein_id gnl|my_center|LOCUS_15440 83792 83256 gene locus_tag LOCUS_15450 gene nrdG 83792 83256 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_15450 86143 83792 gene locus_tag LOCUS_15460 86143 83792 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459055.1 protein_id gnl|my_center|LOCUS_15460 86801 86352 gene locus_tag LOCUS_15470 86801 86352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 87022 88224 gene locus_tag LOCUS_15480 87022 88224 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199189.1 protein_id gnl|my_center|LOCUS_15480 88240 89652 gene locus_tag LOCUS_15490 gene pepV 88240 89652 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048281.1 protein_id gnl|my_center|LOCUS_15490 89664 90557 gene locus_tag LOCUS_15500 89664 90557 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066267.1 protein_id gnl|my_center|LOCUS_15500 90650 92305 gene locus_tag LOCUS_15510 90650 92305 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913630.1 protein_id gnl|my_center|LOCUS_15510 92302 92760 gene locus_tag LOCUS_15520 92302 92760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 93915 92911 gene locus_tag LOCUS_15530 93915 92911 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965559.1 protein_id gnl|my_center|LOCUS_15530 94421 93996 gene locus_tag LOCUS_15540 94421 93996 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877618.1 protein_id gnl|my_center|LOCUS_15540 96663 94492 gene locus_tag LOCUS_15550 96663 94492 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461496.1 protein_id gnl|my_center|LOCUS_15550 97512 96730 gene locus_tag LOCUS_15560 97512 96730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 98518 97541 gene locus_tag LOCUS_15570 98518 97541 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_15570 99635 98577 gene locus_tag LOCUS_15580 99635 98577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 101380 100133 gene locus_tag LOCUS_15590 101380 100133 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814996.1 protein_id gnl|my_center|LOCUS_15590 101992 102279 gene locus_tag LOCUS_15600 gene rpsF 101992 102279 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_15600 102295 102735 gene locus_tag LOCUS_15610 gene ssb 102295 102735 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272405.1 protein_id gnl|my_center|LOCUS_15610 102789 103034 gene locus_tag LOCUS_15620 gene rpsR 102789 103034 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_15620 104023 103178 gene locus_tag LOCUS_15630 104023 103178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 104184 104002 gene locus_tag LOCUS_15640 104184 104002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 104507 104758 gene locus_tag LOCUS_15650 104507 104758 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788104.1 protein_id gnl|my_center|LOCUS_15650 104786 105646 gene locus_tag LOCUS_15660 104786 105646 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127403.1 protein_id gnl|my_center|LOCUS_15660 105666 106550 gene locus_tag LOCUS_15670 105666 106550 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964578.1 protein_id gnl|my_center|LOCUS_15670 107452 106541 gene locus_tag LOCUS_15680 107452 106541 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387131.1 protein_id gnl|my_center|LOCUS_15680 108953 107574 gene locus_tag LOCUS_15690 108953 107574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 110560 109040 gene locus_tag LOCUS_15700 110560 109040 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242688.1 protein_id gnl|my_center|LOCUS_15700 111150 110572 gene locus_tag LOCUS_15710 111150 110572 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068193.1 protein_id gnl|my_center|LOCUS_15710 111533 111458 gene locus_tag LOCUS_t00150 111533 111458 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 111977 112912 gene locus_tag LOCUS_15720 gene fba 111977 112912 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_15720 112997 113383 gene locus_tag LOCUS_15730 112997 113383 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022772.1 protein_id gnl|my_center|LOCUS_15730 113474 114625 gene locus_tag LOCUS_15740 113474 114625 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681491.1 protein_id gnl|my_center|LOCUS_15740 114901 114825 gene locus_tag LOCUS_t00160 114901 114825 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 115014 114940 gene locus_tag LOCUS_t00170 115014 114940 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 115094 115018 gene locus_tag LOCUS_t00180 115094 115018 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 116657 115299 gene locus_tag LOCUS_15750 116657 115299 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393008.1 protein_id gnl|my_center|LOCUS_15750 116858 117553 gene locus_tag LOCUS_15760 116858 117553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 119096 117690 gene locus_tag LOCUS_15770 119096 117690 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245209.1 protein_id gnl|my_center|LOCUS_15770 119512 119958 gene locus_tag LOCUS_15780 119512 119958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 120712 120080 gene locus_tag LOCUS_15790 gene nth 120712 120080 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013539.1 protein_id gnl|my_center|LOCUS_15790 121098 121173 gene locus_tag LOCUS_t00190 121098 121173 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 121228 121312 gene locus_tag LOCUS_t00200 121228 121312 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 121465 121716 gene locus_tag LOCUS_15800 121465 121716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 122859 121705 gene locus_tag LOCUS_15810 122859 121705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 123657 123091 gene locus_tag LOCUS_15820 123657 123091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 124356 123700 gene locus_tag LOCUS_15830 124356 123700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 124870 124388 gene locus_tag LOCUS_15840 124870 124388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 125182 124904 gene locus_tag LOCUS_15850 125182 124904 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916506.1 protein_id gnl|my_center|LOCUS_15850 125441 125175 gene locus_tag LOCUS_15860 125441 125175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 126220 125693 gene locus_tag LOCUS_15870 126220 125693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence12 1077 1226 gene locus_tag LOCUS_15880 1077 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 1478 1702 gene locus_tag LOCUS_15890 1478 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1699 2205 gene locus_tag LOCUS_15900 1699 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 2278 3756 gene locus_tag LOCUS_15910 2278 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 3753 4361 gene locus_tag LOCUS_15920 3753 4361 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812592.1 protein_id gnl|my_center|LOCUS_15920 4766 5404 gene locus_tag LOCUS_15930 4766 5404 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762936.1 protein_id gnl|my_center|LOCUS_15930 5457 6560 gene locus_tag LOCUS_15940 5457 6560 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_15940 6611 7396 gene locus_tag LOCUS_15950 6611 7396 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027567.1 protein_id gnl|my_center|LOCUS_15950 7583 7756 gene locus_tag LOCUS_15960 7583 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 7880 8125 gene locus_tag LOCUS_15970 7880 8125 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965971.1 protein_id gnl|my_center|LOCUS_15970 9525 8290 gene locus_tag LOCUS_15980 9525 8290 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769287.1 protein_id gnl|my_center|LOCUS_15980 10210 9620 gene locus_tag LOCUS_15990 10210 9620 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462102.1 protein_id gnl|my_center|LOCUS_15990 11022 10687 gene locus_tag LOCUS_16000 11022 10687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 11290 10994 gene locus_tag LOCUS_16010 11290 10994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 11849 11685 gene locus_tag LOCUS_16020 11849 11685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16020 12305 12221 gene locus_tag LOCUS_t00210 12305 12221 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12504 14255 gene locus_tag LOCUS_16030 12504 14255 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 protein_id gnl|my_center|LOCUS_16030 14366 15367 gene locus_tag LOCUS_16040 14366 15367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 16528 15521 gene locus_tag LOCUS_16050 16528 15521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 16817 17884 gene locus_tag LOCUS_16060 16817 17884 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795587.1 protein_id gnl|my_center|LOCUS_16060 18858 18004 gene locus_tag LOCUS_16070 gene larE 18858 18004 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461498.1 protein_id gnl|my_center|LOCUS_16070 19190 19939 gene locus_tag LOCUS_16080 19190 19939 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966742.1 protein_id gnl|my_center|LOCUS_16080 20087 20950 gene locus_tag LOCUS_16090 20087 20950 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964020.1 protein_id gnl|my_center|LOCUS_16090 21349 22134 gene locus_tag LOCUS_16100 21349 22134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 22242 22718 gene locus_tag LOCUS_16110 22242 22718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 23103 23969 gene locus_tag LOCUS_16120 23103 23969 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_16120 24014 24934 gene locus_tag LOCUS_16130 24014 24934 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_16130 25194 25898 gene locus_tag LOCUS_16140 25194 25898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 26916 25831 gene locus_tag LOCUS_16150 26916 25831 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785904.1 protein_id gnl|my_center|LOCUS_16150 27143 28327 gene locus_tag LOCUS_16160 27143 28327 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_16160 28374 28769 gene locus_tag LOCUS_16170 28374 28769 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_16170 28803 29963 gene locus_tag LOCUS_16180 28803 29963 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964358.1 protein_id gnl|my_center|LOCUS_16180 30004 30846 gene locus_tag LOCUS_16190 30004 30846 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 protein_id gnl|my_center|LOCUS_16190 30978 31508 gene locus_tag LOCUS_16200 gene raiA 30978 31508 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_16200 31690 32820 gene locus_tag LOCUS_16210 31690 32820 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944494.1 protein_id gnl|my_center|LOCUS_16210 33042 33986 gene locus_tag LOCUS_16220 33042 33986 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_16220 35375 34092 gene locus_tag LOCUS_16230 35375 34092 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_16230 35472 35705 gene locus_tag LOCUS_16240 35472 35705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 36001 35687 gene locus_tag LOCUS_16250 36001 35687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 36452 36120 gene locus_tag LOCUS_16260 36452 36120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16260 37001 36828 gene locus_tag LOCUS_16270 37001 36828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 37443 37802 gene locus_tag LOCUS_16280 37443 37802 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288776.1 protein_id gnl|my_center|LOCUS_16280 37976 38782 gene locus_tag LOCUS_16290 37976 38782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 39404 38844 gene locus_tag LOCUS_16300 39404 38844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 39616 41091 gene locus_tag LOCUS_16310 39616 41091 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014017276.1 protein_id gnl|my_center|LOCUS_16310 41233 41538 gene locus_tag LOCUS_16320 41233 41538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 41568 41831 gene locus_tag LOCUS_16330 41568 41831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 42014 42526 gene locus_tag LOCUS_16340 gene ruvC 42014 42526 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_16340 42523 43131 gene locus_tag LOCUS_16350 gene ruvA 42523 43131 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_16350 43201 43695 gene locus_tag LOCUS_16360 43201 43695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 43714 44742 gene locus_tag LOCUS_16370 gene ruvB 43714 44742 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344450.1 protein_id gnl|my_center|LOCUS_16370 44863 46212 gene locus_tag LOCUS_16380 gene glmM 44863 46212 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_16380 46216 47094 gene locus_tag LOCUS_16390 46216 47094 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_16390 47117 47968 gene locus_tag LOCUS_16400 47117 47968 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435660.1 protein_id gnl|my_center|LOCUS_16400 48561 49433 gene locus_tag LOCUS_16410 48561 49433 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_16410 49427 50242 gene locus_tag LOCUS_16420 49427 50242 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_16420 50284 51018 gene locus_tag LOCUS_16430 gene truA 50284 51018 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_16430 51163 52260 gene locus_tag LOCUS_16440 51163 52260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 52423 53133 gene locus_tag LOCUS_16450 52423 53133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 53204 53839 gene locus_tag LOCUS_16460 53204 53839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 54012 56342 gene locus_tag LOCUS_16470 54012 56342 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_16470 56736 57662 gene locus_tag LOCUS_16480 56736 57662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 57828 58634 gene locus_tag LOCUS_16490 57828 58634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 59048 60067 gene locus_tag LOCUS_16500 gene pheS 59048 60067 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403382.1 protein_id gnl|my_center|LOCUS_16500 60086 62467 gene locus_tag LOCUS_16510 gene pheT 60086 62467 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_16510 63603 62737 gene locus_tag LOCUS_16520 63603 62737 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287688.1 protein_id gnl|my_center|LOCUS_16520 64335 63871 gene locus_tag LOCUS_16530 64335 63871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 65040 64579 gene locus_tag LOCUS_16540 65040 64579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 65253 65438 gene locus_tag LOCUS_16550 65253 65438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 65456 66130 gene locus_tag LOCUS_16560 65456 66130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 66166 66330 gene locus_tag LOCUS_16570 66166 66330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 66342 66503 gene locus_tag LOCUS_16580 66342 66503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 66509 66928 gene locus_tag LOCUS_16590 66509 66928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 66933 67157 gene locus_tag LOCUS_16600 66933 67157 CDS product DUF739 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905683.1 protein_id gnl|my_center|LOCUS_16600 67182 67373 gene locus_tag LOCUS_16610 67182 67373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 67396 67806 gene locus_tag LOCUS_16620 67396 67806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 67825 68190 gene locus_tag LOCUS_16630 67825 68190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 68210 69139 gene locus_tag LOCUS_16640 68210 69139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 69152 70417 gene locus_tag LOCUS_16650 69152 70417 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087359848.1 protein_id gnl|my_center|LOCUS_16650 70377 71057 gene locus_tag LOCUS_16660 70377 71057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 71050 71487 gene locus_tag LOCUS_16670 71050 71487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 71487 71900 gene locus_tag LOCUS_16680 71487 71900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703702.1 protein_id gnl|my_center|LOCUS_16680 71822 73360 gene locus_tag LOCUS_16690 71822 73360 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125080931.1 protein_id gnl|my_center|LOCUS_16690 73417 73662 gene locus_tag LOCUS_16700 73417 73662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 73692 74156 gene locus_tag LOCUS_16710 73692 74156 CDS product DUF669 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703687.1 protein_id gnl|my_center|LOCUS_16710 74241 75950 gene locus_tag LOCUS_16720 74241 75950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475919.1 protein_id gnl|my_center|LOCUS_16720 75950 76381 gene locus_tag LOCUS_16730 75950 76381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 76396 78285 gene locus_tag LOCUS_16740 76396 78285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 78304 78939 gene locus_tag LOCUS_16750 78304 78939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 78952 79158 gene locus_tag LOCUS_16760 78952 79158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 79158 79703 gene locus_tag LOCUS_16770 79158 79703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 79722 80630 gene locus_tag LOCUS_16780 79722 80630 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837604.1 protein_id gnl|my_center|LOCUS_16780 80948 81391 gene locus_tag LOCUS_16790 80948 81391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 81538 81960 gene locus_tag LOCUS_16800 81538 81960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 81950 83209 gene locus_tag LOCUS_16810 81950 83209 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988380.1 protein_id gnl|my_center|LOCUS_16810 83296 84810 gene locus_tag LOCUS_16820 83296 84810 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047637.1 protein_id gnl|my_center|LOCUS_16820 84788 85000 gene locus_tag LOCUS_16830 84788 85000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 84990 87488 gene locus_tag LOCUS_16840 84990 87488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 87504 87740 gene locus_tag LOCUS_16850 87504 87740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 88049 88672 gene locus_tag LOCUS_16860 88049 88672 CDS product phage scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003769956.1 protein_id gnl|my_center|LOCUS_16860 88698 89681 gene locus_tag LOCUS_16870 88698 89681 CDS product DUF5309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093935635.1 protein_id gnl|my_center|LOCUS_16870 89702 89995 gene locus_tag LOCUS_16880 89702 89995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 90001 90399 gene locus_tag LOCUS_16890 90001 90399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220482838.1 protein_id gnl|my_center|LOCUS_16890 90393 90779 gene locus_tag LOCUS_16900 90393 90779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429844.1 protein_id gnl|my_center|LOCUS_16900 90779 91270 gene locus_tag LOCUS_16910 90779 91270 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861030.1 protein_id gnl|my_center|LOCUS_16910 91267 91692 gene locus_tag LOCUS_16920 91267 91692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373960.1 protein_id gnl|my_center|LOCUS_16920 91703 91906 gene locus_tag LOCUS_16930 91703 91906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 91908 93215 gene locus_tag LOCUS_16940 91908 93215 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861032.1 protein_id gnl|my_center|LOCUS_16940 93233 93715 gene locus_tag LOCUS_16950 93233 93715 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429851.1 protein_id gnl|my_center|LOCUS_16950 93815 94246 gene locus_tag LOCUS_16960 93815 94246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 94443 97169 gene locus_tag LOCUS_16970 94443 97169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047651.1 protein_id gnl|my_center|LOCUS_16970 97169 97891 gene locus_tag LOCUS_16980 97169 97891 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861037.1 protein_id gnl|my_center|LOCUS_16980 97905 98885 gene locus_tag LOCUS_16990 97905 98885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 98878 99273 gene locus_tag LOCUS_17000 98878 99273 CDS product DUF2577 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817292.1 protein_id gnl|my_center|LOCUS_17000 99270 99674 gene locus_tag LOCUS_17010 99270 99674 CDS product DUF2634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861039.1 protein_id gnl|my_center|LOCUS_17010 99675 100871 gene locus_tag LOCUS_17020 99675 100871 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861040.1 protein_id gnl|my_center|LOCUS_17020 100868 101656 gene locus_tag LOCUS_17030 100868 101656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 101674 103431 gene locus_tag LOCUS_17040 101674 103431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 103530 103760 gene locus_tag LOCUS_17050 103530 103760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 103851 104978 gene locus_tag LOCUS_17060 103851 104978 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_17060 104982 105245 gene locus_tag LOCUS_17070 104982 105245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 105421 105546 gene locus_tag LOCUS_17080 105421 105546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 105661 106092 gene locus_tag LOCUS_17090 105661 106092 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439566.1 protein_id gnl|my_center|LOCUS_17090 106100 107089 gene locus_tag LOCUS_17100 106100 107089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 107249 108037 gene locus_tag LOCUS_17110 107249 108037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 108770 108186 gene locus_tag LOCUS_17120 108770 108186 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203642.1 protein_id gnl|my_center|LOCUS_17120 109283 108774 gene locus_tag LOCUS_17130 109283 108774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 109824 109324 gene locus_tag LOCUS_17140 109824 109324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 110035 109898 gene locus_tag LOCUS_17150 110035 109898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 110357 112330 gene locus_tag LOCUS_17160 110357 112330 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964362.1 protein_id gnl|my_center|LOCUS_17160 112744 113496 gene locus_tag LOCUS_17170 gene rpsB 112744 113496 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_17170 113651 114580 gene locus_tag LOCUS_17180 gene tsf 113651 114580 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_17180 116465 114738 gene locus_tag LOCUS_17190 116465 114738 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_17190 116638 117831 gene locus_tag LOCUS_17200 116638 117831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence13 561 1481 gene locus_tag LOCUS_17210 561 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1474 2883 gene locus_tag LOCUS_17220 1474 2883 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032496674.1 protein_id gnl|my_center|LOCUS_17220 3822 3562 gene locus_tag LOCUS_17230 3822 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 4068 5036 gene locus_tag LOCUS_17240 4068 5036 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700854.1 protein_id gnl|my_center|LOCUS_17240 5043 6878 gene locus_tag LOCUS_17250 gene uvrC 5043 6878 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_17250 7071 7619 gene locus_tag LOCUS_17260 gene rsmD 7071 7619 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_17260 7616 8101 gene locus_tag LOCUS_17270 gene coaD 7616 8101 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965045.1 protein_id gnl|my_center|LOCUS_17270 8138 9004 gene locus_tag LOCUS_17280 8138 9004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 9106 9546 gene locus_tag LOCUS_17290 9106 9546 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900905.1 protein_id gnl|my_center|LOCUS_17290 9558 10592 gene locus_tag LOCUS_17300 gene ansA 9558 10592 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072398.1 protein_id gnl|my_center|LOCUS_17300 10871 11719 gene locus_tag LOCUS_17310 10871 11719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 11736 12476 gene locus_tag LOCUS_17320 11736 12476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 12535 13272 gene locus_tag LOCUS_17330 12535 13272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 15039 13408 gene locus_tag LOCUS_17340 15039 13408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 16665 15082 gene locus_tag LOCUS_17350 16665 15082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 16884 17075 gene locus_tag LOCUS_17360 16884 17075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 17342 18298 gene locus_tag LOCUS_17370 17342 18298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 18579 19124 gene locus_tag LOCUS_17380 18579 19124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 20823 19225 gene locus_tag LOCUS_17390 gene metG 20823 19225 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021600.1 protein_id gnl|my_center|LOCUS_17390 21379 21678 gene locus_tag LOCUS_17400 21379 21678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 21847 23166 gene locus_tag LOCUS_17410 21847 23166 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966615.1 protein_id gnl|my_center|LOCUS_17410 23145 24011 gene locus_tag LOCUS_17420 23145 24011 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966616.1 protein_id gnl|my_center|LOCUS_17420 24178 25551 gene locus_tag LOCUS_17430 24178 25551 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_17430 26051 25689 gene locus_tag LOCUS_17440 26051 25689 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_17440 26328 26143 gene locus_tag LOCUS_17450 26328 26143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 26580 26873 gene locus_tag LOCUS_17460 26580 26873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 27929 27036 gene locus_tag LOCUS_17470 gene iolE 27929 27036 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471986.1 protein_id gnl|my_center|LOCUS_17470 29809 27956 gene locus_tag LOCUS_17480 gene iolD 29809 27956 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104587.1 protein_id gnl|my_center|LOCUS_17480 30673 29882 gene locus_tag LOCUS_17490 30673 29882 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900828.1 protein_id gnl|my_center|LOCUS_17490 31746 30727 gene locus_tag LOCUS_17500 gene iolG 31746 30727 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_17500 32514 31903 gene locus_tag LOCUS_17510 32514 31903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 33996 32638 gene locus_tag LOCUS_17520 33996 32638 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_17520 34152 34607 gene locus_tag LOCUS_17530 34152 34607 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550374.1 protein_id gnl|my_center|LOCUS_17530 34726 35754 gene locus_tag LOCUS_17540 34726 35754 CDS product phosphorylating glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867508.1 protein_id gnl|my_center|LOCUS_17540 35757 37001 gene locus_tag LOCUS_17550 gene pgk 35757 37001 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061271.1 protein_id gnl|my_center|LOCUS_17550 37113 38366 gene locus_tag LOCUS_17560 gene larA 37113 38366 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_17560 38686 40128 gene locus_tag LOCUS_17570 38686 40128 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289668.1 protein_id gnl|my_center|LOCUS_17570 40179 42341 gene locus_tag LOCUS_17580 40179 42341 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107432.1 protein_id gnl|my_center|LOCUS_17580 42607 43863 gene locus_tag LOCUS_17590 42607 43863 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428267.1 protein_id gnl|my_center|LOCUS_17590 44009 45352 gene locus_tag LOCUS_17600 44009 45352 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722393.1 protein_id gnl|my_center|LOCUS_17600 45407 45823 gene locus_tag LOCUS_17610 45407 45823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_17610 46012 46506 gene locus_tag LOCUS_17620 46012 46506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 46548 46730 gene locus_tag LOCUS_17630 gene rpmF 46548 46730 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830121.1 protein_id gnl|my_center|LOCUS_17630 46953 48269 gene locus_tag LOCUS_17640 46953 48269 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_17640 48306 49631 gene locus_tag LOCUS_17650 gene der 48306 49631 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_17650 50473 49751 gene locus_tag LOCUS_17660 50473 49751 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966938.1 protein_id gnl|my_center|LOCUS_17660 53162 50466 gene locus_tag LOCUS_17670 53162 50466 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016309345.1 protein_id gnl|my_center|LOCUS_17670 54437 53556 gene locus_tag LOCUS_17680 54437 53556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 55132 54527 gene locus_tag LOCUS_17690 55132 54527 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943629.1 protein_id gnl|my_center|LOCUS_17690 57241 55172 gene locus_tag LOCUS_17700 gene kdpB 57241 55172 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733062.1 protein_id gnl|my_center|LOCUS_17700 59065 57254 gene locus_tag LOCUS_17710 gene kdpA 59065 57254 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814045.1 protein_id gnl|my_center|LOCUS_17710 59455 59261 gene locus_tag LOCUS_17720 59455 59261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 59865 60986 gene locus_tag LOCUS_17730 59865 60986 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_17730 60990 61817 gene locus_tag LOCUS_17740 60990 61817 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_17740 61913 62740 gene locus_tag LOCUS_17750 61913 62740 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_17750 62737 63966 gene locus_tag LOCUS_17760 62737 63966 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_17760 64003 64599 gene locus_tag LOCUS_17770 64003 64599 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722402.1 protein_id gnl|my_center|LOCUS_17770 64815 65168 gene locus_tag LOCUS_17780 64815 65168 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813638.1 protein_id gnl|my_center|LOCUS_17780 65208 65750 gene locus_tag LOCUS_17790 65208 65750 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798510.1 protein_id gnl|my_center|LOCUS_17790 66003 66944 gene locus_tag LOCUS_17800 66003 66944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 67063 67623 gene locus_tag LOCUS_17810 67063 67623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 68716 67751 gene locus_tag LOCUS_17820 68716 67751 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_17820 69062 69754 gene locus_tag LOCUS_17830 gene radC 69062 69754 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969427.1 protein_id gnl|my_center|LOCUS_17830 69785 70198 gene locus_tag LOCUS_17840 69785 70198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 70995 70345 gene locus_tag LOCUS_17850 70995 70345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 71221 72900 gene locus_tag LOCUS_17860 71221 72900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 72930 73592 gene locus_tag LOCUS_17870 72930 73592 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_17870 73673 75226 gene locus_tag LOCUS_17880 73673 75226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 75502 75311 gene locus_tag LOCUS_17890 75502 75311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 75770 75591 gene locus_tag LOCUS_17900 75770 75591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 75960 76343 gene locus_tag LOCUS_17910 75960 76343 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642574.1 protein_id gnl|my_center|LOCUS_17910 76325 77173 gene locus_tag LOCUS_17920 76325 77173 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948845.1 protein_id gnl|my_center|LOCUS_17920 77188 77910 gene locus_tag LOCUS_17930 77188 77910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 78231 77968 gene locus_tag LOCUS_17940 78231 77968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 78602 78339 gene locus_tag LOCUS_17950 78602 78339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 78974 80218 gene locus_tag LOCUS_17960 gene spoIVB 78974 80218 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_17960 80352 81128 gene locus_tag LOCUS_17970 gene spo0A 80352 81128 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358896.1 protein_id gnl|my_center|LOCUS_17970 81401 82189 gene locus_tag LOCUS_17980 81401 82189 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_17980 82374 83006 gene locus_tag LOCUS_17990 gene hisH 82374 83006 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964257.1 protein_id gnl|my_center|LOCUS_17990 83006 83767 gene locus_tag LOCUS_18000 gene hisF 83006 83767 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_18000 84720 84001 gene locus_tag LOCUS_18010 84720 84001 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518847.1 protein_id gnl|my_center|LOCUS_18010 86188 84743 gene locus_tag LOCUS_18020 86188 84743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 87657 86287 gene locus_tag LOCUS_18030 87657 86287 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_18030 88649 87855 gene locus_tag LOCUS_18040 gene erm(A) 88649 87855 CDS product 23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072201.1 protein_id gnl|my_center|LOCUS_18040 89606 88833 gene locus_tag LOCUS_18050 gene sigG 89606 88833 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774282.1 protein_id gnl|my_center|LOCUS_18050 89863 90144 gene locus_tag LOCUS_18060 gene yabP 89863 90144 CDS product sporulation protein YabP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059101.1 protein_id gnl|my_center|LOCUS_18060 90146 90694 gene locus_tag LOCUS_18070 90146 90694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 90691 90984 gene locus_tag LOCUS_18080 90691 90984 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391639.1 protein_id gnl|my_center|LOCUS_18080 91000 91503 gene locus_tag LOCUS_18090 91000 91503 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021452.1 protein_id gnl|my_center|LOCUS_18090 91798 93171 gene locus_tag LOCUS_18100 91798 93171 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930806.1 protein_id gnl|my_center|LOCUS_18100 93300 93569 gene locus_tag LOCUS_18110 93300 93569 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814546.1 protein_id gnl|my_center|LOCUS_18110 93592 95583 gene locus_tag LOCUS_18120 gene ligA 93592 95583 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_18120 95670 96542 gene locus_tag LOCUS_18130 95670 96542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 96572 97102 gene locus_tag LOCUS_18140 96572 97102 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545215.1 protein_id gnl|my_center|LOCUS_18140 97161 97877 gene locus_tag LOCUS_18150 97161 97877 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_18150 97912 98382 gene locus_tag LOCUS_18160 gene ybaK 97912 98382 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788187.1 protein_id gnl|my_center|LOCUS_18160 99097 98591 gene locus_tag LOCUS_18170 99097 98591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 100299 99163 gene locus_tag LOCUS_18180 100299 99163 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068707.1 protein_id gnl|my_center|LOCUS_18180 101349 100498 gene locus_tag LOCUS_18190 101349 100498 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 protein_id gnl|my_center|LOCUS_18190 102503 101520 gene locus_tag LOCUS_18200 gene dusB 102503 101520 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_18200 102917 103138 gene locus_tag LOCUS_18210 102917 103138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 105576 103165 gene locus_tag LOCUS_18220 105576 103165 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582331.1 protein_id gnl|my_center|LOCUS_18220 106880 105591 gene locus_tag LOCUS_18230 106880 105591 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989563.1 protein_id gnl|my_center|LOCUS_18230 108340 107030 gene locus_tag LOCUS_18240 gene mtaB 108340 107030 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_18240 109179 108505 gene locus_tag LOCUS_18250 109179 108505 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429376.1 protein_id gnl|my_center|LOCUS_18250 109394 110281 gene locus_tag LOCUS_18260 109394 110281 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_18260 110368 110511 gene locus_tag LOCUS_18270 110368 110511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 110465 110941 gene locus_tag LOCUS_18280 110465 110941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 111383 111078 gene locus_tag LOCUS_18290 111383 111078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 111905 111405 gene locus_tag LOCUS_18300 111905 111405 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454674.1 protein_id gnl|my_center|LOCUS_18300 112629 111997 gene locus_tag LOCUS_18310 112629 111997 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989890.1 protein_id gnl|my_center|LOCUS_18310 113176 112712 gene locus_tag LOCUS_18320 113176 112712 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905253.1 protein_id gnl|my_center|LOCUS_18320 113484 113215 gene locus_tag LOCUS_18330 113484 113215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 114228 >115266 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccactccgcccgtgtgggcggagac >Feature sequence14 212 562 gene locus_tag LOCUS_18340 212 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 726 1400 gene locus_tag LOCUS_18350 726 1400 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892113.1 protein_id gnl|my_center|LOCUS_18350 1394 2287 gene locus_tag LOCUS_18360 1394 2287 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814607.1 protein_id gnl|my_center|LOCUS_18360 2284 3162 gene locus_tag LOCUS_18370 2284 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 3183 3725 gene locus_tag LOCUS_18380 3183 3725 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_18380 3812 4327 gene locus_tag LOCUS_18390 3812 4327 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230122.1 protein_id gnl|my_center|LOCUS_18390 4409 5791 gene locus_tag LOCUS_18400 4409 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 5788 7047 gene locus_tag LOCUS_18410 5788 7047 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_18410 7048 7920 gene locus_tag LOCUS_18420 7048 7920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 8049 8954 gene locus_tag LOCUS_18430 8049 8954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 9138 9509 gene locus_tag LOCUS_18440 9138 9509 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272371.1 protein_id gnl|my_center|LOCUS_18440 9693 10442 gene locus_tag LOCUS_18450 gene cwlD 9693 10442 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048347.1 protein_id gnl|my_center|LOCUS_18450 10473 11849 gene locus_tag LOCUS_18460 gene radA 10473 11849 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_18460 11992 11846 gene locus_tag LOCUS_18470 11992 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 12187 12939 gene locus_tag LOCUS_18480 12187 12939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048138.1 protein_id gnl|my_center|LOCUS_18480 13193 14071 gene locus_tag LOCUS_18490 13193 14071 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_18490 14134 14412 gene locus_tag LOCUS_18500 14134 14412 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 protein_id gnl|my_center|LOCUS_18500 14405 15022 gene locus_tag LOCUS_18510 gene gmk 14405 15022 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830096.1 protein_id gnl|my_center|LOCUS_18510 15015 15224 gene locus_tag LOCUS_18520 15015 15224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 15258 17729 gene locus_tag LOCUS_18530 gene priA 15258 17729 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_18530 17818 18288 gene locus_tag LOCUS_18540 gene def 17818 18288 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388617.1 protein_id gnl|my_center|LOCUS_18540 18314 19243 gene locus_tag LOCUS_18550 gene fmt 18314 19243 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460526.1 protein_id gnl|my_center|LOCUS_18550 19277 19978 gene locus_tag LOCUS_18560 19277 19978 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957169.1 protein_id gnl|my_center|LOCUS_18560 20002 21336 gene locus_tag LOCUS_18570 gene rsmB 20002 21336 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460525.1 protein_id gnl|my_center|LOCUS_18570 21333 22385 gene locus_tag LOCUS_18580 gene rlmN 21333 22385 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986842.1 protein_id gnl|my_center|LOCUS_18580 22382 23110 gene locus_tag LOCUS_18590 gene prpC 22382 23110 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_18590 23151 25358 gene locus_tag LOCUS_18600 gene pknB 23151 25358 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087065956.1 protein_id gnl|my_center|LOCUS_18600 25367 26284 gene locus_tag LOCUS_18610 gene rsgA 25367 26284 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392430.1 protein_id gnl|my_center|LOCUS_18610 26313 26939 gene locus_tag LOCUS_18620 26313 26939 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_18620 28599 27400 gene locus_tag LOCUS_18630 28599 27400 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_18630 28994 30208 gene locus_tag LOCUS_18640 28994 30208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 30193 32370 gene locus_tag LOCUS_18650 30193 32370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 32551 33513 gene locus_tag LOCUS_18660 gene pfkA 32551 33513 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229420.1 protein_id gnl|my_center|LOCUS_18660 34658 33744 gene locus_tag LOCUS_18670 gene metA 34658 33744 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121536.1 protein_id gnl|my_center|LOCUS_18670 35126 37495 gene locus_tag LOCUS_18680 35126 37495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 37754 38311 gene locus_tag LOCUS_18690 37754 38311 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966725.1 protein_id gnl|my_center|LOCUS_18690 39353 38367 gene locus_tag LOCUS_18700 39353 38367 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 protein_id gnl|my_center|LOCUS_18700 40063 39497 gene locus_tag LOCUS_18710 40063 39497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 40564 42294 gene locus_tag LOCUS_18720 40564 42294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_18720 42291 44033 gene locus_tag LOCUS_18730 42291 44033 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_18730 44857 44117 gene locus_tag LOCUS_18740 44857 44117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 45273 45055 gene locus_tag LOCUS_18750 45273 45055 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220771.1 protein_id gnl|my_center|LOCUS_18750 45572 46486 gene locus_tag LOCUS_18760 gene spoIIGA 45572 46486 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291042.1 protein_id gnl|my_center|LOCUS_18760 46674 47252 gene locus_tag LOCUS_18770 gene sigE 46674 47252 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976948.1 protein_id gnl|my_center|LOCUS_18770 48257 47658 gene locus_tag LOCUS_18780 48257 47658 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_18780 49121 48279 gene locus_tag LOCUS_18790 49121 48279 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_18790 49732 49196 gene locus_tag LOCUS_18800 49732 49196 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356666.1 protein_id gnl|my_center|LOCUS_18800 49887 49729 gene locus_tag LOCUS_18810 49887 49729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 50743 49880 gene locus_tag LOCUS_18820 50743 49880 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897816.1 protein_id gnl|my_center|LOCUS_18820 51129 51863 gene locus_tag LOCUS_18830 51129 51863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 51892 52401 gene locus_tag LOCUS_18840 51892 52401 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_18840 52840 52541 gene locus_tag LOCUS_18850 52840 52541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 53054 55360 gene locus_tag LOCUS_18860 53054 55360 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808242.1 protein_id gnl|my_center|LOCUS_18860 55459 56730 gene locus_tag LOCUS_18870 55459 56730 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_18870 56780 57712 gene locus_tag LOCUS_18880 gene pyrF 56780 57712 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_18880 57741 58853 gene locus_tag LOCUS_18890 57741 58853 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828679.1 protein_id gnl|my_center|LOCUS_18890 58834 61995 gene locus_tag LOCUS_18900 gene carB 58834 61995 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392401.1 protein_id gnl|my_center|LOCUS_18900 62038 62823 gene locus_tag LOCUS_18910 62038 62823 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_18910 62823 63734 gene locus_tag LOCUS_18920 62823 63734 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 protein_id gnl|my_center|LOCUS_18920 63728 64423 gene locus_tag LOCUS_18930 63728 64423 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881302.1 protein_id gnl|my_center|LOCUS_18930 64438 64866 gene locus_tag LOCUS_18940 gene ruvX 64438 64866 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775670.1 protein_id gnl|my_center|LOCUS_18940 65251 64880 gene locus_tag LOCUS_18950 65251 64880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 65598 65248 gene locus_tag LOCUS_18960 65598 65248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 66951 65857 gene locus_tag LOCUS_18970 66951 65857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 67373 69103 gene locus_tag LOCUS_18980 67373 69103 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143146.1 protein_id gnl|my_center|LOCUS_18980 69324 70337 gene locus_tag LOCUS_18990 gene spoIIIAA 69324 70337 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438117.1 protein_id gnl|my_center|LOCUS_18990 70276 70785 gene locus_tag LOCUS_19000 70276 70785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 70854 71048 gene locus_tag LOCUS_19010 gene spoIIIAC 70854 71048 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358967.1 protein_id gnl|my_center|LOCUS_19010 71054 71443 gene locus_tag LOCUS_19020 gene spoIIIAD 71054 71443 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810912.1 protein_id gnl|my_center|LOCUS_19020 71450 72580 gene locus_tag LOCUS_19030 71450 72580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 72596 73078 gene locus_tag LOCUS_19040 72596 73078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 73115 73693 gene locus_tag LOCUS_19050 73115 73693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 73963 74562 gene locus_tag LOCUS_19060 73963 74562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 75075 75449 gene locus_tag LOCUS_19070 75075 75449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 75603 76004 gene locus_tag LOCUS_19080 gene nusB 75603 76004 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230256.1 protein_id gnl|my_center|LOCUS_19080 76007 76957 gene locus_tag LOCUS_19090 76007 76957 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 protein_id gnl|my_center|LOCUS_19090 77014 78219 gene locus_tag LOCUS_19100 gene xseA 77014 78219 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_19100 78294 78515 gene locus_tag LOCUS_19110 gene xseB 78294 78515 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418105.1 protein_id gnl|my_center|LOCUS_19110 78509 79402 gene locus_tag LOCUS_19120 78509 79402 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_19120 79440 81323 gene locus_tag LOCUS_19130 gene dxs 79440 81323 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965377.1 protein_id gnl|my_center|LOCUS_19130 81304 82152 gene locus_tag LOCUS_19140 81304 82152 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965376.1 protein_id gnl|my_center|LOCUS_19140 82149 83009 gene locus_tag LOCUS_19150 82149 83009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 83006 83461 gene locus_tag LOCUS_19160 83006 83461 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_19160 83489 85168 gene locus_tag LOCUS_19170 gene recN 83489 85168 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645158.1 protein_id gnl|my_center|LOCUS_19170 85544 86191 gene locus_tag LOCUS_19180 85544 86191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 86937 86302 gene locus_tag LOCUS_19190 86937 86302 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_19190 88120 86951 gene locus_tag LOCUS_19200 88120 86951 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_19200 90090 88156 gene locus_tag LOCUS_19210 90090 88156 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_19210 91053 90235 gene locus_tag LOCUS_19220 91053 90235 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383369.1 protein_id gnl|my_center|LOCUS_19220 92325 91141 gene locus_tag LOCUS_19230 gene rodA 92325 91141 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_19230 92823 92380 gene locus_tag LOCUS_19240 gene rpiB 92823 92380 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_19240 93545 92841 gene locus_tag LOCUS_19250 gene tsaB 93545 92841 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966124.1 protein_id gnl|my_center|LOCUS_19250 93973 93542 gene locus_tag LOCUS_19260 gene tsaE 93973 93542 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405136.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence15 356 159 gene locus_tag LOCUS_19270 356 159 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_19270 865 3291 gene locus_tag LOCUS_19280 gene lon 865 3291 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_19280 3389 3601 gene locus_tag LOCUS_19290 3389 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 3652 4260 gene locus_tag LOCUS_19300 gene yihA 3652 4260 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775089.1 protein_id gnl|my_center|LOCUS_19300 4294 5592 gene locus_tag LOCUS_19310 gene lysA 4294 5592 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_19310 7176 5695 gene locus_tag LOCUS_19320 7176 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 8653 7169 gene locus_tag LOCUS_19330 8653 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 10883 8997 gene locus_tag LOCUS_19340 10883 8997 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732630.1 protein_id gnl|my_center|LOCUS_19340 12700 10943 gene locus_tag LOCUS_19350 12700 10943 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966556.1 protein_id gnl|my_center|LOCUS_19350 13036 12869 gene locus_tag LOCUS_19360 13036 12869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 13255 13494 gene locus_tag LOCUS_19370 13255 13494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 13956 13750 gene locus_tag LOCUS_19380 13956 13750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 13967 14137 gene locus_tag LOCUS_19390 13967 14137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 14749 14210 gene locus_tag LOCUS_19400 14749 14210 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420711.1 protein_id gnl|my_center|LOCUS_19400 15506 14742 gene locus_tag LOCUS_19410 15506 14742 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_19410 16573 15506 gene locus_tag LOCUS_19420 16573 15506 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357407.1 protein_id gnl|my_center|LOCUS_19420 16790 16584 gene locus_tag LOCUS_19430 16790 16584 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_19430 17520 16834 gene locus_tag LOCUS_19440 17520 16834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420704.1 protein_id gnl|my_center|LOCUS_19440 18263 17859 gene locus_tag LOCUS_19450 18263 17859 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384928.1 protein_id gnl|my_center|LOCUS_19450 18425 18718 gene locus_tag LOCUS_19460 18425 18718 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285944.1 protein_id gnl|my_center|LOCUS_19460 21820 18797 gene locus_tag LOCUS_19470 21820 18797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 23268 21973 gene locus_tag LOCUS_19480 23268 21973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 23381 23695 gene locus_tag LOCUS_19490 23381 23695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 23692 23985 gene locus_tag LOCUS_19500 23692 23985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 24175 24468 gene locus_tag LOCUS_19510 24175 24468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 24558 24634 gene locus_tag LOCUS_t00220 24558 24634 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 25105 24734 gene locus_tag LOCUS_19520 gene fra 25105 24734 CDS product iron chaperone frataxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244145.1 protein_id gnl|my_center|LOCUS_19520 26007 25333 gene locus_tag LOCUS_19530 26007 25333 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438070.1 protein_id gnl|my_center|LOCUS_19530 27844 25994 gene locus_tag LOCUS_19540 27844 25994 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_19540 28155 29063 gene locus_tag LOCUS_19550 28155 29063 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902813.1 protein_id gnl|my_center|LOCUS_19550 30261 29158 gene locus_tag LOCUS_19560 30261 29158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 31298 30318 gene locus_tag LOCUS_19570 31298 30318 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 protein_id gnl|my_center|LOCUS_19570 31490 32503 gene locus_tag LOCUS_19580 31490 32503 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262368.1 protein_id gnl|my_center|LOCUS_19580 33194 32580 gene locus_tag LOCUS_19590 33194 32580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 34122 33184 gene locus_tag LOCUS_19600 34122 33184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 35260 34220 gene locus_tag LOCUS_19610 35260 34220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 35823 36806 gene locus_tag LOCUS_19620 35823 36806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 36833 37705 gene locus_tag LOCUS_19630 36833 37705 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956754.1 protein_id gnl|my_center|LOCUS_19630 37728 38525 gene locus_tag LOCUS_19640 37728 38525 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886850.1 protein_id gnl|my_center|LOCUS_19640 41491 38609 gene locus_tag LOCUS_19650 41491 38609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 41881 42231 gene locus_tag LOCUS_19660 41881 42231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 44950 42311 gene locus_tag LOCUS_19670 44950 42311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 47608 45065 gene locus_tag LOCUS_19680 47608 45065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 48590 47718 gene locus_tag LOCUS_19690 48590 47718 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767449.1 protein_id gnl|my_center|LOCUS_19690 48908 48690 gene locus_tag LOCUS_19700 48908 48690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 49677 48898 gene locus_tag LOCUS_19710 49677 48898 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392585.1 protein_id gnl|my_center|LOCUS_19710 49643 49831 gene locus_tag LOCUS_19720 49643 49831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 50016 50528 gene locus_tag LOCUS_19730 50016 50528 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459551.1 protein_id gnl|my_center|LOCUS_19730 51296 50688 gene locus_tag LOCUS_19740 51296 50688 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_19740 52790 51423 gene locus_tag LOCUS_19750 52790 51423 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869268.1 protein_id gnl|my_center|LOCUS_19750 54765 53002 gene locus_tag LOCUS_19760 54765 53002 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_19760 55389 54787 gene locus_tag LOCUS_19770 55389 54787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 55708 55400 gene locus_tag LOCUS_19780 55708 55400 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_19780 56219 55749 gene locus_tag LOCUS_19790 56219 55749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 58221 56281 gene locus_tag LOCUS_19800 58221 56281 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868885.1 protein_id gnl|my_center|LOCUS_19800 59343 58294 gene locus_tag LOCUS_19810 59343 58294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 59820 59509 gene locus_tag LOCUS_19820 59820 59509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 60257 60445 gene locus_tag LOCUS_19830 gene rpmB 60257 60445 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_19830 61090 61332 gene locus_tag LOCUS_19840 61090 61332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 61453 62466 gene locus_tag LOCUS_19850 gene aroF 61453 62466 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_19850 64308 62638 gene locus_tag LOCUS_19860 64308 62638 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641784.1 protein_id gnl|my_center|LOCUS_19860 64717 64514 gene locus_tag LOCUS_19870 64717 64514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 65961 64813 gene locus_tag LOCUS_19880 65961 64813 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113524.1 protein_id gnl|my_center|LOCUS_19880 66392 66195 gene locus_tag LOCUS_19890 66392 66195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 66743 66652 gene locus_tag LOCUS_t00230 66743 66652 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 67972 67046 gene locus_tag LOCUS_19900 67972 67046 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_19900 68490 68047 gene locus_tag LOCUS_19910 68490 68047 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437174.1 protein_id gnl|my_center|LOCUS_19910 69139 68573 gene locus_tag LOCUS_19920 69139 68573 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459865.1 protein_id gnl|my_center|LOCUS_19920 69525 69283 gene locus_tag LOCUS_19930 69525 69283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 69586 69831 gene locus_tag LOCUS_19940 69586 69831 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348590.1 protein_id gnl|my_center|LOCUS_19940 69993 70292 gene locus_tag LOCUS_19950 69993 70292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 73277 70731 gene locus_tag LOCUS_19960 73277 70731 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_19960 74160 73246 gene locus_tag LOCUS_19970 74160 73246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 75845 74394 gene locus_tag LOCUS_19980 75845 74394 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681540.1 protein_id gnl|my_center|LOCUS_19980 77257 75842 gene locus_tag LOCUS_19990 77257 75842 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068650.1 protein_id gnl|my_center|LOCUS_19990 77604 77293 gene locus_tag LOCUS_20000 77604 77293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 79344 77968 gene locus_tag LOCUS_20010 79344 77968 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_20010 80114 79788 gene locus_tag LOCUS_20020 80114 79788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20020 80787 80194 gene locus_tag LOCUS_20030 80787 80194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20030 81429 81235 gene locus_tag LOCUS_20040 81429 81235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 81653 81453 gene locus_tag LOCUS_20050 81653 81453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 81922 81776 gene locus_tag LOCUS_20060 81922 81776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 82499 82089 gene locus_tag LOCUS_20070 82499 82089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 82640 82885 gene locus_tag LOCUS_20080 82640 82885 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287739.1 protein_id gnl|my_center|LOCUS_20080 84265 82988 gene locus_tag LOCUS_20090 84265 82988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 84502 84269 gene locus_tag LOCUS_20100 84502 84269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 84872 84558 gene locus_tag LOCUS_20110 84872 84558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 85966 84944 gene locus_tag LOCUS_20120 85966 84944 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_20120 86730 86332 gene locus_tag LOCUS_20130 86730 86332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 87884 86784 gene locus_tag LOCUS_20140 87884 86784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 88381 87884 gene locus_tag LOCUS_20150 88381 87884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 89446 88385 gene locus_tag LOCUS_20160 89446 88385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 90515 89469 gene locus_tag LOCUS_20170 90515 89469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 91468 90518 gene locus_tag LOCUS_20180 91468 90518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 92161 91475 gene locus_tag LOCUS_20190 92161 91475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 >Feature sequence16 296 517 gene locus_tag LOCUS_20200 296 517 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459191.1 protein_id gnl|my_center|LOCUS_20200 645 929 gene locus_tag LOCUS_20210 645 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 2198 1563 gene locus_tag LOCUS_20220 2198 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2670 2467 gene locus_tag LOCUS_20230 2670 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 5137 2720 gene locus_tag LOCUS_20240 5137 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 5454 5233 gene locus_tag LOCUS_20250 5454 5233 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_20250 5708 5496 gene locus_tag LOCUS_20260 5708 5496 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_20260 6166 7563 gene locus_tag LOCUS_20270 6166 7563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 8772 7702 gene locus_tag LOCUS_20280 8772 7702 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_20280 8994 10421 gene locus_tag LOCUS_20290 8994 10421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 11208 10576 gene locus_tag LOCUS_20300 11208 10576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 12275 11421 gene locus_tag LOCUS_20310 12275 11421 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861405.1 protein_id gnl|my_center|LOCUS_20310 13196 12423 gene locus_tag LOCUS_20320 13196 12423 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948811.1 protein_id gnl|my_center|LOCUS_20320 14106 13183 gene locus_tag LOCUS_20330 14106 13183 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948810.1 protein_id gnl|my_center|LOCUS_20330 15295 14270 gene locus_tag LOCUS_20340 15295 14270 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439336.1 protein_id gnl|my_center|LOCUS_20340 15629 15465 gene locus_tag LOCUS_20350 15629 15465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 15899 17509 gene locus_tag LOCUS_20360 15899 17509 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633864.1 protein_id gnl|my_center|LOCUS_20360 17751 17593 gene locus_tag LOCUS_20370 17751 17593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 17950 17783 gene locus_tag LOCUS_20380 17950 17783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 19015 17963 gene locus_tag LOCUS_20390 19015 17963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 20688 19288 gene locus_tag LOCUS_20400 gene uxaC 20688 19288 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_20400 23628 20983 gene locus_tag LOCUS_20410 23628 20983 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966018.1 protein_id gnl|my_center|LOCUS_20410 24326 23625 gene locus_tag LOCUS_20420 24326 23625 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438655.1 protein_id gnl|my_center|LOCUS_20420 24897 24568 gene locus_tag LOCUS_20430 24897 24568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 26253 24925 gene locus_tag LOCUS_20440 26253 24925 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_20440 26756 26319 gene locus_tag LOCUS_20450 26756 26319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 27170 26820 gene locus_tag LOCUS_20460 27170 26820 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583275.1 protein_id gnl|my_center|LOCUS_20460 27521 27874 gene locus_tag LOCUS_20470 27521 27874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 29896 28016 gene locus_tag LOCUS_20480 29896 28016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 30623 29964 gene locus_tag LOCUS_20490 30623 29964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 31421 30684 gene locus_tag LOCUS_20500 31421 30684 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869446.1 protein_id gnl|my_center|LOCUS_20500 31974 31531 gene locus_tag LOCUS_20510 31974 31531 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935469.1 protein_id gnl|my_center|LOCUS_20510 33501 32026 gene locus_tag LOCUS_20520 33501 32026 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_20520 34890 33547 gene locus_tag LOCUS_20530 gene trkA 34890 33547 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_20530 35175 36164 gene locus_tag LOCUS_20540 35175 36164 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223218.1 protein_id gnl|my_center|LOCUS_20540 36272 36484 gene locus_tag LOCUS_20550 gene rpmE 36272 36484 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_20550 36549 37172 gene locus_tag LOCUS_20560 36549 37172 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249474.1 protein_id gnl|my_center|LOCUS_20560 37319 38326 gene locus_tag LOCUS_20570 37319 38326 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_20570 38364 40130 gene locus_tag LOCUS_20580 gene dnaG 38364 40130 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_20580 40191 41300 gene locus_tag LOCUS_20590 gene rpoD 40191 41300 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964612.1 protein_id gnl|my_center|LOCUS_20590 41562 42035 gene locus_tag LOCUS_20600 41562 42035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 42139 42999 gene locus_tag LOCUS_20610 42139 42999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 42996 44891 gene locus_tag LOCUS_20620 42996 44891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 44892 46691 gene locus_tag LOCUS_20630 44892 46691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 47094 47675 gene locus_tag LOCUS_20640 47094 47675 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454633.1 protein_id gnl|my_center|LOCUS_20640 47736 48902 gene locus_tag LOCUS_20650 47736 48902 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276126.1 protein_id gnl|my_center|LOCUS_20650 48939 50474 gene locus_tag LOCUS_20660 48939 50474 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_20660 50471 51589 gene locus_tag LOCUS_20670 50471 51589 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_20670 51586 52542 gene locus_tag LOCUS_20680 51586 52542 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_20680 54072 52774 gene locus_tag LOCUS_20690 54072 52774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 54888 54094 gene locus_tag LOCUS_20700 54888 54094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 57722 55047 gene locus_tag LOCUS_20710 57722 55047 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377094.1 protein_id gnl|my_center|LOCUS_20710 58367 59029 gene locus_tag LOCUS_20720 58367 59029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 59245 59787 gene locus_tag LOCUS_20730 59245 59787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 59847 60629 gene locus_tag LOCUS_20740 59847 60629 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780022.1 protein_id gnl|my_center|LOCUS_20740 61871 60759 gene locus_tag LOCUS_20750 61871 60759 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392538.1 protein_id gnl|my_center|LOCUS_20750 62425 63480 gene locus_tag LOCUS_20760 62425 63480 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_20760 63484 63891 gene locus_tag LOCUS_20770 63484 63891 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461457.1 protein_id gnl|my_center|LOCUS_20770 63917 64453 gene locus_tag LOCUS_20780 63917 64453 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432371.1 protein_id gnl|my_center|LOCUS_20780 64484 65839 gene locus_tag LOCUS_20790 gene rsxC 64484 65839 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_20790 65836 66867 gene locus_tag LOCUS_20800 65836 66867 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_20800 66864 67448 gene locus_tag LOCUS_20810 66864 67448 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_20810 67441 68145 gene locus_tag LOCUS_20820 67441 68145 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869098.1 protein_id gnl|my_center|LOCUS_20820 68142 68732 gene locus_tag LOCUS_20830 gene rsxA 68142 68732 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_20830 68755 69579 gene locus_tag LOCUS_20840 68755 69579 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_20840 69606 70889 gene locus_tag LOCUS_20850 69606 70889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 70914 72251 gene locus_tag LOCUS_20860 70914 72251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 73819 72461 gene locus_tag LOCUS_20870 gene mgtE 73819 72461 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_20870 74295 74768 gene locus_tag LOCUS_20880 74295 74768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 >Feature sequence17 350 123 gene locus_tag LOCUS_20890 350 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 534 340 gene locus_tag LOCUS_20900 534 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 1056 679 gene locus_tag LOCUS_20910 1056 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 1277 1059 gene locus_tag LOCUS_20920 1277 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 1651 1274 gene locus_tag LOCUS_20930 1651 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 1790 1632 gene locus_tag LOCUS_20940 1790 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 2022 1774 gene locus_tag LOCUS_20950 2022 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 2349 2077 gene locus_tag LOCUS_20960 2349 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 2616 2780 gene locus_tag LOCUS_20970 2616 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 3191 2955 gene locus_tag LOCUS_20980 3191 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 3344 4075 gene locus_tag LOCUS_20990 3344 4075 CDS product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003058809.1 protein_id gnl|my_center|LOCUS_20990 4112 4828 gene locus_tag LOCUS_21000 4112 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 4949 5905 gene locus_tag LOCUS_21010 4949 5905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 6467 5889 gene locus_tag LOCUS_21020 6467 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 6814 7995 gene locus_tag LOCUS_21030 6814 7995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 8137 8051 gene locus_tag LOCUS_t00240 8137 8051 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8268 8185 gene locus_tag LOCUS_t00250 8268 8185 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8524 10059 gene locus_tag LOCUS_21040 8524 10059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 10090 11568 gene locus_tag LOCUS_21050 gene spoIVA 10090 11568 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986845.1 protein_id gnl|my_center|LOCUS_21050 11926 11711 gene locus_tag LOCUS_21060 11926 11711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 13830 11983 gene locus_tag LOCUS_21070 13830 11983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 15442 14042 gene locus_tag LOCUS_21080 gene ctpM 15442 14042 CDS product radical SAM/SPASM domain Clo7bot peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948312.1 protein_id gnl|my_center|LOCUS_21080 15773 15958 gene locus_tag LOCUS_21090 15773 15958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 15982 16965 gene locus_tag LOCUS_21100 15982 16965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 16968 17192 gene locus_tag LOCUS_21110 16968 17192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 17197 19041 gene locus_tag LOCUS_21120 17197 19041 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680888.1 protein_id gnl|my_center|LOCUS_21120 19038 20897 gene locus_tag LOCUS_21130 19038 20897 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680887.1 protein_id gnl|my_center|LOCUS_21130 21053 21220 gene locus_tag LOCUS_21140 21053 21220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 21657 22982 gene locus_tag LOCUS_21150 gene rimO 21657 22982 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198793.1 protein_id gnl|my_center|LOCUS_21150 23005 23571 gene locus_tag LOCUS_21160 gene pgsA 23005 23571 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459962.1 protein_id gnl|my_center|LOCUS_21160 23987 24643 gene locus_tag LOCUS_21170 gene cysE 23987 24643 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_21170 24713 26116 gene locus_tag LOCUS_21180 gene cysS 24713 26116 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_21180 26541 26720 gene locus_tag LOCUS_21190 26541 26720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 26950 27939 gene locus_tag LOCUS_21200 26950 27939 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703563.1 protein_id gnl|my_center|LOCUS_21200 27923 28174 gene locus_tag LOCUS_21210 27923 28174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 28216 28716 gene locus_tag LOCUS_21220 28216 28716 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428667.1 protein_id gnl|my_center|LOCUS_21220 28743 29381 gene locus_tag LOCUS_21230 28743 29381 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112761.1 protein_id gnl|my_center|LOCUS_21230 29422 30396 gene locus_tag LOCUS_21240 29422 30396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 30824 31873 gene locus_tag LOCUS_21250 30824 31873 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966511.1 protein_id gnl|my_center|LOCUS_21250 32156 32896 gene locus_tag LOCUS_21260 gene ftsE 32156 32896 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963819.1 protein_id gnl|my_center|LOCUS_21260 32893 33804 gene locus_tag LOCUS_21270 gene ftsX 32893 33804 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198720.1 protein_id gnl|my_center|LOCUS_21270 33797 35107 gene locus_tag LOCUS_21280 33797 35107 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_21280 35125 36327 gene locus_tag LOCUS_21290 35125 36327 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_21290 36732 37463 gene locus_tag LOCUS_21300 36732 37463 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362119.1 protein_id gnl|my_center|LOCUS_21300 37546 38367 gene locus_tag LOCUS_21310 37546 38367 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535365.1 protein_id gnl|my_center|LOCUS_21310 38364 39227 gene locus_tag LOCUS_21320 38364 39227 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_21320 39240 39983 gene locus_tag LOCUS_21330 39240 39983 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461000.1 protein_id gnl|my_center|LOCUS_21330 40064 40780 gene locus_tag LOCUS_21340 40064 40780 CDS product D-ribitol-5-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872486.1 protein_id gnl|my_center|LOCUS_21340 40773 41798 gene locus_tag LOCUS_21350 40773 41798 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610180.1 protein_id gnl|my_center|LOCUS_21350 41930 43282 gene locus_tag LOCUS_21360 41930 43282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 43272 44516 gene locus_tag LOCUS_21370 43272 44516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 44626 45945 gene locus_tag LOCUS_21380 44626 45945 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_21380 46029 48479 gene locus_tag LOCUS_21390 46029 48479 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620712.1 protein_id gnl|my_center|LOCUS_21390 48600 49271 gene locus_tag LOCUS_21400 48600 49271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 49350 49679 gene locus_tag LOCUS_21410 49350 49679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 49702 50886 gene locus_tag LOCUS_21420 49702 50886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 50922 51260 gene locus_tag LOCUS_21430 50922 51260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 51281 52036 gene locus_tag LOCUS_21440 51281 52036 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107878.1 protein_id gnl|my_center|LOCUS_21440 52191 52751 gene locus_tag LOCUS_21450 52191 52751 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_21450 52941 53822 gene locus_tag LOCUS_21460 gene dpsA 52941 53822 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460385.1 protein_id gnl|my_center|LOCUS_21460 53931 54503 gene locus_tag LOCUS_21470 53931 54503 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_21470 55511 54669 gene locus_tag LOCUS_21480 55511 54669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 55770 57104 gene locus_tag LOCUS_21490 55770 57104 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229240.1 protein_id gnl|my_center|LOCUS_21490 57085 57837 gene locus_tag LOCUS_21500 57085 57837 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803873.1 protein_id gnl|my_center|LOCUS_21500 57842 59107 gene locus_tag LOCUS_21510 57842 59107 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226019.1 protein_id gnl|my_center|LOCUS_21510 59258 59476 gene locus_tag LOCUS_21520 59258 59476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 59706 60668 gene locus_tag LOCUS_21530 gene manA 59706 60668 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 protein_id gnl|my_center|LOCUS_21530 61222 60767 gene locus_tag LOCUS_21540 61222 60767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 61203 61436 gene locus_tag LOCUS_21550 61203 61436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 61713 61399 gene locus_tag LOCUS_21560 61713 61399 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804080.1 protein_id gnl|my_center|LOCUS_21560 61925 62000 gene locus_tag LOCUS_t00260 61925 62000 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 62591 62866 gene locus_tag LOCUS_21570 62591 62866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 63571 62975 gene locus_tag LOCUS_21580 63571 62975 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_21580 63834 65591 gene locus_tag LOCUS_21590 63834 65591 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940378.1 protein_id gnl|my_center|LOCUS_21590 66391 65657 gene locus_tag LOCUS_21600 66391 65657 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763760.1 protein_id gnl|my_center|LOCUS_21600 68594 66381 gene locus_tag LOCUS_21610 68594 66381 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_21610 >Feature sequence18 2304 1183 gene locus_tag LOCUS_21620 2304 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 2527 3105 gene locus_tag LOCUS_21630 2527 3105 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080601.1 protein_id gnl|my_center|LOCUS_21630 3136 3975 gene locus_tag LOCUS_21640 3136 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 5553 4060 gene locus_tag LOCUS_21650 5553 4060 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682348.1 protein_id gnl|my_center|LOCUS_21650 7196 5742 gene locus_tag LOCUS_21660 gene malQ 7196 5742 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_21660 8185 7520 gene locus_tag LOCUS_21670 8185 7520 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811475.1 protein_id gnl|my_center|LOCUS_21670 9471 8185 gene locus_tag LOCUS_21680 9471 8185 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226570.1 protein_id gnl|my_center|LOCUS_21680 10481 9468 gene locus_tag LOCUS_21690 10481 9468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 10942 10577 gene locus_tag LOCUS_21700 10942 10577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 11293 11220 gene locus_tag LOCUS_t00270 11293 11220 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 11505 12362 gene locus_tag LOCUS_21710 11505 12362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 12848 12687 gene locus_tag LOCUS_21720 12848 12687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 13301 14434 gene locus_tag LOCUS_21730 13301 14434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 14596 17064 gene locus_tag LOCUS_21740 14596 17064 CDS product beta-galactosidase GalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036450.1 protein_id gnl|my_center|LOCUS_21740 17146 18510 gene locus_tag LOCUS_21750 17146 18510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 19699 19439 gene locus_tag LOCUS_21760 19699 19439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 20297 20130 gene locus_tag LOCUS_21770 20297 20130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 20926 20852 gene locus_tag LOCUS_t00280 20926 20852 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 21051 20976 gene locus_tag LOCUS_t00290 21051 20976 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 21132 21057 gene locus_tag LOCUS_t00300 21132 21057 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 21214 21138 gene locus_tag LOCUS_t00310 21214 21138 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 21296 21221 gene locus_tag LOCUS_t00320 21296 21221 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 21941 21519 gene locus_tag LOCUS_21780 21941 21519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 22853 21975 gene locus_tag LOCUS_21790 gene hslO 22853 21975 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965667.1 protein_id gnl|my_center|LOCUS_21790 23612 22854 gene locus_tag LOCUS_21800 23612 22854 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_21800 23981 23664 gene locus_tag LOCUS_21810 23981 23664 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965963.1 protein_id gnl|my_center|LOCUS_21810 24420 25205 gene locus_tag LOCUS_21820 24420 25205 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232140.1 protein_id gnl|my_center|LOCUS_21820 26137 25337 gene locus_tag LOCUS_21830 26137 25337 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566050.1 protein_id gnl|my_center|LOCUS_21830 28449 26419 gene locus_tag LOCUS_21840 gene lysS 28449 26419 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558598.1 protein_id gnl|my_center|LOCUS_21840 29789 28545 gene locus_tag LOCUS_21850 29789 28545 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963345.1 protein_id gnl|my_center|LOCUS_21850 32336 29835 gene locus_tag LOCUS_21860 32336 29835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 33309 32629 gene locus_tag LOCUS_21870 gene yunB 33309 32629 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393210.1 protein_id gnl|my_center|LOCUS_21870 33525 33788 gene locus_tag LOCUS_21880 33525 33788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 33785 34039 gene locus_tag LOCUS_21890 33785 34039 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438891.1 protein_id gnl|my_center|LOCUS_21890 35719 34151 gene locus_tag LOCUS_21900 35719 34151 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_21900 35868 35716 gene locus_tag LOCUS_21910 35868 35716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 36883 36002 gene locus_tag LOCUS_21920 36883 36002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 37482 37000 gene locus_tag LOCUS_21930 37482 37000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 38135 37656 gene locus_tag LOCUS_21940 38135 37656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 42286 38159 gene locus_tag LOCUS_21950 42286 38159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 43125 42328 gene locus_tag LOCUS_21960 43125 42328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 45260 43683 gene locus_tag LOCUS_21970 45260 43683 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861147.1 protein_id gnl|my_center|LOCUS_21970 45809 45501 gene locus_tag LOCUS_21980 45809 45501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 45970 45827 gene locus_tag LOCUS_21990 45970 45827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 49296 46189 gene locus_tag LOCUS_22000 49296 46189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 49493 50149 gene locus_tag LOCUS_22010 49493 50149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 51605 50472 gene locus_tag LOCUS_22020 51605 50472 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_22020 52178 51957 gene locus_tag LOCUS_22030 52178 51957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 52311 52132 gene locus_tag LOCUS_22040 52311 52132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 52526 53413 gene locus_tag LOCUS_22050 52526 53413 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_22050 53497 54063 gene locus_tag LOCUS_22060 53497 54063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 54552 55190 gene locus_tag LOCUS_22070 54552 55190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 55331 56587 gene locus_tag LOCUS_22080 55331 56587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 56602 57483 gene locus_tag LOCUS_22090 56602 57483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 57838 58068 gene locus_tag LOCUS_22100 57838 58068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 58069 59631 gene locus_tag LOCUS_22110 58069 59631 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence19 334 876 gene locus_tag LOCUS_22120 334 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 890 1555 gene locus_tag LOCUS_22130 890 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 1879 2937 gene locus_tag LOCUS_22140 1879 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 2956 4065 gene locus_tag LOCUS_22150 2956 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 4083 4976 gene locus_tag LOCUS_22160 4083 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 5043 5561 gene locus_tag LOCUS_22170 5043 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 5568 5810 gene locus_tag LOCUS_22180 5568 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 5917 6756 gene locus_tag LOCUS_22190 5917 6756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 6753 7589 gene locus_tag LOCUS_22200 6753 7589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 7601 10621 gene locus_tag LOCUS_22210 7601 10621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 10634 11005 gene locus_tag LOCUS_22220 10634 11005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 11201 11734 gene locus_tag LOCUS_22230 11201 11734 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108735.1 protein_id gnl|my_center|LOCUS_22230 11740 12465 gene locus_tag LOCUS_22240 11740 12465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 12503 13528 gene locus_tag LOCUS_22250 12503 13528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 13587 14363 gene locus_tag LOCUS_22260 13587 14363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 15622 14432 gene locus_tag LOCUS_22270 15622 14432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 15875 16402 gene locus_tag LOCUS_22280 15875 16402 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460496.1 protein_id gnl|my_center|LOCUS_22280 16412 17149 gene locus_tag LOCUS_22290 16412 17149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 17169 17654 gene locus_tag LOCUS_22300 17169 17654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 18282 17695 gene locus_tag LOCUS_22310 18282 17695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 18695 19024 gene locus_tag LOCUS_22320 18695 19024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 19097 19423 gene locus_tag LOCUS_22330 19097 19423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 19436 19648 gene locus_tag LOCUS_22340 19436 19648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 19642 19872 gene locus_tag LOCUS_22350 19642 19872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 19878 20150 gene locus_tag LOCUS_22360 19878 20150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 20171 20329 gene locus_tag LOCUS_22370 20171 20329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 20313 21464 gene locus_tag LOCUS_22380 20313 21464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 21523 22080 gene locus_tag LOCUS_22390 21523 22080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 22226 22540 gene locus_tag LOCUS_22400 22226 22540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 22588 23271 gene locus_tag LOCUS_22410 22588 23271 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965287.1 protein_id gnl|my_center|LOCUS_22410 24549 23335 gene locus_tag LOCUS_22420 24549 23335 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_22420 25255 26298 gene locus_tag LOCUS_22430 25255 26298 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398673.1 protein_id gnl|my_center|LOCUS_22430 26315 28564 gene locus_tag LOCUS_22440 26315 28564 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_22440 28626 29381 gene locus_tag LOCUS_22450 28626 29381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 29396 30907 gene locus_tag LOCUS_22460 29396 30907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 30977 31243 gene locus_tag LOCUS_22470 30977 31243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 31263 32006 gene locus_tag LOCUS_22480 31263 32006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 32094 32579 gene locus_tag LOCUS_22490 32094 32579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 32582 33121 gene locus_tag LOCUS_22500 32582 33121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 33124 35331 gene locus_tag LOCUS_22510 33124 35331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 35575 36012 gene locus_tag LOCUS_22520 35575 36012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 36124 37167 gene locus_tag LOCUS_22530 36124 37167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 37656 37961 gene locus_tag LOCUS_22540 37656 37961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 38669 38454 gene locus_tag LOCUS_22550 38669 38454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 38807 39451 gene locus_tag LOCUS_22560 38807 39451 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460105.1 protein_id gnl|my_center|LOCUS_22560 39523 40014 gene locus_tag LOCUS_22570 39523 40014 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816021.1 protein_id gnl|my_center|LOCUS_22570 40021 41076 gene locus_tag LOCUS_22580 40021 41076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 41288 41635 gene locus_tag LOCUS_22590 41288 41635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 41988 41632 gene locus_tag LOCUS_22600 41988 41632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 42800 42441 gene locus_tag LOCUS_22610 42800 42441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 42969 42820 gene locus_tag LOCUS_22620 42969 42820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 44331 43162 gene locus_tag LOCUS_22630 44331 43162 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461660.1 protein_id gnl|my_center|LOCUS_22630 44915 44604 gene locus_tag LOCUS_22640 44915 44604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 45254 44925 gene locus_tag LOCUS_22650 45254 44925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 45636 45421 gene locus_tag LOCUS_22660 45636 45421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 45995 45597 gene locus_tag LOCUS_22670 45995 45597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 46475 46666 gene locus_tag LOCUS_22680 46475 46666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 46671 47600 gene locus_tag LOCUS_22690 46671 47600 CDS product ParM/StbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461997.1 protein_id gnl|my_center|LOCUS_22690 47606 47980 gene locus_tag LOCUS_22700 47606 47980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 48118 48867 gene locus_tag LOCUS_22710 48118 48867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 49287 49493 gene locus_tag LOCUS_22720 49287 49493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 49523 50956 gene locus_tag LOCUS_22730 49523 50956 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_22730 51184 51108 gene locus_tag LOCUS_t00330 51184 51108 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 51538 52815 gene locus_tag LOCUS_22740 51538 52815 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404565.1 protein_id gnl|my_center|LOCUS_22740 52853 54388 gene locus_tag LOCUS_22750 gene guaA 52853 54388 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_22750 >Feature sequence20 322 247 gene locus_tag LOCUS_t00340 322 247 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1255 518 gene locus_tag LOCUS_22760 1255 518 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043775763.1 protein_id gnl|my_center|LOCUS_22760 1480 2232 gene locus_tag LOCUS_22770 1480 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 2347 3333 gene locus_tag LOCUS_22780 2347 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 3566 3402 gene locus_tag LOCUS_22790 3566 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 3799 4491 gene locus_tag LOCUS_22800 3799 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 4708 5451 gene locus_tag LOCUS_22810 4708 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 5433 6203 gene locus_tag LOCUS_22820 5433 6203 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055361.1 protein_id gnl|my_center|LOCUS_22820 6200 7045 gene locus_tag LOCUS_22830 gene rsmI 6200 7045 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530019.1 protein_id gnl|my_center|LOCUS_22830 7081 7704 gene locus_tag LOCUS_22840 7081 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 7858 8034 gene locus_tag LOCUS_22850 7858 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 8132 8662 gene locus_tag LOCUS_22860 8132 8662 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765311.1 protein_id gnl|my_center|LOCUS_22860 8693 9136 gene locus_tag LOCUS_22870 gene aroQ 8693 9136 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230223.1 protein_id gnl|my_center|LOCUS_22870 9141 10217 gene locus_tag LOCUS_22880 9141 10217 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393048.1 protein_id gnl|my_center|LOCUS_22880 10313 10870 gene locus_tag LOCUS_22890 gene efp 10313 10870 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_22890 10969 11391 gene locus_tag LOCUS_22900 10969 11391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428343.1 protein_id gnl|my_center|LOCUS_22900 11576 12100 gene locus_tag LOCUS_22910 11576 12100 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436147.1 protein_id gnl|my_center|LOCUS_22910 12113 12712 gene locus_tag LOCUS_22920 12113 12712 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547369.1 protein_id gnl|my_center|LOCUS_22920 12779 13150 gene locus_tag LOCUS_22930 12779 13150 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_22930 13157 14083 gene locus_tag LOCUS_22940 13157 14083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 14076 15668 gene locus_tag LOCUS_22950 14076 15668 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225543.1 protein_id gnl|my_center|LOCUS_22950 15665 16336 gene locus_tag LOCUS_22960 15665 16336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 17854 16424 gene locus_tag LOCUS_22970 gene purB 17854 16424 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_22970 19361 17892 gene locus_tag LOCUS_22980 gene purF 19361 17892 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_22980 20149 19442 gene locus_tag LOCUS_22990 20149 19442 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964700.1 protein_id gnl|my_center|LOCUS_22990 21466 20255 gene locus_tag LOCUS_23000 21466 20255 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788259.1 protein_id gnl|my_center|LOCUS_23000 22390 21518 gene locus_tag LOCUS_23010 gene dapF 22390 21518 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_23010 22950 22405 gene locus_tag LOCUS_23020 22950 22405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 23618 24706 gene locus_tag LOCUS_23030 gene carA 23618 24706 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104362.1 protein_id gnl|my_center|LOCUS_23030 24703 27897 gene locus_tag LOCUS_23040 gene carB 24703 27897 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392401.1 protein_id gnl|my_center|LOCUS_23040 28025 28312 gene locus_tag LOCUS_23050 28025 28312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 28434 28709 gene locus_tag LOCUS_23060 28434 28709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 29056 28781 gene locus_tag LOCUS_23070 29056 28781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 30633 29173 gene locus_tag LOCUS_23080 30633 29173 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_23080 32022 30754 gene locus_tag LOCUS_23090 32022 30754 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461202.1 protein_id gnl|my_center|LOCUS_23090 32695 32012 gene locus_tag LOCUS_23100 32695 32012 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461203.1 protein_id gnl|my_center|LOCUS_23100 33306 34076 gene locus_tag LOCUS_23110 33306 34076 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_23110 34115 34798 gene locus_tag LOCUS_23120 34115 34798 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_23120 35015 35869 gene locus_tag LOCUS_23130 35015 35869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 35859 36677 gene locus_tag LOCUS_23140 35859 36677 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994265.1 protein_id gnl|my_center|LOCUS_23140 36773 37690 gene locus_tag LOCUS_23150 36773 37690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 39369 37900 gene locus_tag LOCUS_23160 39369 37900 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_23160 39663 40640 gene locus_tag LOCUS_23170 39663 40640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 40712 43351 gene locus_tag LOCUS_23180 gene ggaB 40712 43351 CDS product poly(glucosyl N-acetylgalactosamine 1-phosphate) glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227939.1 protein_id gnl|my_center|LOCUS_23180 43906 43442 gene locus_tag LOCUS_23190 43906 43442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 44489 43923 gene locus_tag LOCUS_23200 44489 43923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 45575 44502 gene locus_tag LOCUS_23210 45575 44502 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938401.1 protein_id gnl|my_center|LOCUS_23210 45936 45568 gene locus_tag LOCUS_23220 45936 45568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 46324 45941 gene locus_tag LOCUS_23230 46324 45941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 47292 46342 gene locus_tag LOCUS_23240 47292 46342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 47795 47289 gene locus_tag LOCUS_23250 47795 47289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 47950 47825 gene locus_tag LOCUS_23260 47950 47825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 48347 47967 gene locus_tag LOCUS_23270 48347 47967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 48799 48344 gene locus_tag LOCUS_23280 48799 48344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 49152 48796 gene locus_tag LOCUS_23290 49152 48796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 49553 49179 gene locus_tag LOCUS_23300 49553 49179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 50618 49611 gene locus_tag LOCUS_23310 50618 49611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 50983 50639 gene locus_tag LOCUS_23320 50983 50639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 51986 51009 gene locus_tag LOCUS_23330 51986 51009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 53145 51979 gene locus_tag LOCUS_23340 53145 51979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 >Feature sequence21 711 493 gene locus_tag LOCUS_23350 711 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 1043 801 gene locus_tag LOCUS_23360 1043 801 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809979.1 protein_id gnl|my_center|LOCUS_23360 1174 1668 gene locus_tag LOCUS_23370 1174 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 2261 2058 gene locus_tag LOCUS_23380 2261 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 2442 2855 gene locus_tag LOCUS_23390 2442 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 4252 3071 gene locus_tag LOCUS_23400 4252 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 5983 4454 gene locus_tag LOCUS_23410 gene putP 5983 4454 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_23410 8362 6170 gene locus_tag LOCUS_23420 8362 6170 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066523182.1 protein_id gnl|my_center|LOCUS_23420 9375 8359 gene locus_tag LOCUS_23430 9375 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 10309 9380 gene locus_tag LOCUS_23440 10309 9380 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887563.1 protein_id gnl|my_center|LOCUS_23440 10651 11859 gene locus_tag LOCUS_23450 10651 11859 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814294.1 protein_id gnl|my_center|LOCUS_23450 12419 14374 gene locus_tag LOCUS_23460 gene glgB 12419 14374 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_23460 14446 15663 gene locus_tag LOCUS_23470 gene glgC 14446 15663 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057611.1 protein_id gnl|my_center|LOCUS_23470 15779 16894 gene locus_tag LOCUS_23480 gene glgD 15779 16894 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_23480 16946 18370 gene locus_tag LOCUS_23490 gene glgA 16946 18370 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042515450.1 protein_id gnl|my_center|LOCUS_23490 19174 18545 gene locus_tag LOCUS_23500 19174 18545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 19292 20002 gene locus_tag LOCUS_23510 19292 20002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 22664 20070 gene locus_tag LOCUS_23520 22664 20070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 25588 23210 gene locus_tag LOCUS_23530 25588 23210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 27397 25727 gene locus_tag LOCUS_23540 27397 25727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 28375 27449 gene locus_tag LOCUS_23550 gene srtB 28375 27449 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242427.1 protein_id gnl|my_center|LOCUS_23550 29764 28520 gene locus_tag LOCUS_23560 29764 28520 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_23560 30972 29800 gene locus_tag LOCUS_23570 gene thiI 30972 29800 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_23570 32212 31046 gene locus_tag LOCUS_23580 32212 31046 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_23580 32451 33272 gene locus_tag LOCUS_23590 32451 33272 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272547.1 protein_id gnl|my_center|LOCUS_23590 33419 34114 gene locus_tag LOCUS_23600 33419 34114 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549992.1 protein_id gnl|my_center|LOCUS_23600 34248 35012 gene locus_tag LOCUS_23610 34248 35012 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 protein_id gnl|my_center|LOCUS_23610 35403 35209 gene locus_tag LOCUS_23620 35403 35209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 36286 35366 gene locus_tag LOCUS_23630 36286 35366 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581611.1 protein_id gnl|my_center|LOCUS_23630 37828 36332 gene locus_tag LOCUS_23640 37828 36332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 39217 37844 gene locus_tag LOCUS_23650 39217 37844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 40135 39329 gene locus_tag LOCUS_23660 40135 39329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 40602 40291 gene locus_tag LOCUS_23670 40602 40291 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396712.1 protein_id gnl|my_center|LOCUS_23670 40807 40583 gene locus_tag LOCUS_23680 40807 40583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 42507 40903 gene locus_tag LOCUS_23690 42507 40903 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_23690 44131 42647 gene locus_tag LOCUS_23700 44131 42647 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_23700 45559 44231 gene locus_tag LOCUS_23710 gene guaA 45559 44231 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764094.1 protein_id gnl|my_center|LOCUS_23710 46600 45617 gene locus_tag LOCUS_23720 46600 45617 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_23720 46923 46792 gene locus_tag LOCUS_23730 46923 46792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 47116 46883 gene locus_tag LOCUS_23740 47116 46883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 47471 47295 gene locus_tag LOCUS_23750 47471 47295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 47853 47692 gene locus_tag LOCUS_23760 47853 47692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 49522 48332 gene locus_tag LOCUS_23770 49522 48332 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948371.1 protein_id gnl|my_center|LOCUS_23770 49854 50666 gene locus_tag LOCUS_23780 49854 50666 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948538.1 protein_id gnl|my_center|LOCUS_23780 51272 50997 gene locus_tag LOCUS_23790 51272 50997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence22 942 1196 gene locus_tag LOCUS_23800 gene spoIIID 942 1196 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356559.1 protein_id gnl|my_center|LOCUS_23800 1337 1939 gene locus_tag LOCUS_23810 1337 1939 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964891.1 protein_id gnl|my_center|LOCUS_23810 2378 3220 gene locus_tag LOCUS_23820 2378 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 4217 3342 gene locus_tag LOCUS_23830 gene rfbD 4217 3342 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664667.1 protein_id gnl|my_center|LOCUS_23830 5055 4498 gene locus_tag LOCUS_23840 gene rfbC 5055 4498 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721499.1 protein_id gnl|my_center|LOCUS_23840 6056 5106 gene locus_tag LOCUS_23850 gene rfbA 6056 5106 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112125.1 protein_id gnl|my_center|LOCUS_23850 6454 6687 gene locus_tag LOCUS_23860 6454 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 6713 8764 gene locus_tag LOCUS_23870 gene feoB 6713 8764 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861233.1 protein_id gnl|my_center|LOCUS_23870 8777 8989 gene locus_tag LOCUS_23880 8777 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 8982 9371 gene locus_tag LOCUS_23890 8982 9371 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010885248.1 protein_id gnl|my_center|LOCUS_23890 9361 10638 gene locus_tag LOCUS_23900 9361 10638 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_23900 10663 12267 gene locus_tag LOCUS_23910 10663 12267 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_23910 13169 12855 gene locus_tag LOCUS_23920 13169 12855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 14031 13864 gene locus_tag LOCUS_23930 14031 13864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 14313 16016 gene locus_tag LOCUS_23940 14313 16016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 16013 17326 gene locus_tag LOCUS_23950 16013 17326 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546148.1 protein_id gnl|my_center|LOCUS_23950 17344 19596 gene locus_tag LOCUS_23960 17344 19596 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459225.1 protein_id gnl|my_center|LOCUS_23960 19619 20071 gene locus_tag LOCUS_23970 19619 20071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 21883 20324 gene locus_tag LOCUS_23980 21883 20324 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_23980 22145 22444 gene locus_tag LOCUS_23990 22145 22444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 22449 22925 gene locus_tag LOCUS_24000 22449 22925 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836998.1 protein_id gnl|my_center|LOCUS_24000 22937 23590 gene locus_tag LOCUS_24010 22937 23590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 23625 24593 gene locus_tag LOCUS_24020 23625 24593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 24640 25479 gene locus_tag LOCUS_24030 24640 25479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 25516 26478 gene locus_tag LOCUS_24040 25516 26478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 26469 27455 gene locus_tag LOCUS_24050 26469 27455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 27552 28535 gene locus_tag LOCUS_24060 27552 28535 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485415.1 protein_id gnl|my_center|LOCUS_24060 28969 29802 gene locus_tag LOCUS_24070 28969 29802 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_24070 31127 30429 gene locus_tag LOCUS_24080 gene sigK 31127 30429 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 protein_id gnl|my_center|LOCUS_24080 31219 31067 gene locus_tag LOCUS_24090 31219 31067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 32233 31253 gene locus_tag LOCUS_24100 32233 31253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 34651 32654 gene locus_tag LOCUS_24110 34651 32654 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107432.1 protein_id gnl|my_center|LOCUS_24110 34973 34695 gene locus_tag LOCUS_24120 34973 34695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 36177 35269 gene locus_tag LOCUS_24130 gene trxB 36177 35269 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_24130 37703 36345 gene locus_tag LOCUS_24140 37703 36345 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_24140 39186 37990 gene locus_tag LOCUS_24150 39186 37990 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081862.1 protein_id gnl|my_center|LOCUS_24150 39400 40605 gene locus_tag LOCUS_24160 gene ackA 39400 40605 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_24160 40838 41125 gene locus_tag LOCUS_24170 40838 41125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 41383 41748 gene locus_tag LOCUS_24180 41383 41748 CDS product YmaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986739.1 protein_id gnl|my_center|LOCUS_24180 41878 41802 gene locus_tag LOCUS_t00350 41878 41802 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 42234 43517 gene locus_tag LOCUS_24190 42234 43517 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895264.1 protein_id gnl|my_center|LOCUS_24190 43824 43654 gene locus_tag LOCUS_24200 43824 43654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 44022 43840 gene locus_tag LOCUS_24210 44022 43840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 44274 44349 gene locus_tag LOCUS_t00360 44274 44349 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 45057 44344 gene locus_tag LOCUS_24220 45057 44344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 46169 45069 gene locus_tag LOCUS_24230 46169 45069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 46747 46508 gene locus_tag LOCUS_24240 46747 46508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 47241 46873 gene locus_tag LOCUS_24250 47241 46873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 47410 47246 gene locus_tag LOCUS_24260 47410 47246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 47604 47410 gene locus_tag LOCUS_24270 47604 47410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 47777 48268 gene locus_tag LOCUS_24280 47777 48268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 <49325 48802 gene locus_tag LOCUS_24290 <49325 48802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986581.1:esterase EstB >Feature sequence23 444 1865 gene locus_tag LOCUS_24300 444 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 2357 2064 gene locus_tag LOCUS_24310 2357 2064 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774520.1 protein_id gnl|my_center|LOCUS_24310 2472 3431 gene locus_tag LOCUS_24320 2472 3431 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938705.1 protein_id gnl|my_center|LOCUS_24320 3645 4346 gene locus_tag LOCUS_24330 3645 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 5746 4502 gene locus_tag LOCUS_24340 5746 4502 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404919.1 protein_id gnl|my_center|LOCUS_24340 7326 5764 gene locus_tag LOCUS_24350 7326 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 8780 7518 gene locus_tag LOCUS_24360 gene purD 8780 7518 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_24360 10085 8907 gene locus_tag LOCUS_24370 10085 8907 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_24370 10814 10110 gene locus_tag LOCUS_24380 10814 10110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 11465 10863 gene locus_tag LOCUS_24390 gene purN 11465 10863 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_24390 12493 11459 gene locus_tag LOCUS_24400 gene purM 12493 11459 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836288.1 protein_id gnl|my_center|LOCUS_24400 13994 12549 gene locus_tag LOCUS_24410 gene purF 13994 12549 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 protein_id gnl|my_center|LOCUS_24410 14535 14035 gene locus_tag LOCUS_24420 gene purE 14535 14035 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147124.1 protein_id gnl|my_center|LOCUS_24420 14882 15526 gene locus_tag LOCUS_24430 14882 15526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 17067 15589 gene locus_tag LOCUS_24440 17067 15589 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681540.1 protein_id gnl|my_center|LOCUS_24440 18495 17140 gene locus_tag LOCUS_24450 18495 17140 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_24450 18790 18521 gene locus_tag LOCUS_24460 18790 18521 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112985.1 protein_id gnl|my_center|LOCUS_24460 19087 19911 gene locus_tag LOCUS_24470 19087 19911 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459478.1 protein_id gnl|my_center|LOCUS_24470 20001 21173 gene locus_tag LOCUS_24480 20001 21173 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_24480 22466 21246 gene locus_tag LOCUS_24490 22466 21246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 22968 22642 gene locus_tag LOCUS_24500 22968 22642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 23126 22995 gene locus_tag LOCUS_24510 23126 22995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 23416 23204 gene locus_tag LOCUS_24520 23416 23204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 23676 25145 gene locus_tag LOCUS_24530 23676 25145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 25142 26149 gene locus_tag LOCUS_24540 25142 26149 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646211.1 protein_id gnl|my_center|LOCUS_24540 26432 27298 gene locus_tag LOCUS_24550 26432 27298 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_24550 27304 28188 gene locus_tag LOCUS_24560 27304 28188 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_24560 28249 28551 gene locus_tag LOCUS_24570 28249 28551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 28572 29531 gene locus_tag LOCUS_24580 28572 29531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 29549 30952 gene locus_tag LOCUS_24590 29549 30952 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039147.1 protein_id gnl|my_center|LOCUS_24590 30966 31988 gene locus_tag LOCUS_24600 30966 31988 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088034.1 protein_id gnl|my_center|LOCUS_24600 32003 32818 gene locus_tag LOCUS_24610 32003 32818 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083016.1 protein_id gnl|my_center|LOCUS_24610 34538 33075 gene locus_tag LOCUS_24620 34538 33075 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456609.1 protein_id gnl|my_center|LOCUS_24620 35894 34569 gene locus_tag LOCUS_24630 35894 34569 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828465.1 protein_id gnl|my_center|LOCUS_24630 36784 35996 gene locus_tag LOCUS_24640 36784 35996 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002325086.1 protein_id gnl|my_center|LOCUS_24640 38208 36919 gene locus_tag LOCUS_24650 gene galK 38208 36919 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_24650 38999 38250 gene locus_tag LOCUS_24660 38999 38250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 39555 40934 gene locus_tag LOCUS_24670 39555 40934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 41318 41067 gene locus_tag LOCUS_24680 41318 41067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 42292 42597 gene locus_tag LOCUS_24690 42292 42597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 42979 44013 gene locus_tag LOCUS_24700 42979 44013 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_24700 45092 44121 gene locus_tag LOCUS_24710 45092 44121 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022960.1 protein_id gnl|my_center|LOCUS_24710 45168 45374 gene locus_tag LOCUS_24720 45168 45374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 >Feature sequence24 421 1236 gene locus_tag LOCUS_24730 421 1236 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795042.1 protein_id gnl|my_center|LOCUS_24730 1233 1904 gene locus_tag LOCUS_24740 1233 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 2158 3627 gene locus_tag LOCUS_24750 2158 3627 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109123.1 protein_id gnl|my_center|LOCUS_24750 4600 3722 gene locus_tag LOCUS_24760 4600 3722 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949104.1 protein_id gnl|my_center|LOCUS_24760 5614 4787 gene locus_tag LOCUS_24770 5614 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 5916 9674 gene locus_tag LOCUS_24780 5916 9674 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272602.1 protein_id gnl|my_center|LOCUS_24780 9714 10940 gene locus_tag LOCUS_24790 9714 10940 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_24790 10980 12260 gene locus_tag LOCUS_24800 10980 12260 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_24800 15030 12382 gene locus_tag LOCUS_24810 15030 12382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 17235 15091 gene locus_tag LOCUS_24820 17235 15091 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_24820 17880 17269 gene locus_tag LOCUS_24830 17880 17269 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048232.1 protein_id gnl|my_center|LOCUS_24830 18332 19129 gene locus_tag LOCUS_24840 gene proC 18332 19129 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363318.1 protein_id gnl|my_center|LOCUS_24840 19575 19838 gene locus_tag LOCUS_24850 19575 19838 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_24850 20737 20093 gene locus_tag LOCUS_24860 20737 20093 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964199.1 protein_id gnl|my_center|LOCUS_24860 20962 20765 gene locus_tag LOCUS_24870 20962 20765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 21630 20893 gene locus_tag LOCUS_24880 21630 20893 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_24880 21940 22752 gene locus_tag LOCUS_24890 21940 22752 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542436.1 protein_id gnl|my_center|LOCUS_24890 22913 23587 gene locus_tag LOCUS_24900 22913 23587 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_24900 23873 24829 gene locus_tag LOCUS_24910 23873 24829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 24872 25096 gene locus_tag LOCUS_24920 24872 25096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 25335 25532 gene locus_tag LOCUS_24930 25335 25532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 26479 25610 gene locus_tag LOCUS_24940 26479 25610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 26692 27897 gene locus_tag LOCUS_24950 26692 27897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 27979 28236 gene locus_tag LOCUS_24960 27979 28236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 28490 29260 gene locus_tag LOCUS_24970 28490 29260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 29250 30107 gene locus_tag LOCUS_24980 29250 30107 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886850.1 protein_id gnl|my_center|LOCUS_24980 30058 31071 gene locus_tag LOCUS_24990 30058 31071 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865419.1 protein_id gnl|my_center|LOCUS_24990 31375 32169 gene locus_tag LOCUS_25000 31375 32169 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_25000 32361 32963 gene locus_tag LOCUS_25010 32361 32963 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287046.1 protein_id gnl|my_center|LOCUS_25010 34245 33211 gene locus_tag LOCUS_25020 34245 33211 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986736.1 protein_id gnl|my_center|LOCUS_25020 34532 36295 gene locus_tag LOCUS_25030 gene metG 34532 36295 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_25030 36331 36486 gene locus_tag LOCUS_25040 36331 36486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25040 36557 37273 gene locus_tag LOCUS_25050 36557 37273 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181710.1 protein_id gnl|my_center|LOCUS_25050 37307 37636 gene locus_tag LOCUS_25060 37307 37636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 37658 38434 gene locus_tag LOCUS_25070 37658 38434 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836613.1 protein_id gnl|my_center|LOCUS_25070 38450 39283 gene locus_tag LOCUS_25080 38450 39283 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947941.1 protein_id gnl|my_center|LOCUS_25080 39665 42496 gene locus_tag LOCUS_25090 gene uvrA 39665 42496 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_25090 42847 44217 gene locus_tag LOCUS_25100 gene melB 42847 44217 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005106176.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence25 5425 1523 gene locus_tag LOCUS_25110 5425 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 8272 7295 gene locus_tag LOCUS_25120 gene galT 8272 7295 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583557.1 protein_id gnl|my_center|LOCUS_25120 10081 8630 gene locus_tag LOCUS_25130 10081 8630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 11883 10414 gene locus_tag LOCUS_25140 11883 10414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 13496 11940 gene locus_tag LOCUS_25150 13496 11940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 15522 13582 gene locus_tag LOCUS_25160 gene thrS 15522 13582 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_25160 17452 15539 gene locus_tag LOCUS_25170 gene thrS 17452 15539 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_25170 18330 17464 gene locus_tag LOCUS_25180 18330 17464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 18491 18661 gene locus_tag LOCUS_25190 18491 18661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 19336 20916 gene locus_tag LOCUS_25200 gene rny 19336 20916 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428216.1 protein_id gnl|my_center|LOCUS_25200 21040 21816 gene locus_tag LOCUS_25210 21040 21816 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_25210 21894 23450 gene locus_tag LOCUS_25220 21894 23450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 23832 24185 gene locus_tag LOCUS_25230 23832 24185 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701710.1 protein_id gnl|my_center|LOCUS_25230 24275 25945 gene locus_tag LOCUS_25240 24275 25945 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_25240 25969 28011 gene locus_tag LOCUS_25250 gene recG 25969 28011 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_25250 28231 28100 gene locus_tag LOCUS_25260 28231 28100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 28582 28265 gene locus_tag LOCUS_25270 28582 28265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25270 28782 28615 gene locus_tag LOCUS_25280 28782 28615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 29410 28775 gene locus_tag LOCUS_25290 29410 28775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 30108 29569 gene locus_tag LOCUS_25300 30108 29569 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_25300 31030 30212 gene locus_tag LOCUS_25310 31030 30212 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765762.1 protein_id gnl|my_center|LOCUS_25310 31396 31938 gene locus_tag LOCUS_25320 gene rimM 31396 31938 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_25320 31922 32704 gene locus_tag LOCUS_25330 gene trmD 31922 32704 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_25330 32749 34116 gene locus_tag LOCUS_25340 32749 34116 CDS product DUF4832 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767298.1 protein_id gnl|my_center|LOCUS_25340 34965 34225 gene locus_tag LOCUS_25350 34965 34225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 35935 35048 gene locus_tag LOCUS_25360 gene ispE 35935 35048 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947969.1 protein_id gnl|my_center|LOCUS_25360 36419 37453 gene locus_tag LOCUS_25370 36419 37453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 37576 38595 gene locus_tag LOCUS_25380 37576 38595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 39893 38766 gene locus_tag LOCUS_25390 gene nagA 39893 38766 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963512.1 protein_id gnl|my_center|LOCUS_25390 40306 40112 gene locus_tag LOCUS_25400 40306 40112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 41378 40365 gene locus_tag LOCUS_25410 gene spoVAD 41378 40365 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_25410 41837 41394 gene locus_tag LOCUS_25420 gene spoVAC 41837 41394 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418420.1 protein_id gnl|my_center|LOCUS_25420 42092 42775 gene locus_tag LOCUS_25430 42092 42775 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722723.1 protein_id gnl|my_center|LOCUS_25430 <43544 42998 gene locus_tag LOCUS_25440 <43544 42998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811628.1:M23 family metallopeptidase >Feature sequence26 1148 1660 gene locus_tag LOCUS_25450 1148 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 1672 2091 gene locus_tag LOCUS_25460 1672 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 2215 2997 gene locus_tag LOCUS_25470 2215 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 3010 3318 gene locus_tag LOCUS_25480 3010 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 3449 3721 gene locus_tag LOCUS_25490 3449 3721 CDS product phage holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611512.1 protein_id gnl|my_center|LOCUS_25490 4137 3778 gene locus_tag LOCUS_25500 4137 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 4637 4143 gene locus_tag LOCUS_25510 4637 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 4888 4640 gene locus_tag LOCUS_25520 4888 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 6015 5542 gene locus_tag LOCUS_25530 gene smpB 6015 5542 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_25530 6728 6120 gene locus_tag LOCUS_25540 gene recR 6728 6120 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_25540 7076 6732 gene locus_tag LOCUS_25550 7076 6732 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_25550 7563 7093 gene locus_tag LOCUS_25560 7563 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 9309 7588 gene locus_tag LOCUS_25570 9309 7588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 10450 9803 gene locus_tag LOCUS_25580 10450 9803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 11736 10447 gene locus_tag LOCUS_25590 11736 10447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 13362 12034 gene locus_tag LOCUS_25600 gene gdhA 13362 12034 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_25600 14394 13837 gene locus_tag LOCUS_25610 14394 13837 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_25610 15701 14484 gene locus_tag LOCUS_25620 15701 14484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 17235 15772 gene locus_tag LOCUS_25630 17235 15772 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095406.1 protein_id gnl|my_center|LOCUS_25630 18272 17538 gene locus_tag LOCUS_25640 18272 17538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 18658 19887 gene locus_tag LOCUS_25650 18658 19887 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964048.1 protein_id gnl|my_center|LOCUS_25650 20272 20042 gene locus_tag LOCUS_25660 20272 20042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 20692 20504 gene locus_tag LOCUS_25670 20692 20504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 20809 21024 gene locus_tag LOCUS_25680 20809 21024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 21063 21773 gene locus_tag LOCUS_25690 21063 21773 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 protein_id gnl|my_center|LOCUS_25690 21973 22404 gene locus_tag LOCUS_25700 21973 22404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 22611 23552 gene locus_tag LOCUS_25710 22611 23552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 24600 23665 gene locus_tag LOCUS_25720 gene cysK 24600 23665 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_25720 25074 24637 gene locus_tag LOCUS_25730 gene nifU 25074 24637 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_25730 26298 25099 gene locus_tag LOCUS_25740 gene nifS 26298 25099 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_25740 26753 26295 gene locus_tag LOCUS_25750 26753 26295 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_25750 27331 26963 gene locus_tag LOCUS_25760 27331 26963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25760 27697 27350 gene locus_tag LOCUS_25770 27697 27350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25770 28161 27694 gene locus_tag LOCUS_25780 28161 27694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 28788 28522 gene locus_tag LOCUS_25790 28788 28522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 29290 28916 gene locus_tag LOCUS_25800 29290 28916 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436478.1 protein_id gnl|my_center|LOCUS_25800 29472 30776 gene locus_tag LOCUS_25810 29472 30776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 31399 30851 gene locus_tag LOCUS_25820 31399 30851 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_25820 32053 31607 gene locus_tag LOCUS_25830 32053 31607 CDS product DUF1893 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761597.1 protein_id gnl|my_center|LOCUS_25830 32800 32057 gene locus_tag LOCUS_25840 32800 32057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 33162 35756 gene locus_tag LOCUS_25850 33162 35756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 36028 38076 gene locus_tag LOCUS_25860 36028 38076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 39224 38355 gene locus_tag LOCUS_25870 39224 38355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965639.1 protein_id gnl|my_center|LOCUS_25870 39473 39952 gene locus_tag LOCUS_25880 39473 39952 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_25880 >Feature sequence27 670 125 gene locus_tag LOCUS_25890 670 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 1067 762 gene locus_tag LOCUS_25900 1067 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 1388 1528 gene locus_tag LOCUS_25910 1388 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 1807 3471 gene locus_tag LOCUS_25920 1807 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 3498 3944 gene locus_tag LOCUS_25930 3498 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 3954 4169 gene locus_tag LOCUS_25940 3954 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 6211 4052 gene locus_tag LOCUS_25950 gene feoB 6211 4052 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439379.1 protein_id gnl|my_center|LOCUS_25950 6508 6272 gene locus_tag LOCUS_25960 6508 6272 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460459.1 protein_id gnl|my_center|LOCUS_25960 6804 7583 gene locus_tag LOCUS_25970 6804 7583 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101055.1 protein_id gnl|my_center|LOCUS_25970 7528 8658 gene locus_tag LOCUS_25980 gene wecB 7528 8658 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140128.1 protein_id gnl|my_center|LOCUS_25980 9216 9049 gene locus_tag LOCUS_25990 9216 9049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 9515 10498 gene locus_tag LOCUS_26000 9515 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 10489 10995 gene locus_tag LOCUS_26010 10489 10995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 11008 12405 gene locus_tag LOCUS_26020 11008 12405 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167732.1 protein_id gnl|my_center|LOCUS_26020 12398 13786 gene locus_tag LOCUS_26030 12398 13786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 13848 14876 gene locus_tag LOCUS_26040 13848 14876 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546727.1 protein_id gnl|my_center|LOCUS_26040 14890 16032 gene locus_tag LOCUS_26050 gene neuC 14890 16032 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545909.1 protein_id gnl|my_center|LOCUS_26050 16046 16420 gene locus_tag LOCUS_26060 16046 16420 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545353.1 protein_id gnl|my_center|LOCUS_26060 16417 17112 gene locus_tag LOCUS_26070 16417 17112 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545779.1 protein_id gnl|my_center|LOCUS_26070 17489 17109 gene locus_tag LOCUS_26080 17489 17109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 17598 17377 gene locus_tag LOCUS_26090 17598 17377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 18290 17595 gene locus_tag LOCUS_26100 18290 17595 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963990.1 protein_id gnl|my_center|LOCUS_26100 18649 20187 gene locus_tag LOCUS_26110 18649 20187 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890705.1 protein_id gnl|my_center|LOCUS_26110 20218 21312 gene locus_tag LOCUS_26120 20218 21312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 21309 22466 gene locus_tag LOCUS_26130 21309 22466 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243672.1 protein_id gnl|my_center|LOCUS_26130 22665 22862 gene locus_tag LOCUS_26140 22665 22862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 24414 23032 gene locus_tag LOCUS_26150 24414 23032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 25487 24456 gene locus_tag LOCUS_26160 25487 24456 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963682.1 protein_id gnl|my_center|LOCUS_26160 26923 25736 gene locus_tag LOCUS_26170 26923 25736 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_26170 27555 27097 gene locus_tag LOCUS_26180 27555 27097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 27994 27572 gene locus_tag LOCUS_26190 27994 27572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 28449 28030 gene locus_tag LOCUS_26200 28449 28030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 29509 28676 gene locus_tag LOCUS_26210 29509 28676 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_26210 29668 29820 gene locus_tag LOCUS_26220 29668 29820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 29875 31050 gene locus_tag LOCUS_26230 29875 31050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 31253 33331 gene locus_tag LOCUS_26240 31253 33331 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108597.1 protein_id gnl|my_center|LOCUS_26240 34086 33475 gene locus_tag LOCUS_26250 gene mubP 34086 33475 CDS product mutanobactin A biosynthesis phosphopantetheinyl transferase MubP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267537.1 protein_id gnl|my_center|LOCUS_26250 37335 34135 gene locus_tag LOCUS_26260 37335 34135 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943878.1 protein_id gnl|my_center|LOCUS_26260 38383 37688 gene locus_tag LOCUS_26270 38383 37688 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_26270 39959 38430 gene locus_tag LOCUS_26280 39959 38430 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812190.1 protein_id gnl|my_center|LOCUS_26280 >Feature sequence28 417 148 gene locus_tag LOCUS_26290 417 148 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_26290 1973 531 gene locus_tag LOCUS_26300 1973 531 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_26300 3187 2015 gene locus_tag LOCUS_26310 3187 2015 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_26310 4919 3201 gene locus_tag LOCUS_26320 4919 3201 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986398.1 protein_id gnl|my_center|LOCUS_26320 5192 4947 gene locus_tag LOCUS_26330 5192 4947 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_26330 8022 5410 gene locus_tag LOCUS_26340 gene adhE 8022 5410 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260509.1 protein_id gnl|my_center|LOCUS_26340 8904 8440 gene locus_tag LOCUS_26350 8904 8440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 9744 9010 gene locus_tag LOCUS_26360 9744 9010 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_26360 10255 11781 gene locus_tag LOCUS_26370 10255 11781 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456609.1 protein_id gnl|my_center|LOCUS_26370 11878 12930 gene locus_tag LOCUS_26380 11878 12930 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_26380 13270 15276 gene locus_tag LOCUS_26390 13270 15276 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_26390 15489 16376 gene locus_tag LOCUS_26400 15489 16376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 16415 17764 gene locus_tag LOCUS_26410 16415 17764 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357478.1 protein_id gnl|my_center|LOCUS_26410 17785 19176 gene locus_tag LOCUS_26420 17785 19176 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048310.1 protein_id gnl|my_center|LOCUS_26420 19462 20163 gene locus_tag LOCUS_26430 19462 20163 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171779440.1 protein_id gnl|my_center|LOCUS_26430 20166 23780 gene locus_tag LOCUS_26440 20166 23780 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721622.1 protein_id gnl|my_center|LOCUS_26440 24164 24673 gene locus_tag LOCUS_26450 24164 24673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 24670 26400 gene locus_tag LOCUS_26460 24670 26400 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_26460 26401 28320 gene locus_tag LOCUS_26470 26401 28320 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_26470 29656 28385 gene locus_tag LOCUS_26480 29656 28385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 31201 29873 gene locus_tag LOCUS_26490 31201 29873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 32512 31832 gene locus_tag LOCUS_26500 gene sleB 32512 31832 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964005.1 protein_id gnl|my_center|LOCUS_26500 >Feature sequence29 5770 491 gene locus_tag LOCUS_26510 5770 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 5940 5767 gene locus_tag LOCUS_26520 5940 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 6750 6490 gene locus_tag LOCUS_26530 6750 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 6999 7238 gene locus_tag LOCUS_26540 6999 7238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 8029 7280 gene locus_tag LOCUS_26550 8029 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 9557 8244 gene locus_tag LOCUS_26560 9557 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 10455 9790 gene locus_tag LOCUS_26570 10455 9790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 12833 10563 gene locus_tag LOCUS_26580 12833 10563 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861457.1 protein_id gnl|my_center|LOCUS_26580 13151 14071 gene locus_tag LOCUS_26590 13151 14071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 15178 14165 gene locus_tag LOCUS_26600 gene gap 15178 14165 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292818.1 protein_id gnl|my_center|LOCUS_26600 15384 16223 gene locus_tag LOCUS_26610 15384 16223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 16658 16383 gene locus_tag LOCUS_26620 16658 16383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 18005 16806 gene locus_tag LOCUS_26630 gene metK 18005 16806 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163127.1 protein_id gnl|my_center|LOCUS_26630 18371 18961 gene locus_tag LOCUS_26640 18371 18961 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_26640 20126 19053 gene locus_tag LOCUS_26650 20126 19053 CDS product endonuclease subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387048.1 protein_id gnl|my_center|LOCUS_26650 21199 20366 gene locus_tag LOCUS_26660 21199 20366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 23195 21219 gene locus_tag LOCUS_26670 gene uvrB 23195 21219 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_26670 23737 23576 gene locus_tag LOCUS_26680 23737 23576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 23935 23741 gene locus_tag LOCUS_26690 23935 23741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 24174 24887 gene locus_tag LOCUS_26700 24174 24887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 25498 25043 gene locus_tag LOCUS_26710 25498 25043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 26250 25483 gene locus_tag LOCUS_26720 26250 25483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 26920 26408 gene locus_tag LOCUS_26730 26920 26408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 27997 26936 gene locus_tag LOCUS_26740 27997 26936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 28391 28083 gene locus_tag LOCUS_26750 28391 28083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 >Feature sequence30 447 307 gene locus_tag LOCUS_26760 447 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 694 990 gene locus_tag LOCUS_26770 694 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 968 1288 gene locus_tag LOCUS_26780 968 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 1290 1523 gene locus_tag LOCUS_26790 1290 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 1520 1723 gene locus_tag LOCUS_26800 1520 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 1720 2385 gene locus_tag LOCUS_26810 1720 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 2387 2581 gene locus_tag LOCUS_26820 2387 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 2583 3014 gene locus_tag LOCUS_26830 2583 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 3018 3401 gene locus_tag LOCUS_26840 3018 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 3398 3991 gene locus_tag LOCUS_26850 3398 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 4017 4535 gene locus_tag LOCUS_26860 4017 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 4537 5301 gene locus_tag LOCUS_26870 4537 5301 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989482.1 protein_id gnl|my_center|LOCUS_26870 5302 5817 gene locus_tag LOCUS_26880 5302 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 5756 6247 gene locus_tag LOCUS_26890 5756 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 6237 6659 gene locus_tag LOCUS_26900 6237 6659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 6662 7129 gene locus_tag LOCUS_26910 6662 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 7359 7988 gene locus_tag LOCUS_26920 7359 7988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 8034 8672 gene locus_tag LOCUS_26930 8034 8672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 8669 8812 gene locus_tag LOCUS_26940 8669 8812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 8832 9104 gene locus_tag LOCUS_26950 8832 9104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 9903 10910 gene locus_tag LOCUS_26960 9903 10910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 10914 11138 gene locus_tag LOCUS_26970 10914 11138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 11173 11670 gene locus_tag LOCUS_26980 11173 11670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 11667 13361 gene locus_tag LOCUS_26990 11667 13361 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387707.1 protein_id gnl|my_center|LOCUS_26990 13371 15461 gene locus_tag LOCUS_27000 13371 15461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 15619 15768 gene locus_tag LOCUS_27010 15619 15768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 15864 16928 gene locus_tag LOCUS_27020 15864 16928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 16972 17397 gene locus_tag LOCUS_27030 16972 17397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 17431 18441 gene locus_tag LOCUS_27040 17431 18441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 18500 19591 gene locus_tag LOCUS_27050 18500 19591 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_27050 19588 19974 gene locus_tag LOCUS_27060 19588 19974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 20435 20046 gene locus_tag LOCUS_27070 20435 20046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 >Feature sequence31 1539 1174 gene locus_tag LOCUS_27080 1539 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 1871 1566 gene locus_tag LOCUS_27090 1871 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 2093 1884 gene locus_tag LOCUS_27100 2093 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 2941 2105 gene locus_tag LOCUS_27110 2941 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 3352 3008 gene locus_tag LOCUS_27120 3352 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 5168 3327 gene locus_tag LOCUS_27130 5168 3327 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860784.1 protein_id gnl|my_center|LOCUS_27130 5346 5155 gene locus_tag LOCUS_27140 5346 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 6249 5359 gene locus_tag LOCUS_27150 6249 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 7152 6253 gene locus_tag LOCUS_27160 7152 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 8518 7094 gene locus_tag LOCUS_27170 8518 7094 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102364993.1 protein_id gnl|my_center|LOCUS_27170 8822 8520 gene locus_tag LOCUS_27180 8822 8520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 9157 8981 gene locus_tag LOCUS_27190 9157 8981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 9532 9251 gene locus_tag LOCUS_27200 9532 9251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 10461 9529 gene locus_tag LOCUS_27210 10461 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 11399 10449 gene locus_tag LOCUS_27220 11399 10449 CDS product DUF3991 and toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368706.1 protein_id gnl|my_center|LOCUS_27220 11739 11401 gene locus_tag LOCUS_27230 11739 11401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 12797 11856 gene locus_tag LOCUS_27240 12797 11856 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945539.1 protein_id gnl|my_center|LOCUS_27240 13080 12802 gene locus_tag LOCUS_27250 13080 12802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 13407 14021 gene locus_tag LOCUS_27260 13407 14021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 14069 14566 gene locus_tag LOCUS_27270 14069 14566 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_27270 14553 15182 gene locus_tag LOCUS_27280 14553 15182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 >Feature sequence32 890 1450 gene locus_tag LOCUS_27290 890 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 1870 1493 gene locus_tag LOCUS_27300 1870 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 4296 1876 gene locus_tag LOCUS_27310 4296 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 4432 4788 gene locus_tag LOCUS_27320 4432 4788 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497212.1 protein_id gnl|my_center|LOCUS_27320 4792 5079 gene locus_tag LOCUS_27330 4792 5079 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391158.1 protein_id gnl|my_center|LOCUS_27330 5693 5100 gene locus_tag LOCUS_27340 5693 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 6144 5686 gene locus_tag LOCUS_27350 6144 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 6670 6158 gene locus_tag LOCUS_27360 6670 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 7122 6670 gene locus_tag LOCUS_27370 7122 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 7536 7126 gene locus_tag LOCUS_27380 7536 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 7856 7515 gene locus_tag LOCUS_27390 7856 7515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 8224 7850 gene locus_tag LOCUS_27400 8224 7850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 9412 8237 gene locus_tag LOCUS_27410 9412 8237 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389876.1 protein_id gnl|my_center|LOCUS_27410 9974 9417 gene locus_tag LOCUS_27420 9974 9417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 11730 10207 gene locus_tag LOCUS_27430 11730 10207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 13349 11730 gene locus_tag LOCUS_27440 13349 11730 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989955.1 protein_id gnl|my_center|LOCUS_27440 14605 13355 gene locus_tag LOCUS_27450 14605 13355 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_27450 15055 14606 gene locus_tag LOCUS_27460 15055 14606 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383816.1 protein_id gnl|my_center|LOCUS_27460 15575 15135 gene locus_tag LOCUS_27470 15575 15135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence33 <1 1155 gene locus_tag LOCUS_27480 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861361.1:ATP-binding protein 1194 1652 gene locus_tag LOCUS_27490 1194 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 1562 3649 gene locus_tag LOCUS_27500 1562 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 5207 3828 gene locus_tag LOCUS_27510 5207 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 6316 5450 gene locus_tag LOCUS_27520 6316 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 6773 6351 gene locus_tag LOCUS_27530 6773 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 7774 6791 gene locus_tag LOCUS_27540 7774 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 8767 7874 gene locus_tag LOCUS_27550 8767 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 8934 8797 gene locus_tag LOCUS_27560 8934 8797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 9051 9320 gene locus_tag LOCUS_27570 9051 9320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 9441 9701 gene locus_tag LOCUS_27580 9441 9701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 10041 10400 gene locus_tag LOCUS_27590 10041 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 10534 10776 gene locus_tag LOCUS_27600 10534 10776 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809979.1 protein_id gnl|my_center|LOCUS_27600 11374 11895 gene locus_tag LOCUS_27610 11374 11895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 12491 13024 gene locus_tag LOCUS_27620 12491 13024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 13021 13224 gene locus_tag LOCUS_27630 13021 13224 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262306.1 protein_id gnl|my_center|LOCUS_27630 13312 14499 gene locus_tag LOCUS_27640 13312 14499 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860746.1 protein_id gnl|my_center|LOCUS_27640 >Feature sequence34 4583 4269 gene locus_tag LOCUS_27650 4583 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 5036 4641 gene locus_tag LOCUS_27660 5036 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 7237 5096 gene locus_tag LOCUS_27670 7237 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 9064 7307 gene locus_tag LOCUS_27680 9064 7307 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836303.1 protein_id gnl|my_center|LOCUS_27680 10334 9099 gene locus_tag LOCUS_27690 10334 9099 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202216.1 protein_id gnl|my_center|LOCUS_27690 12490 10331 gene locus_tag LOCUS_27700 12490 10331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 <13903 12506 gene locus_tag LOCUS_27710 <13903 12506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108778.1:glycoside hydrolase family 2 TIM barrel-domain containing protein >Feature sequence35 342 560 gene locus_tag LOCUS_27720 342 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 687 821 gene locus_tag LOCUS_27730 687 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 1594 890 gene locus_tag LOCUS_27740 1594 890 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039550.1 protein_id gnl|my_center|LOCUS_27740 2893 4143 gene locus_tag LOCUS_27750 gene glyA 2893 4143 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227669.1 protein_id gnl|my_center|LOCUS_27750 4251 5060 gene locus_tag LOCUS_27760 4251 5060 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_27760 5773 5138 gene locus_tag LOCUS_27770 5773 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 8993 5877 gene locus_tag LOCUS_27780 gene lacZ 8993 5877 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_27780 9329 10678 gene locus_tag LOCUS_27790 gene ypeB 9329 10678 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391745.1 protein_id gnl|my_center|LOCUS_27790 10798 11097 gene locus_tag LOCUS_27800 10798 11097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 11562 11182 gene locus_tag LOCUS_27810 11562 11182 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419037.1 protein_id gnl|my_center|LOCUS_27810 >Feature sequence36 633 1688 gene locus_tag LOCUS_27820 633 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 1685 3298 gene locus_tag LOCUS_27830 1685 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 3658 4008 gene locus_tag LOCUS_27840 3658 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 4062 4631 gene locus_tag LOCUS_27850 4062 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 5107 6606 gene locus_tag LOCUS_27860 5107 6606 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267608.1 protein_id gnl|my_center|LOCUS_27860 6603 7445 gene locus_tag LOCUS_27870 6603 7445 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272232.1 protein_id gnl|my_center|LOCUS_27870 7743 7591 gene locus_tag LOCUS_27880 7743 7591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 7857 8045 gene locus_tag LOCUS_27890 7857 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 9739 8975 gene locus_tag LOCUS_27900 9739 8975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 9977 11023 gene locus_tag LOCUS_27910 9977 11023 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966051.1 protein_id gnl|my_center|LOCUS_27910 11172 11414 gene locus_tag LOCUS_27920 11172 11414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 >Feature sequence37 3188 1260 gene locus_tag LOCUS_27930 gene iolD 3188 1260 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195356.1 protein_id gnl|my_center|LOCUS_27930 4009 3206 gene locus_tag LOCUS_27940 4009 3206 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900828.1 protein_id gnl|my_center|LOCUS_27940 5103 4201 gene locus_tag LOCUS_27950 gene iolE 5103 4201 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471986.1 protein_id gnl|my_center|LOCUS_27950 5458 5243 gene locus_tag LOCUS_27960 5458 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 6048 6458 gene locus_tag LOCUS_27970 6048 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 6580 6843 gene locus_tag LOCUS_27980 6580 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 9435 7534 gene locus_tag LOCUS_27990 9435 7534 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897930.1 protein_id gnl|my_center|LOCUS_27990 11391 9964 gene locus_tag LOCUS_28000 11391 9964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 >Feature sequence38 2072 1071 gene locus_tag LOCUS_28010 2072 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 2400 3188 gene locus_tag LOCUS_28020 gene pdaB 2400 3188 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048155.1 protein_id gnl|my_center|LOCUS_28020 3895 3278 gene locus_tag LOCUS_28030 3895 3278 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225731.1 protein_id gnl|my_center|LOCUS_28030 4131 3913 gene locus_tag LOCUS_28040 4131 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 7197 4171 gene locus_tag LOCUS_28050 7197 4171 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085775.1 protein_id gnl|my_center|LOCUS_28050 8428 7361 gene locus_tag LOCUS_28060 8428 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460508.1 protein_id gnl|my_center|LOCUS_28060 8510 8827 gene locus_tag LOCUS_28070 8510 8827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 8863 10059 gene locus_tag LOCUS_28080 gene yqfD 8863 10059 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047998.1 protein_id gnl|my_center|LOCUS_28080 10093 10275 gene locus_tag LOCUS_28090 10093 10275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 10336 10482 gene locus_tag LOCUS_28100 10336 10482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 10587 10775 gene locus_tag LOCUS_28110 10587 10775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 >Feature sequence39 1400 438 gene locus_tag LOCUS_28120 1400 438 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_28120 2495 1413 gene locus_tag LOCUS_28130 2495 1413 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007539819.1 protein_id gnl|my_center|LOCUS_28130 2849 3223 gene locus_tag LOCUS_28140 2849 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28140 3248 3568 gene locus_tag LOCUS_28150 3248 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28150 3550 3789 gene locus_tag LOCUS_28160 3550 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 4404 4736 gene locus_tag LOCUS_28170 4404 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28170 4806 5159 gene locus_tag LOCUS_28180 4806 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28180 5268 5411 gene locus_tag LOCUS_28190 5268 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 6391 5531 gene locus_tag LOCUS_28200 6391 5531 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963515.1 protein_id gnl|my_center|LOCUS_28200 7412 6414 gene locus_tag LOCUS_28210 7412 6414 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_28210 8280 7354 gene locus_tag LOCUS_28220 gene murQ 8280 7354 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963499.1 protein_id gnl|my_center|LOCUS_28220 >Feature sequence40 223 137 gene locus_tag LOCUS_t00370 223 137 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1026 1844 gene locus_tag LOCUS_28230 1026 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 1875 2339 gene locus_tag LOCUS_28240 1875 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 2363 2851 gene locus_tag LOCUS_28250 gene sigV 2363 2851 CDS product RNA polymerase sigma factor SigV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398891.1 protein_id gnl|my_center|LOCUS_28250 2963 3811 gene locus_tag LOCUS_28260 gene rsiV 2963 3811 CDS product anti-sigma-V factor RsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398482.1 protein_id gnl|my_center|LOCUS_28260 3824 5239 gene locus_tag LOCUS_28270 3824 5239 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_28270 5261 6412 gene locus_tag LOCUS_28280 5261 6412 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_28280 6498 6584 gene locus_tag LOCUS_t00380 6498 6584 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6752 7192 gene locus_tag LOCUS_28290 6752 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 7265 7636 gene locus_tag LOCUS_28300 7265 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 8242 7799 gene locus_tag LOCUS_28310 8242 7799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 9131 8289 gene locus_tag LOCUS_28320 9131 8289 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789270.1 protein_id gnl|my_center|LOCUS_28320 9858 9283 gene locus_tag LOCUS_28330 9858 9283 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_28330 >Feature sequence41 122 283 gene locus_tag LOCUS_28340 122 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 424 888 gene locus_tag LOCUS_28350 424 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 1967 1308 gene locus_tag LOCUS_28360 1967 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 2312 2034 gene locus_tag LOCUS_28370 2312 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28370 2574 2305 gene locus_tag LOCUS_28380 2574 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 2820 2623 gene locus_tag LOCUS_28390 2820 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28390 3041 2796 gene locus_tag LOCUS_28400 3041 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 3448 3044 gene locus_tag LOCUS_28410 3448 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461992.1 protein_id gnl|my_center|LOCUS_28410 3963 3775 gene locus_tag LOCUS_28420 3963 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 4804 5247 gene locus_tag LOCUS_28430 4804 5247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 5263 5643 gene locus_tag LOCUS_28440 5263 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 6142 7533 gene locus_tag LOCUS_28450 6142 7533 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940093.1 protein_id gnl|my_center|LOCUS_28450 >Feature sequence42 729 2099 gene locus_tag LOCUS_28460 729 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 2604 2909 gene locus_tag LOCUS_28470 2604 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 3289 3702 gene locus_tag LOCUS_28480 3289 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 4005 4280 gene locus_tag LOCUS_28490 4005 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 4542 4466 gene locus_tag LOCUS_t00390 4542 4466 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4623 4547 gene locus_tag LOCUS_t00400 4623 4547 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4737 4664 gene locus_tag LOCUS_t00410 4737 4664 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4942 5628 gene locus_tag LOCUS_28500 4942 5628 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812251.1 protein_id gnl|my_center|LOCUS_28500 5670 6758 gene locus_tag LOCUS_28510 5670 6758 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_28510 6748 7542 gene locus_tag LOCUS_28520 6748 7542 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_28520 >Feature sequence43 1569 112 gene locus_tag LOCUS_28530 1569 112 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304851.1 protein_id gnl|my_center|LOCUS_28530 3347 1575 gene locus_tag LOCUS_28540 3347 1575 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902683.1 protein_id gnl|my_center|LOCUS_28540 5049 3427 gene locus_tag LOCUS_28550 5049 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 6061 5141 gene locus_tag LOCUS_28560 6061 5141 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804067.1 protein_id gnl|my_center|LOCUS_28560 7026 6076 gene locus_tag LOCUS_28570 7026 6076 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_28570 >Feature sequence44 <1 827 gene locus_tag LOCUS_28580 <1 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582718.1:carbohydrate ABC transporter permease 857 2653 gene locus_tag LOCUS_28590 857 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 2868 3626 gene locus_tag LOCUS_28600 2868 3626 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972957.1 protein_id gnl|my_center|LOCUS_28600 3634 5514 gene locus_tag LOCUS_28610 3634 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 5492 7093 gene locus_tag LOCUS_28620 5492 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 >Feature sequence45 1336 134 gene locus_tag LOCUS_28630 1336 134 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_28630 1830 1336 gene locus_tag LOCUS_28640 1830 1336 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438466.1 protein_id gnl|my_center|LOCUS_28640 1980 2162 gene locus_tag LOCUS_28650 1980 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 2159 2395 gene locus_tag LOCUS_28660 2159 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 2428 4410 gene locus_tag LOCUS_28670 2428 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28670 4476 4805 gene locus_tag LOCUS_28680 4476 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 4964 5299 gene locus_tag LOCUS_28690 4964 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 5274 5471 gene locus_tag LOCUS_28700 5274 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 5488 5847 gene locus_tag LOCUS_28710 5488 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 6332 6934 gene locus_tag LOCUS_28720 6332 6934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence46 496 924 gene locus_tag LOCUS_28730 496 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 921 2618 gene locus_tag LOCUS_28740 921 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 2673 3089 gene locus_tag LOCUS_28750 2673 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 3070 3231 gene locus_tag LOCUS_28760 3070 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 3293 4639 gene locus_tag LOCUS_28770 3293 4639 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081586538.1 protein_id gnl|my_center|LOCUS_28770 4627 6240 gene locus_tag LOCUS_28780 4627 6240 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_28780 6240 6632 gene locus_tag LOCUS_28790 6240 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 >Feature sequence47 26 814 gene locus_tag LOCUS_28800 26 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 1057 1836 gene locus_tag LOCUS_28810 1057 1836 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722374.1 protein_id gnl|my_center|LOCUS_28810 2528 3967 gene locus_tag LOCUS_28820 2528 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 4002 4688 gene locus_tag LOCUS_28830 4002 4688 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963693.1 protein_id gnl|my_center|LOCUS_28830 4685 5752 gene locus_tag LOCUS_28840 4685 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 5736 6233 gene locus_tag LOCUS_28850 5736 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 6344 6751 gene locus_tag LOCUS_28860 6344 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 >Feature sequence48 371 667 gene locus_tag LOCUS_28870 371 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943419.1 protein_id gnl|my_center|LOCUS_28870 798 1109 gene locus_tag LOCUS_28880 798 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 1239 2576 gene locus_tag LOCUS_28890 1239 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 2579 3442 gene locus_tag LOCUS_28900 2579 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 4275 3676 gene locus_tag LOCUS_28910 4275 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 5752 4352 gene locus_tag LOCUS_28920 gene murC 5752 4352 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_28920 6095 6562 gene locus_tag LOCUS_28930 6095 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 >Feature sequence49 371 949 gene locus_tag LOCUS_28940 371 949 CDS product phage scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047641.1 protein_id gnl|my_center|LOCUS_28940 963 2063 gene locus_tag LOCUS_28950 963 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 2063 2413 gene locus_tag LOCUS_28960 2063 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 2415 2762 gene locus_tag LOCUS_28970 2415 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 2759 3199 gene locus_tag LOCUS_28980 2759 3199 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002403769.1 protein_id gnl|my_center|LOCUS_28980 3196 3585 gene locus_tag LOCUS_28990 3196 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 3626 4051 gene locus_tag LOCUS_29000 3626 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 4077 4418 gene locus_tag LOCUS_29010 4077 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 4502 4774 gene locus_tag LOCUS_29020 4502 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 >Feature sequence50 1940 1563 gene locus_tag LOCUS_29030 1940 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 2107 2274 gene locus_tag LOCUS_29040 2107 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 2305 2454 gene locus_tag LOCUS_29050 2305 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 2451 3239 gene locus_tag LOCUS_29060 2451 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 3773 4291 gene locus_tag LOCUS_29070 3773 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 4347 4583 gene locus_tag LOCUS_29080 4347 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 4643 5023 gene locus_tag LOCUS_29090 4643 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 >Feature sequence51 6 902 gene locus_tag LOCUS_29100 6 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 1031 1336 gene locus_tag LOCUS_29110 1031 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 1336 2052 gene locus_tag LOCUS_29120 1336 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 2082 2969 gene locus_tag LOCUS_29130 2082 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 3647 5557 gene locus_tag LOCUS_29140 gene ltrA 3647 5557 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286940.1 protein_id gnl|my_center|LOCUS_29140 >Feature sequence52 57 215 gene locus_tag LOCUS_29150 57 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 212 820 gene locus_tag LOCUS_29160 212 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29160 830 1357 gene locus_tag LOCUS_29170 830 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 1997 1719 gene locus_tag LOCUS_29180 1997 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 3186 2650 gene locus_tag LOCUS_29190 3186 2650 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068139.1 protein_id gnl|my_center|LOCUS_29190 4594 3200 gene locus_tag LOCUS_29200 4594 3200 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072447.1 protein_id gnl|my_center|LOCUS_29200 5060 4863 gene locus_tag LOCUS_29210 5060 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 >Feature sequence53 258 1496 gene locus_tag LOCUS_29220 258 1496 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047809.1 protein_id gnl|my_center|LOCUS_29220 1501 3036 gene locus_tag LOCUS_29230 1501 3036 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861027.1 protein_id gnl|my_center|LOCUS_29230 3033 4634 gene locus_tag LOCUS_29240 3033 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 4640 4834 gene locus_tag LOCUS_29250 4640 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 >Feature sequence54 1389 2048 gene locus_tag LOCUS_29260 1389 2048 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454838.1 protein_id gnl|my_center|LOCUS_29260 2160 4664 gene locus_tag LOCUS_29270 2160 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 >Feature sequence55 <1 962 gene locus_tag LOCUS_29280 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674640.1:phage tail tape measure protein 962 1837 gene locus_tag LOCUS_29290 962 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 1840 2955 gene locus_tag LOCUS_29300 1840 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 2969 4021 gene locus_tag LOCUS_29310 2969 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 >Feature sequence56 1200 730 gene locus_tag LOCUS_29320 1200 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 1264 1419 gene locus_tag LOCUS_29330 1264 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 1716 2048 gene locus_tag LOCUS_29340 1716 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 2273 2076 gene locus_tag LOCUS_29350 2273 2076 CDS product cysteine-rich KTR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387697.1 protein_id gnl|my_center|LOCUS_29350 2791 2270 gene locus_tag LOCUS_29360 2791 2270 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399375.1 protein_id gnl|my_center|LOCUS_29360 3516 2788 gene locus_tag LOCUS_29370 3516 2788 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_29370 3894 3538 gene locus_tag LOCUS_29380 3894 3538 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214305.1 protein_id gnl|my_center|LOCUS_29380 <4825 3891 gene locus_tag LOCUS_29390 <4825 3891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817208.1:FAD:protein FMN transferase >Feature sequence57 427 1542 gene locus_tag LOCUS_29400 427 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 1561 2025 gene locus_tag LOCUS_29410 gene tadA 1561 2025 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254132.1 protein_id gnl|my_center|LOCUS_29410 2045 2902 gene locus_tag LOCUS_29420 2045 2902 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_29420 3874 2978 gene locus_tag LOCUS_29430 3874 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430