>Feature sequence001 1318 725 gene locus_tag LOCUS_00010 1318 725 CDS product methanogenesis marker 17 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023888.1 protein_id gnl|my_center|LOCUS_00010 2565 1324 gene locus_tag LOCUS_00020 2565 1324 CDS product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023889.1 protein_id gnl|my_center|LOCUS_00020 3014 2562 gene locus_tag LOCUS_00030 3014 2562 CDS product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066559.1 protein_id gnl|my_center|LOCUS_00030 3455 3024 gene locus_tag LOCUS_00040 3455 3024 CDS product methanogenesis marker 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065869.1 protein_id gnl|my_center|LOCUS_00040 5007 3445 gene locus_tag LOCUS_00050 5007 3445 CDS product methanogenesis marker 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023892.1 protein_id gnl|my_center|LOCUS_00050 6646 5030 gene locus_tag LOCUS_00060 gene atwA 6646 5030 CDS product methyl coenzyme M reductase system, component A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023893.1 protein_id gnl|my_center|LOCUS_00060 7696 6878 gene locus_tag LOCUS_00070 7696 6878 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023894.1 protein_id gnl|my_center|LOCUS_00070 7863 8150 gene locus_tag LOCUS_00080 7863 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8174 8536 gene locus_tag LOCUS_00090 8174 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8549 10255 gene locus_tag LOCUS_00100 8549 10255 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023883.1 protein_id gnl|my_center|LOCUS_00100 10436 10819 gene locus_tag LOCUS_00110 10436 10819 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023881.1 protein_id gnl|my_center|LOCUS_00110 10892 11743 gene locus_tag LOCUS_00120 gene speB 10892 11743 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023880.1 protein_id gnl|my_center|LOCUS_00120 11850 12500 gene locus_tag LOCUS_00130 11850 12500 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020594.1 protein_id gnl|my_center|LOCUS_00130 12467 13135 gene locus_tag LOCUS_00140 12467 13135 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879811.1 protein_id gnl|my_center|LOCUS_00140 13258 13713 gene locus_tag LOCUS_00150 13258 13713 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020591.1 protein_id gnl|my_center|LOCUS_00150 13761 14468 gene locus_tag LOCUS_00160 13761 14468 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064937.1 protein_id gnl|my_center|LOCUS_00160 14518 15339 gene locus_tag LOCUS_00170 gene hisF 14518 15339 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020590.1 protein_id gnl|my_center|LOCUS_00170 15383 15643 gene locus_tag LOCUS_00180 15383 15643 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020589.1 protein_id gnl|my_center|LOCUS_00180 16560 15664 gene locus_tag LOCUS_00190 16560 15664 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020666.1 protein_id gnl|my_center|LOCUS_00190 18460 16976 gene locus_tag LOCUS_00200 18460 16976 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920935.1 protein_id gnl|my_center|LOCUS_00200 19986 18619 gene locus_tag LOCUS_00210 19986 18619 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021373.1 protein_id gnl|my_center|LOCUS_00210 21467 20100 gene locus_tag LOCUS_00220 21467 20100 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021373.1 protein_id gnl|my_center|LOCUS_00220 22461 21565 gene locus_tag LOCUS_00230 22461 21565 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_00230 23004 22573 gene locus_tag LOCUS_00240 23004 22573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 24577 23144 gene locus_tag LOCUS_00250 24577 23144 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_00250 25662 24892 gene locus_tag LOCUS_00260 25662 24892 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020864.1 protein_id gnl|my_center|LOCUS_00260 25835 26764 gene locus_tag LOCUS_00270 gene mdh 25835 26764 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020863.1 protein_id gnl|my_center|LOCUS_00270 26847 27113 gene locus_tag LOCUS_00280 26847 27113 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020862.1 protein_id gnl|my_center|LOCUS_00280 27121 27852 gene locus_tag LOCUS_00290 27121 27852 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_00290 27907 28866 gene locus_tag LOCUS_00300 27907 28866 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020859.1 protein_id gnl|my_center|LOCUS_00300 28945 30078 gene locus_tag LOCUS_00310 28945 30078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022800.1 protein_id gnl|my_center|LOCUS_00310 30468 32525 gene locus_tag LOCUS_00320 30468 32525 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023047.1 protein_id gnl|my_center|LOCUS_00320 32755 33195 gene locus_tag LOCUS_00330 32755 33195 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021476.1 protein_id gnl|my_center|LOCUS_00330 33628 34467 gene locus_tag LOCUS_00340 gene nadC 33628 34467 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020993.1 protein_id gnl|my_center|LOCUS_00340 35006 34614 gene locus_tag LOCUS_00350 35006 34614 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021676.1 protein_id gnl|my_center|LOCUS_00350 35136 36413 gene locus_tag LOCUS_00360 gene eno 35136 36413 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065179.1 protein_id gnl|my_center|LOCUS_00360 37548 36682 gene locus_tag LOCUS_00370 37548 36682 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024123.1 protein_id gnl|my_center|LOCUS_00370 38396 37551 gene locus_tag LOCUS_00380 38396 37551 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024124.1 protein_id gnl|my_center|LOCUS_00380 38844 38449 gene locus_tag LOCUS_00390 38844 38449 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065940.1 protein_id gnl|my_center|LOCUS_00390 39105 38857 gene locus_tag LOCUS_00400 39105 38857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 41283 39349 gene locus_tag LOCUS_00410 41283 39349 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024088.1 protein_id gnl|my_center|LOCUS_00410 41402 42133 gene locus_tag LOCUS_00420 41402 42133 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024284.1 protein_id gnl|my_center|LOCUS_00420 42299 42634 gene locus_tag LOCUS_00430 42299 42634 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024127.1 protein_id gnl|my_center|LOCUS_00430 42588 42773 gene locus_tag LOCUS_00440 42588 42773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 42760 43530 gene locus_tag LOCUS_00450 42760 43530 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024128.1 protein_id gnl|my_center|LOCUS_00450 43707 44018 gene locus_tag LOCUS_00460 43707 44018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00460 46721 44475 gene locus_tag LOCUS_00470 gene mgtA 46721 44475 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402038.1 protein_id gnl|my_center|LOCUS_00470 47379 48446 gene locus_tag LOCUS_00480 47379 48446 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022231.1 protein_id gnl|my_center|LOCUS_00480 48651 50453 gene locus_tag LOCUS_00490 48651 50453 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937606.1 protein_id gnl|my_center|LOCUS_00490 50564 51196 gene locus_tag LOCUS_00500 50564 51196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020214.1 protein_id gnl|my_center|LOCUS_00500 51264 51695 gene locus_tag LOCUS_00510 51264 51695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020121.1 protein_id gnl|my_center|LOCUS_00510 52494 51727 gene locus_tag LOCUS_00520 52494 51727 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_00520 53321 52494 gene locus_tag LOCUS_00530 53321 52494 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020123.1 protein_id gnl|my_center|LOCUS_00530 54391 53372 gene locus_tag LOCUS_00540 54391 53372 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020124.1 protein_id gnl|my_center|LOCUS_00540 54541 55062 gene locus_tag LOCUS_00550 54541 55062 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020126.1 protein_id gnl|my_center|LOCUS_00550 58518 55069 gene locus_tag LOCUS_00560 58518 55069 CDS product S-layer protein domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020127.1 protein_id gnl|my_center|LOCUS_00560 59548 58550 gene locus_tag LOCUS_00570 gene thiL 59548 58550 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066048.1 protein_id gnl|my_center|LOCUS_00570 60640 59855 gene locus_tag LOCUS_00580 60640 59855 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020130.1 protein_id gnl|my_center|LOCUS_00580 63032 60651 gene locus_tag LOCUS_00590 gene nrdD 63032 60651 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020131.1 protein_id gnl|my_center|LOCUS_00590 63302 63051 gene locus_tag LOCUS_00600 63302 63051 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064801.1 protein_id gnl|my_center|LOCUS_00600 63704 64300 gene locus_tag LOCUS_00610 gene radB 63704 64300 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860416.1 protein_id gnl|my_center|LOCUS_00610 65070 64318 gene locus_tag LOCUS_00620 65070 64318 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902268.1 protein_id gnl|my_center|LOCUS_00620 66909 65086 gene locus_tag LOCUS_00630 66909 65086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 68510 67176 gene locus_tag LOCUS_00640 68510 67176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 68864 69883 gene locus_tag LOCUS_00650 68864 69883 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064802.1 protein_id gnl|my_center|LOCUS_00650 69908 70147 gene locus_tag LOCUS_00660 69908 70147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 70482 70192 gene locus_tag LOCUS_00670 70482 70192 CDS product signal recognition particle protein Srp19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066074.1 protein_id gnl|my_center|LOCUS_00670 70967 70539 gene locus_tag LOCUS_00680 70967 70539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 71175 71339 gene locus_tag LOCUS_00690 71175 71339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 71803 71336 gene locus_tag LOCUS_00700 71803 71336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 71899 72351 gene locus_tag LOCUS_00710 71899 72351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 73137 72325 gene locus_tag LOCUS_00720 73137 72325 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020335.1 protein_id gnl|my_center|LOCUS_00720 73534 74439 gene locus_tag LOCUS_00730 gene mtrE 73534 74439 CDS product tetrahydromethanopterin S-methyltransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020334.1 protein_id gnl|my_center|LOCUS_00730 74436 75188 gene locus_tag LOCUS_00740 gene mtrD 74436 75188 CDS product tetrahydromethanopterin S-methyltransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020333.1 protein_id gnl|my_center|LOCUS_00740 75190 76017 gene locus_tag LOCUS_00750 gene mtrC 75190 76017 CDS product tetrahydromethanopterin S-methyltransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020332.1 protein_id gnl|my_center|LOCUS_00750 76014 76337 gene locus_tag LOCUS_00760 76014 76337 CDS product tetrahydromethanopterin S-methyltransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020331.1 protein_id gnl|my_center|LOCUS_00760 76339 77064 gene locus_tag LOCUS_00770 gene mtrA 76339 77064 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020330.1 protein_id gnl|my_center|LOCUS_00770 77066 77299 gene locus_tag LOCUS_00780 gene mtrF 77066 77299 CDS product tetrahydromethanopterin S-methyltransferase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020329.1 protein_id gnl|my_center|LOCUS_00780 77299 77529 gene locus_tag LOCUS_00790 gene mtrG 77299 77529 CDS product tetrahydromethanopterin S-methyltransferase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020328.1 protein_id gnl|my_center|LOCUS_00790 77542 78498 gene locus_tag LOCUS_00800 gene mtrH 77542 78498 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020327.1 protein_id gnl|my_center|LOCUS_00800 79590 78547 gene locus_tag LOCUS_00810 79590 78547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 79790 80362 gene locus_tag LOCUS_00820 79790 80362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066058.1 protein_id gnl|my_center|LOCUS_00820 80652 80365 gene locus_tag LOCUS_00830 80652 80365 CDS product DUF1894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020185.1 protein_id gnl|my_center|LOCUS_00830 81667 80666 gene locus_tag LOCUS_00840 gene purM 81667 80666 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066059.1 protein_id gnl|my_center|LOCUS_00840 83063 81684 gene locus_tag LOCUS_00850 83063 81684 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020190.1 protein_id gnl|my_center|LOCUS_00850 84020 83178 gene locus_tag LOCUS_00860 84020 83178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 84214 85413 gene locus_tag LOCUS_00870 84214 85413 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020191.1 protein_id gnl|my_center|LOCUS_00870 85530 85991 gene locus_tag LOCUS_00880 85530 85991 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020192.1 protein_id gnl|my_center|LOCUS_00880 >Feature sequence002 <1 1183 gene locus_tag LOCUS_00890 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064791.1:GntP family permease 1621 1340 gene locus_tag LOCUS_00900 1621 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 2542 2183 gene locus_tag LOCUS_00910 2542 2183 CDS product F420H2 dehydrogenase subunit FpoO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021521.1 protein_id gnl|my_center|LOCUS_00910 3998 2556 gene locus_tag LOCUS_00920 gene fpoN 3998 2556 CDS product F(420)H(2) dehydrogenase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_00920 5492 4002 gene locus_tag LOCUS_00930 gene fpoM 5492 4002 CDS product F(420)H(2) dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021519.1 protein_id gnl|my_center|LOCUS_00930 7508 5493 gene locus_tag LOCUS_00940 gene fpoL 7508 5493 CDS product F420H2 dehydrogenase subunit FpoL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021518.1 protein_id gnl|my_center|LOCUS_00940 7813 7511 gene locus_tag LOCUS_00950 gene fpoK 7813 7511 CDS product F420H2 dehydrogenase subunit FpoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589525.1 protein_id gnl|my_center|LOCUS_00950 8121 7813 gene locus_tag LOCUS_00960 gene fpoJ 8121 7813 CDS product F420H2 dehydrogenase subunit FpoJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048140882.1 protein_id gnl|my_center|LOCUS_00960 8389 8102 gene locus_tag LOCUS_00970 8389 8102 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048140880.1 protein_id gnl|my_center|LOCUS_00970 8817 8374 gene locus_tag LOCUS_00980 gene fpoI 8817 8374 CDS product F420H2 dehydrogenase subunit FpoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021514.1 protein_id gnl|my_center|LOCUS_00980 9848 8823 gene locus_tag LOCUS_00990 gene fpoH 9848 8823 CDS product F420H2 dehydrogenase subunit FpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065137.1 protein_id gnl|my_center|LOCUS_00990 10978 9854 gene locus_tag LOCUS_01000 gene fpoD 10978 9854 CDS product F420H2 dehydrogenase subunit FpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021512.1 protein_id gnl|my_center|LOCUS_01000 11464 10988 gene locus_tag LOCUS_01010 gene fpoC 11464 10988 CDS product F420H2 dehydrogenase subunit FpoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021511.1 protein_id gnl|my_center|LOCUS_01010 12026 11475 gene locus_tag LOCUS_01020 gene fpoB 12026 11475 CDS product F(420)H(2) dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021510.1 protein_id gnl|my_center|LOCUS_01020 12406 12014 gene locus_tag LOCUS_01030 gene fpoA 12406 12014 CDS product F420H2 dehydrogenase subunit FpoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021509.1 protein_id gnl|my_center|LOCUS_01030 13225 12725 gene locus_tag LOCUS_01040 13225 12725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 13673 13254 gene locus_tag LOCUS_01050 13673 13254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 14244 13795 gene locus_tag LOCUS_01060 14244 13795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 14435 14596 gene locus_tag LOCUS_01070 14435 14596 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065135.1 protein_id gnl|my_center|LOCUS_01070 14593 15897 gene locus_tag LOCUS_01080 14593 15897 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021506.1 protein_id gnl|my_center|LOCUS_01080 15902 16921 gene locus_tag LOCUS_01090 gene cofG 15902 16921 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755891.1 protein_id gnl|my_center|LOCUS_01090 17008 18147 gene locus_tag LOCUS_01100 gene cofH 17008 18147 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021504.1 protein_id gnl|my_center|LOCUS_01100 18234 18863 gene locus_tag LOCUS_01110 gene cofC 18234 18863 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021502.1 protein_id gnl|my_center|LOCUS_01110 18963 19136 gene locus_tag LOCUS_01120 18963 19136 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065133.1 protein_id gnl|my_center|LOCUS_01120 19133 20308 gene locus_tag LOCUS_01130 19133 20308 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 protein_id gnl|my_center|LOCUS_01130 21852 20419 gene locus_tag LOCUS_01140 21852 20419 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_01140 23200 21866 gene locus_tag LOCUS_01150 gene trkA 23200 21866 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021494.1 protein_id gnl|my_center|LOCUS_01150 24499 23336 gene locus_tag LOCUS_01160 gene dnaJ 24499 23336 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021493.1 protein_id gnl|my_center|LOCUS_01160 26426 24573 gene locus_tag LOCUS_01170 gene dnaK 26426 24573 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021492.1 protein_id gnl|my_center|LOCUS_01170 27109 26540 gene locus_tag LOCUS_01180 gene grpE 27109 26540 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021491.1 protein_id gnl|my_center|LOCUS_01180 27630 27220 gene locus_tag LOCUS_01190 27630 27220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048125745.1 protein_id gnl|my_center|LOCUS_01190 27747 28664 gene locus_tag LOCUS_01200 27747 28664 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021489.1 protein_id gnl|my_center|LOCUS_01200 28661 29638 gene locus_tag LOCUS_01210 28661 29638 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021488.1 protein_id gnl|my_center|LOCUS_01210 29705 30307 gene locus_tag LOCUS_01220 29705 30307 CDS product amino acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021487.1 protein_id gnl|my_center|LOCUS_01220 30569 30838 gene locus_tag LOCUS_01230 30569 30838 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021485.1 protein_id gnl|my_center|LOCUS_01230 30864 30935 gene locus_tag LOCUS_t00010 30864 30935 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 31321 31860 gene locus_tag LOCUS_01240 31321 31860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 33042 31876 gene locus_tag LOCUS_01250 33042 31876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 33613 33804 gene locus_tag LOCUS_01260 33613 33804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 33875 34399 gene locus_tag LOCUS_01270 33875 34399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 34400 35629 gene locus_tag LOCUS_01280 34400 35629 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021201.1 protein_id gnl|my_center|LOCUS_01280 35646 37166 gene locus_tag LOCUS_01290 35646 37166 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279119.1 protein_id gnl|my_center|LOCUS_01290 37219 37533 gene locus_tag LOCUS_01300 37219 37533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 37619 38677 gene locus_tag LOCUS_01310 37619 38677 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_01310 38671 39924 gene locus_tag LOCUS_01320 38671 39924 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021204.1 protein_id gnl|my_center|LOCUS_01320 40745 40086 gene locus_tag LOCUS_01330 40745 40086 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022990.1 protein_id gnl|my_center|LOCUS_01330 41668 40724 gene locus_tag LOCUS_01340 41668 40724 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022981.1 protein_id gnl|my_center|LOCUS_01340 42079 41825 gene locus_tag LOCUS_01350 42079 41825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 42590 43684 gene locus_tag LOCUS_01360 42590 43684 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021442.1 protein_id gnl|my_center|LOCUS_01360 44358 43666 gene locus_tag LOCUS_01370 44358 43666 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065832.1 protein_id gnl|my_center|LOCUS_01370 44680 45351 gene locus_tag LOCUS_01380 44680 45351 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021999.1 protein_id gnl|my_center|LOCUS_01380 45369 45950 gene locus_tag LOCUS_01390 45369 45950 CDS product DUF2119 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082089005.1 protein_id gnl|my_center|LOCUS_01390 47648 45999 gene locus_tag LOCUS_01400 gene thsA 47648 45999 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021686.1 protein_id gnl|my_center|LOCUS_01400 47809 48609 gene locus_tag LOCUS_01410 gene dph5 47809 48609 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021388.1 protein_id gnl|my_center|LOCUS_01410 48713 50398 gene locus_tag LOCUS_01420 48713 50398 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878560.1 protein_id gnl|my_center|LOCUS_01420 50410 50691 gene locus_tag LOCUS_01430 50410 50691 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066211.1 protein_id gnl|my_center|LOCUS_01430 50734 51075 gene locus_tag LOCUS_01440 50734 51075 CDS product DUF555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021390.1 protein_id gnl|my_center|LOCUS_01440 51091 51984 gene locus_tag LOCUS_01450 51091 51984 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021391.1 protein_id gnl|my_center|LOCUS_01450 51953 52102 gene locus_tag LOCUS_01460 51953 52102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 52512 52781 gene locus_tag LOCUS_01470 52512 52781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 52824 53840 gene locus_tag LOCUS_01480 gene amrS 52824 53840 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023404.1 protein_id gnl|my_center|LOCUS_01480 54013 54085 gene locus_tag LOCUS_t00020 54013 54085 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 54109 54184 gene locus_tag LOCUS_t00030 54109 54184 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 54455 54165 gene locus_tag LOCUS_01490 54455 54165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 55631 54480 gene locus_tag LOCUS_01500 55631 54480 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020830.1 protein_id gnl|my_center|LOCUS_01500 55998 55813 gene locus_tag LOCUS_01510 55998 55813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 56059 56289 gene locus_tag LOCUS_01520 56059 56289 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990715.1 protein_id gnl|my_center|LOCUS_01520 57716 56304 gene locus_tag LOCUS_01530 57716 56304 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020227.1 protein_id gnl|my_center|LOCUS_01530 58092 59663 gene locus_tag LOCUS_01540 gene serA 58092 59663 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020641.1 protein_id gnl|my_center|LOCUS_01540 59722 60201 gene locus_tag LOCUS_01550 59722 60201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 60201 60668 gene locus_tag LOCUS_01560 60201 60668 CDS product DUF2240 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020642.1 protein_id gnl|my_center|LOCUS_01560 60811 61191 gene locus_tag LOCUS_01570 60811 61191 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064921.1 protein_id gnl|my_center|LOCUS_01570 61204 61623 gene locus_tag LOCUS_01580 61204 61623 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020645.1 protein_id gnl|my_center|LOCUS_01580 61635 62039 gene locus_tag LOCUS_01590 61635 62039 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020646.1 protein_id gnl|my_center|LOCUS_01590 62546 62740 gene locus_tag LOCUS_01600 62546 62740 CDS product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020648.1 protein_id gnl|my_center|LOCUS_01600 62737 63408 gene locus_tag LOCUS_01610 gene rpsB 62737 63408 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020649.1 protein_id gnl|my_center|LOCUS_01610 63476 64276 gene locus_tag LOCUS_01620 63476 64276 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020650.1 protein_id gnl|my_center|LOCUS_01620 64287 65201 gene locus_tag LOCUS_01630 64287 65201 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064922.1 protein_id gnl|my_center|LOCUS_01630 65203 65982 gene locus_tag LOCUS_01640 65203 65982 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020652.1 protein_id gnl|my_center|LOCUS_01640 65997 67100 gene locus_tag LOCUS_01650 gene fni 65997 67100 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020653.1 protein_id gnl|my_center|LOCUS_01650 67146 68489 gene locus_tag LOCUS_01660 67146 68489 CDS product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020654.1 protein_id gnl|my_center|LOCUS_01660 68514 69479 gene locus_tag LOCUS_01670 68514 69479 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066119.1 protein_id gnl|my_center|LOCUS_01670 72269 69603 gene locus_tag LOCUS_01680 gene ppdK 72269 69603 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020657.1 protein_id gnl|my_center|LOCUS_01680 73276 72494 gene locus_tag LOCUS_01690 73276 72494 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066008.1 protein_id gnl|my_center|LOCUS_01690 73866 73411 gene locus_tag LOCUS_01700 73866 73411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 >Feature sequence003 1674 2453 gene locus_tag LOCUS_01710 1674 2453 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064392.1 protein_id gnl|my_center|LOCUS_01710 3585 2692 gene locus_tag LOCUS_01720 3585 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 4202 4546 gene locus_tag LOCUS_01730 4202 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 4553 4816 gene locus_tag LOCUS_01740 4553 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 6148 5072 gene locus_tag LOCUS_01750 6148 5072 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021199.1 protein_id gnl|my_center|LOCUS_01750 7305 6145 gene locus_tag LOCUS_01760 7305 6145 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021210.1 protein_id gnl|my_center|LOCUS_01760 8440 7310 gene locus_tag LOCUS_01770 8440 7310 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 protein_id gnl|my_center|LOCUS_01770 9106 8867 gene locus_tag LOCUS_01780 9106 8867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 9627 9713 gene locus_tag LOCUS_t00040 9627 9713 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9756 9998 gene locus_tag LOCUS_01790 9756 9998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 10334 9978 gene locus_tag LOCUS_01800 10334 9978 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020348.1 protein_id gnl|my_center|LOCUS_01800 11072 10335 gene locus_tag LOCUS_01810 11072 10335 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064852.1 protein_id gnl|my_center|LOCUS_01810 11324 12310 gene locus_tag LOCUS_01820 11324 12310 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021397.1 protein_id gnl|my_center|LOCUS_01820 12420 13055 gene locus_tag LOCUS_01830 12420 13055 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021398.1 protein_id gnl|my_center|LOCUS_01830 13055 13423 gene locus_tag LOCUS_01840 13055 13423 CDS product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021399.1 protein_id gnl|my_center|LOCUS_01840 13459 13968 gene locus_tag LOCUS_01850 13459 13968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065104.1 protein_id gnl|my_center|LOCUS_01850 13988 14602 gene locus_tag LOCUS_01860 gene hxlB 13988 14602 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065105.1 protein_id gnl|my_center|LOCUS_01860 14617 15738 gene locus_tag LOCUS_01870 14617 15738 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021402.1 protein_id gnl|my_center|LOCUS_01870 16712 15729 gene locus_tag LOCUS_01880 16712 15729 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589523.1 protein_id gnl|my_center|LOCUS_01880 16864 17739 gene locus_tag LOCUS_01890 16864 17739 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021408.1 protein_id gnl|my_center|LOCUS_01890 18087 17788 gene locus_tag LOCUS_01900 gene hisE 18087 17788 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021409.1 protein_id gnl|my_center|LOCUS_01900 19582 18296 gene locus_tag LOCUS_01910 19582 18296 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589524.1 protein_id gnl|my_center|LOCUS_01910 19916 19665 gene locus_tag LOCUS_01920 19916 19665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 22049 20760 gene locus_tag LOCUS_01930 22049 20760 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784716.1 protein_id gnl|my_center|LOCUS_01930 23035 22250 gene locus_tag LOCUS_01940 23035 22250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016905.1 protein_id gnl|my_center|LOCUS_01940 23820 23035 gene locus_tag LOCUS_01950 23820 23035 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016906.1 protein_id gnl|my_center|LOCUS_01950 25406 23877 gene locus_tag LOCUS_01960 25406 23877 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626195.1 protein_id gnl|my_center|LOCUS_01960 26253 25447 gene locus_tag LOCUS_01970 26253 25447 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903784.1 protein_id gnl|my_center|LOCUS_01970 27133 26246 gene locus_tag LOCUS_01980 27133 26246 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016909.1 protein_id gnl|my_center|LOCUS_01980 27333 27695 gene locus_tag LOCUS_01990 27333 27695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 29704 28262 gene locus_tag LOCUS_02000 29704 28262 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065053.1 protein_id gnl|my_center|LOCUS_02000 29848 31320 gene locus_tag LOCUS_02010 29848 31320 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021194.1 protein_id gnl|my_center|LOCUS_02010 31325 31510 gene locus_tag LOCUS_02020 31325 31510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 31527 32006 gene locus_tag LOCUS_02030 gene moaC 31527 32006 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066185.1 protein_id gnl|my_center|LOCUS_02030 32074 32922 gene locus_tag LOCUS_02040 32074 32922 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021191.1 protein_id gnl|my_center|LOCUS_02040 33165 33635 gene locus_tag LOCUS_02050 33165 33635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 33628 34407 gene locus_tag LOCUS_02060 33628 34407 CDS product C15orf41 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065051.1 protein_id gnl|my_center|LOCUS_02060 34645 34373 gene locus_tag LOCUS_02070 34645 34373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 34842 36434 gene locus_tag LOCUS_02080 gene lysS 34842 36434 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066108.1 protein_id gnl|my_center|LOCUS_02080 36394 37086 gene locus_tag LOCUS_02090 36394 37086 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020584.1 protein_id gnl|my_center|LOCUS_02090 37310 37065 gene locus_tag LOCUS_02100 37310 37065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 39881 37452 gene locus_tag LOCUS_02110 39881 37452 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020587.1 protein_id gnl|my_center|LOCUS_02110 40777 39959 gene locus_tag LOCUS_02120 gene truA 40777 39959 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020266.1 protein_id gnl|my_center|LOCUS_02120 41683 40784 gene locus_tag LOCUS_02130 41683 40784 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020265.1 protein_id gnl|my_center|LOCUS_02130 41813 42880 gene locus_tag LOCUS_02140 41813 42880 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064840.1 protein_id gnl|my_center|LOCUS_02140 42924 44333 gene locus_tag LOCUS_02150 42924 44333 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066384.1 protein_id gnl|my_center|LOCUS_02150 44640 45929 gene locus_tag LOCUS_02160 44640 45929 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020262.1 protein_id gnl|my_center|LOCUS_02160 46095 46577 gene locus_tag LOCUS_02170 46095 46577 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020260.1 protein_id gnl|my_center|LOCUS_02170 46613 47740 gene locus_tag LOCUS_02180 46613 47740 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020259.1 protein_id gnl|my_center|LOCUS_02180 47959 48270 gene locus_tag LOCUS_02190 47959 48270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 49103 48399 gene locus_tag LOCUS_02200 gene pyrH 49103 48399 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020429.1 protein_id gnl|my_center|LOCUS_02200 49864 49124 gene locus_tag LOCUS_02210 49864 49124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 50916 49885 gene locus_tag LOCUS_02220 gene asd 50916 49885 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020482.1 protein_id gnl|my_center|LOCUS_02220 51152 50976 gene locus_tag LOCUS_02230 51152 50976 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024079.1 protein_id gnl|my_center|LOCUS_02230 51976 51314 gene locus_tag LOCUS_02240 51976 51314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 52481 52041 gene locus_tag LOCUS_02250 52481 52041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 52939 52478 gene locus_tag LOCUS_02260 52939 52478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 53436 52927 gene locus_tag LOCUS_02270 53436 52927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064284.1 protein_id gnl|my_center|LOCUS_02270 54383 53436 gene locus_tag LOCUS_02280 54383 53436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 54597 55028 gene locus_tag LOCUS_02290 54597 55028 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_02290 55218 55922 gene locus_tag LOCUS_02300 55218 55922 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169713.1 protein_id gnl|my_center|LOCUS_02300 55894 56655 gene locus_tag LOCUS_02310 gene ribB 55894 56655 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020597.1 protein_id gnl|my_center|LOCUS_02310 56674 56748 gene locus_tag LOCUS_t00050 56674 56748 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 57025 58044 gene locus_tag LOCUS_02320 gene mtaA 57025 58044 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020823.1 protein_id gnl|my_center|LOCUS_02320 >Feature sequence004 <1 1244 gene locus_tag LOCUS_02330 <1 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064974.1:DHH family phosphoesterase 2011 1256 gene locus_tag LOCUS_02340 2011 1256 CDS product NrpR regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020866.1 protein_id gnl|my_center|LOCUS_02340 2824 2090 gene locus_tag LOCUS_02350 2824 2090 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020865.1 protein_id gnl|my_center|LOCUS_02350 4765 2942 gene locus_tag LOCUS_02360 gene uvrC 4765 2942 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_02360 5013 4936 gene locus_tag LOCUS_t00060 5013 4936 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5687 5136 gene locus_tag LOCUS_02370 5687 5136 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020756.1 protein_id gnl|my_center|LOCUS_02370 6042 5692 gene locus_tag LOCUS_02380 6042 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020757.1 protein_id gnl|my_center|LOCUS_02380 7241 6042 gene locus_tag LOCUS_02390 7241 6042 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020758.1 protein_id gnl|my_center|LOCUS_02390 7322 8239 gene locus_tag LOCUS_02400 gene cofD 7322 8239 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066127.1 protein_id gnl|my_center|LOCUS_02400 8363 8932 gene locus_tag LOCUS_02410 gene hpt 8363 8932 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020762.1 protein_id gnl|my_center|LOCUS_02410 8922 9914 gene locus_tag LOCUS_02420 gene dph2 8922 9914 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020763.1 protein_id gnl|my_center|LOCUS_02420 9928 10530 gene locus_tag LOCUS_02430 9928 10530 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020764.1 protein_id gnl|my_center|LOCUS_02430 10788 10594 gene locus_tag LOCUS_02440 10788 10594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 10739 11395 gene locus_tag LOCUS_02450 10739 11395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 11427 11705 gene locus_tag LOCUS_02460 11427 11705 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020766.1 protein_id gnl|my_center|LOCUS_02460 11875 12108 gene locus_tag LOCUS_02470 11875 12108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 12206 13369 gene locus_tag LOCUS_02480 gene pscS 12206 13369 CDS product O-phospho-L-seryl-tRNA:Cys-tRNA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020767.1 protein_id gnl|my_center|LOCUS_02480 15522 13558 gene locus_tag LOCUS_02490 15522 13558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 16114 15704 gene locus_tag LOCUS_02500 16114 15704 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065668.1 protein_id gnl|my_center|LOCUS_02500 16587 17561 gene locus_tag LOCUS_02510 16587 17561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 17630 17703 gene locus_tag LOCUS_t00070 17630 17703 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17942 17733 gene locus_tag LOCUS_02520 17942 17733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022523.1 protein_id gnl|my_center|LOCUS_02520 18659 18141 gene locus_tag LOCUS_02530 18659 18141 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065785.1 protein_id gnl|my_center|LOCUS_02530 19703 18672 gene locus_tag LOCUS_02540 gene fpoF 19703 18672 CDS product F420H2 dehydrogenase subunit FpoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023636.1 protein_id gnl|my_center|LOCUS_02540 20701 19721 gene locus_tag LOCUS_02550 gene mer 20701 19721 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023637.1 protein_id gnl|my_center|LOCUS_02550 20977 21261 gene locus_tag LOCUS_02560 20977 21261 CDS product DUF2180 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023639.1 protein_id gnl|my_center|LOCUS_02560 21267 21488 gene locus_tag LOCUS_02570 21267 21488 CDS product DUF2180 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065787.1 protein_id gnl|my_center|LOCUS_02570 21513 21878 gene locus_tag LOCUS_02580 21513 21878 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023090.1 protein_id gnl|my_center|LOCUS_02580 21983 23386 gene locus_tag LOCUS_02590 21983 23386 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_02590 23447 23638 gene locus_tag LOCUS_02600 23447 23638 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024079.1 protein_id gnl|my_center|LOCUS_02600 23674 24309 gene locus_tag LOCUS_02610 23674 24309 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065789.1 protein_id gnl|my_center|LOCUS_02610 24306 25004 gene locus_tag LOCUS_02620 24306 25004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 25021 25566 gene locus_tag LOCUS_02630 gene afpA 25021 25566 CDS product archaeoflavoprotein AfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023646.1 protein_id gnl|my_center|LOCUS_02630 26386 25571 gene locus_tag LOCUS_02640 26386 25571 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616091.1 protein_id gnl|my_center|LOCUS_02640 27494 26391 gene locus_tag LOCUS_02650 27494 26391 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020134.1 protein_id gnl|my_center|LOCUS_02650 27768 28259 gene locus_tag LOCUS_02660 27768 28259 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023647.1 protein_id gnl|my_center|LOCUS_02660 28274 29476 gene locus_tag LOCUS_02670 28274 29476 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065790.1 protein_id gnl|my_center|LOCUS_02670 29520 29795 gene locus_tag LOCUS_02680 29520 29795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 30151 32838 gene locus_tag LOCUS_02690 30151 32838 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257097.1 protein_id gnl|my_center|LOCUS_02690 33456 33731 gene locus_tag LOCUS_02700 33456 33731 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065894.1 protein_id gnl|my_center|LOCUS_02700 34147 33725 gene locus_tag LOCUS_02710 gene nikR 34147 33725 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023967.1 protein_id gnl|my_center|LOCUS_02710 34294 35007 gene locus_tag LOCUS_02720 34294 35007 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065889.1 protein_id gnl|my_center|LOCUS_02720 35028 36482 gene locus_tag LOCUS_02730 35028 36482 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022909.1 protein_id gnl|my_center|LOCUS_02730 37193 36492 gene locus_tag LOCUS_02740 37193 36492 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022879.1 protein_id gnl|my_center|LOCUS_02740 38227 37190 gene locus_tag LOCUS_02750 38227 37190 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022880.1 protein_id gnl|my_center|LOCUS_02750 39547 38324 gene locus_tag LOCUS_02760 39547 38324 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023953.1 protein_id gnl|my_center|LOCUS_02760 39906 39544 gene locus_tag LOCUS_02770 39906 39544 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023952.1 protein_id gnl|my_center|LOCUS_02770 40295 39924 gene locus_tag LOCUS_02780 gene nifU 40295 39924 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_02780 41458 40295 gene locus_tag LOCUS_02790 gene nifS 41458 40295 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_02790 41876 41568 gene locus_tag LOCUS_02800 gene yciH 41876 41568 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023951.1 protein_id gnl|my_center|LOCUS_02800 41954 42307 gene locus_tag LOCUS_02810 41954 42307 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868239.1 protein_id gnl|my_center|LOCUS_02810 42190 42402 gene locus_tag LOCUS_02820 42190 42402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 42424 44571 gene locus_tag LOCUS_02830 gene purL 42424 44571 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023948.1 protein_id gnl|my_center|LOCUS_02830 44831 47068 gene locus_tag LOCUS_02840 44831 47068 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903216.1 protein_id gnl|my_center|LOCUS_02840 47095 47367 gene locus_tag LOCUS_02850 47095 47367 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023444.1 protein_id gnl|my_center|LOCUS_02850 48071 47391 gene locus_tag LOCUS_02860 48071 47391 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023459.1 protein_id gnl|my_center|LOCUS_02860 49087 48110 gene locus_tag LOCUS_02870 gene radA 49087 48110 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023460.1 protein_id gnl|my_center|LOCUS_02870 49286 49744 gene locus_tag LOCUS_02880 49286 49744 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023461.1 protein_id gnl|my_center|LOCUS_02880 49746 50120 gene locus_tag LOCUS_02890 49746 50120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023462.1 protein_id gnl|my_center|LOCUS_02890 50186 50956 gene locus_tag LOCUS_02900 50186 50956 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023463.1 protein_id gnl|my_center|LOCUS_02900 51255 50953 gene locus_tag LOCUS_02910 51255 50953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02910 52271 51231 gene locus_tag LOCUS_02920 52271 51231 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023466.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02920 53062 52280 gene locus_tag LOCUS_02930 gene cbiQ 53062 52280 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065744.1 protein_id gnl|my_center|LOCUS_02930 53528 53238 gene locus_tag LOCUS_02940 53528 53238 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258435.1 protein_id gnl|my_center|LOCUS_02940 54232 53528 gene locus_tag LOCUS_02950 54232 53528 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023469.1 protein_id gnl|my_center|LOCUS_02950 55135 54551 gene locus_tag LOCUS_02960 55135 54551 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020569.1 protein_id gnl|my_center|LOCUS_02960 56151 55132 gene locus_tag LOCUS_02970 56151 55132 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020570.1 protein_id gnl|my_center|LOCUS_02970 >Feature sequence005 405 1787 gene locus_tag LOCUS_02980 405 1787 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020201.1 protein_id gnl|my_center|LOCUS_02980 1803 2072 gene locus_tag LOCUS_02990 1803 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 2084 2338 gene locus_tag LOCUS_03000 2084 2338 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020200.1 protein_id gnl|my_center|LOCUS_03000 2400 2867 gene locus_tag LOCUS_03010 2400 2867 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279208.1 protein_id gnl|my_center|LOCUS_03010 3437 4690 gene locus_tag LOCUS_03020 3437 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 4949 5245 gene locus_tag LOCUS_03030 4949 5245 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221875345.1 protein_id gnl|my_center|LOCUS_03030 5624 5265 gene locus_tag LOCUS_03040 5624 5265 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022051.1 protein_id gnl|my_center|LOCUS_03040 5684 6130 gene locus_tag LOCUS_03050 5684 6130 CDS product DUF123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990683.1 protein_id gnl|my_center|LOCUS_03050 7734 6448 gene locus_tag LOCUS_03060 gene thiC 7734 6448 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024209.1 protein_id gnl|my_center|LOCUS_03060 8947 8027 gene locus_tag LOCUS_03070 gene aglJ 8947 8027 CDS product S-layer glycoprotein N-glycosyltransferase AglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024210.1 protein_id gnl|my_center|LOCUS_03070 9510 8959 gene locus_tag LOCUS_03080 9510 8959 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024211.1 protein_id gnl|my_center|LOCUS_03080 10805 9690 gene locus_tag LOCUS_03090 gene scpB 10805 9690 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065962.1 protein_id gnl|my_center|LOCUS_03090 11649 10798 gene locus_tag LOCUS_03100 11649 10798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 15167 11646 gene locus_tag LOCUS_03110 gene smc 15167 11646 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024214.1 protein_id gnl|my_center|LOCUS_03110 15965 15207 gene locus_tag LOCUS_03120 15965 15207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 18731 16071 gene locus_tag LOCUS_03130 gene rad50 18731 16071 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902341.1 protein_id gnl|my_center|LOCUS_03130 20008 18731 gene locus_tag LOCUS_03140 20008 18731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 20108 20374 gene locus_tag LOCUS_03150 20108 20374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 20928 20578 gene locus_tag LOCUS_03160 20928 20578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 20816 26113 gene locus_tag LOCUS_03170 20816 26113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 26347 26913 gene locus_tag LOCUS_03180 26347 26913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 26951 29131 gene locus_tag LOCUS_03190 26951 29131 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903824.1 protein_id gnl|my_center|LOCUS_03190 29215 29643 gene locus_tag LOCUS_03200 29215 29643 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020395.1 protein_id gnl|my_center|LOCUS_03200 29711 30406 gene locus_tag LOCUS_03210 29711 30406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 30467 31435 gene locus_tag LOCUS_03220 30467 31435 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064863.1 protein_id gnl|my_center|LOCUS_03220 31437 32537 gene locus_tag LOCUS_03230 31437 32537 CDS product NOP5/NOP56 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020398.1 protein_id gnl|my_center|LOCUS_03230 32534 33229 gene locus_tag LOCUS_03240 32534 33229 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020399.1 protein_id gnl|my_center|LOCUS_03240 35198 33594 gene locus_tag LOCUS_03250 35198 33594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 35568 36011 gene locus_tag LOCUS_03260 35568 36011 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065558.1 protein_id gnl|my_center|LOCUS_03260 36127 36342 gene locus_tag LOCUS_03270 36127 36342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 36415 36708 gene locus_tag LOCUS_03280 36415 36708 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022869.1 protein_id gnl|my_center|LOCUS_03280 37122 36715 gene locus_tag LOCUS_03290 37122 36715 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338938.1 protein_id gnl|my_center|LOCUS_03290 37223 38140 gene locus_tag LOCUS_03300 37223 38140 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018271.1 protein_id gnl|my_center|LOCUS_03300 38143 38934 gene locus_tag LOCUS_03310 38143 38934 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545091.1 protein_id gnl|my_center|LOCUS_03310 39058 39894 gene locus_tag LOCUS_03320 39058 39894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 40654 39914 gene locus_tag LOCUS_03330 40654 39914 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023957.1 protein_id gnl|my_center|LOCUS_03330 41937 40660 gene locus_tag LOCUS_03340 41937 40660 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023956.1 protein_id gnl|my_center|LOCUS_03340 42425 42057 gene locus_tag LOCUS_03350 42425 42057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 42528 42409 gene locus_tag LOCUS_03360 42528 42409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 43610 42963 gene locus_tag LOCUS_03370 43610 42963 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024281.1 protein_id gnl|my_center|LOCUS_03370 44850 43669 gene locus_tag LOCUS_03380 44850 43669 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024280.1 protein_id gnl|my_center|LOCUS_03380 44972 45045 gene locus_tag LOCUS_t00080 44972 45045 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 45403 46017 gene locus_tag LOCUS_03390 gene wrbA 45403 46017 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941470.1 protein_id gnl|my_center|LOCUS_03390 47330 46080 gene locus_tag LOCUS_03400 gene cysS 47330 46080 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883567.1 protein_id gnl|my_center|LOCUS_03400 47596 47892 gene locus_tag LOCUS_03410 47596 47892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 47893 51372 gene locus_tag LOCUS_03420 47893 51372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 >Feature sequence006 190 1614 gene locus_tag LOCUS_03430 190 1614 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021657.1 protein_id gnl|my_center|LOCUS_03430 1859 2035 gene locus_tag LOCUS_03440 1859 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065866.1 protein_id gnl|my_center|LOCUS_03440 3175 2375 gene locus_tag LOCUS_03450 gene cofE 3175 2375 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023428.1 protein_id gnl|my_center|LOCUS_03450 4061 3165 gene locus_tag LOCUS_03460 4061 3165 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023430.1 protein_id gnl|my_center|LOCUS_03460 6016 4178 gene locus_tag LOCUS_03470 6016 4178 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020947.1 protein_id gnl|my_center|LOCUS_03470 6425 6063 gene locus_tag LOCUS_03480 gene hisI 6425 6063 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020946.1 protein_id gnl|my_center|LOCUS_03480 6532 7296 gene locus_tag LOCUS_03490 6532 7296 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878025.1 protein_id gnl|my_center|LOCUS_03490 7354 8439 gene locus_tag LOCUS_03500 7354 8439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064994.1 protein_id gnl|my_center|LOCUS_03500 8553 8876 gene locus_tag LOCUS_03510 8553 8876 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020942.1 protein_id gnl|my_center|LOCUS_03510 8912 9262 gene locus_tag LOCUS_03520 8912 9262 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064993.1 protein_id gnl|my_center|LOCUS_03520 9539 11425 gene locus_tag LOCUS_03530 gene acs 9539 11425 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056731.1 protein_id gnl|my_center|LOCUS_03530 12162 11473 gene locus_tag LOCUS_03540 12162 11473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 12530 12751 gene locus_tag LOCUS_03550 12530 12751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 13130 14608 gene locus_tag LOCUS_03560 13130 14608 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021937.1 protein_id gnl|my_center|LOCUS_03560 14709 15518 gene locus_tag LOCUS_03570 14709 15518 CDS product nicotinate-nucleotide pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064859.1 protein_id gnl|my_center|LOCUS_03570 15723 15992 gene locus_tag LOCUS_03580 gene trxA 15723 15992 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065637.1 protein_id gnl|my_center|LOCUS_03580 16050 17066 gene locus_tag LOCUS_03590 16050 17066 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066456.1 protein_id gnl|my_center|LOCUS_03590 17159 17563 gene locus_tag LOCUS_03600 17159 17563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990637.1 protein_id gnl|my_center|LOCUS_03600 17603 19369 gene locus_tag LOCUS_03610 17603 19369 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023139.1 protein_id gnl|my_center|LOCUS_03610 21675 19756 gene locus_tag LOCUS_03620 21675 19756 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024230.1 protein_id gnl|my_center|LOCUS_03620 21926 21681 gene locus_tag LOCUS_03630 21926 21681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 22921 22040 gene locus_tag LOCUS_03640 gene ilvE 22921 22040 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065968.1 protein_id gnl|my_center|LOCUS_03640 23141 24217 gene locus_tag LOCUS_03650 23141 24217 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064979.1 protein_id gnl|my_center|LOCUS_03650 24333 24408 gene locus_tag LOCUS_t00090 24333 24408 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25645 24467 gene locus_tag LOCUS_03660 25645 24467 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990816.1 protein_id gnl|my_center|LOCUS_03660 26481 25732 gene locus_tag LOCUS_03670 26481 25732 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022096.1 protein_id gnl|my_center|LOCUS_03670 27469 26483 gene locus_tag LOCUS_03680 27469 26483 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582485.1 protein_id gnl|my_center|LOCUS_03680 28076 27450 gene locus_tag LOCUS_03690 28076 27450 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943169.1 protein_id gnl|my_center|LOCUS_03690 28263 28667 gene locus_tag LOCUS_03700 28263 28667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020755.1 protein_id gnl|my_center|LOCUS_03700 28874 30508 gene locus_tag LOCUS_03710 gene thsB 28874 30508 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024292.1 protein_id gnl|my_center|LOCUS_03710 32225 30711 gene locus_tag LOCUS_03720 32225 30711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 33480 32440 gene locus_tag LOCUS_03730 33480 32440 CDS product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020267.1 protein_id gnl|my_center|LOCUS_03730 33613 35514 gene locus_tag LOCUS_03740 33613 35514 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250266.1 protein_id gnl|my_center|LOCUS_03740 35507 37210 gene locus_tag LOCUS_03750 gene purH 35507 37210 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023907.1 protein_id gnl|my_center|LOCUS_03750 37373 38155 gene locus_tag LOCUS_03760 37373 38155 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048173813.1 protein_id gnl|my_center|LOCUS_03760 38950 38165 gene locus_tag LOCUS_03770 38950 38165 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023905.1 protein_id gnl|my_center|LOCUS_03770 39427 40968 gene locus_tag LOCUS_03780 gene gpmI 39427 40968 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065873.1 protein_id gnl|my_center|LOCUS_03780 41986 40970 gene locus_tag LOCUS_03790 gene fen 41986 40970 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023899.1 protein_id gnl|my_center|LOCUS_03790 42313 42002 gene locus_tag LOCUS_03800 42313 42002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023897.1 protein_id gnl|my_center|LOCUS_03800 42757 42434 gene locus_tag LOCUS_03810 42757 42434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 43993 45147 gene locus_tag LOCUS_03820 43993 45147 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020271.1 protein_id gnl|my_center|LOCUS_03820 45178 46068 gene locus_tag LOCUS_03830 gene map 45178 46068 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020270.1 protein_id gnl|my_center|LOCUS_03830 46068 46844 gene locus_tag LOCUS_03840 46068 46844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 46896 47183 gene locus_tag LOCUS_03850 46896 47183 CDS product YunC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066065.1 protein_id gnl|my_center|LOCUS_03850 47302 48213 gene locus_tag LOCUS_03860 47302 48213 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065870.1 protein_id gnl|my_center|LOCUS_03860 48689 48228 gene locus_tag LOCUS_03870 48689 48228 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065868.1 protein_id gnl|my_center|LOCUS_03870 >Feature sequence007 372 1355 gene locus_tag LOCUS_03880 372 1355 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020886.1 protein_id gnl|my_center|LOCUS_03880 1352 2293 gene locus_tag LOCUS_03890 1352 2293 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064978.1 protein_id gnl|my_center|LOCUS_03890 2295 4001 gene locus_tag LOCUS_03900 2295 4001 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020888.1 protein_id gnl|my_center|LOCUS_03900 3958 4161 gene locus_tag LOCUS_03910 3958 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 4994 4437 gene locus_tag LOCUS_03920 4994 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03920 6068 5232 gene locus_tag LOCUS_03930 6068 5232 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021378.1 protein_id gnl|my_center|LOCUS_03930 6363 6983 gene locus_tag LOCUS_03940 6363 6983 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876213.1 protein_id gnl|my_center|LOCUS_03940 7106 7747 gene locus_tag LOCUS_03950 7106 7747 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024475.1 protein_id gnl|my_center|LOCUS_03950 8734 8165 gene locus_tag LOCUS_03960 8734 8165 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_03960 10537 8756 gene locus_tag LOCUS_03970 10537 8756 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022623.1 protein_id gnl|my_center|LOCUS_03970 11346 10780 gene locus_tag LOCUS_03980 11346 10780 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022274.1 protein_id gnl|my_center|LOCUS_03980 12127 11522 gene locus_tag LOCUS_03990 12127 11522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 13039 12233 gene locus_tag LOCUS_04000 13039 12233 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905410.1 protein_id gnl|my_center|LOCUS_04000 13696 13145 gene locus_tag LOCUS_04010 13696 13145 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023634.1 protein_id gnl|my_center|LOCUS_04010 14308 13721 gene locus_tag LOCUS_04020 14308 13721 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022926.1 protein_id gnl|my_center|LOCUS_04020 15879 14308 gene locus_tag LOCUS_04030 gene trpE 15879 14308 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022927.1 protein_id gnl|my_center|LOCUS_04030 16558 15872 gene locus_tag LOCUS_04040 16558 15872 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065580.1 protein_id gnl|my_center|LOCUS_04040 17570 16512 gene locus_tag LOCUS_04050 gene trpD 17570 16512 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022929.1 protein_id gnl|my_center|LOCUS_04050 17775 18050 gene locus_tag LOCUS_04060 17775 18050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 19706 18222 gene locus_tag LOCUS_04070 19706 18222 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023184.1 protein_id gnl|my_center|LOCUS_04070 19827 20378 gene locus_tag LOCUS_04080 gene cbiT 19827 20378 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024144.1 protein_id gnl|my_center|LOCUS_04080 20395 21003 gene locus_tag LOCUS_04090 20395 21003 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024143.1 protein_id gnl|my_center|LOCUS_04090 21025 21756 gene locus_tag LOCUS_04100 21025 21756 CDS product cobalt-precorrin-4/precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024142.1 protein_id gnl|my_center|LOCUS_04100 21870 22265 gene locus_tag LOCUS_04110 21870 22265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 22262 22615 gene locus_tag LOCUS_04120 22262 22615 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990686.1 protein_id gnl|my_center|LOCUS_04120 22584 23390 gene locus_tag LOCUS_04130 gene cobJ 22584 23390 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024141.1 protein_id gnl|my_center|LOCUS_04130 23380 24105 gene locus_tag LOCUS_04140 23380 24105 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024140.1 protein_id gnl|my_center|LOCUS_04140 24822 24139 gene locus_tag LOCUS_04150 24822 24139 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024137.1 protein_id gnl|my_center|LOCUS_04150 25292 24819 gene locus_tag LOCUS_04160 25292 24819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 25959 25381 gene locus_tag LOCUS_04170 25959 25381 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023984.1 protein_id gnl|my_center|LOCUS_04170 26974 26123 gene locus_tag LOCUS_04180 26974 26123 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023985.1 protein_id gnl|my_center|LOCUS_04180 27448 26993 gene locus_tag LOCUS_04190 27448 26993 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023986.1 protein_id gnl|my_center|LOCUS_04190 28572 27469 gene locus_tag LOCUS_04200 28572 27469 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023987.1 protein_id gnl|my_center|LOCUS_04200 28991 29323 gene locus_tag LOCUS_04210 28991 29323 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066569.1 protein_id gnl|my_center|LOCUS_04210 29581 30081 gene locus_tag LOCUS_04220 29581 30081 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023990.1 protein_id gnl|my_center|LOCUS_04220 30470 30078 gene locus_tag LOCUS_04230 30470 30078 CDS product DUF356 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023991.1 protein_id gnl|my_center|LOCUS_04230 31411 30596 gene locus_tag LOCUS_04240 gene proC 31411 30596 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_04240 31915 31433 gene locus_tag LOCUS_04250 31915 31433 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065943.1 protein_id gnl|my_center|LOCUS_04250 31999 33291 gene locus_tag LOCUS_04260 31999 33291 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048136943.1 protein_id gnl|my_center|LOCUS_04260 33291 33929 gene locus_tag LOCUS_04270 33291 33929 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024150.1 protein_id gnl|my_center|LOCUS_04270 35277 33937 gene locus_tag LOCUS_04280 gene glmM 35277 33937 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020299.1 protein_id gnl|my_center|LOCUS_04280 35377 36180 gene locus_tag LOCUS_04290 gene larE 35377 36180 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020298.1 protein_id gnl|my_center|LOCUS_04290 36161 36637 gene locus_tag LOCUS_04300 36161 36637 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020297.1 protein_id gnl|my_center|LOCUS_04300 36606 37154 gene locus_tag LOCUS_04310 36606 37154 CDS product DUF531 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020296.1 protein_id gnl|my_center|LOCUS_04310 37794 37195 gene locus_tag LOCUS_04320 37794 37195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 39478 38000 gene locus_tag LOCUS_04330 39478 38000 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020229.1 protein_id gnl|my_center|LOCUS_04330 40805 39507 gene locus_tag LOCUS_04340 40805 39507 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020230.1 protein_id gnl|my_center|LOCUS_04340 42123 40915 gene locus_tag LOCUS_04350 42123 40915 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020233.1 protein_id gnl|my_center|LOCUS_04350 42899 42120 gene locus_tag LOCUS_04360 42899 42120 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064392.1 protein_id gnl|my_center|LOCUS_04360 43590 42982 gene locus_tag LOCUS_04370 43590 42982 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020240.1 protein_id gnl|my_center|LOCUS_04370 44142 43624 gene locus_tag LOCUS_04380 44142 43624 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020241.1 protein_id gnl|my_center|LOCUS_04380 44344 44162 gene locus_tag LOCUS_04390 44344 44162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 44503 44904 gene locus_tag LOCUS_04400 44503 44904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 45018 45719 gene locus_tag LOCUS_04410 45018 45719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902413.1 protein_id gnl|my_center|LOCUS_04410 45822 46082 gene locus_tag LOCUS_04420 45822 46082 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020250.1 protein_id gnl|my_center|LOCUS_04420 >Feature sequence008 85 1347 gene locus_tag LOCUS_04430 gene lysA 85 1347 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020771.1 protein_id gnl|my_center|LOCUS_04430 1617 2858 gene locus_tag LOCUS_04440 1617 2858 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020503.1 protein_id gnl|my_center|LOCUS_04440 3078 2896 gene locus_tag LOCUS_04450 3078 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04450 3269 3096 gene locus_tag LOCUS_04460 3269 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 3409 4593 gene locus_tag LOCUS_04470 gene arsB 3409 4593 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_04470 5020 4679 gene locus_tag LOCUS_04480 5020 4679 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065462.1 protein_id gnl|my_center|LOCUS_04480 5344 6231 gene locus_tag LOCUS_04490 5344 6231 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_04490 6231 7061 gene locus_tag LOCUS_04500 6231 7061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 7380 7814 gene locus_tag LOCUS_04510 7380 7814 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066044.1 protein_id gnl|my_center|LOCUS_04510 7903 8802 gene locus_tag LOCUS_04520 7903 8802 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439262.1 protein_id gnl|my_center|LOCUS_04520 8803 9552 gene locus_tag LOCUS_04530 8803 9552 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_04530 9565 10380 gene locus_tag LOCUS_04540 9565 10380 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_04540 10728 10405 gene locus_tag LOCUS_04550 10728 10405 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065092.1 protein_id gnl|my_center|LOCUS_04550 11292 11059 gene locus_tag LOCUS_04560 11292 11059 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023356.1 protein_id gnl|my_center|LOCUS_04560 12650 11295 gene locus_tag LOCUS_04570 12650 11295 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023357.1 protein_id gnl|my_center|LOCUS_04570 13840 12647 gene locus_tag LOCUS_04580 13840 12647 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022964.1 protein_id gnl|my_center|LOCUS_04580 15138 13840 gene locus_tag LOCUS_04590 gene glmM 15138 13840 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065583.1 protein_id gnl|my_center|LOCUS_04590 16987 15158 gene locus_tag LOCUS_04600 gene glmS 16987 15158 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022962.1 protein_id gnl|my_center|LOCUS_04600 18212 16998 gene locus_tag LOCUS_04610 18212 16998 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022961.1 protein_id gnl|my_center|LOCUS_04610 18890 18432 gene locus_tag LOCUS_04620 18890 18432 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020987.1 protein_id gnl|my_center|LOCUS_04620 20243 19050 gene locus_tag LOCUS_04630 20243 19050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 20759 20259 gene locus_tag LOCUS_04640 20759 20259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 21294 20740 gene locus_tag LOCUS_04650 21294 20740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 21834 21346 gene locus_tag LOCUS_04660 21834 21346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 23090 21849 gene locus_tag LOCUS_04670 gene hisS 23090 21849 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020981.1 protein_id gnl|my_center|LOCUS_04670 23304 24608 gene locus_tag LOCUS_04680 23304 24608 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065635.1 protein_id gnl|my_center|LOCUS_04680 25437 24748 gene locus_tag LOCUS_04690 25437 24748 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021712.1 protein_id gnl|my_center|LOCUS_04690 25730 27934 gene locus_tag LOCUS_04700 25730 27934 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_04700 27958 29244 gene locus_tag LOCUS_04710 gene hisD 27958 29244 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023136.1 protein_id gnl|my_center|LOCUS_04710 29339 29740 gene locus_tag LOCUS_04720 29339 29740 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065387.1 protein_id gnl|my_center|LOCUS_04720 29826 30647 gene locus_tag LOCUS_04730 gene cobA 29826 30647 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022972.1 protein_id gnl|my_center|LOCUS_04730 30653 31456 gene locus_tag LOCUS_04740 30653 31456 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022973.1 protein_id gnl|my_center|LOCUS_04740 31568 32770 gene locus_tag LOCUS_04750 gene ahbC 31568 32770 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022974.1 protein_id gnl|my_center|LOCUS_04750 33278 32928 gene locus_tag LOCUS_04760 33278 32928 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868764.1 protein_id gnl|my_center|LOCUS_04760 33739 33389 gene locus_tag LOCUS_04770 33739 33389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 33944 36544 gene locus_tag LOCUS_04780 33944 36544 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022991.1 protein_id gnl|my_center|LOCUS_04780 36633 37118 gene locus_tag LOCUS_04790 36633 37118 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023779.1 protein_id gnl|my_center|LOCUS_04790 37244 37624 gene locus_tag LOCUS_04800 gene sepF 37244 37624 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023780.1 protein_id gnl|my_center|LOCUS_04800 37621 38250 gene locus_tag LOCUS_04810 37621 38250 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023781.1 protein_id gnl|my_center|LOCUS_04810 38284 39051 gene locus_tag LOCUS_04820 38284 39051 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_04820 39142 40596 gene locus_tag LOCUS_04830 gene proS 39142 40596 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023782.1 protein_id gnl|my_center|LOCUS_04830 40635 41699 gene locus_tag LOCUS_04840 40635 41699 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023783.1 protein_id gnl|my_center|LOCUS_04840 41768 41920 gene locus_tag LOCUS_04850 41768 41920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 42442 43449 gene locus_tag LOCUS_04860 42442 43449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 43608 44198 gene locus_tag LOCUS_04870 43608 44198 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021787.1 protein_id gnl|my_center|LOCUS_04870 44255 44650 gene locus_tag LOCUS_04880 44255 44650 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755897.1 protein_id gnl|my_center|LOCUS_04880 >Feature sequence009 3769 344 gene locus_tag LOCUS_04890 3769 344 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024425.1 protein_id gnl|my_center|LOCUS_04890 3994 4455 gene locus_tag LOCUS_04900 3994 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 4714 4481 gene locus_tag LOCUS_04910 4714 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 5772 4723 gene locus_tag LOCUS_04920 5772 4723 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868714.1 protein_id gnl|my_center|LOCUS_04920 6506 5784 gene locus_tag LOCUS_04930 6506 5784 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675715.1 protein_id gnl|my_center|LOCUS_04930 11651 6726 gene locus_tag LOCUS_04940 gene cobN 11651 6726 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162013063.1 protein_id gnl|my_center|LOCUS_04940 13491 12397 gene locus_tag LOCUS_04950 13491 12397 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878013.1 protein_id gnl|my_center|LOCUS_04950 14330 13701 gene locus_tag LOCUS_04960 14330 13701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 14573 15763 gene locus_tag LOCUS_04970 14573 15763 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023790.1 protein_id gnl|my_center|LOCUS_04970 16132 16785 gene locus_tag LOCUS_04980 16132 16785 CDS product TatD family nuclease-associated radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990793.1 protein_id gnl|my_center|LOCUS_04980 17445 16816 gene locus_tag LOCUS_04990 gene engB 17445 16816 CDS product GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022535.1 protein_id gnl|my_center|LOCUS_04990 18473 17442 gene locus_tag LOCUS_05000 18473 17442 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065440.1 protein_id gnl|my_center|LOCUS_05000 19814 18543 gene locus_tag LOCUS_05010 19814 18543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 21390 19816 gene locus_tag LOCUS_05020 21390 19816 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022533.1 protein_id gnl|my_center|LOCUS_05020 23847 21514 gene locus_tag LOCUS_05030 23847 21514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 24432 23929 gene locus_tag LOCUS_05040 24432 23929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250862.1 protein_id gnl|my_center|LOCUS_05040 25190 24447 gene locus_tag LOCUS_05050 25190 24447 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250861.1 protein_id gnl|my_center|LOCUS_05050 25329 26069 gene locus_tag LOCUS_05060 25329 26069 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022780.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05060 26069 26224 gene locus_tag LOCUS_05070 26069 26224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 27413 26244 gene locus_tag LOCUS_05080 27413 26244 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065771.1 protein_id gnl|my_center|LOCUS_05080 28418 27438 gene locus_tag LOCUS_05090 28418 27438 CDS product DUF4921 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023587.1 protein_id gnl|my_center|LOCUS_05090 30269 28452 gene locus_tag LOCUS_05100 30269 28452 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023586.1 protein_id gnl|my_center|LOCUS_05100 30426 31556 gene locus_tag LOCUS_05110 30426 31556 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990904.1 protein_id gnl|my_center|LOCUS_05110 31538 32788 gene locus_tag LOCUS_05120 31538 32788 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_05120 32782 33591 gene locus_tag LOCUS_05130 32782 33591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065887.1 protein_id gnl|my_center|LOCUS_05130 33588 35558 gene locus_tag LOCUS_05140 33588 35558 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065886.1 protein_id gnl|my_center|LOCUS_05140 35542 37554 gene locus_tag LOCUS_05150 35542 37554 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064995.1 protein_id gnl|my_center|LOCUS_05150 39052 37544 gene locus_tag LOCUS_05160 39052 37544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 40038 39646 gene locus_tag LOCUS_05170 40038 39646 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021540.1 protein_id gnl|my_center|LOCUS_05170 41869 40094 gene locus_tag LOCUS_05180 gene infB 41869 40094 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065143.1 protein_id gnl|my_center|LOCUS_05180 42445 41996 gene locus_tag LOCUS_05190 gene ndk 42445 41996 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065142.1 protein_id gnl|my_center|LOCUS_05190 42646 42458 gene locus_tag LOCUS_05200 42646 42458 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021537.1 protein_id gnl|my_center|LOCUS_05200 42867 42652 gene locus_tag LOCUS_05210 42867 42652 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065141.1 protein_id gnl|my_center|LOCUS_05210 43244 42888 gene locus_tag LOCUS_05220 gene rpl7ae 43244 42888 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021535.1 protein_id gnl|my_center|LOCUS_05220 44179 43505 gene locus_tag LOCUS_05230 44179 43505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 >Feature sequence010 2000 423 gene locus_tag LOCUS_05240 2000 423 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860105.1 protein_id gnl|my_center|LOCUS_05240 2436 2663 gene locus_tag LOCUS_05250 2436 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 3174 3596 gene locus_tag LOCUS_05260 3174 3596 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023551.1 protein_id gnl|my_center|LOCUS_05260 4223 5287 gene locus_tag LOCUS_05270 4223 5287 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023765.1 protein_id gnl|my_center|LOCUS_05270 5300 6457 gene locus_tag LOCUS_05280 5300 6457 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023766.1 protein_id gnl|my_center|LOCUS_05280 6542 7036 gene locus_tag LOCUS_05290 6542 7036 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066543.1 protein_id gnl|my_center|LOCUS_05290 7038 7544 gene locus_tag LOCUS_05300 7038 7544 CDS product TIGR00295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023768.1 protein_id gnl|my_center|LOCUS_05300 7700 8332 gene locus_tag LOCUS_05310 gene psmB 7700 8332 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023769.1 protein_id gnl|my_center|LOCUS_05310 8434 10344 gene locus_tag LOCUS_05320 8434 10344 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023770.1 protein_id gnl|my_center|LOCUS_05320 10991 10350 gene locus_tag LOCUS_05330 10991 10350 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020502.1 protein_id gnl|my_center|LOCUS_05330 11329 12207 gene locus_tag LOCUS_05340 11329 12207 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023811.1 protein_id gnl|my_center|LOCUS_05340 12576 14165 gene locus_tag LOCUS_05350 12576 14165 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021335.1 protein_id gnl|my_center|LOCUS_05350 14777 15931 gene locus_tag LOCUS_05360 14777 15931 CDS product DUF2117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990783.1 protein_id gnl|my_center|LOCUS_05360 16041 16424 gene locus_tag LOCUS_05370 16041 16424 CDS product transcriptional regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065665.1 protein_id gnl|my_center|LOCUS_05370 16886 16677 gene locus_tag LOCUS_05380 16886 16677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 17043 16900 gene locus_tag LOCUS_05390 17043 16900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 17542 18303 gene locus_tag LOCUS_05400 17542 18303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 19036 18305 gene locus_tag LOCUS_05410 gene minD 19036 18305 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503310.1 protein_id gnl|my_center|LOCUS_05410 19448 19041 gene locus_tag LOCUS_05420 19448 19041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 19617 20318 gene locus_tag LOCUS_05430 19617 20318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 21420 20653 gene locus_tag LOCUS_05440 21420 20653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 23135 21459 gene locus_tag LOCUS_05450 23135 21459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 23922 23152 gene locus_tag LOCUS_05460 23922 23152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 25019 23940 gene locus_tag LOCUS_05470 25019 23940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 25357 25016 gene locus_tag LOCUS_05480 25357 25016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 26296 25367 gene locus_tag LOCUS_05490 26296 25367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 26923 26336 gene locus_tag LOCUS_05500 26923 26336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 27980 27063 gene locus_tag LOCUS_05510 27980 27063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 29067 28003 gene locus_tag LOCUS_05520 29067 28003 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877642.1 protein_id gnl|my_center|LOCUS_05520 30953 29079 gene locus_tag LOCUS_05530 30953 29079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 31832 30975 gene locus_tag LOCUS_05540 31832 30975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 32642 31956 gene locus_tag LOCUS_05550 32642 31956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 33483 32701 gene locus_tag LOCUS_05560 gene flaB3 33483 32701 CDS product flagellin B3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248995.1 protein_id gnl|my_center|LOCUS_05560 34325 33513 gene locus_tag LOCUS_05570 34325 33513 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870406.1 protein_id gnl|my_center|LOCUS_05570 34487 35254 gene locus_tag LOCUS_05580 34487 35254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 35244 35606 gene locus_tag LOCUS_05590 35244 35606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 36689 35904 gene locus_tag LOCUS_05600 gene flaB3 36689 35904 CDS product flagellin B3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248995.1 protein_id gnl|my_center|LOCUS_05600 37536 36724 gene locus_tag LOCUS_05610 37536 36724 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870406.1 protein_id gnl|my_center|LOCUS_05610 37826 38614 gene locus_tag LOCUS_05620 37826 38614 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022932.1 protein_id gnl|my_center|LOCUS_05620 38617 38802 gene locus_tag LOCUS_05630 38617 38802 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023998.1 protein_id gnl|my_center|LOCUS_05630 38870 40069 gene locus_tag LOCUS_05640 gene trpB 38870 40069 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022931.1 protein_id gnl|my_center|LOCUS_05640 40066 40845 gene locus_tag LOCUS_05650 gene trpA 40066 40845 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_05650 41999 40851 gene locus_tag LOCUS_05660 gene ftsY 41999 40851 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024000.1 protein_id gnl|my_center|LOCUS_05660 42466 42032 gene locus_tag LOCUS_05670 gene pfdA 42466 42032 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249956.1 protein_id gnl|my_center|LOCUS_05670 42646 42470 gene locus_tag LOCUS_05680 gene rpl18a 42646 42470 CDS product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024002.1 protein_id gnl|my_center|LOCUS_05680 43344 42679 gene locus_tag LOCUS_05690 43344 42679 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024003.1 protein_id gnl|my_center|LOCUS_05690 43649 43383 gene locus_tag LOCUS_05700 43649 43383 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024004.1 protein_id gnl|my_center|LOCUS_05700 >Feature sequence011 450 3095 gene locus_tag LOCUS_05710 450 3095 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545920.1 protein_id gnl|my_center|LOCUS_05710 3324 3935 gene locus_tag LOCUS_05720 gene tmk 3324 3935 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024311.1 protein_id gnl|my_center|LOCUS_05720 4252 4001 gene locus_tag LOCUS_05730 4252 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 4734 4273 gene locus_tag LOCUS_05740 4734 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 5031 5729 gene locus_tag LOCUS_05750 5031 5729 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024314.1 protein_id gnl|my_center|LOCUS_05750 5902 6873 gene locus_tag LOCUS_05760 5902 6873 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_05760 6925 7224 gene locus_tag LOCUS_05770 6925 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 8067 7624 gene locus_tag LOCUS_05780 8067 7624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 10442 8259 gene locus_tag LOCUS_05790 10442 8259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 10952 10551 gene locus_tag LOCUS_05800 10952 10551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 11154 11786 gene locus_tag LOCUS_05810 11154 11786 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020574.1 protein_id gnl|my_center|LOCUS_05810 11849 12097 gene locus_tag LOCUS_05820 gene purS 11849 12097 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066286.1 protein_id gnl|my_center|LOCUS_05820 12097 12795 gene locus_tag LOCUS_05830 gene purQ 12097 12795 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021958.1 protein_id gnl|my_center|LOCUS_05830 13448 12798 gene locus_tag LOCUS_05840 gene rnhB 13448 12798 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021954.1 protein_id gnl|my_center|LOCUS_05840 15765 13489 gene locus_tag LOCUS_05850 15765 13489 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878495.1 protein_id gnl|my_center|LOCUS_05850 17960 15762 gene locus_tag LOCUS_05860 17960 15762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 18228 20210 gene locus_tag LOCUS_05870 18228 20210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 20838 21755 gene locus_tag LOCUS_05880 20838 21755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 21861 23477 gene locus_tag LOCUS_05890 gene pheT 21861 23477 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021951.1 protein_id gnl|my_center|LOCUS_05890 23776 25290 gene locus_tag LOCUS_05900 23776 25290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 25581 26465 gene locus_tag LOCUS_05910 25581 26465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065193.1 protein_id gnl|my_center|LOCUS_05910 26590 27708 gene locus_tag LOCUS_05920 26590 27708 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020683.1 protein_id gnl|my_center|LOCUS_05920 27894 28391 gene locus_tag LOCUS_05930 27894 28391 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023392.1 protein_id gnl|my_center|LOCUS_05930 28551 28787 gene locus_tag LOCUS_05940 28551 28787 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023401.1 protein_id gnl|my_center|LOCUS_05940 28877 30871 gene locus_tag LOCUS_05950 gene feoB 28877 30871 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065727.1 protein_id gnl|my_center|LOCUS_05950 30881 31360 gene locus_tag LOCUS_05960 30881 31360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 31374 31631 gene locus_tag LOCUS_05970 31374 31631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 31864 33480 gene locus_tag LOCUS_05980 31864 33480 CDS product methylamine methyltransferase corrinoid protein reductive activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024259.1 protein_id gnl|my_center|LOCUS_05980 33514 34605 gene locus_tag LOCUS_05990 33514 34605 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066591.1 protein_id gnl|my_center|LOCUS_05990 35338 36099 gene locus_tag LOCUS_06000 gene mtaC 35338 36099 CDS product methanol--corrinoid protein MtaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021627.1 protein_id gnl|my_center|LOCUS_06000 36114 37505 gene locus_tag LOCUS_06010 gene mtaB 36114 37505 CDS product methanol--corrinoid protein co-methyltransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024271.1 protein_id gnl|my_center|LOCUS_06010 38700 37684 gene locus_tag LOCUS_06020 gene mtaA 38700 37684 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021625.1 protein_id gnl|my_center|LOCUS_06020 41666 38835 gene locus_tag LOCUS_06030 41666 38835 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020807.1 protein_id gnl|my_center|LOCUS_06030 42493 41663 gene locus_tag LOCUS_06040 42493 41663 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020802.1 protein_id gnl|my_center|LOCUS_06040 42621 43577 gene locus_tag LOCUS_06050 42621 43577 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021005.1 protein_id gnl|my_center|LOCUS_06050 >Feature sequence012 3345 2527 gene locus_tag LOCUS_06060 3345 2527 CDS product Dna2/Cas4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065883.1 protein_id gnl|my_center|LOCUS_06060 3454 4215 gene locus_tag LOCUS_06070 3454 4215 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023933.1 protein_id gnl|my_center|LOCUS_06070 4250 5299 gene locus_tag LOCUS_06080 4250 5299 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023934.1 protein_id gnl|my_center|LOCUS_06080 5310 6482 gene locus_tag LOCUS_06090 5310 6482 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_06090 6488 6877 gene locus_tag LOCUS_06100 6488 6877 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023936.1 protein_id gnl|my_center|LOCUS_06100 6877 7410 gene locus_tag LOCUS_06110 gene cyaB 6877 7410 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023937.1 protein_id gnl|my_center|LOCUS_06110 9532 7487 gene locus_tag LOCUS_06120 gene metG 9532 7487 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065884.1 protein_id gnl|my_center|LOCUS_06120 9711 10784 gene locus_tag LOCUS_06130 gene sppA 9711 10784 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065885.1 protein_id gnl|my_center|LOCUS_06130 11430 10852 gene locus_tag LOCUS_06140 11430 10852 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_06140 11828 12523 gene locus_tag LOCUS_06150 11828 12523 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079931.1 protein_id gnl|my_center|LOCUS_06150 12557 13291 gene locus_tag LOCUS_06160 12557 13291 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875755.1 protein_id gnl|my_center|LOCUS_06160 14521 13595 gene locus_tag LOCUS_06170 14521 13595 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020436.1 protein_id gnl|my_center|LOCUS_06170 15258 16145 gene locus_tag LOCUS_06180 15258 16145 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021656.1 protein_id gnl|my_center|LOCUS_06180 16142 17557 gene locus_tag LOCUS_06190 16142 17557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 17594 18697 gene locus_tag LOCUS_06200 gene ftsZ 17594 18697 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024152.1 protein_id gnl|my_center|LOCUS_06200 18858 19091 gene locus_tag LOCUS_06210 18858 19091 CDS product protein translocase SEC61 complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024153.1 protein_id gnl|my_center|LOCUS_06210 19095 19556 gene locus_tag LOCUS_06220 19095 19556 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065945.1 protein_id gnl|my_center|LOCUS_06220 19600 20082 gene locus_tag LOCUS_06230 19600 20082 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024155.1 protein_id gnl|my_center|LOCUS_06230 20230 20871 gene locus_tag LOCUS_06240 20230 20871 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024156.1 protein_id gnl|my_center|LOCUS_06240 20873 21898 gene locus_tag LOCUS_06250 20873 21898 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024157.1 protein_id gnl|my_center|LOCUS_06250 21938 22249 gene locus_tag LOCUS_06260 gene rpl12p 21938 22249 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024158.1 protein_id gnl|my_center|LOCUS_06260 22384 23358 gene locus_tag LOCUS_06270 22384 23358 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024160.1 protein_id gnl|my_center|LOCUS_06270 25410 23407 gene locus_tag LOCUS_06280 25410 23407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 26350 25574 gene locus_tag LOCUS_06290 26350 25574 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024199.1 protein_id gnl|my_center|LOCUS_06290 26926 27126 gene locus_tag LOCUS_06300 26926 27126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 27640 27825 gene locus_tag LOCUS_06310 27640 27825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 28141 28338 gene locus_tag LOCUS_06320 28141 28338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 28743 29129 gene locus_tag LOCUS_06330 28743 29129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06330 29126 29395 gene locus_tag LOCUS_06340 29126 29395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 29963 29888 gene locus_tag LOCUS_t00100 29963 29888 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 31121 30030 gene locus_tag LOCUS_06350 31121 30030 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024231.1 protein_id gnl|my_center|LOCUS_06350 31410 32078 gene locus_tag LOCUS_06360 31410 32078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 33057 32167 gene locus_tag LOCUS_06370 33057 32167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 35181 33070 gene locus_tag LOCUS_06380 35181 33070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 35330 35178 gene locus_tag LOCUS_06390 35330 35178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 36897 35332 gene locus_tag LOCUS_06400 36897 35332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 37912 36902 gene locus_tag LOCUS_06410 37912 36902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 38644 38090 gene locus_tag LOCUS_06420 38644 38090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 38786 40081 gene locus_tag LOCUS_06430 38786 40081 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024335.1 protein_id gnl|my_center|LOCUS_06430 >Feature sequence013 263 147 gene locus_tag LOCUS_r00010 263 147 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 360 288 gene locus_tag LOCUS_t00110 360 288 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3371 472 gene locus_tag LOCUS_r00020 3371 472 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3583 3509 gene locus_tag LOCUS_t00120 3583 3509 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5139 3671 gene locus_tag LOCUS_r00030 5139 3671 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5382 5600 gene locus_tag LOCUS_06440 5382 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 5698 7209 gene locus_tag LOCUS_06450 5698 7209 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024485.1 protein_id gnl|my_center|LOCUS_06450 7328 8086 gene locus_tag LOCUS_06460 7328 8086 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066032.1 protein_id gnl|my_center|LOCUS_06460 8120 8764 gene locus_tag LOCUS_06470 8120 8764 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024487.1 protein_id gnl|my_center|LOCUS_06470 8818 10620 gene locus_tag LOCUS_06480 8818 10620 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024488.1 protein_id gnl|my_center|LOCUS_06480 11679 10624 gene locus_tag LOCUS_06490 11679 10624 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066036.1 protein_id gnl|my_center|LOCUS_06490 13063 11681 gene locus_tag LOCUS_06500 13063 11681 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066616.1 protein_id gnl|my_center|LOCUS_06500 13165 14997 gene locus_tag LOCUS_06510 gene arcS 13165 14997 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024500.1 protein_id gnl|my_center|LOCUS_06510 15015 15536 gene locus_tag LOCUS_06520 gene rimI 15015 15536 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066037.1 protein_id gnl|my_center|LOCUS_06520 15846 15559 gene locus_tag LOCUS_06530 15846 15559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 17397 16069 gene locus_tag LOCUS_06540 17397 16069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 18030 19406 gene locus_tag LOCUS_06550 18030 19406 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024504.1 protein_id gnl|my_center|LOCUS_06550 19403 20398 gene locus_tag LOCUS_06560 gene rtcA 19403 20398 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024505.1 protein_id gnl|my_center|LOCUS_06560 21054 20419 gene locus_tag LOCUS_06570 21054 20419 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024506.1 protein_id gnl|my_center|LOCUS_06570 21227 22354 gene locus_tag LOCUS_06580 21227 22354 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024513.1 protein_id gnl|my_center|LOCUS_06580 22491 23102 gene locus_tag LOCUS_06590 22491 23102 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024515.1 protein_id gnl|my_center|LOCUS_06590 23145 23933 gene locus_tag LOCUS_06600 23145 23933 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024516.1 protein_id gnl|my_center|LOCUS_06600 24050 25018 gene locus_tag LOCUS_06610 24050 25018 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048168954.1 protein_id gnl|my_center|LOCUS_06610 25068 25916 gene locus_tag LOCUS_06620 25068 25916 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024518.1 protein_id gnl|my_center|LOCUS_06620 25953 26729 gene locus_tag LOCUS_06630 25953 26729 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589511.1 protein_id gnl|my_center|LOCUS_06630 26732 27898 gene locus_tag LOCUS_06640 26732 27898 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024521.1 protein_id gnl|my_center|LOCUS_06640 27954 28988 gene locus_tag LOCUS_06650 27954 28988 CDS product translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024522.1 protein_id gnl|my_center|LOCUS_06650 29498 28995 gene locus_tag LOCUS_06660 29498 28995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 30254 29511 gene locus_tag LOCUS_06670 30254 29511 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250992.1 protein_id gnl|my_center|LOCUS_06670 30448 31350 gene locus_tag LOCUS_06680 30448 31350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 32377 31358 gene locus_tag LOCUS_06690 32377 31358 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020113.1 protein_id gnl|my_center|LOCUS_06690 32789 32451 gene locus_tag LOCUS_06700 32789 32451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 34798 32882 gene locus_tag LOCUS_06710 34798 32882 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020337.1 protein_id gnl|my_center|LOCUS_06710 35062 36345 gene locus_tag LOCUS_06720 35062 36345 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020753.1 protein_id gnl|my_center|LOCUS_06720 36332 38158 gene locus_tag LOCUS_06730 36332 38158 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990744.1 protein_id gnl|my_center|LOCUS_06730 38279 38355 gene locus_tag LOCUS_t00130 38279 38355 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 38414 38644 gene locus_tag LOCUS_06740 38414 38644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 39436 38663 gene locus_tag LOCUS_06750 39436 38663 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024526.1 protein_id gnl|my_center|LOCUS_06750 39891 39433 gene locus_tag LOCUS_06760 39891 39433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 >Feature sequence014 1450 1034 gene locus_tag LOCUS_06770 1450 1034 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024443.1 protein_id gnl|my_center|LOCUS_06770 1863 1447 gene locus_tag LOCUS_06780 1863 1447 CDS product monovalent cation/H+ antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024444.1 protein_id gnl|my_center|LOCUS_06780 4226 1860 gene locus_tag LOCUS_06790 4226 1860 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024445.1 protein_id gnl|my_center|LOCUS_06790 4401 4736 gene locus_tag LOCUS_06800 4401 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065385.1 protein_id gnl|my_center|LOCUS_06800 5384 4890 gene locus_tag LOCUS_06810 5384 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 6614 5547 gene locus_tag LOCUS_06820 6614 5547 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023369.1 protein_id gnl|my_center|LOCUS_06820 7137 6781 gene locus_tag LOCUS_06830 7137 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 7344 7168 gene locus_tag LOCUS_06840 7344 7168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 9021 7612 gene locus_tag LOCUS_06850 gene acsC 9021 7612 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021046.1 protein_id gnl|my_center|LOCUS_06850 10362 9025 gene locus_tag LOCUS_06860 gene cdhD 10362 9025 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021047.1 protein_id gnl|my_center|LOCUS_06860 11143 10391 gene locus_tag LOCUS_06870 11143 10391 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023761.1 protein_id gnl|my_center|LOCUS_06870 12583 11156 gene locus_tag LOCUS_06880 gene cdhC 12583 11156 CDS product CO dehydrogenase/CO-methylating acetyl-CoA synthase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023760.1 protein_id gnl|my_center|LOCUS_06880 13124 12615 gene locus_tag LOCUS_06890 gene cdhB 13124 12615 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023759.1 protein_id gnl|my_center|LOCUS_06890 15538 13124 gene locus_tag LOCUS_06900 gene cdhA 15538 13124 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023758.1 protein_id gnl|my_center|LOCUS_06900 16339 16788 gene locus_tag LOCUS_06910 16339 16788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 16757 17200 gene locus_tag LOCUS_06920 16757 17200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023756.1 protein_id gnl|my_center|LOCUS_06920 17350 17910 gene locus_tag LOCUS_06930 17350 17910 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065830.1 protein_id gnl|my_center|LOCUS_06930 19090 17912 gene locus_tag LOCUS_06940 19090 17912 CDS product homocitrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023272.1 protein_id gnl|my_center|LOCUS_06940 20072 19224 gene locus_tag LOCUS_06950 20072 19224 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023273.1 protein_id gnl|my_center|LOCUS_06950 20859 20059 gene locus_tag LOCUS_06960 20859 20059 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023274.1 protein_id gnl|my_center|LOCUS_06960 21879 20872 gene locus_tag LOCUS_06970 21879 20872 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023275.1 protein_id gnl|my_center|LOCUS_06970 22178 21990 gene locus_tag LOCUS_06980 22178 21990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 23070 22192 gene locus_tag LOCUS_06990 23070 22192 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023289.1 protein_id gnl|my_center|LOCUS_06990 23219 23746 gene locus_tag LOCUS_07000 23219 23746 CDS product TIGR00267 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876200.1 protein_id gnl|my_center|LOCUS_07000 23985 23800 gene locus_tag LOCUS_07010 23985 23800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 23906 24781 gene locus_tag LOCUS_07020 23906 24781 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022960.1 protein_id gnl|my_center|LOCUS_07020 24853 25290 gene locus_tag LOCUS_07030 24853 25290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020487.1 protein_id gnl|my_center|LOCUS_07030 25355 25915 gene locus_tag LOCUS_07040 25355 25915 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021817.1 protein_id gnl|my_center|LOCUS_07040 26028 27179 gene locus_tag LOCUS_07050 26028 27179 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065228.1 protein_id gnl|my_center|LOCUS_07050 27191 27661 gene locus_tag LOCUS_07060 gene ribC 27191 27661 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021819.1 protein_id gnl|my_center|LOCUS_07060 27719 28123 gene locus_tag LOCUS_07070 gene ribH 27719 28123 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021820.1 protein_id gnl|my_center|LOCUS_07070 28151 29293 gene locus_tag LOCUS_07080 28151 29293 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021821.1 protein_id gnl|my_center|LOCUS_07080 29716 29297 gene locus_tag LOCUS_07090 29716 29297 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064389.1 protein_id gnl|my_center|LOCUS_07090 30133 31635 gene locus_tag LOCUS_07100 30133 31635 CDS product L-aspartate semialdehyde sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021823.1 protein_id gnl|my_center|LOCUS_07100 31637 32032 gene locus_tag LOCUS_07110 31637 32032 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065229.1 protein_id gnl|my_center|LOCUS_07110 32019 32768 gene locus_tag LOCUS_07120 32019 32768 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021719.1 protein_id gnl|my_center|LOCUS_07120 33466 32771 gene locus_tag LOCUS_07130 33466 32771 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021827.1 protein_id gnl|my_center|LOCUS_07130 34379 33975 gene locus_tag LOCUS_07140 34379 33975 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022524.1 protein_id gnl|my_center|LOCUS_07140 34699 34872 gene locus_tag LOCUS_07150 34699 34872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 34841 35152 gene locus_tag LOCUS_07160 34841 35152 CDS product DUF5611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065922.1 protein_id gnl|my_center|LOCUS_07160 35183 35695 gene locus_tag LOCUS_07170 35183 35695 CDS product chorismate pyruvate-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024074.1 protein_id gnl|my_center|LOCUS_07170 35799 35870 gene locus_tag LOCUS_t00140 35799 35870 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 36394 37512 gene locus_tag LOCUS_07180 36394 37512 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023496.1 protein_id gnl|my_center|LOCUS_07180 37522 38730 gene locus_tag LOCUS_07190 37522 38730 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023495.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence015 2163 1021 gene locus_tag LOCUS_07200 2163 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 3709 2240 gene locus_tag LOCUS_07210 3709 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 5121 4405 gene locus_tag LOCUS_07220 gene pseF 5121 4405 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_07220 5675 5151 gene locus_tag LOCUS_07230 5675 5151 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015753.1 protein_id gnl|my_center|LOCUS_07230 6784 5675 gene locus_tag LOCUS_07240 6784 5675 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015754.1 protein_id gnl|my_center|LOCUS_07240 7634 6750 gene locus_tag LOCUS_07250 gene rfbD 7634 6750 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_07250 8582 7650 gene locus_tag LOCUS_07260 8582 7650 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965465.1 protein_id gnl|my_center|LOCUS_07260 9642 8611 gene locus_tag LOCUS_07270 9642 8611 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870574.1 protein_id gnl|my_center|LOCUS_07270 11171 9885 gene locus_tag LOCUS_07280 11171 9885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 12127 11330 gene locus_tag LOCUS_07290 12127 11330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 12708 12166 gene locus_tag LOCUS_07300 12708 12166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07300 13397 12738 gene locus_tag LOCUS_07310 13397 12738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07310 14357 13416 gene locus_tag LOCUS_07320 14357 13416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 15903 14446 gene locus_tag LOCUS_07330 15903 14446 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860184.1 protein_id gnl|my_center|LOCUS_07330 16923 16000 gene locus_tag LOCUS_07340 16923 16000 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403373.1 protein_id gnl|my_center|LOCUS_07340 17945 16935 gene locus_tag LOCUS_07350 17945 16935 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932409.1 protein_id gnl|my_center|LOCUS_07350 19305 18043 gene locus_tag LOCUS_07360 19305 18043 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860339.1 protein_id gnl|my_center|LOCUS_07360 21058 21363 gene locus_tag LOCUS_07370 21058 21363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 21576 22367 gene locus_tag LOCUS_07380 21576 22367 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065799.1 protein_id gnl|my_center|LOCUS_07380 22367 23740 gene locus_tag LOCUS_07390 gene gltA 22367 23740 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023687.1 protein_id gnl|my_center|LOCUS_07390 24050 25798 gene locus_tag LOCUS_07400 24050 25798 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022843.1 protein_id gnl|my_center|LOCUS_07400 25872 26945 gene locus_tag LOCUS_07410 25872 26945 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022844.1 protein_id gnl|my_center|LOCUS_07410 27041 28945 gene locus_tag LOCUS_07420 27041 28945 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022845.1 protein_id gnl|my_center|LOCUS_07420 28947 29252 gene locus_tag LOCUS_07430 28947 29252 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545551.1 protein_id gnl|my_center|LOCUS_07430 29327 30496 gene locus_tag LOCUS_07440 gene thiI 29327 30496 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021480.1 protein_id gnl|my_center|LOCUS_07440 31715 31554 gene locus_tag LOCUS_07450 31715 31554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 31826 33382 gene locus_tag LOCUS_07460 31826 33382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 34116 33526 gene locus_tag LOCUS_07470 34116 33526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 34791 34225 gene locus_tag LOCUS_07480 34791 34225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 36309 35719 gene locus_tag LOCUS_07490 36309 35719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 36497 36255 gene locus_tag LOCUS_07500 36497 36255 CDS product DUF5371 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064725.1 protein_id gnl|my_center|LOCUS_07500 36828 37106 gene locus_tag LOCUS_07510 36828 37106 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023169.1 protein_id gnl|my_center|LOCUS_07510 >Feature sequence016 <1 1290 gene locus_tag LOCUS_07520 <1 1290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065860.1:ABC transporter ATP-binding protein 1414 1773 gene locus_tag LOCUS_07530 1414 1773 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065462.1 protein_id gnl|my_center|LOCUS_07530 2266 3246 gene locus_tag LOCUS_07540 2266 3246 CDS product DUF128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065980.1 protein_id gnl|my_center|LOCUS_07540 4810 3572 gene locus_tag LOCUS_07550 4810 3572 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020688.1 protein_id gnl|my_center|LOCUS_07550 5595 4816 gene locus_tag LOCUS_07560 5595 4816 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020689.1 protein_id gnl|my_center|LOCUS_07560 6560 5763 gene locus_tag LOCUS_07570 6560 5763 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064935.1 protein_id gnl|my_center|LOCUS_07570 7041 6763 gene locus_tag LOCUS_07580 7041 6763 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020693.1 protein_id gnl|my_center|LOCUS_07580 7797 7066 gene locus_tag LOCUS_07590 7797 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064936.1 protein_id gnl|my_center|LOCUS_07590 8959 7790 gene locus_tag LOCUS_07600 gene priS 8959 7790 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020695.1 protein_id gnl|my_center|LOCUS_07600 9088 11067 gene locus_tag LOCUS_07610 gene rqcH 9088 11067 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020698.1 protein_id gnl|my_center|LOCUS_07610 11160 12200 gene locus_tag LOCUS_07620 11160 12200 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020699.1 protein_id gnl|my_center|LOCUS_07620 12681 13262 gene locus_tag LOCUS_07630 12681 13262 CDS product acetate uptake transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024272.1 protein_id gnl|my_center|LOCUS_07630 13620 15095 gene locus_tag LOCUS_07640 13620 15095 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787371.1 protein_id gnl|my_center|LOCUS_07640 16193 15258 gene locus_tag LOCUS_07650 16193 15258 CDS product diadenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064938.1 protein_id gnl|my_center|LOCUS_07650 16296 16841 gene locus_tag LOCUS_07660 gene thpR 16296 16841 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066123.1 protein_id gnl|my_center|LOCUS_07660 17758 16862 gene locus_tag LOCUS_07670 17758 16862 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020704.1 protein_id gnl|my_center|LOCUS_07670 17989 18417 gene locus_tag LOCUS_07680 17989 18417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 18429 19901 gene locus_tag LOCUS_07690 18429 19901 CDS product methanogenesis multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064939.1 protein_id gnl|my_center|LOCUS_07690 19915 21267 gene locus_tag LOCUS_07700 19915 21267 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860093.1 protein_id gnl|my_center|LOCUS_07700 21268 22284 gene locus_tag LOCUS_07710 21268 22284 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020707.1 protein_id gnl|my_center|LOCUS_07710 22277 22855 gene locus_tag LOCUS_07720 22277 22855 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020708.1 protein_id gnl|my_center|LOCUS_07720 22861 23475 gene locus_tag LOCUS_07730 22861 23475 CDS product RnfABCDGE type electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064940.1 protein_id gnl|my_center|LOCUS_07730 23477 24064 gene locus_tag LOCUS_07740 23477 24064 CDS product electron transport complex protein RnfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064941.1 protein_id gnl|my_center|LOCUS_07740 24061 24867 gene locus_tag LOCUS_07750 24061 24867 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020711.1 protein_id gnl|my_center|LOCUS_07750 24864 25202 gene locus_tag LOCUS_07760 24864 25202 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020712.1 protein_id gnl|my_center|LOCUS_07760 25375 26295 gene locus_tag LOCUS_07770 25375 26295 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064944.1 protein_id gnl|my_center|LOCUS_07770 26297 26812 gene locus_tag LOCUS_07780 26297 26812 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064945.1 protein_id gnl|my_center|LOCUS_07780 27043 26819 gene locus_tag LOCUS_07790 27043 26819 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020717.1 protein_id gnl|my_center|LOCUS_07790 27712 27269 gene locus_tag LOCUS_07800 27712 27269 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021802.1 protein_id gnl|my_center|LOCUS_07800 27889 29190 gene locus_tag LOCUS_07810 27889 29190 CDS product Single-stranded DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020639.1 protein_id gnl|my_center|LOCUS_07810 29195 30070 gene locus_tag LOCUS_07820 29195 30070 CDS product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064919.1 protein_id gnl|my_center|LOCUS_07820 30401 30081 gene locus_tag LOCUS_07830 30401 30081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023839.1 protein_id gnl|my_center|LOCUS_07830 30557 31144 gene locus_tag LOCUS_07840 30557 31144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020871.1 protein_id gnl|my_center|LOCUS_07840 32124 31201 gene locus_tag LOCUS_07850 32124 31201 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065835.1 protein_id gnl|my_center|LOCUS_07850 32668 34914 gene locus_tag LOCUS_07860 32668 34914 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404984.1 protein_id gnl|my_center|LOCUS_07860 35092 36339 gene locus_tag LOCUS_07870 35092 36339 CDS product replication protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022958.1 protein_id gnl|my_center|LOCUS_07870 36340 36921 gene locus_tag LOCUS_07880 36340 36921 CDS product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022957.1 protein_id gnl|my_center|LOCUS_07880 >Feature sequence017 1309 2610 gene locus_tag LOCUS_07890 gene mcrB 1309 2610 CDS product coenzyme-B sulfoethylthiotransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024423.1 protein_id gnl|my_center|LOCUS_07890 2652 3137 gene locus_tag LOCUS_07900 gene mcrD 2652 3137 CDS product methyl-coenzyme M reductase operon protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024422.1 protein_id gnl|my_center|LOCUS_07900 3142 3753 gene locus_tag LOCUS_07910 gene mcrC 3142 3753 CDS product methyl-coenzyme M reductase I operon protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024421.1 protein_id gnl|my_center|LOCUS_07910 3756 4505 gene locus_tag LOCUS_07920 gene mcrG 3756 4505 CDS product coenzyme-B sulfoethylthiotransferase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024420.1 protein_id gnl|my_center|LOCUS_07920 4520 6238 gene locus_tag LOCUS_07930 gene mcrA 4520 6238 CDS product coenzyme-B sulfoethylthiotransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024419.1 protein_id gnl|my_center|LOCUS_07930 6414 8465 gene locus_tag LOCUS_07940 6414 8465 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024274.1 protein_id gnl|my_center|LOCUS_07940 9749 8469 gene locus_tag LOCUS_07950 gene aroA 9749 8469 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024417.1 protein_id gnl|my_center|LOCUS_07950 10123 12072 gene locus_tag LOCUS_07960 10123 12072 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023418.1 protein_id gnl|my_center|LOCUS_07960 12456 12815 gene locus_tag LOCUS_07970 12456 12815 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_07970 12812 13366 gene locus_tag LOCUS_07980 12812 13366 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943299.1 protein_id gnl|my_center|LOCUS_07980 13410 13862 gene locus_tag LOCUS_07990 13410 13862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 14723 13866 gene locus_tag LOCUS_08000 gene htpX 14723 13866 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024415.1 protein_id gnl|my_center|LOCUS_08000 15121 14852 gene locus_tag LOCUS_08010 15121 14852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 16414 15125 gene locus_tag LOCUS_08020 16414 15125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 16825 16571 gene locus_tag LOCUS_08030 16825 16571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 17133 17849 gene locus_tag LOCUS_08040 17133 17849 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878499.1 protein_id gnl|my_center|LOCUS_08040 17913 18419 gene locus_tag LOCUS_08050 17913 18419 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065441.1 protein_id gnl|my_center|LOCUS_08050 18429 19424 gene locus_tag LOCUS_08060 18429 19424 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022537.1 protein_id gnl|my_center|LOCUS_08060 19439 21124 gene locus_tag LOCUS_08070 19439 21124 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022536.1 protein_id gnl|my_center|LOCUS_08070 21200 21559 gene locus_tag LOCUS_08080 21200 21559 CDS product cupredoxin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065099.1 protein_id gnl|my_center|LOCUS_08080 22596 21562 gene locus_tag LOCUS_08090 22596 21562 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022381.1 protein_id gnl|my_center|LOCUS_08090 22669 23880 gene locus_tag LOCUS_08100 22669 23880 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023499.1 protein_id gnl|my_center|LOCUS_08100 26485 23864 gene locus_tag LOCUS_08110 26485 23864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 27952 26642 gene locus_tag LOCUS_08120 27952 26642 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065661.1 protein_id gnl|my_center|LOCUS_08120 29293 27953 gene locus_tag LOCUS_08130 29293 27953 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990640.1 protein_id gnl|my_center|LOCUS_08130 31210 29312 gene locus_tag LOCUS_08140 gene lonB 31210 29312 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023222.1 protein_id gnl|my_center|LOCUS_08140 31361 31801 gene locus_tag LOCUS_08150 31361 31801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023229.1 protein_id gnl|my_center|LOCUS_08150 32053 32126 gene locus_tag LOCUS_t00150 32053 32126 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 32197 32270 gene locus_tag LOCUS_t00160 32197 32270 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 32281 32354 gene locus_tag LOCUS_t00170 32281 32354 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 32718 32416 gene locus_tag LOCUS_08160 32718 32416 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986755.1 protein_id gnl|my_center|LOCUS_08160 33398 32787 gene locus_tag LOCUS_08170 33398 32787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 >Feature sequence018 561 31 gene locus_tag LOCUS_08180 561 31 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022955.1 protein_id gnl|my_center|LOCUS_08180 1368 580 gene locus_tag LOCUS_08190 1368 580 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589532.1 protein_id gnl|my_center|LOCUS_08190 1874 1365 gene locus_tag LOCUS_08200 1874 1365 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022953.1 protein_id gnl|my_center|LOCUS_08200 3074 2025 gene locus_tag LOCUS_08210 3074 2025 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 protein_id gnl|my_center|LOCUS_08210 3292 3900 gene locus_tag LOCUS_08220 3292 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022949.1 protein_id gnl|my_center|LOCUS_08220 3997 4395 gene locus_tag LOCUS_08230 gene tsaA 3997 4395 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064869.1 protein_id gnl|my_center|LOCUS_08230 4413 5174 gene locus_tag LOCUS_08240 4413 5174 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066008.1 protein_id gnl|my_center|LOCUS_08240 5549 5229 gene locus_tag LOCUS_08250 5549 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023845.1 protein_id gnl|my_center|LOCUS_08250 6602 5748 gene locus_tag LOCUS_08260 6602 5748 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_08260 7002 7610 gene locus_tag LOCUS_08270 7002 7610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08270 7665 9611 gene locus_tag LOCUS_08280 7665 9611 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162013089.1 protein_id gnl|my_center|LOCUS_08280 10180 11001 gene locus_tag LOCUS_08290 10180 11001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 10998 12230 gene locus_tag LOCUS_08300 10998 12230 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023374.1 protein_id gnl|my_center|LOCUS_08300 12325 13392 gene locus_tag LOCUS_08310 12325 13392 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_08310 13427 14191 gene locus_tag LOCUS_08320 13427 14191 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_08320 14805 14999 gene locus_tag LOCUS_08330 14805 14999 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024348.1 protein_id gnl|my_center|LOCUS_08330 15021 15896 gene locus_tag LOCUS_08340 gene dapA 15021 15896 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024349.1 protein_id gnl|my_center|LOCUS_08340 15893 16684 gene locus_tag LOCUS_08350 gene dapB 15893 16684 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024350.1 protein_id gnl|my_center|LOCUS_08350 17182 16688 gene locus_tag LOCUS_08360 gene pyrI 17182 16688 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024377.1 protein_id gnl|my_center|LOCUS_08360 18075 17179 gene locus_tag LOCUS_08370 gene pyrB 18075 17179 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024378.1 protein_id gnl|my_center|LOCUS_08370 18274 19593 gene locus_tag LOCUS_08380 18274 19593 CDS product bifunctional hexulose-6-phosphate synthase/ribonuclease regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860554.1 protein_id gnl|my_center|LOCUS_08380 19595 20362 gene locus_tag LOCUS_08390 19595 20362 CDS product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023041.1 protein_id gnl|my_center|LOCUS_08390 20414 20542 gene locus_tag LOCUS_08400 20414 20542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 22643 20556 gene locus_tag LOCUS_08410 gene recQ 22643 20556 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066602.1 protein_id gnl|my_center|LOCUS_08410 22824 23738 gene locus_tag LOCUS_08420 gene guaA 22824 23738 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024387.1 protein_id gnl|my_center|LOCUS_08420 23883 25355 gene locus_tag LOCUS_08430 23883 25355 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_08430 25348 26508 gene locus_tag LOCUS_08440 25348 26508 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123362.1 protein_id gnl|my_center|LOCUS_08440 26528 29848 gene locus_tag LOCUS_08450 26528 29848 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948403.1 protein_id gnl|my_center|LOCUS_08450 29915 30817 gene locus_tag LOCUS_08460 29915 30817 CDS product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554540.1 protein_id gnl|my_center|LOCUS_08460 31400 31327 gene locus_tag LOCUS_t00180 31400 31327 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 31472 32023 gene locus_tag LOCUS_08470 31472 32023 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020321.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence019 1768 755 gene locus_tag LOCUS_08480 1768 755 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107805.1 protein_id gnl|my_center|LOCUS_08480 4319 1905 gene locus_tag LOCUS_08490 gene ppsA 4319 1905 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023333.1 protein_id gnl|my_center|LOCUS_08490 4603 5145 gene locus_tag LOCUS_08500 4603 5145 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021659.1 protein_id gnl|my_center|LOCUS_08500 6228 5470 gene locus_tag LOCUS_08510 6228 5470 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022348.1 protein_id gnl|my_center|LOCUS_08510 6312 6397 gene locus_tag LOCUS_t00190 6312 6397 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6619 8151 gene locus_tag LOCUS_08520 6619 8151 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851467.1 protein_id gnl|my_center|LOCUS_08520 8141 9217 gene locus_tag LOCUS_08530 8141 9217 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049613991.1 protein_id gnl|my_center|LOCUS_08530 9388 9660 gene locus_tag LOCUS_08540 9388 9660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 9657 10805 gene locus_tag LOCUS_08550 9657 10805 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851154.1 protein_id gnl|my_center|LOCUS_08550 10805 11356 gene locus_tag LOCUS_08560 10805 11356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 11353 12177 gene locus_tag LOCUS_08570 11353 12177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688774.1 protein_id gnl|my_center|LOCUS_08570 12247 12471 gene locus_tag LOCUS_08580 12247 12471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 12577 15828 gene locus_tag LOCUS_08590 12577 15828 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_08590 18058 16154 gene locus_tag LOCUS_08600 gene cooS 18058 16154 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021329.1 protein_id gnl|my_center|LOCUS_08600 18480 18166 gene locus_tag LOCUS_08610 18480 18166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023845.1 protein_id gnl|my_center|LOCUS_08610 19218 21209 gene locus_tag LOCUS_08620 19218 21209 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023330.1 protein_id gnl|my_center|LOCUS_08620 21315 22991 gene locus_tag LOCUS_08630 21315 22991 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022420.1 protein_id gnl|my_center|LOCUS_08630 23231 23938 gene locus_tag LOCUS_08640 23231 23938 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265536.1 protein_id gnl|my_center|LOCUS_08640 24815 24075 gene locus_tag LOCUS_08650 gene sfsA 24815 24075 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877131.1 protein_id gnl|my_center|LOCUS_08650 25755 25045 gene locus_tag LOCUS_08660 25755 25045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 26525 25803 gene locus_tag LOCUS_08670 26525 25803 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020502.1 protein_id gnl|my_center|LOCUS_08670 28415 26928 gene locus_tag LOCUS_08680 gene mttB 28415 26928 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:O93658 protein_id gnl|my_center|LOCUS_08680 28932 28648 gene locus_tag LOCUS_08690 28932 28648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 30368 28992 gene locus_tag LOCUS_08700 gene mtmB 30368 28992 CDS product monomethylamine methyltransferase MtmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:P58865 protein_id gnl|my_center|LOCUS_08700 31040 30381 gene locus_tag LOCUS_08710 31040 30381 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020578.1 protein_id gnl|my_center|LOCUS_08710 >Feature sequence020 139 504 gene locus_tag LOCUS_08720 139 504 CDS product Rpp14/Pop5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064245.1 protein_id gnl|my_center|LOCUS_08720 573 1358 gene locus_tag LOCUS_08730 gene psmA 573 1358 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_08730 1417 2109 gene locus_tag LOCUS_08740 1417 2109 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021781.1 protein_id gnl|my_center|LOCUS_08740 2121 2939 gene locus_tag LOCUS_08750 gene rrp4 2121 2939 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021780.1 protein_id gnl|my_center|LOCUS_08750 3003 3986 gene locus_tag LOCUS_08760 3003 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 3976 4758 gene locus_tag LOCUS_08770 gene rrp42 3976 4758 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021779.1 protein_id gnl|my_center|LOCUS_08770 4822 5109 gene locus_tag LOCUS_08780 4822 5109 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021778.1 protein_id gnl|my_center|LOCUS_08780 5369 5719 gene locus_tag LOCUS_08790 5369 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 5728 5994 gene locus_tag LOCUS_08800 5728 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 6032 6385 gene locus_tag LOCUS_08810 6032 6385 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023749.1 protein_id gnl|my_center|LOCUS_08810 6461 7435 gene locus_tag LOCUS_08820 6461 7435 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023750.1 protein_id gnl|my_center|LOCUS_08820 7469 8773 gene locus_tag LOCUS_08830 7469 8773 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023751.1 protein_id gnl|my_center|LOCUS_08830 8813 9250 gene locus_tag LOCUS_08840 8813 9250 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023752.1 protein_id gnl|my_center|LOCUS_08840 9322 9696 gene locus_tag LOCUS_08850 9322 9696 CDS product DUF2103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065829.1 protein_id gnl|my_center|LOCUS_08850 9713 10699 gene locus_tag LOCUS_08860 9713 10699 CDS product methanogenesis marker 12 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023754.1 protein_id gnl|my_center|LOCUS_08860 11148 13526 gene locus_tag LOCUS_08870 11148 13526 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066188.1 protein_id gnl|my_center|LOCUS_08870 13523 14704 gene locus_tag LOCUS_08880 13523 14704 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021204.1 protein_id gnl|my_center|LOCUS_08880 17570 14910 gene locus_tag LOCUS_08890 17570 14910 CDS product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990677.1 protein_id gnl|my_center|LOCUS_08890 18015 18593 gene locus_tag LOCUS_08900 18015 18593 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021440.1 protein_id gnl|my_center|LOCUS_08900 18608 19018 gene locus_tag LOCUS_08910 18608 19018 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 protein_id gnl|my_center|LOCUS_08910 19049 20701 gene locus_tag LOCUS_08920 19049 20701 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021438.1 protein_id gnl|my_center|LOCUS_08920 22676 20718 gene locus_tag LOCUS_08930 22676 20718 CDS product DUF2341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064883.1 protein_id gnl|my_center|LOCUS_08930 23569 22901 gene locus_tag LOCUS_08940 23569 22901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 23836 24504 gene locus_tag LOCUS_08950 23836 24504 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022371.1 protein_id gnl|my_center|LOCUS_08950 24913 24521 gene locus_tag LOCUS_08960 24913 24521 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021003.1 protein_id gnl|my_center|LOCUS_08960 25589 25221 gene locus_tag LOCUS_08970 25589 25221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 26791 25601 gene locus_tag LOCUS_08980 26791 25601 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978596.1 protein_id gnl|my_center|LOCUS_08980 27314 27003 gene locus_tag LOCUS_08990 gene rpsJ 27314 27003 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021276.1 protein_id gnl|my_center|LOCUS_08990 28616 27348 gene locus_tag LOCUS_09000 gene tuf 28616 27348 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021277.1 protein_id gnl|my_center|LOCUS_09000 30924 28732 gene locus_tag LOCUS_09010 30924 28732 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021278.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence021 592 146 gene locus_tag LOCUS_09020 592 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020949.1 protein_id gnl|my_center|LOCUS_09020 1126 626 gene locus_tag LOCUS_09030 1126 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048170305.1 protein_id gnl|my_center|LOCUS_09030 1269 1877 gene locus_tag LOCUS_09040 gene hisH 1269 1877 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020951.1 protein_id gnl|my_center|LOCUS_09040 1887 3215 gene locus_tag LOCUS_09050 1887 3215 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066157.1 protein_id gnl|my_center|LOCUS_09050 4024 3308 gene locus_tag LOCUS_09060 4024 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 5503 4301 gene locus_tag LOCUS_09070 5503 4301 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020953.1 protein_id gnl|my_center|LOCUS_09070 6374 5604 gene locus_tag LOCUS_09080 6374 5604 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020954.1 protein_id gnl|my_center|LOCUS_09080 6734 8860 gene locus_tag LOCUS_09090 6734 8860 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064996.1 protein_id gnl|my_center|LOCUS_09090 9515 8904 gene locus_tag LOCUS_09100 9515 8904 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020957.1 protein_id gnl|my_center|LOCUS_09100 10076 9597 gene locus_tag LOCUS_09110 10076 9597 CDS product NOB1 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066159.1 protein_id gnl|my_center|LOCUS_09110 10218 10997 gene locus_tag LOCUS_09120 10218 10997 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023442.1 protein_id gnl|my_center|LOCUS_09120 12244 11000 gene locus_tag LOCUS_09130 12244 11000 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066507.1 protein_id gnl|my_center|LOCUS_09130 12213 12383 gene locus_tag LOCUS_09140 12213 12383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 12424 13386 gene locus_tag LOCUS_09150 12424 13386 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023440.1 protein_id gnl|my_center|LOCUS_09150 13453 14067 gene locus_tag LOCUS_09160 gene purN 13453 14067 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065739.1 protein_id gnl|my_center|LOCUS_09160 14099 15334 gene locus_tag LOCUS_09170 gene glyA 14099 15334 CDS product bifunctional serine hydroxymethyltransferase/L-allo-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023436.1 protein_id gnl|my_center|LOCUS_09170 15348 16211 gene locus_tag LOCUS_09180 15348 16211 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023435.1 protein_id gnl|my_center|LOCUS_09180 16242 17471 gene locus_tag LOCUS_09190 gene folP 16242 17471 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065738.1 protein_id gnl|my_center|LOCUS_09190 17474 18082 gene locus_tag LOCUS_09200 17474 18082 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023431.1 protein_id gnl|my_center|LOCUS_09200 18425 19255 gene locus_tag LOCUS_09210 gene modA 18425 19255 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022259.1 protein_id gnl|my_center|LOCUS_09210 19387 19938 gene locus_tag LOCUS_09220 gene modB 19387 19938 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021257.1 protein_id gnl|my_center|LOCUS_09220 19950 21068 gene locus_tag LOCUS_09230 19950 21068 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023799.1 protein_id gnl|my_center|LOCUS_09230 21313 21861 gene locus_tag LOCUS_09240 21313 21861 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020341.1 protein_id gnl|my_center|LOCUS_09240 22994 21897 gene locus_tag LOCUS_09250 22994 21897 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_09250 23341 22991 gene locus_tag LOCUS_09260 23341 22991 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024224.1 protein_id gnl|my_center|LOCUS_09260 23678 23854 gene locus_tag LOCUS_09270 23678 23854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 24974 24150 gene locus_tag LOCUS_09280 24974 24150 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024222.1 protein_id gnl|my_center|LOCUS_09280 25774 24959 gene locus_tag LOCUS_09290 25774 24959 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024221.1 protein_id gnl|my_center|LOCUS_09290 26278 25778 gene locus_tag LOCUS_09300 26278 25778 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024220.1 protein_id gnl|my_center|LOCUS_09300 26743 29382 gene locus_tag LOCUS_09310 gene mutS 26743 29382 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020572.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence022 <1 1016 gene locus_tag LOCUS_09320 <1 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990604.1:homoserine O-acetyltransferase 4695 1198 gene locus_tag LOCUS_09330 4695 1198 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_09330 7566 4699 gene locus_tag LOCUS_09340 7566 4699 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_09340 11178 7612 gene locus_tag LOCUS_09350 11178 7612 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_09350 11553 12899 gene locus_tag LOCUS_09360 11553 12899 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065684.1 protein_id gnl|my_center|LOCUS_09360 13035 14207 gene locus_tag LOCUS_09370 13035 14207 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020852.1 protein_id gnl|my_center|LOCUS_09370 14212 14850 gene locus_tag LOCUS_09380 14212 14850 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020851.1 protein_id gnl|my_center|LOCUS_09380 14873 15409 gene locus_tag LOCUS_09390 14873 15409 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024115.1 protein_id gnl|my_center|LOCUS_09390 15424 16134 gene locus_tag LOCUS_09400 15424 16134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 16422 16625 gene locus_tag LOCUS_09410 16422 16625 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876887.1 protein_id gnl|my_center|LOCUS_09410 18254 17457 gene locus_tag LOCUS_09420 18254 17457 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962703.1 protein_id gnl|my_center|LOCUS_09420 19194 18208 gene locus_tag LOCUS_09430 19194 18208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 20253 19507 gene locus_tag LOCUS_09440 20253 19507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 20701 21348 gene locus_tag LOCUS_09450 20701 21348 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020542.1 protein_id gnl|my_center|LOCUS_09450 22045 21836 gene locus_tag LOCUS_09460 22045 21836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 22519 22343 gene locus_tag LOCUS_09470 22519 22343 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392923.1 protein_id gnl|my_center|LOCUS_09470 23505 24092 gene locus_tag LOCUS_09480 23505 24092 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065384.1 protein_id gnl|my_center|LOCUS_09480 24119 27685 gene locus_tag LOCUS_09490 gene brxC 24119 27685 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065383.1 protein_id gnl|my_center|LOCUS_09490 27687 29543 gene locus_tag LOCUS_09500 27687 29543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 >Feature sequence023 3302 834 gene locus_tag LOCUS_09510 3302 834 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990782.1 protein_id gnl|my_center|LOCUS_09510 3487 4413 gene locus_tag LOCUS_09520 3487 4413 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257444.1 protein_id gnl|my_center|LOCUS_09520 4455 5690 gene locus_tag LOCUS_09530 4455 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 7030 7608 gene locus_tag LOCUS_09540 7030 7608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 7620 8735 gene locus_tag LOCUS_09550 7620 8735 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023661.1 protein_id gnl|my_center|LOCUS_09550 12133 8738 gene locus_tag LOCUS_09560 12133 8738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 13607 12141 gene locus_tag LOCUS_09570 13607 12141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 14023 13619 gene locus_tag LOCUS_09580 14023 13619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 14542 14255 gene locus_tag LOCUS_09590 14542 14255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 18153 14539 gene locus_tag LOCUS_09600 18153 14539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 19613 18165 gene locus_tag LOCUS_09610 19613 18165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 21217 19610 gene locus_tag LOCUS_09620 21217 19610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 21370 22647 gene locus_tag LOCUS_09630 21370 22647 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860184.1 protein_id gnl|my_center|LOCUS_09630 22629 23189 gene locus_tag LOCUS_09640 22629 23189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 24771 23197 gene locus_tag LOCUS_09650 24771 23197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 25856 24753 gene locus_tag LOCUS_09660 gene wecB 25856 24753 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905859.1 protein_id gnl|my_center|LOCUS_09660 26959 25976 gene locus_tag LOCUS_09670 gene gmd 26959 25976 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_09670 27138 28358 gene locus_tag LOCUS_09680 gene xseA 27138 28358 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_09680 28330 28614 gene locus_tag LOCUS_09690 28330 28614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence024 364 71 gene locus_tag LOCUS_09700 364 71 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022822.1 protein_id gnl|my_center|LOCUS_09700 1209 862 gene locus_tag LOCUS_09710 gene pth2 1209 862 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023203.1 protein_id gnl|my_center|LOCUS_09710 2173 1265 gene locus_tag LOCUS_09720 gene mptN 2173 1265 CDS product tetrahydromethanopterin:alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023202.1 protein_id gnl|my_center|LOCUS_09720 2989 2492 gene locus_tag LOCUS_09730 2989 2492 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024085.1 protein_id gnl|my_center|LOCUS_09730 4168 3602 gene locus_tag LOCUS_09740 4168 3602 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065167.1 protein_id gnl|my_center|LOCUS_09740 4282 5724 gene locus_tag LOCUS_09750 4282 5724 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022613.1 protein_id gnl|my_center|LOCUS_09750 5960 6163 gene locus_tag LOCUS_09760 5960 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 7278 6646 gene locus_tag LOCUS_09770 7278 6646 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065150.1 protein_id gnl|my_center|LOCUS_09770 7442 8125 gene locus_tag LOCUS_09780 7442 8125 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187151961.1 protein_id gnl|my_center|LOCUS_09780 8186 9361 gene locus_tag LOCUS_09790 8186 9361 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023854.1 protein_id gnl|my_center|LOCUS_09790 9370 10584 gene locus_tag LOCUS_09800 9370 10584 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065859.1 protein_id gnl|my_center|LOCUS_09800 10596 11810 gene locus_tag LOCUS_09810 10596 11810 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065859.1 protein_id gnl|my_center|LOCUS_09810 13148 11970 gene locus_tag LOCUS_09820 13148 11970 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022687.1 protein_id gnl|my_center|LOCUS_09820 13673 13314 gene locus_tag LOCUS_09830 13673 13314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 16616 14106 gene locus_tag LOCUS_09840 16616 14106 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023083.1 protein_id gnl|my_center|LOCUS_09840 18490 16616 gene locus_tag LOCUS_09850 18490 16616 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023084.1 protein_id gnl|my_center|LOCUS_09850 19370 18492 gene locus_tag LOCUS_09860 19370 18492 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023085.1 protein_id gnl|my_center|LOCUS_09860 20357 19383 gene locus_tag LOCUS_09870 20357 19383 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023086.1 protein_id gnl|my_center|LOCUS_09870 21290 20409 gene locus_tag LOCUS_09880 21290 20409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860288.1 protein_id gnl|my_center|LOCUS_09880 22225 21332 gene locus_tag LOCUS_09890 gene pheA 22225 21332 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066451.1 protein_id gnl|my_center|LOCUS_09890 22418 26434 gene locus_tag LOCUS_09900 22418 26434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021179.1 protein_id gnl|my_center|LOCUS_09900 26431 27036 gene locus_tag LOCUS_09910 26431 27036 CDS product sarcinarray family MAST domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065049.1 protein_id gnl|my_center|LOCUS_09910 27633 27172 gene locus_tag LOCUS_09920 27633 27172 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948908.1 protein_id gnl|my_center|LOCUS_09920 28059 28202 gene locus_tag LOCUS_09930 28059 28202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 28775 28572 gene locus_tag LOCUS_09940 28775 28572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 28905 >29238 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccacgtgtgtggggaactc >Feature sequence025 1666 293 gene locus_tag LOCUS_09950 1666 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1959 2978 gene locus_tag LOCUS_09960 1959 2978 CDS product MtaA/CmuA family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020204.1 protein_id gnl|my_center|LOCUS_09960 3422 4039 gene locus_tag LOCUS_09970 3422 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 4169 5413 gene locus_tag LOCUS_09980 gene prf1 4169 5413 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020101.1 protein_id gnl|my_center|LOCUS_09980 5426 7129 gene locus_tag LOCUS_09990 gene argS 5426 7129 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064797.1 protein_id gnl|my_center|LOCUS_09990 7482 7135 gene locus_tag LOCUS_10000 7482 7135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 7679 8077 gene locus_tag LOCUS_10010 gene msrB 7679 8077 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066093.1 protein_id gnl|my_center|LOCUS_10010 9140 8370 gene locus_tag LOCUS_10020 9140 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 11075 9435 gene locus_tag LOCUS_10030 11075 9435 CDS product methylamine methyltransferase corrinoid protein reductive activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020208.1 protein_id gnl|my_center|LOCUS_10030 12483 11284 gene locus_tag LOCUS_10040 12483 11284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 12962 13555 gene locus_tag LOCUS_10050 12962 13555 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020095.1 protein_id gnl|my_center|LOCUS_10050 14828 13581 gene locus_tag LOCUS_10060 14828 13581 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064787.1 protein_id gnl|my_center|LOCUS_10060 15486 16640 gene locus_tag LOCUS_10070 gene mfnA 15486 16640 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020065.1 protein_id gnl|my_center|LOCUS_10070 16948 18048 gene locus_tag LOCUS_10080 16948 18048 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020066.1 protein_id gnl|my_center|LOCUS_10080 18127 19533 gene locus_tag LOCUS_10090 18127 19533 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020067.1 protein_id gnl|my_center|LOCUS_10090 20469 19573 gene locus_tag LOCUS_10100 gene fhcD 20469 19573 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020069.1 protein_id gnl|my_center|LOCUS_10100 22782 20659 gene locus_tag LOCUS_10110 22782 20659 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_10110 24179 23088 gene locus_tag LOCUS_10120 gene dinB 24179 23088 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066563.1 protein_id gnl|my_center|LOCUS_10120 24565 24810 gene locus_tag LOCUS_10130 24565 24810 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021062.1 protein_id gnl|my_center|LOCUS_10130 24815 26293 gene locus_tag LOCUS_10140 24815 26293 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065781.1 protein_id gnl|my_center|LOCUS_10140 26274 27308 gene locus_tag LOCUS_10150 26274 27308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023621.1 protein_id gnl|my_center|LOCUS_10150 27382 28350 gene locus_tag LOCUS_10160 gene nadE 27382 28350 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065780.1 protein_id gnl|my_center|LOCUS_10160 >Feature sequence026 40 2691 gene locus_tag LOCUS_10170 gene ileS 40 2691 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022402.1 protein_id gnl|my_center|LOCUS_10170 2714 3349 gene locus_tag LOCUS_10180 2714 3349 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022401.1 protein_id gnl|my_center|LOCUS_10180 3423 4508 gene locus_tag LOCUS_10190 3423 4508 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066217.1 protein_id gnl|my_center|LOCUS_10190 4513 5316 gene locus_tag LOCUS_10200 gene mtnP 4513 5316 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021425.1 protein_id gnl|my_center|LOCUS_10200 6166 5327 gene locus_tag LOCUS_10210 6166 5327 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878668.1 protein_id gnl|my_center|LOCUS_10210 6385 8790 gene locus_tag LOCUS_10220 6385 8790 CDS product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021427.1 protein_id gnl|my_center|LOCUS_10220 9729 8797 gene locus_tag LOCUS_10230 9729 8797 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990787.1 protein_id gnl|my_center|LOCUS_10230 10321 9872 gene locus_tag LOCUS_10240 10321 9872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 10275 10481 gene locus_tag LOCUS_10250 10275 10481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 10438 10815 gene locus_tag LOCUS_10260 10438 10815 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021428.1 protein_id gnl|my_center|LOCUS_10260 10995 11153 gene locus_tag LOCUS_10270 10995 11153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 11187 11549 gene locus_tag LOCUS_10280 11187 11549 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589516.1 protein_id gnl|my_center|LOCUS_10280 11617 11692 gene locus_tag LOCUS_t00200 11617 11692 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 11919 11740 gene locus_tag LOCUS_10290 11919 11740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 13839 12130 gene locus_tag LOCUS_10300 13839 12130 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064918.1 protein_id gnl|my_center|LOCUS_10300 14293 13994 gene locus_tag LOCUS_10310 14293 13994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020635.1 protein_id gnl|my_center|LOCUS_10310 15027 14293 gene locus_tag LOCUS_10320 15027 14293 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020634.1 protein_id gnl|my_center|LOCUS_10320 15187 16239 gene locus_tag LOCUS_10330 15187 16239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022403.1 protein_id gnl|my_center|LOCUS_10330 17249 16341 gene locus_tag LOCUS_10340 17249 16341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 18151 17372 gene locus_tag LOCUS_10350 18151 17372 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020633.1 protein_id gnl|my_center|LOCUS_10350 19053 18151 gene locus_tag LOCUS_10360 19053 18151 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066118.1 protein_id gnl|my_center|LOCUS_10360 20001 19081 gene locus_tag LOCUS_10370 gene hemC 20001 19081 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020631.1 protein_id gnl|my_center|LOCUS_10370 21279 20014 gene locus_tag LOCUS_10380 gene hemL 21279 20014 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020630.1 protein_id gnl|my_center|LOCUS_10380 22270 21296 gene locus_tag LOCUS_10390 gene hemB 22270 21296 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020627.1 protein_id gnl|my_center|LOCUS_10390 23555 22284 gene locus_tag LOCUS_10400 gene hemA 23555 22284 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020626.1 protein_id gnl|my_center|LOCUS_10400 24293 23622 gene locus_tag LOCUS_10410 24293 23622 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020625.1 protein_id gnl|my_center|LOCUS_10410 24795 24331 gene locus_tag LOCUS_10420 gene ahbB 24795 24331 CDS product siroheme decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064915.1 protein_id gnl|my_center|LOCUS_10420 25255 24800 gene locus_tag LOCUS_10430 25255 24800 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785477.1 protein_id gnl|my_center|LOCUS_10430 26327 25239 gene locus_tag LOCUS_10440 gene ahbD 26327 25239 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_10440 >Feature sequence027 1001 396 gene locus_tag LOCUS_10450 1001 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1638 1012 gene locus_tag LOCUS_10460 1638 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 2491 1862 gene locus_tag LOCUS_10470 gene cheC 2491 1862 CDS product CheY-P phosphatase CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080665.1 protein_id gnl|my_center|LOCUS_10470 3515 2520 gene locus_tag LOCUS_10480 3515 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 4040 3567 gene locus_tag LOCUS_10490 4040 3567 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020070.1 protein_id gnl|my_center|LOCUS_10490 4677 4060 gene locus_tag LOCUS_10500 4677 4060 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020071.1 protein_id gnl|my_center|LOCUS_10500 5533 4712 gene locus_tag LOCUS_10510 5533 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 6229 5615 gene locus_tag LOCUS_10520 6229 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 8336 6249 gene locus_tag LOCUS_10530 8336 6249 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392263.1 protein_id gnl|my_center|LOCUS_10530 9473 8379 gene locus_tag LOCUS_10540 9473 8379 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020074.1 protein_id gnl|my_center|LOCUS_10540 9832 9476 gene locus_tag LOCUS_10550 9832 9476 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064788.1 protein_id gnl|my_center|LOCUS_10550 10549 10298 gene locus_tag LOCUS_10560 10549 10298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 11326 12636 gene locus_tag LOCUS_10570 11326 12636 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021464.1 protein_id gnl|my_center|LOCUS_10570 13331 12831 gene locus_tag LOCUS_10580 13331 12831 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_10580 14012 15739 gene locus_tag LOCUS_10590 gene oadA 14012 15739 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020719.1 protein_id gnl|my_center|LOCUS_10590 15750 17240 gene locus_tag LOCUS_10600 15750 17240 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020720.1 protein_id gnl|my_center|LOCUS_10600 17274 18251 gene locus_tag LOCUS_10610 17274 18251 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020721.1 protein_id gnl|my_center|LOCUS_10610 18263 18838 gene locus_tag LOCUS_10620 18263 18838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 19759 18839 gene locus_tag LOCUS_10630 19759 18839 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020723.1 protein_id gnl|my_center|LOCUS_10630 20388 19756 gene locus_tag LOCUS_10640 20388 19756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066125.1 protein_id gnl|my_center|LOCUS_10640 20748 20458 gene locus_tag LOCUS_10650 20748 20458 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020725.1 protein_id gnl|my_center|LOCUS_10650 22849 20759 gene locus_tag LOCUS_10660 22849 20759 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020726.1 protein_id gnl|my_center|LOCUS_10660 23642 22932 gene locus_tag LOCUS_10670 23642 22932 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064947.1 protein_id gnl|my_center|LOCUS_10670 23874 24563 gene locus_tag LOCUS_10680 23874 24563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860333.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence028 993 811 gene locus_tag LOCUS_10690 993 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 2133 1297 gene locus_tag LOCUS_10700 2133 1297 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020797.1 protein_id gnl|my_center|LOCUS_10700 3047 4828 gene locus_tag LOCUS_10710 3047 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020427.1 protein_id gnl|my_center|LOCUS_10710 4891 5439 gene locus_tag LOCUS_10720 4891 5439 CDS product DUF111 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990917.1 protein_id gnl|my_center|LOCUS_10720 5498 6307 gene locus_tag LOCUS_10730 gene larB 5498 6307 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020480.1 protein_id gnl|my_center|LOCUS_10730 6288 7487 gene locus_tag LOCUS_10740 gene larC 6288 7487 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020481.1 protein_id gnl|my_center|LOCUS_10740 7926 8327 gene locus_tag LOCUS_10750 7926 8327 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066143.1 protein_id gnl|my_center|LOCUS_10750 8541 8792 gene locus_tag LOCUS_10760 8541 8792 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021387.1 protein_id gnl|my_center|LOCUS_10760 8813 9727 gene locus_tag LOCUS_10770 gene trxB 8813 9727 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065103.1 protein_id gnl|my_center|LOCUS_10770 9764 10183 gene locus_tag LOCUS_10780 9764 10183 CDS product DUF2111 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589540.1 protein_id gnl|my_center|LOCUS_10780 10407 10198 gene locus_tag LOCUS_10790 10407 10198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 10613 11398 gene locus_tag LOCUS_10800 10613 11398 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020249.1 protein_id gnl|my_center|LOCUS_10800 12338 11610 gene locus_tag LOCUS_10810 12338 11610 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023187.1 protein_id gnl|my_center|LOCUS_10810 12548 13834 gene locus_tag LOCUS_10820 12548 13834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 13910 14629 gene locus_tag LOCUS_10830 13910 14629 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249999.1 protein_id gnl|my_center|LOCUS_10830 14805 15092 gene locus_tag LOCUS_10840 14805 15092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 15866 15111 gene locus_tag LOCUS_10850 15866 15111 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023550.1 protein_id gnl|my_center|LOCUS_10850 16933 15863 gene locus_tag LOCUS_10860 16933 15863 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065759.1 protein_id gnl|my_center|LOCUS_10860 18126 16963 gene locus_tag LOCUS_10870 18126 16963 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023548.1 protein_id gnl|my_center|LOCUS_10870 18963 18613 gene locus_tag LOCUS_10880 18963 18613 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020768.1 protein_id gnl|my_center|LOCUS_10880 19132 19365 gene locus_tag LOCUS_10890 19132 19365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 19591 19517 gene locus_tag LOCUS_t00210 19591 19517 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 20045 19641 gene locus_tag LOCUS_10900 20045 19641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022359.1 protein_id gnl|my_center|LOCUS_10900 20386 20060 gene locus_tag LOCUS_10910 20386 20060 CDS product DUF2551 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065388.1 protein_id gnl|my_center|LOCUS_10910 20559 21059 gene locus_tag LOCUS_10920 20559 21059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022361.1 protein_id gnl|my_center|LOCUS_10920 21912 21676 gene locus_tag LOCUS_10930 21912 21676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 23234 22593 gene locus_tag LOCUS_10940 23234 22593 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064856.1 protein_id gnl|my_center|LOCUS_10940 23804 23634 gene locus_tag LOCUS_10950 23804 23634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 24068 25372 gene locus_tag LOCUS_10960 24068 25372 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963927.1 protein_id gnl|my_center|LOCUS_10960 >Feature sequence029 1977 796 gene locus_tag LOCUS_10970 1977 796 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022128.1 protein_id gnl|my_center|LOCUS_10970 5263 2036 gene locus_tag LOCUS_10980 gene carB 5263 2036 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022129.1 protein_id gnl|my_center|LOCUS_10980 6360 5263 gene locus_tag LOCUS_10990 gene carA 6360 5263 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022130.1 protein_id gnl|my_center|LOCUS_10990 8430 6529 gene locus_tag LOCUS_11000 gene gatE 8430 6529 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022814.1 protein_id gnl|my_center|LOCUS_11000 9827 8511 gene locus_tag LOCUS_11010 9827 8511 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022819.1 protein_id gnl|my_center|LOCUS_11010 12177 9817 gene locus_tag LOCUS_11020 gene hdrA2 12177 9817 CDS product CoB-CoM heterodisulfide reductase HdrA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022820.1 protein_id gnl|my_center|LOCUS_11020 12497 13300 gene locus_tag LOCUS_11030 12497 13300 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021773.1 protein_id gnl|my_center|LOCUS_11030 13792 14457 gene locus_tag LOCUS_11040 13792 14457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 14721 16406 gene locus_tag LOCUS_11050 gene hcp 14721 16406 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047923.1 protein_id gnl|my_center|LOCUS_11050 16426 16764 gene locus_tag LOCUS_11060 16426 16764 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023100.1 protein_id gnl|my_center|LOCUS_11060 17479 16982 gene locus_tag LOCUS_11070 17479 16982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 17735 18127 gene locus_tag LOCUS_11080 17735 18127 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023127.1 protein_id gnl|my_center|LOCUS_11080 18334 18155 gene locus_tag LOCUS_11090 18334 18155 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064556.1 protein_id gnl|my_center|LOCUS_11090 18828 18406 gene locus_tag LOCUS_11100 18828 18406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 20045 19107 gene locus_tag LOCUS_11110 20045 19107 CDS product nucleoside recognition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023218.1 protein_id gnl|my_center|LOCUS_11110 20164 20331 gene locus_tag LOCUS_11120 20164 20331 CDS product methytransferase partner Trm112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023214.1 protein_id gnl|my_center|LOCUS_11120 20343 21011 gene locus_tag LOCUS_11130 20343 21011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023213.1 protein_id gnl|my_center|LOCUS_11130 21030 22628 gene locus_tag LOCUS_11140 gene pyrG 21030 22628 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023212.1 protein_id gnl|my_center|LOCUS_11140 23941 22625 gene locus_tag LOCUS_11150 gene truD 23941 22625 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_11150 24614 24126 gene locus_tag LOCUS_11160 24614 24126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 >Feature sequence030 390 1262 gene locus_tag LOCUS_11170 gene hisG 390 1262 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942177.1 protein_id gnl|my_center|LOCUS_11170 2248 1835 gene locus_tag LOCUS_11180 2248 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 2787 3257 gene locus_tag LOCUS_11190 2787 3257 CDS product DUF5788 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024379.1 protein_id gnl|my_center|LOCUS_11190 3529 3780 gene locus_tag LOCUS_11200 3529 3780 CDS product Gar1/Naf1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020658.1 protein_id gnl|my_center|LOCUS_11200 3872 4885 gene locus_tag LOCUS_11210 3872 4885 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020659.1 protein_id gnl|my_center|LOCUS_11210 4959 5582 gene locus_tag LOCUS_11220 4959 5582 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064923.1 protein_id gnl|my_center|LOCUS_11220 5579 6577 gene locus_tag LOCUS_11230 5579 6577 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020662.1 protein_id gnl|my_center|LOCUS_11230 6821 7369 gene locus_tag LOCUS_11240 6821 7369 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023416.1 protein_id gnl|my_center|LOCUS_11240 7782 8837 gene locus_tag LOCUS_11250 7782 8837 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065828.1 protein_id gnl|my_center|LOCUS_11250 8976 10508 gene locus_tag LOCUS_11260 8976 10508 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589535.1 protein_id gnl|my_center|LOCUS_11260 10577 12268 gene locus_tag LOCUS_11270 10577 12268 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_11270 12265 12750 gene locus_tag LOCUS_11280 gene ilvN 12265 12750 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_11280 12774 13784 gene locus_tag LOCUS_11290 gene ilvC 12774 13784 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023690.1 protein_id gnl|my_center|LOCUS_11290 13871 14395 gene locus_tag LOCUS_11300 13871 14395 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023689.1 protein_id gnl|my_center|LOCUS_11300 16916 14604 gene locus_tag LOCUS_11310 16916 14604 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021792.1 protein_id gnl|my_center|LOCUS_11310 17436 17014 gene locus_tag LOCUS_11320 17436 17014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 17495 18895 gene locus_tag LOCUS_11330 gene thiC 17495 18895 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021793.1 protein_id gnl|my_center|LOCUS_11330 19019 19660 gene locus_tag LOCUS_11340 19019 19660 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023336.1 protein_id gnl|my_center|LOCUS_11340 22376 19797 gene locus_tag LOCUS_11350 22376 19797 CDS product S-layer protein domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023471.1 protein_id gnl|my_center|LOCUS_11350 <23056 22503 gene locus_tag LOCUS_11360 <23056 22503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064408.1:mechanosensitive ion channel family protein >Feature sequence031 <1 1938 gene locus_tag LOCUS_11370 <1 1938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990711.1:HAMP domain-containing methyl-accepting chemotaxis protein 2134 2874 gene locus_tag LOCUS_11380 2134 2874 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022767.1 protein_id gnl|my_center|LOCUS_11380 2974 3061 gene locus_tag LOCUS_t00220 2974 3061 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5444 3291 gene locus_tag LOCUS_11390 5444 3291 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_11390 5845 6078 gene locus_tag LOCUS_11400 5845 6078 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860313.1 protein_id gnl|my_center|LOCUS_11400 6534 7637 gene locus_tag LOCUS_11410 6534 7637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 7653 8492 gene locus_tag LOCUS_11420 7653 8492 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022132.1 protein_id gnl|my_center|LOCUS_11420 8546 9436 gene locus_tag LOCUS_11430 8546 9436 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022133.1 protein_id gnl|my_center|LOCUS_11430 9578 10054 gene locus_tag LOCUS_11440 9578 10054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 10951 10106 gene locus_tag LOCUS_11450 10951 10106 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066039.1 protein_id gnl|my_center|LOCUS_11450 11031 11225 gene locus_tag LOCUS_11460 11031 11225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 11339 11812 gene locus_tag LOCUS_11470 11339 11812 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949083.1 protein_id gnl|my_center|LOCUS_11470 11899 12366 gene locus_tag LOCUS_11480 11899 12366 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948359.1 protein_id gnl|my_center|LOCUS_11480 12789 13574 gene locus_tag LOCUS_11490 gene thiM 12789 13574 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022683.1 protein_id gnl|my_center|LOCUS_11490 13561 14247 gene locus_tag LOCUS_11500 gene thiE 13561 14247 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022682.1 protein_id gnl|my_center|LOCUS_11500 14344 15075 gene locus_tag LOCUS_11510 14344 15075 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020313.1 protein_id gnl|my_center|LOCUS_11510 15922 15218 gene locus_tag LOCUS_11520 15922 15218 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065117.1 protein_id gnl|my_center|LOCUS_11520 16680 16006 gene locus_tag LOCUS_11530 16680 16006 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_11530 17395 16670 gene locus_tag LOCUS_11540 17395 16670 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_11540 17839 17540 gene locus_tag LOCUS_11550 17839 17540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064198.1 protein_id gnl|my_center|LOCUS_11550 18290 17913 gene locus_tag LOCUS_11560 18290 17913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 18615 18415 gene locus_tag LOCUS_11570 18615 18415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 20009 19584 gene locus_tag LOCUS_11580 20009 19584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 20441 20037 gene locus_tag LOCUS_11590 20441 20037 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065550.1 protein_id gnl|my_center|LOCUS_11590 21685 20441 gene locus_tag LOCUS_11600 21685 20441 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065549.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence032 1250 1056 gene locus_tag LOCUS_11610 1250 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 1883 1689 gene locus_tag LOCUS_11620 1883 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 2637 2488 gene locus_tag LOCUS_11630 2637 2488 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011032551.1 protein_id gnl|my_center|LOCUS_11630 2974 2651 gene locus_tag LOCUS_11640 2974 2651 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023602.1 protein_id gnl|my_center|LOCUS_11640 3545 2964 gene locus_tag LOCUS_11650 3545 2964 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023601.1 protein_id gnl|my_center|LOCUS_11650 3731 3546 gene locus_tag LOCUS_11660 3731 3546 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023600.1 protein_id gnl|my_center|LOCUS_11660 4306 3734 gene locus_tag LOCUS_11670 4306 3734 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023599.1 protein_id gnl|my_center|LOCUS_11670 4743 4375 gene locus_tag LOCUS_11680 4743 4375 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023598.1 protein_id gnl|my_center|LOCUS_11680 5654 4740 gene locus_tag LOCUS_11690 5654 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 7372 6215 gene locus_tag LOCUS_11700 7372 6215 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023596.1 protein_id gnl|my_center|LOCUS_11700 8057 7452 gene locus_tag LOCUS_11710 8057 7452 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066526.1 protein_id gnl|my_center|LOCUS_11710 8908 8057 gene locus_tag LOCUS_11720 8908 8057 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066525.1 protein_id gnl|my_center|LOCUS_11720 9037 10104 gene locus_tag LOCUS_11730 9037 10104 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023593.1 protein_id gnl|my_center|LOCUS_11730 10127 10576 gene locus_tag LOCUS_11740 10127 10576 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023592.1 protein_id gnl|my_center|LOCUS_11740 10660 11283 gene locus_tag LOCUS_11750 10660 11283 CDS product DUF2150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023591.1 protein_id gnl|my_center|LOCUS_11750 11390 12796 gene locus_tag LOCUS_11760 gene cfbE 11390 12796 CDS product coenzyme F430 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023538.1 protein_id gnl|my_center|LOCUS_11760 12938 14065 gene locus_tag LOCUS_11770 gene cfbD 12938 14065 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023536.1 protein_id gnl|my_center|LOCUS_11770 14076 14870 gene locus_tag LOCUS_11780 gene cfbC 14076 14870 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase ATP-dependent reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023535.1 protein_id gnl|my_center|LOCUS_11780 14876 16372 gene locus_tag LOCUS_11790 gene cfbB 14876 16372 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023534.1 protein_id gnl|my_center|LOCUS_11790 16984 18480 gene locus_tag LOCUS_11800 16984 18480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 18572 19798 gene locus_tag LOCUS_11810 gene coaBC 18572 19798 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065075.1 protein_id gnl|my_center|LOCUS_11810 19944 20684 gene locus_tag LOCUS_11820 19944 20684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 20792 20974 gene locus_tag LOCUS_11830 20792 20974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence033 2089 938 gene locus_tag LOCUS_11840 2089 938 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940843.1 protein_id gnl|my_center|LOCUS_11840 2612 4246 gene locus_tag LOCUS_11850 2612 4246 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039057.1 protein_id gnl|my_center|LOCUS_11850 4236 5162 gene locus_tag LOCUS_11860 4236 5162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022423.1 protein_id gnl|my_center|LOCUS_11860 5256 6704 gene locus_tag LOCUS_11870 5256 6704 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065307.1 protein_id gnl|my_center|LOCUS_11870 6781 7122 gene locus_tag LOCUS_11880 6781 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 7115 8350 gene locus_tag LOCUS_11890 7115 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 8353 9315 gene locus_tag LOCUS_11900 8353 9315 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996055.1 protein_id gnl|my_center|LOCUS_11900 9312 10295 gene locus_tag LOCUS_11910 9312 10295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 10703 11968 gene locus_tag LOCUS_11920 10703 11968 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_11920 12007 12576 gene locus_tag LOCUS_11930 12007 12576 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224619.1 protein_id gnl|my_center|LOCUS_11930 12820 14112 gene locus_tag LOCUS_11940 12820 14112 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065247.1 protein_id gnl|my_center|LOCUS_11940 14315 17470 gene locus_tag LOCUS_11950 14315 17470 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_11950 17948 17523 gene locus_tag LOCUS_11960 17948 17523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11960 18417 17950 gene locus_tag LOCUS_11970 18417 17950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 18584 18499 gene locus_tag LOCUS_t00230 18584 18499 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19588 18569 gene locus_tag LOCUS_11980 19588 18569 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021133.1 protein_id gnl|my_center|LOCUS_11980 20129 19575 gene locus_tag LOCUS_11990 20129 19575 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021132.1 protein_id gnl|my_center|LOCUS_11990 20755 20129 gene locus_tag LOCUS_12000 20755 20129 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021131.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence034 3004 743 gene locus_tag LOCUS_12010 3004 743 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022481.1 protein_id gnl|my_center|LOCUS_12010 3582 4841 gene locus_tag LOCUS_12020 3582 4841 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020304.1 protein_id gnl|my_center|LOCUS_12020 4849 6027 gene locus_tag LOCUS_12030 4849 6027 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020303.1 protein_id gnl|my_center|LOCUS_12030 6024 6440 gene locus_tag LOCUS_12040 6024 6440 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020302.1 protein_id gnl|my_center|LOCUS_12040 6470 7576 gene locus_tag LOCUS_12050 6470 7576 CDS product TIGR04013 family B12-binding domain/radical SAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020300.1 protein_id gnl|my_center|LOCUS_12050 8311 7607 gene locus_tag LOCUS_12060 8311 7607 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023983.1 protein_id gnl|my_center|LOCUS_12060 8493 8666 gene locus_tag LOCUS_12070 8493 8666 CDS product DUF5350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879682.1 protein_id gnl|my_center|LOCUS_12070 8848 10500 gene locus_tag LOCUS_12080 gene thsB 8848 10500 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020145.1 protein_id gnl|my_center|LOCUS_12080 11684 10572 gene locus_tag LOCUS_12090 11684 10572 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020144.1 protein_id gnl|my_center|LOCUS_12090 12315 11788 gene locus_tag LOCUS_12100 12315 11788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 13544 12360 gene locus_tag LOCUS_12110 13544 12360 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020294.1 protein_id gnl|my_center|LOCUS_12110 13740 13585 gene locus_tag LOCUS_12120 13740 13585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 13935 15212 gene locus_tag LOCUS_12130 13935 15212 CDS product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020223.1 protein_id gnl|my_center|LOCUS_12130 15212 15871 gene locus_tag LOCUS_12140 15212 15871 CDS product TfuA-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020222.1 protein_id gnl|my_center|LOCUS_12140 16151 16690 gene locus_tag LOCUS_12150 16151 16690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 16716 17486 gene locus_tag LOCUS_12160 16716 17486 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021309.1 protein_id gnl|my_center|LOCUS_12160 17529 18545 gene locus_tag LOCUS_12170 17529 18545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 18854 18564 gene locus_tag LOCUS_12180 18854 18564 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869817.1 protein_id gnl|my_center|LOCUS_12180 18993 19649 gene locus_tag LOCUS_12190 18993 19649 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065078.1 protein_id gnl|my_center|LOCUS_12190 19627 20283 gene locus_tag LOCUS_12200 19627 20283 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023615.1 protein_id gnl|my_center|LOCUS_12200 >Feature sequence035 <1 1657 gene locus_tag LOCUS_12210 <1 1657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065792.1:oligosaccharyl transferase, archaeosortase A system-associated 1708 2196 gene locus_tag LOCUS_12220 gene hacB 1708 2196 CDS product homoaconitase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065791.1 protein_id gnl|my_center|LOCUS_12220 2205 3071 gene locus_tag LOCUS_12230 2205 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023654.1 protein_id gnl|my_center|LOCUS_12230 3068 4066 gene locus_tag LOCUS_12240 3068 4066 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023652.1 protein_id gnl|my_center|LOCUS_12240 5747 4095 gene locus_tag LOCUS_12250 gene flaJ 5747 4095 CDS product archaellar assembly protein FlaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147051.1 protein_id gnl|my_center|LOCUS_12250 7417 5759 gene locus_tag LOCUS_12260 7417 5759 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496653.1 protein_id gnl|my_center|LOCUS_12260 8130 7435 gene locus_tag LOCUS_12270 8130 7435 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496652.1 protein_id gnl|my_center|LOCUS_12270 8643 8146 gene locus_tag LOCUS_12280 8643 8146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 9189 8755 gene locus_tag LOCUS_12290 9189 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 10468 9179 gene locus_tag LOCUS_12300 10468 9179 CDS product FlaD/FlaE family flagellar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868609.1 protein_id gnl|my_center|LOCUS_12300 10644 11663 gene locus_tag LOCUS_12310 10644 11663 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064837.1 protein_id gnl|my_center|LOCUS_12310 12801 11746 gene locus_tag LOCUS_12320 12801 11746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 13393 14568 gene locus_tag LOCUS_12330 13393 14568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 17332 14558 gene locus_tag LOCUS_12340 gene alaS 17332 14558 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020252.1 protein_id gnl|my_center|LOCUS_12340 17581 17856 gene locus_tag LOCUS_12350 17581 17856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 17948 18364 gene locus_tag LOCUS_12360 17948 18364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 18456 19241 gene locus_tag LOCUS_12370 gene surE 18456 19241 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020163.1 protein_id gnl|my_center|LOCUS_12370 19403 19248 gene locus_tag LOCUS_12380 19403 19248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 20185 19400 gene locus_tag LOCUS_12390 gene moaA 20185 19400 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020164.1 protein_id gnl|my_center|LOCUS_12390 >Feature sequence036 34 255 gene locus_tag LOCUS_12400 34 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 694 230 gene locus_tag LOCUS_12410 694 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12410 3007 701 gene locus_tag LOCUS_12420 gene acnA 3007 701 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020308.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12420 3453 3277 gene locus_tag LOCUS_12430 3453 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 3872 3705 gene locus_tag LOCUS_12440 3872 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 5674 3962 gene locus_tag LOCUS_12450 gene glgP 5674 3962 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584150.1 protein_id gnl|my_center|LOCUS_12450 7157 6321 gene locus_tag LOCUS_12460 7157 6321 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257415.1 protein_id gnl|my_center|LOCUS_12460 7976 7353 gene locus_tag LOCUS_12470 7976 7353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 9547 8186 gene locus_tag LOCUS_12480 gene cca 9547 8186 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023473.1 protein_id gnl|my_center|LOCUS_12480 9739 13395 gene locus_tag LOCUS_12490 9739 13395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 14550 13426 gene locus_tag LOCUS_12500 gene proB 14550 13426 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023993.1 protein_id gnl|my_center|LOCUS_12500 15925 14570 gene locus_tag LOCUS_12510 15925 14570 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023992.1 protein_id gnl|my_center|LOCUS_12510 16146 17951 gene locus_tag LOCUS_12520 gene iorA 16146 17951 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065029.1 protein_id gnl|my_center|LOCUS_12520 17948 18538 gene locus_tag LOCUS_12530 17948 18538 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021058.1 protein_id gnl|my_center|LOCUS_12530 18664 19161 gene locus_tag LOCUS_12540 18664 19161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 >Feature sequence037 2962 4029 gene locus_tag LOCUS_12550 gene endA 2962 4029 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023532.1 protein_id gnl|my_center|LOCUS_12550 4038 4463 gene locus_tag LOCUS_12560 4038 4463 CDS product DUF2209 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023531.1 protein_id gnl|my_center|LOCUS_12560 4983 5474 gene locus_tag LOCUS_12570 4983 5474 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020686.1 protein_id gnl|my_center|LOCUS_12570 5871 7115 gene locus_tag LOCUS_12580 gene hflX 5871 7115 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755955.1 protein_id gnl|my_center|LOCUS_12580 7370 8041 gene locus_tag LOCUS_12590 7370 8041 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_12590 8613 8038 gene locus_tag LOCUS_12600 8613 8038 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020740.1 protein_id gnl|my_center|LOCUS_12600 9602 8628 gene locus_tag LOCUS_12610 9602 8628 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020739.1 protein_id gnl|my_center|LOCUS_12610 10732 9599 gene locus_tag LOCUS_12620 10732 9599 CDS product methanogenesis marker 9 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020738.1 protein_id gnl|my_center|LOCUS_12620 11026 11232 gene locus_tag LOCUS_12630 11026 11232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065120.1 protein_id gnl|my_center|LOCUS_12630 11590 12837 gene locus_tag LOCUS_12640 11590 12837 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927136.1 protein_id gnl|my_center|LOCUS_12640 12964 13692 gene locus_tag LOCUS_12650 gene npdG 12964 13692 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878392.1 protein_id gnl|my_center|LOCUS_12650 14852 16000 gene locus_tag LOCUS_12660 14852 16000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 16222 17256 gene locus_tag LOCUS_12670 16222 17256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 17646 17960 gene locus_tag LOCUS_12680 17646 17960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 18577 17975 gene locus_tag LOCUS_12690 18577 17975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence038 3 245 gene locus_tag LOCUS_12700 3 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 297 1088 gene locus_tag LOCUS_12710 297 1088 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020491.1 protein_id gnl|my_center|LOCUS_12710 1519 3273 gene locus_tag LOCUS_12720 gene glyS 1519 3273 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020156.1 protein_id gnl|my_center|LOCUS_12720 3343 5595 gene locus_tag LOCUS_12730 3343 5595 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878955.1 protein_id gnl|my_center|LOCUS_12730 6315 5809 gene locus_tag LOCUS_12740 6315 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 6433 6702 gene locus_tag LOCUS_12750 6433 6702 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064806.1 protein_id gnl|my_center|LOCUS_12750 6888 7520 gene locus_tag LOCUS_12760 6888 7520 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020150.1 protein_id gnl|my_center|LOCUS_12760 7572 9191 gene locus_tag LOCUS_12770 gene sepS 7572 9191 CDS product O-phosphoserine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020149.1 protein_id gnl|my_center|LOCUS_12770 9674 9273 gene locus_tag LOCUS_12780 9674 9273 CDS product DUF473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024293.1 protein_id gnl|my_center|LOCUS_12780 10413 9667 gene locus_tag LOCUS_12790 10413 9667 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066594.1 protein_id gnl|my_center|LOCUS_12790 10512 11093 gene locus_tag LOCUS_12800 10512 11093 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024295.1 protein_id gnl|my_center|LOCUS_12800 11296 11126 gene locus_tag LOCUS_12810 11296 11126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 12154 11330 gene locus_tag LOCUS_12820 12154 11330 CDS product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065986.1 protein_id gnl|my_center|LOCUS_12820 12348 13058 gene locus_tag LOCUS_12830 gene serB 12348 13058 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024307.1 protein_id gnl|my_center|LOCUS_12830 13060 13956 gene locus_tag LOCUS_12840 13060 13956 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024306.1 protein_id gnl|my_center|LOCUS_12840 15155 14007 gene locus_tag LOCUS_12850 15155 14007 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024301.1 protein_id gnl|my_center|LOCUS_12850 16316 15159 gene locus_tag LOCUS_12860 16316 15159 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024300.1 protein_id gnl|my_center|LOCUS_12860 17270 16326 gene locus_tag LOCUS_12870 17270 16326 CDS product UbiA prenyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065984.1 protein_id gnl|my_center|LOCUS_12870 18833 17331 gene locus_tag LOCUS_12880 gene tgtA 18833 17331 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024298.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence039 498 100 gene locus_tag LOCUS_12890 gene cfbA 498 100 CDS product sirohydrochlorin nickelochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023539.1 protein_id gnl|my_center|LOCUS_12890 1437 607 gene locus_tag LOCUS_12900 gene fdhD 1437 607 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851178.1 protein_id gnl|my_center|LOCUS_12900 2747 1434 gene locus_tag LOCUS_12910 2747 1434 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020367.1 protein_id gnl|my_center|LOCUS_12910 3147 2749 gene locus_tag LOCUS_12920 3147 2749 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024065.1 protein_id gnl|my_center|LOCUS_12920 3958 3149 gene locus_tag LOCUS_12930 3958 3149 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066575.1 protein_id gnl|my_center|LOCUS_12930 5717 3963 gene locus_tag LOCUS_12940 5717 3963 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020364.1 protein_id gnl|my_center|LOCUS_12940 6910 5720 gene locus_tag LOCUS_12950 6910 5720 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020363.1 protein_id gnl|my_center|LOCUS_12950 7160 8050 gene locus_tag LOCUS_12960 7160 8050 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021396.1 protein_id gnl|my_center|LOCUS_12960 8037 8324 gene locus_tag LOCUS_12970 8037 8324 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869744.1 protein_id gnl|my_center|LOCUS_12970 8336 8728 gene locus_tag LOCUS_12980 8336 8728 CDS product AIR carboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021394.1 protein_id gnl|my_center|LOCUS_12980 9609 8755 gene locus_tag LOCUS_12990 9609 8755 CDS product methanogen output domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990584.1 protein_id gnl|my_center|LOCUS_12990 10569 9769 gene locus_tag LOCUS_13000 10569 9769 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022415.1 protein_id gnl|my_center|LOCUS_13000 10822 12546 gene locus_tag LOCUS_13010 10822 12546 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065602.1 protein_id gnl|my_center|LOCUS_13010 12546 13400 gene locus_tag LOCUS_13020 12546 13400 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023015.1 protein_id gnl|my_center|LOCUS_13020 14022 13393 gene locus_tag LOCUS_13030 14022 13393 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021454.1 protein_id gnl|my_center|LOCUS_13030 14846 14022 gene locus_tag LOCUS_13040 gene rsmA 14846 14022 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990848.1 protein_id gnl|my_center|LOCUS_13040 15445 14849 gene locus_tag LOCUS_13050 15445 14849 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065124.1 protein_id gnl|my_center|LOCUS_13050 15877 15524 gene locus_tag LOCUS_13060 15877 15524 CDS product RNA polymerase Rpb4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021458.1 protein_id gnl|my_center|LOCUS_13060 16288 16004 gene locus_tag LOCUS_13070 16288 16004 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021460.1 protein_id gnl|my_center|LOCUS_13070 17623 16331 gene locus_tag LOCUS_13080 17623 16331 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021461.1 protein_id gnl|my_center|LOCUS_13080 18292 17678 gene locus_tag LOCUS_13090 gene trmY 18292 17678 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066221.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence040 <1 633 gene locus_tag LOCUS_13100 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583308.1:3-oxoacyl-[acyl-carrier-protein] reductase 737 1867 gene locus_tag LOCUS_13110 737 1867 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021066.1 protein_id gnl|my_center|LOCUS_13110 2620 2039 gene locus_tag LOCUS_13120 2620 2039 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990665.1 protein_id gnl|my_center|LOCUS_13120 5427 2971 gene locus_tag LOCUS_13130 5427 2971 CDS product disaggregatase related repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860211.1 protein_id gnl|my_center|LOCUS_13130 5911 7116 gene locus_tag LOCUS_13140 5911 7116 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020474.1 protein_id gnl|my_center|LOCUS_13140 8807 7143 gene locus_tag LOCUS_13150 8807 7143 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244488.1 protein_id gnl|my_center|LOCUS_13150 9668 9015 gene locus_tag LOCUS_13160 gene nth 9668 9015 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065874.1 protein_id gnl|my_center|LOCUS_13160 10624 9752 gene locus_tag LOCUS_13170 gene porB 10624 9752 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020090.1 protein_id gnl|my_center|LOCUS_13170 11835 10621 gene locus_tag LOCUS_13180 gene porA 11835 10621 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 protein_id gnl|my_center|LOCUS_13180 12095 11835 gene locus_tag LOCUS_13190 gene porD 12095 11835 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020092.1 protein_id gnl|my_center|LOCUS_13190 12640 12092 gene locus_tag LOCUS_13200 12640 12092 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_13200 13852 12845 gene locus_tag LOCUS_13210 gene dusB 13852 12845 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020094.1 protein_id gnl|my_center|LOCUS_13210 16871 14766 gene locus_tag LOCUS_13220 16871 14766 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022388.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence041 622 23 gene locus_tag LOCUS_13230 622 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 3754 1430 gene locus_tag LOCUS_13240 3754 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 7898 3879 gene locus_tag LOCUS_13250 7898 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 8269 9207 gene locus_tag LOCUS_13260 8269 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 9518 9712 gene locus_tag LOCUS_13270 9518 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 9928 10662 gene locus_tag LOCUS_13280 9928 10662 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064392.1 protein_id gnl|my_center|LOCUS_13280 11390 10710 gene locus_tag LOCUS_13290 11390 10710 CDS product DUF5591 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020965.1 protein_id gnl|my_center|LOCUS_13290 11498 11881 gene locus_tag LOCUS_13300 11498 11881 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020964.1 protein_id gnl|my_center|LOCUS_13300 13405 12224 gene locus_tag LOCUS_13310 13405 12224 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020963.1 protein_id gnl|my_center|LOCUS_13310 13999 13436 gene locus_tag LOCUS_13320 13999 13436 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 protein_id gnl|my_center|LOCUS_13320 14354 13980 gene locus_tag LOCUS_13330 14354 13980 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020961.1 protein_id gnl|my_center|LOCUS_13330 14822 15610 gene locus_tag LOCUS_13340 gene rnz 14822 15610 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_13340 15888 15622 gene locus_tag LOCUS_13350 15888 15622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065588.1 protein_id gnl|my_center|LOCUS_13350 17040 15937 gene locus_tag LOCUS_13360 17040 15937 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022968.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence042 1481 2452 gene locus_tag LOCUS_13370 1481 2452 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023617.1 protein_id gnl|my_center|LOCUS_13370 2568 2879 gene locus_tag LOCUS_13380 2568 2879 CDS product DUF2551 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023626.1 protein_id gnl|my_center|LOCUS_13380 3009 3869 gene locus_tag LOCUS_13390 gene uppS 3009 3869 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990666.1 protein_id gnl|my_center|LOCUS_13390 4142 4055 gene locus_tag LOCUS_t00240 4142 4055 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5010 4195 gene locus_tag LOCUS_13400 5010 4195 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902815.1 protein_id gnl|my_center|LOCUS_13400 5394 5014 gene locus_tag LOCUS_13410 5394 5014 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021138.1 protein_id gnl|my_center|LOCUS_13410 5968 5408 gene locus_tag LOCUS_13420 5968 5408 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021137.1 protein_id gnl|my_center|LOCUS_13420 6427 5981 gene locus_tag LOCUS_13430 6427 5981 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066175.1 protein_id gnl|my_center|LOCUS_13430 6789 9410 gene locus_tag LOCUS_13440 6789 9410 CDS product S-layer protein domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023471.1 protein_id gnl|my_center|LOCUS_13440 9615 10358 gene locus_tag LOCUS_13450 gene nudC 9615 10358 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_13450 10767 12176 gene locus_tag LOCUS_13460 10767 12176 CDS product lamin tail domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904188.1 protein_id gnl|my_center|LOCUS_13460 12179 12400 gene locus_tag LOCUS_13470 12179 12400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 14011 12719 gene locus_tag LOCUS_13480 14011 12719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 14265 15566 gene locus_tag LOCUS_13490 14265 15566 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022225.1 protein_id gnl|my_center|LOCUS_13490 15617 16465 gene locus_tag LOCUS_13500 15617 16465 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022219.1 protein_id gnl|my_center|LOCUS_13500 16951 16532 gene locus_tag LOCUS_13510 16951 16532 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064953.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence043 1587 127 gene locus_tag LOCUS_13520 1587 127 CDS product ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339170.1 protein_id gnl|my_center|LOCUS_13520 2548 1700 gene locus_tag LOCUS_13530 2548 1700 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172618.1 protein_id gnl|my_center|LOCUS_13530 4106 2979 gene locus_tag LOCUS_13540 4106 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 5076 4129 gene locus_tag LOCUS_13550 5076 4129 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259445.1 protein_id gnl|my_center|LOCUS_13550 5696 5049 gene locus_tag LOCUS_13560 5696 5049 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289241.1 protein_id gnl|my_center|LOCUS_13560 6535 5693 gene locus_tag LOCUS_13570 6535 5693 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393491.1 protein_id gnl|my_center|LOCUS_13570 7001 6588 gene locus_tag LOCUS_13580 7001 6588 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 protein_id gnl|my_center|LOCUS_13580 7977 7126 gene locus_tag LOCUS_13590 7977 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 8198 8509 gene locus_tag LOCUS_13600 8198 8509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 8579 8758 gene locus_tag LOCUS_13610 8579 8758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 8903 9142 gene locus_tag LOCUS_13620 8903 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 9991 9533 gene locus_tag LOCUS_13630 9991 9533 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404934.1 protein_id gnl|my_center|LOCUS_13630 11149 10094 gene locus_tag LOCUS_13640 11149 10094 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020485.1 protein_id gnl|my_center|LOCUS_13640 13886 11250 gene locus_tag LOCUS_13650 13886 11250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 14244 15875 gene locus_tag LOCUS_13660 14244 15875 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021343.1 protein_id gnl|my_center|LOCUS_13660 16097 16525 gene locus_tag LOCUS_13670 16097 16525 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023482.1 protein_id gnl|my_center|LOCUS_13670 17264 16659 gene locus_tag LOCUS_13680 17264 16659 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023500.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence044 548 1321 gene locus_tag LOCUS_13690 548 1321 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024254.1 protein_id gnl|my_center|LOCUS_13690 1358 2134 gene locus_tag LOCUS_13700 1358 2134 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020249.1 protein_id gnl|my_center|LOCUS_13700 2155 5028 gene locus_tag LOCUS_13710 2155 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 5031 5429 gene locus_tag LOCUS_13720 5031 5429 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021483.1 protein_id gnl|my_center|LOCUS_13720 6211 5432 gene locus_tag LOCUS_13730 gene pylD 6211 5432 CDS product 3-methylornithyl-N6-L-lysine dehydrogenase PylD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020210.1 protein_id gnl|my_center|LOCUS_13730 7302 6211 gene locus_tag LOCUS_13740 gene pylC 7302 6211 CDS product 3-methylornithine--L-lysine ligase PylC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020211.1 protein_id gnl|my_center|LOCUS_13740 8357 7299 gene locus_tag LOCUS_13750 gene pylB 8357 7299 CDS product methylornithine synthase PylB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020212.1 protein_id gnl|my_center|LOCUS_13750 9666 8368 gene locus_tag LOCUS_13760 gene pylS 9666 8368 CDS product pyrrolysine--tRNA(Pyl) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020213.1 protein_id gnl|my_center|LOCUS_13760 10017 9946 gene locus_tag LOCUS_t00250 10017 9946 tRNA product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 12028 10097 gene locus_tag LOCUS_13770 12028 10097 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023418.1 protein_id gnl|my_center|LOCUS_13770 14019 12097 gene locus_tag LOCUS_13780 14019 12097 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023417.1 protein_id gnl|my_center|LOCUS_13780 14822 14019 gene locus_tag LOCUS_13790 14822 14019 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065770.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence045 2485 395 gene locus_tag LOCUS_13800 2485 395 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_13800 3959 2718 gene locus_tag LOCUS_13810 3959 2718 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021177.1 protein_id gnl|my_center|LOCUS_13810 5113 4022 gene locus_tag LOCUS_13820 gene glpX 5113 4022 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021176.1 protein_id gnl|my_center|LOCUS_13820 5726 5217 gene locus_tag LOCUS_13830 gene cgi121 5726 5217 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021174.1 protein_id gnl|my_center|LOCUS_13830 6006 8894 gene locus_tag LOCUS_13840 gene leuS 6006 8894 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021621.1 protein_id gnl|my_center|LOCUS_13840 10685 8955 gene locus_tag LOCUS_13850 10685 8955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 14054 10944 gene locus_tag LOCUS_13860 14054 10944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 15079 14438 gene locus_tag LOCUS_13870 15079 14438 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020384.1 protein_id gnl|my_center|LOCUS_13870 16685 15225 gene locus_tag LOCUS_13880 16685 15225 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065402.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence046 1045 650 gene locus_tag LOCUS_13890 1045 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1458 3689 gene locus_tag LOCUS_13900 1458 3689 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024448.1 protein_id gnl|my_center|LOCUS_13900 3776 4486 gene locus_tag LOCUS_13910 3776 4486 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023580.1 protein_id gnl|my_center|LOCUS_13910 4814 4545 gene locus_tag LOCUS_13920 4814 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 5555 4914 gene locus_tag LOCUS_13930 5555 4914 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020735.1 protein_id gnl|my_center|LOCUS_13930 6186 5548 gene locus_tag LOCUS_13940 6186 5548 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020734.1 protein_id gnl|my_center|LOCUS_13940 7498 6251 gene locus_tag LOCUS_13950 7498 6251 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020733.1 protein_id gnl|my_center|LOCUS_13950 8292 7501 gene locus_tag LOCUS_13960 8292 7501 CDS product disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064949.1 protein_id gnl|my_center|LOCUS_13960 9151 8492 gene locus_tag LOCUS_13970 9151 8492 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066452.1 protein_id gnl|my_center|LOCUS_13970 9522 10073 gene locus_tag LOCUS_13980 9522 10073 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990773.1 protein_id gnl|my_center|LOCUS_13980 10173 10772 gene locus_tag LOCUS_13990 10173 10772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 12535 10901 gene locus_tag LOCUS_14000 gene ade 12535 10901 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963204.1 protein_id gnl|my_center|LOCUS_14000 12707 12994 gene locus_tag LOCUS_14010 12707 12994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065924.1 protein_id gnl|my_center|LOCUS_14010 13463 13191 gene locus_tag LOCUS_14020 13463 13191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 13652 13473 gene locus_tag LOCUS_14030 13652 13473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 13825 13983 gene locus_tag LOCUS_14040 13825 13983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 14029 15300 gene locus_tag LOCUS_14050 14029 15300 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024009.1 protein_id gnl|my_center|LOCUS_14050 15428 15877 gene locus_tag LOCUS_14060 15428 15877 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024008.1 protein_id gnl|my_center|LOCUS_14060 15944 16294 gene locus_tag LOCUS_14070 15944 16294 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024007.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence047 33 549 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccacgtgtgtggggaactc 968 681 gene locus_tag LOCUS_14080 gene cas2e 968 681 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942042.1 protein_id gnl|my_center|LOCUS_14080 1869 949 gene locus_tag LOCUS_14090 gene cas1e 1869 949 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942041.1 protein_id gnl|my_center|LOCUS_14090 2554 1874 gene locus_tag LOCUS_14100 gene cas6e 2554 1874 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281463.1 protein_id gnl|my_center|LOCUS_14100 3312 2545 gene locus_tag LOCUS_14110 gene cas5e 3312 2545 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666425.1 protein_id gnl|my_center|LOCUS_14110 4461 3313 gene locus_tag LOCUS_14120 gene cas7e 4461 3313 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044180303.1 protein_id gnl|my_center|LOCUS_14120 4983 4480 gene locus_tag LOCUS_14130 4983 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 6605 5037 gene locus_tag LOCUS_14140 gene casA 6605 5037 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046083149.1 protein_id gnl|my_center|LOCUS_14140 9407 6630 gene locus_tag LOCUS_14150 9407 6630 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091704098.1 protein_id gnl|my_center|LOCUS_14150 9694 9428 gene locus_tag LOCUS_14160 9694 9428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 10072 10692 gene locus_tag LOCUS_14170 10072 10692 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065157.1 protein_id gnl|my_center|LOCUS_14170 10762 11676 gene locus_tag LOCUS_14180 10762 11676 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878482.1 protein_id gnl|my_center|LOCUS_14180 11733 12860 gene locus_tag LOCUS_14190 11733 12860 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878481.1 protein_id gnl|my_center|LOCUS_14190 12882 13538 gene locus_tag LOCUS_14200 12882 13538 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878480.1 protein_id gnl|my_center|LOCUS_14200 13520 14134 gene locus_tag LOCUS_14210 13520 14134 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878479.1 protein_id gnl|my_center|LOCUS_14210 14379 14756 gene locus_tag LOCUS_14220 14379 14756 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065981.1 protein_id gnl|my_center|LOCUS_14220 14775 15116 gene locus_tag LOCUS_14230 14775 15116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 >Feature sequence048 2377 464 gene locus_tag LOCUS_14240 2377 464 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878496.1 protein_id gnl|my_center|LOCUS_14240 3189 2389 gene locus_tag LOCUS_14250 gene minD 3189 2389 CDS product cell division ATPase MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249304.1 protein_id gnl|my_center|LOCUS_14250 3417 3854 gene locus_tag LOCUS_14260 3417 3854 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 protein_id gnl|my_center|LOCUS_14260 4738 3965 gene locus_tag LOCUS_14270 gene xth 4738 3965 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_14270 5050 5469 gene locus_tag LOCUS_14280 5050 5469 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021041.1 protein_id gnl|my_center|LOCUS_14280 5462 6142 gene locus_tag LOCUS_14290 5462 6142 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_14290 6183 6680 gene locus_tag LOCUS_14300 6183 6680 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932996.1 protein_id gnl|my_center|LOCUS_14300 7170 7448 gene locus_tag LOCUS_14310 7170 7448 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065040.1 protein_id gnl|my_center|LOCUS_14310 8051 7506 gene locus_tag LOCUS_14320 8051 7506 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021127.1 protein_id gnl|my_center|LOCUS_14320 8372 8866 gene locus_tag LOCUS_14330 8372 8866 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107351.1 protein_id gnl|my_center|LOCUS_14330 10242 9064 gene locus_tag LOCUS_14340 10242 9064 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021091.1 protein_id gnl|my_center|LOCUS_14340 11408 10356 gene locus_tag LOCUS_14350 11408 10356 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024332.1 protein_id gnl|my_center|LOCUS_14350 12475 11408 gene locus_tag LOCUS_14360 gene wecB 12475 11408 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048109.1 protein_id gnl|my_center|LOCUS_14360 13588 12485 gene locus_tag LOCUS_14370 13588 12485 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021093.1 protein_id gnl|my_center|LOCUS_14370 14271 13594 gene locus_tag LOCUS_14380 14271 13594 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021094.1 protein_id gnl|my_center|LOCUS_14380 15044 14268 gene locus_tag LOCUS_14390 15044 14268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021095.1 protein_id gnl|my_center|LOCUS_14390 16030 15038 gene locus_tag LOCUS_14400 16030 15038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence049 877 17 gene locus_tag LOCUS_14410 877 17 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066004.1 protein_id gnl|my_center|LOCUS_14410 2163 1741 gene locus_tag LOCUS_14420 2163 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 3258 2458 gene locus_tag LOCUS_14430 3258 2458 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064968.1 protein_id gnl|my_center|LOCUS_14430 4360 3233 gene locus_tag LOCUS_14440 4360 3233 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020842.1 protein_id gnl|my_center|LOCUS_14440 5274 4357 gene locus_tag LOCUS_14450 5274 4357 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064969.1 protein_id gnl|my_center|LOCUS_14450 5739 5527 gene locus_tag LOCUS_14460 5739 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 6587 5832 gene locus_tag LOCUS_14470 6587 5832 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_14470 8016 6676 gene locus_tag LOCUS_14480 8016 6676 CDS product ADP-dependent glucokinase/phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023476.1 protein_id gnl|my_center|LOCUS_14480 9503 8016 gene locus_tag LOCUS_14490 gene pfkC 9503 8016 CDS product ADP-specific phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023477.1 protein_id gnl|my_center|LOCUS_14490 10718 9534 gene locus_tag LOCUS_14500 gene argJ 10718 9534 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023478.1 protein_id gnl|my_center|LOCUS_14500 11188 10715 gene locus_tag LOCUS_14510 11188 10715 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065746.1 protein_id gnl|my_center|LOCUS_14510 12232 11219 gene locus_tag LOCUS_14520 gene argC 12232 11219 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065747.1 protein_id gnl|my_center|LOCUS_14520 13812 12355 gene locus_tag LOCUS_14530 13812 12355 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021658.1 protein_id gnl|my_center|LOCUS_14530 14041 14601 gene locus_tag LOCUS_14540 14041 14601 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022863.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence050 <1 1129 gene locus_tag LOCUS_14550 <1 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064814.1:cobyrinate a,c-diamide synthase 1192 2073 gene locus_tag LOCUS_14560 gene htpX 1192 2073 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022098.1 protein_id gnl|my_center|LOCUS_14560 2073 2636 gene locus_tag LOCUS_14570 2073 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022099.1 protein_id gnl|my_center|LOCUS_14570 2931 2653 gene locus_tag LOCUS_14580 2931 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021475.1 protein_id gnl|my_center|LOCUS_14580 3626 2928 gene locus_tag LOCUS_14590 3626 2928 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021474.1 protein_id gnl|my_center|LOCUS_14590 4782 3721 gene locus_tag LOCUS_14600 gene priL 4782 3721 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020168.1 protein_id gnl|my_center|LOCUS_14600 5523 4786 gene locus_tag LOCUS_14610 5523 4786 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020169.1 protein_id gnl|my_center|LOCUS_14610 5939 5625 gene locus_tag LOCUS_14620 5939 5625 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020171.1 protein_id gnl|my_center|LOCUS_14620 6333 5917 gene locus_tag LOCUS_14630 6333 5917 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020172.1 protein_id gnl|my_center|LOCUS_14630 6396 7202 gene locus_tag LOCUS_14640 gene artA 6396 7202 CDS product archaeosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064816.1 protein_id gnl|my_center|LOCUS_14640 7215 7832 gene locus_tag LOCUS_14650 7215 7832 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020174.1 protein_id gnl|my_center|LOCUS_14650 7829 8527 gene locus_tag LOCUS_14660 7829 8527 CDS product archaetidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020175.1 protein_id gnl|my_center|LOCUS_14660 8502 8867 gene locus_tag LOCUS_14670 8502 8867 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020176.1 protein_id gnl|my_center|LOCUS_14670 9963 8881 gene locus_tag LOCUS_14680 gene hisC 9963 8881 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064817.1 protein_id gnl|my_center|LOCUS_14680 11107 9950 gene locus_tag LOCUS_14690 11107 9950 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066055.1 protein_id gnl|my_center|LOCUS_14690 11501 11172 gene locus_tag LOCUS_14700 11501 11172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 12416 11565 gene locus_tag LOCUS_14710 12416 11565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 12971 12525 gene locus_tag LOCUS_14720 12971 12525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020180.1 protein_id gnl|my_center|LOCUS_14720 14831 13365 gene locus_tag LOCUS_14730 14831 13365 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020324.1 protein_id gnl|my_center|LOCUS_14730 15380 14940 gene locus_tag LOCUS_14740 15380 14940 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020323.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence051 2150 480 gene locus_tag LOCUS_14750 2150 480 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020884.1 protein_id gnl|my_center|LOCUS_14750 2701 3975 gene locus_tag LOCUS_14760 2701 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 5069 4479 gene locus_tag LOCUS_14770 5069 4479 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023502.1 protein_id gnl|my_center|LOCUS_14770 5324 6832 gene locus_tag LOCUS_14780 gene serS 5324 6832 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876746.1 protein_id gnl|my_center|LOCUS_14780 7008 7595 gene locus_tag LOCUS_14790 7008 7595 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023341.1 protein_id gnl|my_center|LOCUS_14790 7872 7633 gene locus_tag LOCUS_14800 7872 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 8894 7869 gene locus_tag LOCUS_14810 8894 7869 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023996.1 protein_id gnl|my_center|LOCUS_14810 10967 8898 gene locus_tag LOCUS_14820 10967 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 11506 12195 gene locus_tag LOCUS_14830 gene queC 11506 12195 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024084.1 protein_id gnl|my_center|LOCUS_14830 12212 12769 gene locus_tag LOCUS_14840 12212 12769 CDS product DUF366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024083.1 protein_id gnl|my_center|LOCUS_14840 12769 13485 gene locus_tag LOCUS_14850 12769 13485 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024082.1 protein_id gnl|my_center|LOCUS_14850 13485 13823 gene locus_tag LOCUS_14860 gene queD 13485 13823 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065925.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence052 1508 1846 gene locus_tag LOCUS_14870 gene eif1A 1508 1846 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021369.1 protein_id gnl|my_center|LOCUS_14870 2179 1973 gene locus_tag LOCUS_14880 2179 1973 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064798.1 protein_id gnl|my_center|LOCUS_14880 2489 3262 gene locus_tag LOCUS_14890 2489 3262 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024520.1 protein_id gnl|my_center|LOCUS_14890 3311 3970 gene locus_tag LOCUS_14900 3311 3970 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021463.1 protein_id gnl|my_center|LOCUS_14900 4020 4547 gene locus_tag LOCUS_14910 4020 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065126.1 protein_id gnl|my_center|LOCUS_14910 4619 5734 gene locus_tag LOCUS_14920 4619 5734 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021469.1 protein_id gnl|my_center|LOCUS_14920 5851 6444 gene locus_tag LOCUS_14930 5851 6444 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021470.1 protein_id gnl|my_center|LOCUS_14930 6459 7148 gene locus_tag LOCUS_14940 6459 7148 CDS product DUF2110 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021471.1 protein_id gnl|my_center|LOCUS_14940 7853 7161 gene locus_tag LOCUS_14950 7853 7161 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021472.1 protein_id gnl|my_center|LOCUS_14950 8014 9042 gene locus_tag LOCUS_14960 8014 9042 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022056.1 protein_id gnl|my_center|LOCUS_14960 9252 9058 gene locus_tag LOCUS_14970 9252 9058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14970 9535 9287 gene locus_tag LOCUS_14980 9535 9287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14980 10549 9587 gene locus_tag LOCUS_14990 gene mch 10549 9587 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021714.1 protein_id gnl|my_center|LOCUS_14990 11618 10818 gene locus_tag LOCUS_15000 11618 10818 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024254.1 protein_id gnl|my_center|LOCUS_15000 12122 11700 gene locus_tag LOCUS_15010 12122 11700 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021483.1 protein_id gnl|my_center|LOCUS_15010 14184 12142 gene locus_tag LOCUS_15020 14184 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 >Feature sequence053 655 230 gene locus_tag LOCUS_15030 655 230 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066022.1 protein_id gnl|my_center|LOCUS_15030 1126 1201 gene locus_tag LOCUS_t00260 1126 1201 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1393 1857 gene locus_tag LOCUS_15040 1393 1857 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023217.1 protein_id gnl|my_center|LOCUS_15040 2056 3375 gene locus_tag LOCUS_15050 2056 3375 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024460.1 protein_id gnl|my_center|LOCUS_15050 3635 5017 gene locus_tag LOCUS_15060 3635 5017 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267691.1 protein_id gnl|my_center|LOCUS_15060 5134 5940 gene locus_tag LOCUS_15070 5134 5940 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024464.1 protein_id gnl|my_center|LOCUS_15070 5945 7087 gene locus_tag LOCUS_15080 5945 7087 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024465.1 protein_id gnl|my_center|LOCUS_15080 7099 7803 gene locus_tag LOCUS_15090 gene aroD 7099 7803 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024466.1 protein_id gnl|my_center|LOCUS_15090 7800 8621 gene locus_tag LOCUS_15100 7800 8621 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024467.1 protein_id gnl|my_center|LOCUS_15100 8618 9925 gene locus_tag LOCUS_15110 8618 9925 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024468.1 protein_id gnl|my_center|LOCUS_15110 10001 10309 gene locus_tag LOCUS_15120 10001 10309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 10996 10340 gene locus_tag LOCUS_15130 gene tpiA 10996 10340 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024480.1 protein_id gnl|my_center|LOCUS_15130 12244 11048 gene locus_tag LOCUS_15140 12244 11048 CDS product bifunctional 5,6,7,8-tetrahydromethanopterin hydro-lyase/3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024481.1 protein_id gnl|my_center|LOCUS_15140 13189 12566 gene locus_tag LOCUS_15150 13189 12566 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066030.1 protein_id gnl|my_center|LOCUS_15150 13360 13821 gene locus_tag LOCUS_15160 13360 13821 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023470.1 protein_id gnl|my_center|LOCUS_15160 14157 14231 gene locus_tag LOCUS_t00270 14157 14231 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence054 1300 1007 gene locus_tag LOCUS_15170 1300 1007 CDS product non-histone chromosomal MC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024392.1 protein_id gnl|my_center|LOCUS_15170 1583 2533 gene locus_tag LOCUS_15180 gene mptA 1583 2533 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066005.1 protein_id gnl|my_center|LOCUS_15180 2585 2899 gene locus_tag LOCUS_15190 2585 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 3870 2929 gene locus_tag LOCUS_15200 3870 2929 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065056.1 protein_id gnl|my_center|LOCUS_15200 4095 5207 gene locus_tag LOCUS_15210 4095 5207 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065055.1 protein_id gnl|my_center|LOCUS_15210 5204 5644 gene locus_tag LOCUS_15220 5204 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 6102 5650 gene locus_tag LOCUS_15230 6102 5650 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024219.1 protein_id gnl|my_center|LOCUS_15230 6219 6144 gene locus_tag LOCUS_t00280 6219 6144 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6471 6950 gene locus_tag LOCUS_15240 6471 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 7926 7027 gene locus_tag LOCUS_15250 gene hdrB 7926 7027 CDS product CoB--CoM heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024119.1 protein_id gnl|my_center|LOCUS_15250 8488 7946 gene locus_tag LOCUS_15260 gene hdrC 8488 7946 CDS product CoB--CoM heterodisulfide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024118.1 protein_id gnl|my_center|LOCUS_15260 9910 8582 gene locus_tag LOCUS_15270 gene glnA 9910 8582 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392808.1 protein_id gnl|my_center|LOCUS_15270 10779 10204 gene locus_tag LOCUS_15280 10779 10204 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065212.1 protein_id gnl|my_center|LOCUS_15280 11129 10776 gene locus_tag LOCUS_15290 11129 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 11390 11142 gene locus_tag LOCUS_15300 11390 11142 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021663.1 protein_id gnl|my_center|LOCUS_15300 11713 11387 gene locus_tag LOCUS_15310 11713 11387 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_15310 12181 11870 gene locus_tag LOCUS_15320 12181 11870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 13338 12457 gene locus_tag LOCUS_15330 13338 12457 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990819.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence055 <1 1764 gene locus_tag LOCUS_15340 <1 1764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022339.1:BREX-1 system phosphatase PglZ type A 1794 3836 gene locus_tag LOCUS_15350 gene brxL 1794 3836 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022338.1 protein_id gnl|my_center|LOCUS_15350 4447 6798 gene locus_tag LOCUS_15360 4447 6798 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209617549.1 protein_id gnl|my_center|LOCUS_15360 6795 7898 gene locus_tag LOCUS_15370 6795 7898 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020343.1 protein_id gnl|my_center|LOCUS_15370 7907 8992 gene locus_tag LOCUS_15380 7907 8992 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064850.1 protein_id gnl|my_center|LOCUS_15380 8989 9198 gene locus_tag LOCUS_15390 8989 9198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 9610 9203 gene locus_tag LOCUS_15400 9610 9203 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065151.1 protein_id gnl|my_center|LOCUS_15400 10742 9846 gene locus_tag LOCUS_15410 gene pdxS 10742 9846 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065155.1 protein_id gnl|my_center|LOCUS_15410 13325 10830 gene locus_tag LOCUS_15420 gene gyrA 13325 10830 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_15420 <14298 13336 gene locus_tag LOCUS_15430 <14298 13336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021594.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence056 <1 1002 gene locus_tag LOCUS_15440 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021101.1:50S ribosomal protein L3 1008 1775 gene locus_tag LOCUS_15450 gene rpl4p 1008 1775 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021102.1 protein_id gnl|my_center|LOCUS_15450 1772 2020 gene locus_tag LOCUS_15460 1772 2020 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021103.1 protein_id gnl|my_center|LOCUS_15460 2032 2745 gene locus_tag LOCUS_15470 2032 2745 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021104.1 protein_id gnl|my_center|LOCUS_15470 2761 3174 gene locus_tag LOCUS_15480 2761 3174 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021105.1 protein_id gnl|my_center|LOCUS_15480 3186 3641 gene locus_tag LOCUS_15490 3186 3641 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021106.1 protein_id gnl|my_center|LOCUS_15490 3641 4555 gene locus_tag LOCUS_15500 3641 4555 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021107.1 protein_id gnl|my_center|LOCUS_15500 4558 4761 gene locus_tag LOCUS_15510 gene rpmC 4558 4761 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021108.1 protein_id gnl|my_center|LOCUS_15510 4763 5074 gene locus_tag LOCUS_15520 4763 5074 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021109.1 protein_id gnl|my_center|LOCUS_15520 5080 5409 gene locus_tag LOCUS_15530 5080 5409 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021110.1 protein_id gnl|my_center|LOCUS_15530 5406 5804 gene locus_tag LOCUS_15540 gene rpl14p 5406 5804 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021111.1 protein_id gnl|my_center|LOCUS_15540 5815 6168 gene locus_tag LOCUS_15550 gene rplX 5815 6168 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065039.1 protein_id gnl|my_center|LOCUS_15550 6177 6890 gene locus_tag LOCUS_15560 6177 6890 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021113.1 protein_id gnl|my_center|LOCUS_15560 6883 7392 gene locus_tag LOCUS_15570 6883 7392 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021114.1 protein_id gnl|my_center|LOCUS_15570 7393 7545 gene locus_tag LOCUS_15580 7393 7545 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021115.1 protein_id gnl|my_center|LOCUS_15580 7557 7949 gene locus_tag LOCUS_15590 7557 7949 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021116.1 protein_id gnl|my_center|LOCUS_15590 7964 8497 gene locus_tag LOCUS_15600 gene rpl6p 7964 8497 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021117.1 protein_id gnl|my_center|LOCUS_15600 8507 8950 gene locus_tag LOCUS_15610 8507 8950 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066173.1 protein_id gnl|my_center|LOCUS_15610 8952 9410 gene locus_tag LOCUS_15620 8952 9410 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021119.1 protein_id gnl|my_center|LOCUS_15620 9451 9978 gene locus_tag LOCUS_15630 9451 9978 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021120.1 protein_id gnl|my_center|LOCUS_15630 9987 10625 gene locus_tag LOCUS_15640 9987 10625 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021121.1 protein_id gnl|my_center|LOCUS_15640 10627 11088 gene locus_tag LOCUS_15650 10627 11088 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021122.1 protein_id gnl|my_center|LOCUS_15650 11093 11521 gene locus_tag LOCUS_15660 11093 11521 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021123.1 protein_id gnl|my_center|LOCUS_15660 11675 13156 gene locus_tag LOCUS_15670 gene secY 11675 13156 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021124.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence057 2121 2045 gene locus_tag LOCUS_t00290 2121 2045 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3439 2201 gene locus_tag LOCUS_15680 3439 2201 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289167.1 protein_id gnl|my_center|LOCUS_15680 4438 4175 gene locus_tag LOCUS_15690 4438 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 4468 4848 gene locus_tag LOCUS_15700 4468 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 5119 5439 gene locus_tag LOCUS_15710 5119 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 5625 7604 gene locus_tag LOCUS_15720 gene uvrB 5625 7604 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_15720 7752 7823 gene locus_tag LOCUS_t00300 7752 7823 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8125 9486 gene locus_tag LOCUS_15730 8125 9486 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022654.1 protein_id gnl|my_center|LOCUS_15730 9567 9653 gene locus_tag LOCUS_t00310 9567 9653 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11174 11007 gene locus_tag LOCUS_15740 11174 11007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 >Feature sequence058 166 870 gene locus_tag LOCUS_15750 166 870 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024122.1 protein_id gnl|my_center|LOCUS_15750 1641 955 gene locus_tag LOCUS_15760 1641 955 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065272.1 protein_id gnl|my_center|LOCUS_15760 4473 1819 gene locus_tag LOCUS_15770 gene clpB 4473 1819 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143566.1 protein_id gnl|my_center|LOCUS_15770 5220 4759 gene locus_tag LOCUS_15780 5220 4759 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020192.1 protein_id gnl|my_center|LOCUS_15780 6907 5297 gene locus_tag LOCUS_15790 gene groL 6907 5297 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020679.1 protein_id gnl|my_center|LOCUS_15790 7246 6971 gene locus_tag LOCUS_15800 gene groES 7246 6971 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020678.1 protein_id gnl|my_center|LOCUS_15800 7422 7838 gene locus_tag LOCUS_15810 7422 7838 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020677.1 protein_id gnl|my_center|LOCUS_15810 8696 7863 gene locus_tag LOCUS_15820 8696 7863 CDS product molybdopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065273.1 protein_id gnl|my_center|LOCUS_15820 8863 9552 gene locus_tag LOCUS_15830 gene radC 8863 9552 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021974.1 protein_id gnl|my_center|LOCUS_15830 9599 10519 gene locus_tag LOCUS_15840 9599 10519 CDS product DUF1743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021976.1 protein_id gnl|my_center|LOCUS_15840 10506 12047 gene locus_tag LOCUS_15850 10506 12047 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021977.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence059 1593 85 gene locus_tag LOCUS_15860 1593 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2157 2014 gene locus_tag LOCUS_15870 2157 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 2306 3019 gene locus_tag LOCUS_15880 2306 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 3022 4215 gene locus_tag LOCUS_15890 3022 4215 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_15890 4734 4246 gene locus_tag LOCUS_15900 4734 4246 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021413.1 protein_id gnl|my_center|LOCUS_15900 4969 6318 gene locus_tag LOCUS_15910 4969 6318 CDS product isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024145.1 protein_id gnl|my_center|LOCUS_15910 7470 6442 gene locus_tag LOCUS_15920 7470 6442 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024146.1 protein_id gnl|my_center|LOCUS_15920 7565 8407 gene locus_tag LOCUS_15930 7565 8407 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024147.1 protein_id gnl|my_center|LOCUS_15930 9741 8422 gene locus_tag LOCUS_15940 9741 8422 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256515.1 protein_id gnl|my_center|LOCUS_15940 10364 9999 gene locus_tag LOCUS_15950 10364 9999 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065626.1 protein_id gnl|my_center|LOCUS_15950 10478 10810 gene locus_tag LOCUS_15960 10478 10810 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061058.1 protein_id gnl|my_center|LOCUS_15960 10819 11157 gene locus_tag LOCUS_15970 10819 11157 CDS product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065624.1 protein_id gnl|my_center|LOCUS_15970 11176 11544 gene locus_tag LOCUS_15980 11176 11544 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023097.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence060 332 646 gene locus_tag LOCUS_15990 332 646 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920728.1 protein_id gnl|my_center|LOCUS_15990 971 2584 gene locus_tag LOCUS_16000 971 2584 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021912.1 protein_id gnl|my_center|LOCUS_16000 2740 3729 gene locus_tag LOCUS_16010 2740 3729 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021910.1 protein_id gnl|my_center|LOCUS_16010 3726 4580 gene locus_tag LOCUS_16020 3726 4580 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021909.1 protein_id gnl|my_center|LOCUS_16020 4647 5624 gene locus_tag LOCUS_16030 4647 5624 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021908.1 protein_id gnl|my_center|LOCUS_16030 5614 6225 gene locus_tag LOCUS_16040 5614 6225 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021907.1 protein_id gnl|my_center|LOCUS_16040 7427 6327 gene locus_tag LOCUS_16050 7427 6327 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545596.1 protein_id gnl|my_center|LOCUS_16050 8571 7462 gene locus_tag LOCUS_16060 8571 7462 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065160.1 protein_id gnl|my_center|LOCUS_16060 10440 8572 gene locus_tag LOCUS_16070 10440 8572 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_16070 10739 10524 gene locus_tag LOCUS_16080 10739 10524 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021598.1 protein_id gnl|my_center|LOCUS_16080 11108 11896 gene locus_tag LOCUS_16090 11108 11896 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence061 3 332 gene locus_tag LOCUS_16100 3 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 475 1032 gene locus_tag LOCUS_16110 475 1032 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020400.1 protein_id gnl|my_center|LOCUS_16110 1139 2272 gene locus_tag LOCUS_16120 1139 2272 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119285.1 protein_id gnl|my_center|LOCUS_16120 2263 3114 gene locus_tag LOCUS_16130 2263 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 3127 5244 gene locus_tag LOCUS_16140 3127 5244 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020139.1 protein_id gnl|my_center|LOCUS_16140 5858 5265 gene locus_tag LOCUS_16150 gene hisB 5858 5265 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020277.1 protein_id gnl|my_center|LOCUS_16150 6636 5893 gene locus_tag LOCUS_16160 gene hisA 6636 5893 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020276.1 protein_id gnl|my_center|LOCUS_16160 7500 6646 gene locus_tag LOCUS_16170 gene hisG 7500 6646 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020275.1 protein_id gnl|my_center|LOCUS_16170 7803 8999 gene locus_tag LOCUS_16180 7803 8999 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020274.1 protein_id gnl|my_center|LOCUS_16180 9317 9391 gene locus_tag LOCUS_t00320 9317 9391 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 9586 10158 gene locus_tag LOCUS_16190 9586 10158 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730082.1 protein_id gnl|my_center|LOCUS_16190 <11671 10326 gene locus_tag LOCUS_16200 <11671 10326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990840.1:PGF-pre-PGF domain-containing protein >Feature sequence062 67 702 gene locus_tag LOCUS_16210 67 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1988 909 gene locus_tag LOCUS_16220 gene ccsA 1988 909 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023237.1 protein_id gnl|my_center|LOCUS_16220 3025 1985 gene locus_tag LOCUS_16230 3025 1985 CDS product cytochrome c-type biogenesis CcmF C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065666.1 protein_id gnl|my_center|LOCUS_16230 3726 3433 gene locus_tag LOCUS_16240 3726 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 3832 4371 gene locus_tag LOCUS_16250 gene pyrE 3832 4371 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023240.1 protein_id gnl|my_center|LOCUS_16250 4567 5868 gene locus_tag LOCUS_16260 gene purD 4567 5868 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065667.1 protein_id gnl|my_center|LOCUS_16260 5907 6812 gene locus_tag LOCUS_16270 gene argF 5907 6812 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023243.1 protein_id gnl|my_center|LOCUS_16270 6902 6989 gene locus_tag LOCUS_t00330 6902 6989 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7219 8688 gene locus_tag LOCUS_16280 7219 8688 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_16280 9156 9869 gene locus_tag LOCUS_16290 9156 9869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 10517 10732 gene locus_tag LOCUS_16300 10517 10732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 10769 10906 gene locus_tag LOCUS_16310 10769 10906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 11252 11511 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agtttcaatccttgttttagtggatcttgcattcaaat >Feature sequence063 1679 600 gene locus_tag LOCUS_16320 1679 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 2251 1766 gene locus_tag LOCUS_16330 2251 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065452.1 protein_id gnl|my_center|LOCUS_16330 2408 2635 gene locus_tag LOCUS_16340 2408 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 2715 3449 gene locus_tag LOCUS_16350 2715 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 3801 4172 gene locus_tag LOCUS_16360 3801 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 5983 4481 gene locus_tag LOCUS_16370 5983 4481 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065226.1 protein_id gnl|my_center|LOCUS_16370 6070 6915 gene locus_tag LOCUS_16380 gene mtxX 6070 6915 CDS product methanogenesis marker protein Mmp4/MtxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065223.1 protein_id gnl|my_center|LOCUS_16380 6920 7684 gene locus_tag LOCUS_16390 6920 7684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 7832 9004 gene locus_tag LOCUS_16400 7832 9004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 9170 8994 gene locus_tag LOCUS_16410 9170 8994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 <10694 9277 gene locus_tag LOCUS_16420 <10694 9277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021805.1:dihydroxy-acid dehydratase >Feature sequence064 798 181 gene locus_tag LOCUS_16430 798 181 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024048.1 protein_id gnl|my_center|LOCUS_16430 2201 819 gene locus_tag LOCUS_16440 2201 819 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024047.1 protein_id gnl|my_center|LOCUS_16440 3939 2203 gene locus_tag LOCUS_16450 3939 2203 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024046.1 protein_id gnl|my_center|LOCUS_16450 4232 3930 gene locus_tag LOCUS_16460 4232 3930 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024045.1 protein_id gnl|my_center|LOCUS_16460 5302 4232 gene locus_tag LOCUS_16470 5302 4232 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024044.1 protein_id gnl|my_center|LOCUS_16470 5861 5310 gene locus_tag LOCUS_16480 5861 5310 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024043.1 protein_id gnl|my_center|LOCUS_16480 6143 5910 gene locus_tag LOCUS_16490 6143 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024042.1 protein_id gnl|my_center|LOCUS_16490 8097 6148 gene locus_tag LOCUS_16500 8097 6148 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589509.1 protein_id gnl|my_center|LOCUS_16500 8416 8090 gene locus_tag LOCUS_16510 gene ahaH 8416 8090 CDS product ATP synthase archaeal subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024040.1 protein_id gnl|my_center|LOCUS_16510 9809 8625 gene locus_tag LOCUS_16520 9809 8625 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065913.1 protein_id gnl|my_center|LOCUS_16520 <10665 9843 gene locus_tag LOCUS_16530 <10665 9843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024038.1:geranylfarnesyl diphosphate synthase >Feature sequence065 793 2538 gene locus_tag LOCUS_16540 793 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 2658 4556 gene locus_tag LOCUS_16550 2658 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 4637 6115 gene locus_tag LOCUS_16560 gene argH 4637 6115 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021337.1 protein_id gnl|my_center|LOCUS_16560 6139 7389 gene locus_tag LOCUS_16570 gene gatD 6139 7389 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021336.1 protein_id gnl|my_center|LOCUS_16570 7475 8803 gene locus_tag LOCUS_16580 gene aspS 7475 8803 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021688.1 protein_id gnl|my_center|LOCUS_16580 8813 9514 gene locus_tag LOCUS_16590 gene rpiA 8813 9514 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021687.1 protein_id gnl|my_center|LOCUS_16590 <10547 9526 gene locus_tag LOCUS_16600 <10547 9526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021450.1:potassium channel family protein >Feature sequence066 848 207 gene locus_tag LOCUS_16610 848 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16610 2978 864 gene locus_tag LOCUS_16620 2978 864 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021360.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16620 3209 3000 gene locus_tag LOCUS_16630 gene copZ 3209 3000 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542561.1 protein_id gnl|my_center|LOCUS_16630 4555 3524 gene locus_tag LOCUS_16640 4555 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 4801 5196 gene locus_tag LOCUS_16650 gene trxA 4801 5196 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 protein_id gnl|my_center|LOCUS_16650 5226 6665 gene locus_tag LOCUS_16660 5226 6665 CDS product methanogenesis marker 14 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024395.1 protein_id gnl|my_center|LOCUS_16660 8780 7056 gene locus_tag LOCUS_16670 gene polX 8780 7056 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence067 <1 580 gene locus_tag LOCUS_16680 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021299.1:4-phosphopantoate--beta-alanine ligase 571 1212 gene locus_tag LOCUS_16690 571 1212 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021298.1 protein_id gnl|my_center|LOCUS_16690 1218 2519 gene locus_tag LOCUS_16700 1218 2519 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_16700 2559 3794 gene locus_tag LOCUS_16710 2559 3794 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021296.1 protein_id gnl|my_center|LOCUS_16710 4094 4170 gene locus_tag LOCUS_t00340 4094 4170 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4249 4485 gene locus_tag LOCUS_16720 4249 4485 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021287.1 protein_id gnl|my_center|LOCUS_16720 4609 6225 gene locus_tag LOCUS_16730 4609 6225 CDS product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755883.1 protein_id gnl|my_center|LOCUS_16730 6218 8032 gene locus_tag LOCUS_16740 gene rpoB 6218 8032 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021285.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence068 <1 1260 gene locus_tag LOCUS_16750 <1 1260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047923.1:hydroxylamine reductase 1539 1763 gene locus_tag LOCUS_16760 1539 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 3511 1814 gene locus_tag LOCUS_16770 3511 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 4709 3609 gene locus_tag LOCUS_16780 4709 3609 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892491.1 protein_id gnl|my_center|LOCUS_16780 6474 4702 gene locus_tag LOCUS_16790 6474 4702 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902477.1 protein_id gnl|my_center|LOCUS_16790 6641 7531 gene locus_tag LOCUS_16800 6641 7531 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902476.1 protein_id gnl|my_center|LOCUS_16800 7730 7897 gene locus_tag LOCUS_16810 7730 7897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 7885 8346 gene locus_tag LOCUS_16820 7885 8346 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022043.1 protein_id gnl|my_center|LOCUS_16820 >Feature sequence069 1914 1723 gene locus_tag LOCUS_16830 1914 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 1944 2831 gene locus_tag LOCUS_16840 1944 2831 CDS product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022486.1 protein_id gnl|my_center|LOCUS_16840 2871 4841 gene locus_tag LOCUS_16850 2871 4841 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990592.1 protein_id gnl|my_center|LOCUS_16850 5396 4845 gene locus_tag LOCUS_16860 5396 4845 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022484.1 protein_id gnl|my_center|LOCUS_16860 5518 6141 gene locus_tag LOCUS_16870 5518 6141 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021972.1 protein_id gnl|my_center|LOCUS_16870 6134 6646 gene locus_tag LOCUS_16880 6134 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 7507 6671 gene locus_tag LOCUS_16890 7507 6671 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022522.1 protein_id gnl|my_center|LOCUS_16890 7758 8378 gene locus_tag LOCUS_16900 7758 8378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 8883 8365 gene locus_tag LOCUS_16910 8883 8365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence070 203 352 gene locus_tag LOCUS_16920 203 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 931 1104 gene locus_tag LOCUS_16930 931 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 1831 1313 gene locus_tag LOCUS_16940 1831 1313 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902263.1 protein_id gnl|my_center|LOCUS_16940 3236 2028 gene locus_tag LOCUS_16950 gene pncB 3236 2028 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022501.1 protein_id gnl|my_center|LOCUS_16950 5200 3575 gene locus_tag LOCUS_16960 5200 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 5409 5582 gene locus_tag LOCUS_16970 5409 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 6496 5531 gene locus_tag LOCUS_16980 6496 5531 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392768.1 protein_id gnl|my_center|LOCUS_16980 7477 6713 gene locus_tag LOCUS_16990 7477 6713 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023329.1 protein_id gnl|my_center|LOCUS_16990 8662 7547 gene locus_tag LOCUS_17000 8662 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 >Feature sequence071 103 867 gene locus_tag LOCUS_17010 103 867 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020194.1 protein_id gnl|my_center|LOCUS_17010 1311 850 gene locus_tag LOCUS_17020 1311 850 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020196.1 protein_id gnl|my_center|LOCUS_17020 1411 2322 gene locus_tag LOCUS_17030 1411 2322 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020197.1 protein_id gnl|my_center|LOCUS_17030 2319 4031 gene locus_tag LOCUS_17040 2319 4031 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020198.1 protein_id gnl|my_center|LOCUS_17040 4064 5074 gene locus_tag LOCUS_17050 4064 5074 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064821.1 protein_id gnl|my_center|LOCUS_17050 5088 6728 gene locus_tag LOCUS_17060 5088 6728 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020870.1 protein_id gnl|my_center|LOCUS_17060 7198 7596 gene locus_tag LOCUS_17070 7198 7596 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066143.1 protein_id gnl|my_center|LOCUS_17070 7969 7775 gene locus_tag LOCUS_17080 7969 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 8048 8545 gene locus_tag LOCUS_17090 8048 8545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020868.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence072 <1 641 gene locus_tag LOCUS_17100 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990773.1:metal-dependent hydrolase 1020 2507 gene locus_tag LOCUS_17110 gene cobD 1020 2507 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020980.1 protein_id gnl|my_center|LOCUS_17110 2704 4134 gene locus_tag LOCUS_17120 gene cobD 2704 4134 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020980.1 protein_id gnl|my_center|LOCUS_17120 4119 5111 gene locus_tag LOCUS_17130 4119 5111 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020979.1 protein_id gnl|my_center|LOCUS_17130 5131 5730 gene locus_tag LOCUS_17140 gene cobZ 5131 5730 CDS product alpha-ribazole phosphatase CobZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065005.1 protein_id gnl|my_center|LOCUS_17140 5727 6557 gene locus_tag LOCUS_17150 gene cobS 5727 6557 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020977.1 protein_id gnl|my_center|LOCUS_17150 6545 7168 gene locus_tag LOCUS_17160 6545 7168 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020976.1 protein_id gnl|my_center|LOCUS_17160 7216 7575 gene locus_tag LOCUS_17170 7216 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990763.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence073 874 1803 gene locus_tag LOCUS_17180 874 1803 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_17180 1844 2353 gene locus_tag LOCUS_17190 1844 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 3797 2367 gene locus_tag LOCUS_17200 3797 2367 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062390429.1 protein_id gnl|my_center|LOCUS_17200 4753 3821 gene locus_tag LOCUS_17210 4753 3821 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024326.1 protein_id gnl|my_center|LOCUS_17210 5835 4750 gene locus_tag LOCUS_17220 5835 4750 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_17220 6545 5880 gene locus_tag LOCUS_17230 6545 5880 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763299.1 protein_id gnl|my_center|LOCUS_17230 7112 6630 gene locus_tag LOCUS_17240 7112 6630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence074 <1 2013 gene locus_tag LOCUS_17250 <1 2013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022778.1:tetratricopeptide repeat protein 2155 3492 gene locus_tag LOCUS_17260 gene purB 2155 3492 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066555.1 protein_id gnl|my_center|LOCUS_17260 6369 3514 gene locus_tag LOCUS_17270 gene uvrA 6369 3514 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_17270 7483 6668 gene locus_tag LOCUS_17280 7483 6668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence075 240 863 gene locus_tag LOCUS_17290 240 863 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013194697.1 protein_id gnl|my_center|LOCUS_17290 860 1231 gene locus_tag LOCUS_17300 860 1231 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020403.1 protein_id gnl|my_center|LOCUS_17300 1345 6489 gene locus_tag LOCUS_17310 1345 6489 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020404.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence076 45 752 gene locus_tag LOCUS_17320 45 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 2711 765 gene locus_tag LOCUS_17330 gene acs 2711 765 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459120.1 protein_id gnl|my_center|LOCUS_17330 3320 3610 gene locus_tag LOCUS_17340 3320 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 4972 3791 gene locus_tag LOCUS_17350 4972 3791 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877755.1 protein_id gnl|my_center|LOCUS_17350 6359 4989 gene locus_tag LOCUS_17360 6359 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 6774 6959 gene locus_tag LOCUS_17370 6774 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 >Feature sequence077 802 1344 gene locus_tag LOCUS_17380 gene msrA 802 1344 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021447.1 protein_id gnl|my_center|LOCUS_17380 2141 1326 gene locus_tag LOCUS_17390 2141 1326 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065769.1 protein_id gnl|my_center|LOCUS_17390 2344 3198 gene locus_tag LOCUS_17400 2344 3198 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023914.1 protein_id gnl|my_center|LOCUS_17400 3210 4019 gene locus_tag LOCUS_17410 gene cbiQ 3210 4019 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023913.1 protein_id gnl|my_center|LOCUS_17410 4371 4072 gene locus_tag LOCUS_17420 4371 4072 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065875.1 protein_id gnl|my_center|LOCUS_17420 5018 4368 gene locus_tag LOCUS_17430 gene cbiM 5018 4368 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065876.1 protein_id gnl|my_center|LOCUS_17430 6092 5580 gene locus_tag LOCUS_17440 6092 5580 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_17440 <6982 6110 gene locus_tag LOCUS_17450 <6982 6110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021695.1:PFL family protein >Feature sequence078 335 628 gene locus_tag LOCUS_17460 335 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020966.1 protein_id gnl|my_center|LOCUS_17460 640 789 gene locus_tag LOCUS_17470 640 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 999 1535 gene locus_tag LOCUS_17480 999 1535 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024115.1 protein_id gnl|my_center|LOCUS_17480 1764 2564 gene locus_tag LOCUS_17490 1764 2564 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_17490 2573 5998 gene locus_tag LOCUS_17500 2573 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 6244 6053 gene locus_tag LOCUS_17510 6244 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 >Feature sequence079 <1 1074 gene locus_tag LOCUS_17520 <1 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066190.1:PGF-pre-PGF domain-containing protein 1368 1910 gene locus_tag LOCUS_17530 1368 1910 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023075.1 protein_id gnl|my_center|LOCUS_17530 2027 2158 gene locus_tag LOCUS_17540 2027 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 2145 2423 gene locus_tag LOCUS_17550 2145 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 2505 3644 gene locus_tag LOCUS_17560 2505 3644 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023078.1 protein_id gnl|my_center|LOCUS_17560 3680 4720 gene locus_tag LOCUS_17570 3680 4720 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023080.1 protein_id gnl|my_center|LOCUS_17570 6409 4730 gene locus_tag LOCUS_17580 6409 4730 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022802.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence080 2480 3838 gene locus_tag LOCUS_17590 gene pyk 2480 3838 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066546.1 protein_id gnl|my_center|LOCUS_17590 4325 3855 gene locus_tag LOCUS_17600 gene msrA 4325 3855 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021447.1 protein_id gnl|my_center|LOCUS_17600 4465 4647 gene locus_tag LOCUS_17610 4465 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 4889 6184 gene locus_tag LOCUS_17620 4889 6184 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022675.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence081 648 1994 gene locus_tag LOCUS_17630 648 1994 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021968.1 protein_id gnl|my_center|LOCUS_17630 2474 2124 gene locus_tag LOCUS_17640 2474 2124 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876396.1 protein_id gnl|my_center|LOCUS_17640 3433 2654 gene locus_tag LOCUS_17650 3433 2654 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082088944.1 protein_id gnl|my_center|LOCUS_17650 3603 4478 gene locus_tag LOCUS_17660 3603 4478 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064910.1 protein_id gnl|my_center|LOCUS_17660 4530 5624 gene locus_tag LOCUS_17670 gene aroC 4530 5624 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence082 <1 1221 gene locus_tag LOCUS_17680 <1 1221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064990.1:DNA-directed DNA polymerase 1289 2692 gene locus_tag LOCUS_17690 1289 2692 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020936.1 protein_id gnl|my_center|LOCUS_17690 2760 3656 gene locus_tag LOCUS_17700 2760 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 4334 3642 gene locus_tag LOCUS_17710 4334 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 4894 4367 gene locus_tag LOCUS_17720 4894 4367 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020937.1 protein_id gnl|my_center|LOCUS_17720 5690 4869 gene locus_tag LOCUS_17730 5690 4869 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020938.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence083 703 1068 gene locus_tag LOCUS_17740 703 1068 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065599.1 protein_id gnl|my_center|LOCUS_17740 1113 2360 gene locus_tag LOCUS_17750 gene hmgA 1113 2360 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065600.1 protein_id gnl|my_center|LOCUS_17750 2633 2427 gene locus_tag LOCUS_17760 2633 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011032363.1 protein_id gnl|my_center|LOCUS_17760 3888 2647 gene locus_tag LOCUS_17770 gene hacA 3888 2647 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066440.1 protein_id gnl|my_center|LOCUS_17770 4424 4050 gene locus_tag LOCUS_17780 4424 4050 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023067.1 protein_id gnl|my_center|LOCUS_17780 4762 4688 gene locus_tag LOCUS_t00350 4762 4688 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 4936 5009 gene locus_tag LOCUS_t00360 4936 5009 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence084 517 368 gene locus_tag LOCUS_17790 517 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 826 530 gene locus_tag LOCUS_17800 826 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020966.1 protein_id gnl|my_center|LOCUS_17800 1874 828 gene locus_tag LOCUS_17810 1874 828 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020579.1 protein_id gnl|my_center|LOCUS_17810 2701 2054 gene locus_tag LOCUS_17820 2701 2054 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020578.1 protein_id gnl|my_center|LOCUS_17820 4220 2730 gene locus_tag LOCUS_17830 gene mttB 4220 2730 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:P0C0W7 transl_except (pos:complement(3219..3221),aa:Pyl) note codon on position 334 is pyrrolysine amber codon. protein_id gnl|my_center|LOCUS_17830 >Feature sequence085 <1 1160 gene locus_tag LOCUS_17840 <1 1160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065389.1:polyphosphate:AMP phosphotransferase 2413 1169 gene locus_tag LOCUS_17850 2413 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 3045 2542 gene locus_tag LOCUS_17860 3045 2542 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392262.1 protein_id gnl|my_center|LOCUS_17860 <5070 3059 gene locus_tag LOCUS_17870 <5070 3059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990711.1:HAMP domain-containing methyl-accepting chemotaxis protein >Feature sequence086 931 257 gene locus_tag LOCUS_17880 931 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 1153 3120 gene locus_tag LOCUS_17890 1153 3120 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024232.1 protein_id gnl|my_center|LOCUS_17890 3344 3469 gene locus_tag LOCUS_17900 3344 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 3910 4539 gene locus_tag LOCUS_17910 3910 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence087 900 472 gene locus_tag LOCUS_17920 900 472 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021280.1 protein_id gnl|my_center|LOCUS_17920 1378 953 gene locus_tag LOCUS_17930 1378 953 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021281.1 protein_id gnl|my_center|LOCUS_17930 1681 1394 gene locus_tag LOCUS_17940 1681 1394 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065070.1 protein_id gnl|my_center|LOCUS_17940 2925 1783 gene locus_tag LOCUS_17950 gene rpoA2 2925 1783 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066196.1 protein_id gnl|my_center|LOCUS_17950 4532 2928 gene locus_tag LOCUS_17960 4532 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence088 38 673 gene locus_tag LOCUS_17970 38 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 999 2159 gene locus_tag LOCUS_17980 999 2159 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932105.1 protein_id gnl|my_center|LOCUS_17980 2759 2340 gene locus_tag LOCUS_17990 2759 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence089 1689 2504 gene locus_tag LOCUS_18000 1689 2504 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_18000 2611 3531 gene locus_tag LOCUS_18010 gene nadA 2611 3531 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020997.1 protein_id gnl|my_center|LOCUS_18010 3542 4390 gene locus_tag LOCUS_18020 3542 4390 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020999.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence090 355 1050 gene locus_tag LOCUS_18030 355 1050 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296409.1 protein_id gnl|my_center|LOCUS_18030 1060 1764 gene locus_tag LOCUS_18040 1060 1764 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296408.1 protein_id gnl|my_center|LOCUS_18040 1769 2122 gene locus_tag LOCUS_18050 1769 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 3669 2245 gene locus_tag LOCUS_18060 3669 2245 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066425.1 protein_id gnl|my_center|LOCUS_18060 <4289 3666 gene locus_tag LOCUS_18070 <4289 3666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022859.1:3-methyl-2-oxobutanoate dehydrogenase subunit VorB >Feature sequence091 <1 2441 gene locus_tag LOCUS_18080 <1 2441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393841.1:S-layer homology domain-containing protein 3477 2710 gene locus_tag LOCUS_18090 3477 2710 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_18090 >Feature sequence092 349 2673 gene locus_tag LOCUS_18100 349 2673 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209617549.1 protein_id gnl|my_center|LOCUS_18100 2670 3779 gene locus_tag LOCUS_18110 2670 3779 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064850.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence093 232 1017 gene locus_tag LOCUS_18120 232 1017 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065770.1 protein_id gnl|my_center|LOCUS_18120 1189 1608 gene locus_tag LOCUS_18130 1189 1608 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065974.1 protein_id gnl|my_center|LOCUS_18130 1618 2124 gene locus_tag LOCUS_18140 1618 2124 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_18140 <3555 2259 gene locus_tag LOCUS_18150 <3555 2259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015951.1:DEAD/DEAH box helicase >Feature sequence094 3066 178 gene locus_tag LOCUS_18160 3066 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence095 211 1284 gene locus_tag LOCUS_18170 211 1284 CDS product phosphotransacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259751.1 protein_id gnl|my_center|LOCUS_18170 1907 1347 gene locus_tag LOCUS_18180 1907 1347 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023516.1 protein_id gnl|my_center|LOCUS_18180 >Feature sequence096 3 728 gene locus_tag LOCUS_18190 3 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 863 1426 gene locus_tag LOCUS_18200 863 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020874.1 protein_id gnl|my_center|LOCUS_18200 >Feature sequence097 535 254 gene locus_tag LOCUS_18210 gene gatC 535 254 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024398.1 protein_id gnl|my_center|LOCUS_18210 1036 1752 gene locus_tag LOCUS_18220 1036 1752 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021001.1 protein_id gnl|my_center|LOCUS_18220 2624 1776 gene locus_tag LOCUS_18230 2624 1776 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020999.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence098 67 900 gene locus_tag LOCUS_18240 67 900 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065423.1 protein_id gnl|my_center|LOCUS_18240 902 1483 gene locus_tag LOCUS_18250 902 1483 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022469.1 protein_id gnl|my_center|LOCUS_18250 2465 1476 gene locus_tag LOCUS_18260 2465 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18260 >Feature sequence099 2594 573 gene locus_tag LOCUS_18270 2594 573 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023776.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence100 1039 335 gene locus_tag LOCUS_18280 1039 335 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296408.1 protein_id gnl|my_center|LOCUS_18280 1744 1049 gene locus_tag LOCUS_18290 1744 1049 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296409.1 protein_id gnl|my_center|LOCUS_18290 1887 2177 gene locus_tag LOCUS_18300 1887 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 >Feature sequence101 33 986 gene locus_tag LOCUS_18310 33 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 995 1456 gene locus_tag LOCUS_18320 995 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023774.1 protein_id gnl|my_center|LOCUS_18320 >Feature sequence102 824 666 gene locus_tag LOCUS_18330 824 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 2001 811 gene locus_tag LOCUS_18340 2001 811 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064950.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence103 299 1465 gene locus_tag LOCUS_18350 gene ftsZ 299 1465 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023772.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence104 242 541 gene locus_tag LOCUS_18360 242 541 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066255.1 protein_id gnl|my_center|LOCUS_18360 912 1205 gene locus_tag LOCUS_18370 912 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 1575 1285 gene locus_tag LOCUS_18380 1575 1285 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580382.1 protein_id gnl|my_center|LOCUS_18380 >Feature sequence105 1156 599 gene locus_tag LOCUS_18390 1156 599 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066220.1 protein_id gnl|my_center|LOCUS_18390