>Feature sequence01 1116 244 gene locus_tag LOCUS_00010 1116 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1184 1450 gene locus_tag LOCUS_00020 1184 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1454 3031 gene locus_tag LOCUS_00030 1454 3031 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020870.1 protein_id gnl|my_center|LOCUS_00030 3028 4191 gene locus_tag LOCUS_00040 gene priS 3028 4191 CDS product DNA primase small subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289337.1 protein_id gnl|my_center|LOCUS_00040 4193 4849 gene locus_tag LOCUS_00050 4193 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4887 5165 gene locus_tag LOCUS_00060 4887 5165 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878830.1 protein_id gnl|my_center|LOCUS_00060 5173 5361 gene locus_tag LOCUS_00070 5173 5361 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878831.1 protein_id gnl|my_center|LOCUS_00070 5369 6148 gene locus_tag LOCUS_00080 5369 6148 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064935.1 protein_id gnl|my_center|LOCUS_00080 6304 7050 gene locus_tag LOCUS_00090 6304 7050 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878032.1 protein_id gnl|my_center|LOCUS_00090 9114 7339 gene locus_tag LOCUS_00100 9114 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9977 9543 gene locus_tag LOCUS_00110 9977 9543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10794 10075 gene locus_tag LOCUS_00120 10794 10075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11191 11925 gene locus_tag LOCUS_00130 11191 11925 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970750.1 protein_id gnl|my_center|LOCUS_00130 14178 12340 gene locus_tag LOCUS_00140 gene asnB 14178 12340 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868273.1 protein_id gnl|my_center|LOCUS_00140 14646 14200 gene locus_tag LOCUS_00150 14646 14200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 15590 14649 gene locus_tag LOCUS_00160 15590 14649 CDS product methanogenesis marker 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023887.1 protein_id gnl|my_center|LOCUS_00160 16171 15587 gene locus_tag LOCUS_00170 16171 15587 CDS product methanogenesis marker 17 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023888.1 protein_id gnl|my_center|LOCUS_00170 17410 16172 gene locus_tag LOCUS_00180 17410 16172 CDS product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023889.1 protein_id gnl|my_center|LOCUS_00180 17859 17407 gene locus_tag LOCUS_00190 17859 17407 CDS product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869903.1 protein_id gnl|my_center|LOCUS_00190 18329 17865 gene locus_tag LOCUS_00200 18329 17865 CDS product methanogenesis marker 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065869.1 protein_id gnl|my_center|LOCUS_00200 19852 18326 gene locus_tag LOCUS_00210 19852 18326 CDS product methanogenesis marker 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023892.1 protein_id gnl|my_center|LOCUS_00210 21476 19863 gene locus_tag LOCUS_00220 gene atwA 21476 19863 CDS product methyl coenzyme M reductase system, component A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023893.1 protein_id gnl|my_center|LOCUS_00220 22366 21524 gene locus_tag LOCUS_00230 22366 21524 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023894.1 protein_id gnl|my_center|LOCUS_00230 22452 23345 gene locus_tag LOCUS_00240 22452 23345 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020436.1 protein_id gnl|my_center|LOCUS_00240 23771 23577 gene locus_tag LOCUS_00250 23771 23577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 24051 24284 gene locus_tag LOCUS_00260 24051 24284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 24281 24553 gene locus_tag LOCUS_00270 24281 24553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 25120 24716 gene locus_tag LOCUS_00280 25120 24716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 26388 25324 gene locus_tag LOCUS_00290 26388 25324 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878633.1 protein_id gnl|my_center|LOCUS_00290 27461 26397 gene locus_tag LOCUS_00300 27461 26397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 28143 27526 gene locus_tag LOCUS_00310 28143 27526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 28142 28396 gene locus_tag LOCUS_00320 28142 28396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 29340 28618 gene locus_tag LOCUS_00330 29340 28618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 29815 29387 gene locus_tag LOCUS_00340 29815 29387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 30411 30160 gene locus_tag LOCUS_00350 30411 30160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 30412 31455 gene locus_tag LOCUS_00360 30412 31455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 31455 32243 gene locus_tag LOCUS_00370 31455 32243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 32276 32674 gene locus_tag LOCUS_00380 32276 32674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 32700 33131 gene locus_tag LOCUS_00390 32700 33131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 33485 34618 gene locus_tag LOCUS_00400 33485 34618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 34863 35750 gene locus_tag LOCUS_00410 34863 35750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 36187 36576 gene locus_tag LOCUS_00420 36187 36576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 36587 37444 gene locus_tag LOCUS_00430 36587 37444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 37749 38114 gene locus_tag LOCUS_00440 37749 38114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 39058 40221 gene locus_tag LOCUS_00450 39058 40221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 40259 40813 gene locus_tag LOCUS_00460 40259 40813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 40933 41517 gene locus_tag LOCUS_00470 40933 41517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00470 41765 42094 gene locus_tag LOCUS_00480 41765 42094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 42204 42656 gene locus_tag LOCUS_00490 42204 42656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 42769 43203 gene locus_tag LOCUS_00500 42769 43203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 43387 43677 gene locus_tag LOCUS_00510 43387 43677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 43851 44015 gene locus_tag LOCUS_00520 43851 44015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 44017 44928 gene locus_tag LOCUS_00530 44017 44928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 45014 45832 gene locus_tag LOCUS_00540 gene dapF 45014 45832 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878250.1 protein_id gnl|my_center|LOCUS_00540 46496 45819 gene locus_tag LOCUS_00550 gene radB 46496 45819 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860416.1 protein_id gnl|my_center|LOCUS_00550 47686 46493 gene locus_tag LOCUS_00560 gene larC 47686 46493 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020481.1 protein_id gnl|my_center|LOCUS_00560 47814 50150 gene locus_tag LOCUS_00570 47814 50150 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903216.1 protein_id gnl|my_center|LOCUS_00570 51120 50383 gene locus_tag LOCUS_00580 51120 50383 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618925.1 protein_id gnl|my_center|LOCUS_00580 51483 51680 gene locus_tag LOCUS_00590 51483 51680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 53015 52170 gene locus_tag LOCUS_00600 gene cas7c 53015 52170 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922510.1 protein_id gnl|my_center|LOCUS_00600 54994 53012 gene locus_tag LOCUS_00610 gene cas8c 54994 53012 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922511.1 protein_id gnl|my_center|LOCUS_00610 55698 54991 gene locus_tag LOCUS_00620 gene cas5c 55698 54991 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922512.1 protein_id gnl|my_center|LOCUS_00620 58149 55720 gene locus_tag LOCUS_00630 58149 55720 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263668.1 protein_id gnl|my_center|LOCUS_00630 58220 58882 gene locus_tag LOCUS_00640 gene cas4 58220 58882 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_00640 58879 59913 gene locus_tag LOCUS_00650 gene cas1c 58879 59913 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_00650 59919 60209 gene locus_tag LOCUS_00660 gene cas2 59919 60209 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626042.1 protein_id gnl|my_center|LOCUS_00660 60482 70352 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgtgcctcacgtaggcacgtggattgaaat 70712 70569 gene locus_tag LOCUS_00670 70712 70569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 71329 71039 gene locus_tag LOCUS_00680 71329 71039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 71760 71326 gene locus_tag LOCUS_00690 71760 71326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 73756 71762 gene locus_tag LOCUS_00700 gene feoB 73756 71762 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065727.1 protein_id gnl|my_center|LOCUS_00700 73995 73753 gene locus_tag LOCUS_00710 73995 73753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 74261 73995 gene locus_tag LOCUS_00720 74261 73995 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392946.1 protein_id gnl|my_center|LOCUS_00720 74527 76080 gene locus_tag LOCUS_00730 74527 76080 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_00730 76148 76732 gene locus_tag LOCUS_00740 76148 76732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 77631 76729 gene locus_tag LOCUS_00750 77631 76729 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876413.1 protein_id gnl|my_center|LOCUS_00750 78917 77628 gene locus_tag LOCUS_00760 gene aspS 78917 77628 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 protein_id gnl|my_center|LOCUS_00760 79588 79046 gene locus_tag LOCUS_00770 79588 79046 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023416.1 protein_id gnl|my_center|LOCUS_00770 79868 80206 gene locus_tag LOCUS_00780 79868 80206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 80216 80464 gene locus_tag LOCUS_00790 80216 80464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 80469 80681 gene locus_tag LOCUS_00800 80469 80681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 80687 81046 gene locus_tag LOCUS_00810 80687 81046 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877699.1 protein_id gnl|my_center|LOCUS_00810 81061 82215 gene locus_tag LOCUS_00820 81061 82215 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064599.1 protein_id gnl|my_center|LOCUS_00820 82225 82611 gene locus_tag LOCUS_00830 gene nifU 82225 82611 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_00830 83524 82622 gene locus_tag LOCUS_00840 gene cofD 83524 82622 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066127.1 protein_id gnl|my_center|LOCUS_00840 84504 83596 gene locus_tag LOCUS_00850 gene cofD 84504 83596 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066127.1 protein_id gnl|my_center|LOCUS_00850 84904 85950 gene locus_tag LOCUS_00860 84904 85950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 85967 86878 gene locus_tag LOCUS_00870 85967 86878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 87215 88423 gene locus_tag LOCUS_00880 87215 88423 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020758.1 protein_id gnl|my_center|LOCUS_00880 88438 88992 gene locus_tag LOCUS_00890 88438 88992 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020756.1 protein_id gnl|my_center|LOCUS_00890 88985 90226 gene locus_tag LOCUS_00900 88985 90226 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020304.1 protein_id gnl|my_center|LOCUS_00900 90227 91387 gene locus_tag LOCUS_00910 90227 91387 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020303.1 protein_id gnl|my_center|LOCUS_00910 91711 91983 gene locus_tag LOCUS_00920 91711 91983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 92072 92350 gene locus_tag LOCUS_00930 92072 92350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 93638 92358 gene locus_tag LOCUS_00940 93638 92358 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249831.1 protein_id gnl|my_center|LOCUS_00940 96533 93831 gene locus_tag LOCUS_00950 96533 93831 CDS product calcium-transporting P-type ATPase, PMR1-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272458.1 protein_id gnl|my_center|LOCUS_00950 96757 97302 gene locus_tag LOCUS_00960 96757 97302 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037521.1 protein_id gnl|my_center|LOCUS_00960 97360 98562 gene locus_tag LOCUS_00970 97360 98562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00970 98574 99116 gene locus_tag LOCUS_00980 98574 99116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00980 99146 101008 gene locus_tag LOCUS_00990 99146 101008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00990 101087 101473 gene locus_tag LOCUS_01000 101087 101473 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943385.1 protein_id gnl|my_center|LOCUS_01000 101485 102069 gene locus_tag LOCUS_01010 101485 102069 CDS product CheB methylesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943384.1 protein_id gnl|my_center|LOCUS_01010 102128 105988 gene locus_tag LOCUS_01020 102128 105988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 106112 106194 gene locus_tag LOCUS_t00010 106112 106194 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 106627 106298 gene locus_tag LOCUS_01030 106627 106298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 110192 107082 gene locus_tag LOCUS_01040 110192 107082 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_01040 111524 110199 gene locus_tag LOCUS_01050 111524 110199 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065247.1 protein_id gnl|my_center|LOCUS_01050 112626 111862 gene locus_tag LOCUS_01060 112626 111862 CDS product DUF1829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213043995.1 protein_id gnl|my_center|LOCUS_01060 113075 112623 gene locus_tag LOCUS_01070 113075 112623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062537442.1 protein_id gnl|my_center|LOCUS_01070 113606 113082 gene locus_tag LOCUS_01080 113606 113082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 115142 113820 gene locus_tag LOCUS_01090 115142 113820 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257684.1 protein_id gnl|my_center|LOCUS_01090 116739 115132 gene locus_tag LOCUS_01100 116739 115132 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_01100 116863 117318 gene locus_tag LOCUS_01110 116863 117318 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879842.1 protein_id gnl|my_center|LOCUS_01110 117493 117792 gene locus_tag LOCUS_01120 117493 117792 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_01120 118142 118729 gene locus_tag LOCUS_01130 118142 118729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 119173 119036 gene locus_tag LOCUS_01140 119173 119036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 119646 120278 gene locus_tag LOCUS_01150 119646 120278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 120282 120734 gene locus_tag LOCUS_01160 120282 120734 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250023.1 protein_id gnl|my_center|LOCUS_01160 122069 120843 gene locus_tag LOCUS_01170 122069 120843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 122368 122583 gene locus_tag LOCUS_01180 122368 122583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 123053 122778 gene locus_tag LOCUS_01190 123053 122778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 123372 123839 gene locus_tag LOCUS_01200 123372 123839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 124741 124007 gene locus_tag LOCUS_01210 124741 124007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 124886 125878 gene locus_tag LOCUS_01220 124886 125878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 126699 125977 gene locus_tag LOCUS_01230 126699 125977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 127186 127001 gene locus_tag LOCUS_01240 127186 127001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 127185 127610 gene locus_tag LOCUS_01250 127185 127610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 127992 128147 gene locus_tag LOCUS_01260 127992 128147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 130766 128178 gene locus_tag LOCUS_01270 130766 128178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 131491 130997 gene locus_tag LOCUS_01280 131491 130997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 132192 131623 gene locus_tag LOCUS_01290 132192 131623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 132276 132536 gene locus_tag LOCUS_01300 132276 132536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 136869 132667 gene locus_tag LOCUS_01310 136869 132667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 137549 137145 gene locus_tag LOCUS_01320 137549 137145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 137773 137627 gene locus_tag LOCUS_01330 137773 137627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 138323 137856 gene locus_tag LOCUS_01340 138323 137856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01340 138882 138304 gene locus_tag LOCUS_01350 138882 138304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01350 139655 141091 gene locus_tag LOCUS_01360 139655 141091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01360 141427 142746 gene locus_tag LOCUS_01370 141427 142746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 143572 142820 gene locus_tag LOCUS_01380 143572 142820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 144052 144954 gene locus_tag LOCUS_01390 144052 144954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01390 145302 145228 gene locus_tag LOCUS_t00020 145302 145228 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 145670 145341 gene locus_tag LOCUS_01400 145670 145341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289276.1 protein_id gnl|my_center|LOCUS_01400 145909 145676 gene locus_tag LOCUS_01410 145909 145676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 145969 147099 gene locus_tag LOCUS_01420 145969 147099 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020271.1 protein_id gnl|my_center|LOCUS_01420 147096 147977 gene locus_tag LOCUS_01430 gene map 147096 147977 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020270.1 protein_id gnl|my_center|LOCUS_01430 148022 149308 gene locus_tag LOCUS_01440 148022 149308 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023956.1 protein_id gnl|my_center|LOCUS_01440 149310 150038 gene locus_tag LOCUS_01450 149310 150038 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023957.1 protein_id gnl|my_center|LOCUS_01450 150628 150254 gene locus_tag LOCUS_01460 150628 150254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 151724 150651 gene locus_tag LOCUS_01470 151724 150651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 152097 152381 gene locus_tag LOCUS_01480 152097 152381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 152389 153021 gene locus_tag LOCUS_01490 152389 153021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 153619 153002 gene locus_tag LOCUS_01500 153619 153002 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020240.1 protein_id gnl|my_center|LOCUS_01500 153713 155785 gene locus_tag LOCUS_01510 gene purL 153713 155785 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023948.1 protein_id gnl|my_center|LOCUS_01510 156273 155779 gene locus_tag LOCUS_01520 156273 155779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 157819 156830 gene locus_tag LOCUS_01530 gene ilvC 157819 156830 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816729.1 protein_id gnl|my_center|LOCUS_01530 157949 158890 gene locus_tag LOCUS_01540 gene mptA 157949 158890 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066005.1 protein_id gnl|my_center|LOCUS_01540 159137 160504 gene locus_tag LOCUS_01550 gene frhA 159137 160504 CDS product coenzyme F420 hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990767.1 protein_id gnl|my_center|LOCUS_01550 160515 161075 gene locus_tag LOCUS_01560 gene frhD 160515 161075 CDS product coenzyme F420-reducing hydrogenase, FrhD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021013.1 protein_id gnl|my_center|LOCUS_01560 161044 161940 gene locus_tag LOCUS_01570 gene frhG 161044 161940 CDS product coenzyme F420 hydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065016.1 protein_id gnl|my_center|LOCUS_01570 161951 162838 gene locus_tag LOCUS_01580 gene frhB 161951 162838 CDS product coenzyme F420 hydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021015.1 protein_id gnl|my_center|LOCUS_01580 >Feature sequence02 <1 625 gene locus_tag LOCUS_01590 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978239.1:radical SAM protein 1225 2361 gene locus_tag LOCUS_01600 1225 2361 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135390550.1 protein_id gnl|my_center|LOCUS_01600 2718 2437 gene locus_tag LOCUS_01610 2718 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 3859 4140 gene locus_tag LOCUS_01620 3859 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 4133 4474 gene locus_tag LOCUS_01630 4133 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 4471 7386 gene locus_tag LOCUS_01640 4471 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 8984 7626 gene locus_tag LOCUS_01650 8984 7626 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_01650 10202 9201 gene locus_tag LOCUS_01660 10202 9201 CDS product ISH3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755984.1 protein_id gnl|my_center|LOCUS_01660 10524 11495 gene locus_tag LOCUS_01670 10524 11495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 11763 11679 gene locus_tag LOCUS_t00030 11763 11679 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12437 12000 gene locus_tag LOCUS_01680 12437 12000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 13917 12709 gene locus_tag LOCUS_01690 13917 12709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 16144 13997 gene locus_tag LOCUS_01700 16144 13997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 17160 16141 gene locus_tag LOCUS_01710 17160 16141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 18190 17174 gene locus_tag LOCUS_01720 18190 17174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 19859 18681 gene locus_tag LOCUS_01730 19859 18681 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707233.1 protein_id gnl|my_center|LOCUS_01730 21643 19904 gene locus_tag LOCUS_01740 21643 19904 CDS product DUF2070 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902126.1 protein_id gnl|my_center|LOCUS_01740 22617 21727 gene locus_tag LOCUS_01750 22617 21727 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021391.1 protein_id gnl|my_center|LOCUS_01750 22952 22614 gene locus_tag LOCUS_01760 22952 22614 CDS product DUF555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021390.1 protein_id gnl|my_center|LOCUS_01760 23515 22973 gene locus_tag LOCUS_01770 23515 22973 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 protein_id gnl|my_center|LOCUS_01770 23843 23487 gene locus_tag LOCUS_01780 23843 23487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 24208 23900 gene locus_tag LOCUS_01790 24208 23900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 26154 24295 gene locus_tag LOCUS_01800 gene gatE 26154 24295 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022814.1 protein_id gnl|my_center|LOCUS_01800 27384 26155 gene locus_tag LOCUS_01810 gene gatD 27384 26155 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021336.1 protein_id gnl|my_center|LOCUS_01810 28787 27384 gene locus_tag LOCUS_01820 gene argH 28787 27384 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021337.1 protein_id gnl|my_center|LOCUS_01820 29611 30597 gene locus_tag LOCUS_01830 29611 30597 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020124.1 protein_id gnl|my_center|LOCUS_01830 30722 31498 gene locus_tag LOCUS_01840 30722 31498 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020123.1 protein_id gnl|my_center|LOCUS_01840 31500 32261 gene locus_tag LOCUS_01850 31500 32261 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_01850 32323 32835 gene locus_tag LOCUS_01860 32323 32835 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020241.1 protein_id gnl|my_center|LOCUS_01860 32938 33777 gene locus_tag LOCUS_01870 32938 33777 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065423.1 protein_id gnl|my_center|LOCUS_01870 33774 34331 gene locus_tag LOCUS_01880 33774 34331 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867611.1 protein_id gnl|my_center|LOCUS_01880 34328 34600 gene locus_tag LOCUS_01890 34328 34600 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869641.1 protein_id gnl|my_center|LOCUS_01890 34597 35697 gene locus_tag LOCUS_01900 34597 35697 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869774.1 protein_id gnl|my_center|LOCUS_01900 35694 36482 gene locus_tag LOCUS_01910 35694 36482 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870041.1 protein_id gnl|my_center|LOCUS_01910 36479 37018 gene locus_tag LOCUS_01920 36479 37018 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250074.1 protein_id gnl|my_center|LOCUS_01920 37015 38100 gene locus_tag LOCUS_01930 gene sucC 37015 38100 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869705.1 protein_id gnl|my_center|LOCUS_01930 38097 38963 gene locus_tag LOCUS_01940 gene sucD 38097 38963 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879674.1 protein_id gnl|my_center|LOCUS_01940 38960 39772 gene locus_tag LOCUS_01950 38960 39772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 39833 41035 gene locus_tag LOCUS_01960 39833 41035 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020274.1 protein_id gnl|my_center|LOCUS_01960 41059 41958 gene locus_tag LOCUS_01970 gene hisG 41059 41958 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020275.1 protein_id gnl|my_center|LOCUS_01970 41963 42682 gene locus_tag LOCUS_01980 gene hisA 41963 42682 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020276.1 protein_id gnl|my_center|LOCUS_01980 42669 43250 gene locus_tag LOCUS_01990 gene hisB 42669 43250 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020277.1 protein_id gnl|my_center|LOCUS_01990 43544 43870 gene locus_tag LOCUS_02000 43544 43870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 44124 43918 gene locus_tag LOCUS_02010 gene hpkA 44124 43918 CDS product archaeal histone HpkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250364.1 protein_id gnl|my_center|LOCUS_02010 45072 44287 gene locus_tag LOCUS_02020 gene mtxX 45072 44287 CDS product methanogenesis marker protein Mmp4/MtxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065223.1 protein_id gnl|my_center|LOCUS_02020 46073 45063 gene locus_tag LOCUS_02030 46073 45063 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061160.1 protein_id gnl|my_center|LOCUS_02030 46327 47691 gene locus_tag LOCUS_02040 46327 47691 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289363.1 protein_id gnl|my_center|LOCUS_02040 48944 48537 gene locus_tag LOCUS_02050 48944 48537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 48962 49501 gene locus_tag LOCUS_02060 48962 49501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 49623 50165 gene locus_tag LOCUS_02070 49623 50165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068320206.1 protein_id gnl|my_center|LOCUS_02070 50177 51499 gene locus_tag LOCUS_02080 50177 51499 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249831.1 protein_id gnl|my_center|LOCUS_02080 51505 51954 gene locus_tag LOCUS_02090 51505 51954 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868808.1 protein_id gnl|my_center|LOCUS_02090 53291 52467 gene locus_tag LOCUS_02100 gene alsD 53291 52467 CDS product alpha-acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215019.1 protein_id gnl|my_center|LOCUS_02100 53736 53302 gene locus_tag LOCUS_02110 53736 53302 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172598099.1 protein_id gnl|my_center|LOCUS_02110 54453 53911 gene locus_tag LOCUS_02120 54453 53911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 54558 54983 gene locus_tag LOCUS_02130 54558 54983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 55240 56169 gene locus_tag LOCUS_02140 55240 56169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 56962 56108 gene locus_tag LOCUS_02150 gene nadC 56962 56108 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867134.1 protein_id gnl|my_center|LOCUS_02150 57862 56969 gene locus_tag LOCUS_02160 gene nadA 57862 56969 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146454.1 protein_id gnl|my_center|LOCUS_02160 58623 57865 gene locus_tag LOCUS_02170 58623 57865 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060936.1 protein_id gnl|my_center|LOCUS_02170 58660 60012 gene locus_tag LOCUS_02180 58660 60012 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021177.1 protein_id gnl|my_center|LOCUS_02180 60055 60498 gene locus_tag LOCUS_02190 60055 60498 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066044.1 protein_id gnl|my_center|LOCUS_02190 60541 61443 gene locus_tag LOCUS_02200 60541 61443 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876243.1 protein_id gnl|my_center|LOCUS_02200 61440 62207 gene locus_tag LOCUS_02210 61440 62207 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_02210 62204 63019 gene locus_tag LOCUS_02220 62204 63019 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485751.1 protein_id gnl|my_center|LOCUS_02220 63070 63594 gene locus_tag LOCUS_02230 63070 63594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 64644 64192 gene locus_tag LOCUS_02240 64644 64192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 64800 66077 gene locus_tag LOCUS_02250 gene serS 64800 66077 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868451.1 protein_id gnl|my_center|LOCUS_02250 66901 66200 gene locus_tag LOCUS_02260 66901 66200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 67830 66898 gene locus_tag LOCUS_02270 67830 66898 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_02270 68915 68178 gene locus_tag LOCUS_02280 gene aqpZ 68915 68178 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185292.1 protein_id gnl|my_center|LOCUS_02280 69328 69255 gene locus_tag LOCUS_t00040 69328 69255 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 69729 71498 gene locus_tag LOCUS_02290 gene iorA 69729 71498 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065029.1 protein_id gnl|my_center|LOCUS_02290 71495 72091 gene locus_tag LOCUS_02300 71495 72091 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021058.1 protein_id gnl|my_center|LOCUS_02300 72183 73700 gene locus_tag LOCUS_02310 72183 73700 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902894.1 protein_id gnl|my_center|LOCUS_02310 75218 74235 gene locus_tag LOCUS_02320 75218 74235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023363.1 protein_id gnl|my_center|LOCUS_02320 76031 75399 gene locus_tag LOCUS_02330 76031 75399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 76250 76663 gene locus_tag LOCUS_02340 76250 76663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 77172 79118 gene locus_tag LOCUS_02350 77172 79118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 79160 79726 gene locus_tag LOCUS_02360 79160 79726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 79805 80455 gene locus_tag LOCUS_02370 79805 80455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 80452 81132 gene locus_tag LOCUS_02380 80452 81132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 83715 81277 gene locus_tag LOCUS_02390 83715 81277 CDS product DNA polymerase elongation subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902345.1 protein_id gnl|my_center|LOCUS_02390 84574 83708 gene locus_tag LOCUS_02400 gene mdh 84574 83708 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903765.1 protein_id gnl|my_center|LOCUS_02400 84778 85665 gene locus_tag LOCUS_02410 84778 85665 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066118.1 protein_id gnl|my_center|LOCUS_02410 85658 86422 gene locus_tag LOCUS_02420 85658 86422 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020633.1 protein_id gnl|my_center|LOCUS_02420 87477 86449 gene locus_tag LOCUS_02430 87477 86449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 88002 88322 gene locus_tag LOCUS_02440 88002 88322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 88939 88316 gene locus_tag LOCUS_02450 88939 88316 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021972.1 protein_id gnl|my_center|LOCUS_02450 89868 88957 gene locus_tag LOCUS_02460 89868 88957 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545174.1 protein_id gnl|my_center|LOCUS_02460 90363 89893 gene locus_tag LOCUS_02470 90363 89893 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080704.1 protein_id gnl|my_center|LOCUS_02470 92384 90351 gene locus_tag LOCUS_02480 92384 90351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 92588 92836 gene locus_tag LOCUS_02490 92588 92836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 92936 93973 gene locus_tag LOCUS_02500 gene corA 92936 93973 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942048.1 protein_id gnl|my_center|LOCUS_02500 94106 96142 gene locus_tag LOCUS_02510 gene acsB 94106 96142 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811727.1 protein_id gnl|my_center|LOCUS_02510 96155 97066 gene locus_tag LOCUS_02520 96155 97066 CDS product acetyl-CoA decarbonylase/synthase complex subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944232.1 protein_id gnl|my_center|LOCUS_02520 97069 98403 gene locus_tag LOCUS_02530 gene acsC 97069 98403 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811725.1 protein_id gnl|my_center|LOCUS_02530 98391 100325 gene locus_tag LOCUS_02540 98391 100325 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811724.1 protein_id gnl|my_center|LOCUS_02540 100313 101347 gene locus_tag LOCUS_02550 100313 101347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392352.1 protein_id gnl|my_center|LOCUS_02550 101344 102099 gene locus_tag LOCUS_02560 101344 102099 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_02560 102146 103486 gene locus_tag LOCUS_02570 gene purB 102146 103486 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066555.1 protein_id gnl|my_center|LOCUS_02570 105512 103494 gene locus_tag LOCUS_02580 105512 103494 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256027.1 protein_id gnl|my_center|LOCUS_02580 105944 105612 gene locus_tag LOCUS_02590 105944 105612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 106219 106434 gene locus_tag LOCUS_02600 106219 106434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 107477 108595 gene locus_tag LOCUS_02610 107477 108595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 108825 109376 gene locus_tag LOCUS_02620 108825 109376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 109586 110881 gene locus_tag LOCUS_02630 109586 110881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 110940 111578 gene locus_tag LOCUS_02640 110940 111578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 112750 113184 gene locus_tag LOCUS_02650 112750 113184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 113205 114386 gene locus_tag LOCUS_02660 113205 114386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 118231 114530 gene locus_tag LOCUS_02670 gene cobN 118231 114530 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020926.1 protein_id gnl|my_center|LOCUS_02670 119007 118228 gene locus_tag LOCUS_02680 119007 118228 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_02680 120083 119022 gene locus_tag LOCUS_02690 120083 119022 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_02690 121300 120083 gene locus_tag LOCUS_02700 121300 120083 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990611.1 protein_id gnl|my_center|LOCUS_02700 121662 121300 gene locus_tag LOCUS_02710 121662 121300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 121579 121767 gene locus_tag LOCUS_02720 121579 121767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 122259 124016 gene locus_tag LOCUS_02730 122259 124016 CDS product DUF3344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065201.1 protein_id gnl|my_center|LOCUS_02730 124003 124971 gene locus_tag LOCUS_02740 124003 124971 CDS product DUF3344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065202.1 protein_id gnl|my_center|LOCUS_02740 124977 125642 gene locus_tag LOCUS_02750 124977 125642 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021756.1 protein_id gnl|my_center|LOCUS_02750 125639 126859 gene locus_tag LOCUS_02760 125639 126859 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990807.1 protein_id gnl|my_center|LOCUS_02760 126864 130955 gene locus_tag LOCUS_02770 126864 130955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 131616 132566 gene locus_tag LOCUS_02780 131616 132566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 133283 141904 gene locus_tag LOCUS_02790 133283 141904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 142924 141989 gene locus_tag LOCUS_02800 142924 141989 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870394.1 protein_id gnl|my_center|LOCUS_02800 143458 143709 gene locus_tag LOCUS_02810 143458 143709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 143710 144627 gene locus_tag LOCUS_02820 143710 144627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 144786 145793 gene locus_tag LOCUS_02830 144786 145793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 145783 146052 gene locus_tag LOCUS_02840 gene gatC 145783 146052 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879817.1 protein_id gnl|my_center|LOCUS_02840 146053 147354 gene locus_tag LOCUS_02850 gene gatA 146053 147354 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066007.1 protein_id gnl|my_center|LOCUS_02850 147351 148766 gene locus_tag LOCUS_02860 gene gatB 147351 148766 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024400.1 protein_id gnl|my_center|LOCUS_02860 148773 151568 gene locus_tag LOCUS_02870 148773 151568 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022481.1 protein_id gnl|my_center|LOCUS_02870 151573 152265 gene locus_tag LOCUS_02880 151573 152265 CDS product phosphoglycerol geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877910.1 protein_id gnl|my_center|LOCUS_02880 152269 152967 gene locus_tag LOCUS_02890 152269 152967 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064947.1 protein_id gnl|my_center|LOCUS_02890 152990 153547 gene locus_tag LOCUS_02900 gene dcd 152990 153547 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881042.1 protein_id gnl|my_center|LOCUS_02900 153695 155530 gene locus_tag LOCUS_02910 153695 155530 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496752.1 protein_id gnl|my_center|LOCUS_02910 >Feature sequence03 695 940 gene locus_tag LOCUS_02920 695 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 1137 946 gene locus_tag LOCUS_02930 1137 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 1334 1879 gene locus_tag LOCUS_02940 1334 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 2630 2037 gene locus_tag LOCUS_02950 2630 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 3498 3232 gene locus_tag LOCUS_02960 3498 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02960 3914 3528 gene locus_tag LOCUS_02970 3914 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02970 4512 3922 gene locus_tag LOCUS_02980 4512 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 4869 5210 gene locus_tag LOCUS_02990 4869 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 5346 5942 gene locus_tag LOCUS_03000 5346 5942 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598657.1 protein_id gnl|my_center|LOCUS_03000 5908 6336 gene locus_tag LOCUS_03010 5908 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 6599 6378 gene locus_tag LOCUS_03020 6599 6378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 7596 6697 gene locus_tag LOCUS_03030 7596 6697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 8187 7972 gene locus_tag LOCUS_03040 8187 7972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 8768 8217 gene locus_tag LOCUS_03050 8768 8217 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065618.1 protein_id gnl|my_center|LOCUS_03050 9151 8858 gene locus_tag LOCUS_03060 9151 8858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 9391 9930 gene locus_tag LOCUS_03070 9391 9930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 10085 10528 gene locus_tag LOCUS_03080 10085 10528 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990599.1 protein_id gnl|my_center|LOCUS_03080 10544 10840 gene locus_tag LOCUS_03090 10544 10840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 12349 11135 gene locus_tag LOCUS_03100 12349 11135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 12679 13110 gene locus_tag LOCUS_03110 12679 13110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03110 13164 13370 gene locus_tag LOCUS_03120 13164 13370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03120 13431 13883 gene locus_tag LOCUS_03130 13431 13883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03130 13847 14035 gene locus_tag LOCUS_03140 13847 14035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03140 15783 14104 gene locus_tag LOCUS_03150 15783 14104 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_03150 16206 17066 gene locus_tag LOCUS_03160 gene nifH 16206 17066 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963576.1 protein_id gnl|my_center|LOCUS_03160 17089 17415 gene locus_tag LOCUS_03170 17089 17415 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963577.1 protein_id gnl|my_center|LOCUS_03170 17431 17850 gene locus_tag LOCUS_03180 17431 17850 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176591.1 protein_id gnl|my_center|LOCUS_03180 17872 19485 gene locus_tag LOCUS_03190 gene nifD 17872 19485 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963579.1 protein_id gnl|my_center|LOCUS_03190 19493 20869 gene locus_tag LOCUS_03200 gene nifK 19493 20869 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963580.1 protein_id gnl|my_center|LOCUS_03200 20886 22277 gene locus_tag LOCUS_03210 gene nifE 20886 22277 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943606.1 protein_id gnl|my_center|LOCUS_03210 22274 23671 gene locus_tag LOCUS_03220 22274 23671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 23658 23966 gene locus_tag LOCUS_03230 23658 23966 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933206.1 protein_id gnl|my_center|LOCUS_03230 23967 24617 gene locus_tag LOCUS_03240 gene anfO 23967 24617 CDS product Fe-only nitrogenase accessory protein AnfO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389145.1 protein_id gnl|my_center|LOCUS_03240 24699 25520 gene locus_tag LOCUS_03250 gene modA 24699 25520 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393324.1 protein_id gnl|my_center|LOCUS_03250 25498 26313 gene locus_tag LOCUS_03260 25498 26313 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393323.1 protein_id gnl|my_center|LOCUS_03260 26313 27044 gene locus_tag LOCUS_03270 26313 27044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 27922 27053 gene locus_tag LOCUS_03280 27922 27053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03280 28027 28500 gene locus_tag LOCUS_03290 28027 28500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 28871 28659 gene locus_tag LOCUS_03300 28871 28659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 29984 28893 gene locus_tag LOCUS_03310 29984 28893 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024205.1 protein_id gnl|my_center|LOCUS_03310 31642 29981 gene locus_tag LOCUS_03320 31642 29981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 32405 31659 gene locus_tag LOCUS_03330 32405 31659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 33215 32484 gene locus_tag LOCUS_03340 33215 32484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 34798 33212 gene locus_tag LOCUS_03350 34798 33212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 34961 35731 gene locus_tag LOCUS_03360 34961 35731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 35871 36413 gene locus_tag LOCUS_03370 35871 36413 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764623.1 protein_id gnl|my_center|LOCUS_03370 37329 36541 gene locus_tag LOCUS_03380 37329 36541 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970774.1 protein_id gnl|my_center|LOCUS_03380 37294 37662 gene locus_tag LOCUS_03390 37294 37662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 37637 38323 gene locus_tag LOCUS_03400 37637 38323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 39085 38342 gene locus_tag LOCUS_03410 39085 38342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 39206 40822 gene locus_tag LOCUS_03420 39206 40822 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_03420 42624 41362 gene locus_tag LOCUS_03430 42624 41362 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978370.1 protein_id gnl|my_center|LOCUS_03430 42946 43587 gene locus_tag LOCUS_03440 42946 43587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 43721 44176 gene locus_tag LOCUS_03450 43721 44176 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404934.1 protein_id gnl|my_center|LOCUS_03450 45913 44180 gene locus_tag LOCUS_03460 gene polX 45913 44180 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_03460 47657 45918 gene locus_tag LOCUS_03470 47657 45918 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978165.1 protein_id gnl|my_center|LOCUS_03470 47753 49063 gene locus_tag LOCUS_03480 47753 49063 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022811.1 protein_id gnl|my_center|LOCUS_03480 49079 50668 gene locus_tag LOCUS_03490 gene pruA 49079 50668 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234655.1 protein_id gnl|my_center|LOCUS_03490 50741 51187 gene locus_tag LOCUS_03500 50741 51187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 51461 51195 gene locus_tag LOCUS_03510 51461 51195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 51836 51552 gene locus_tag LOCUS_03520 51836 51552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 52046 52846 gene locus_tag LOCUS_03530 52046 52846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 52836 54179 gene locus_tag LOCUS_03540 52836 54179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03540 54176 54856 gene locus_tag LOCUS_03550 54176 54856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 55014 55715 gene locus_tag LOCUS_03560 55014 55715 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903934.1 protein_id gnl|my_center|LOCUS_03560 55853 56515 gene locus_tag LOCUS_03570 55853 56515 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024284.1 protein_id gnl|my_center|LOCUS_03570 58219 57368 gene locus_tag LOCUS_03580 58219 57368 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064408.1 protein_id gnl|my_center|LOCUS_03580 58923 58216 gene locus_tag LOCUS_03590 58923 58216 CDS product DUF432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879042.1 protein_id gnl|my_center|LOCUS_03590 59320 60768 gene locus_tag LOCUS_03600 59320 60768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 60904 61299 gene locus_tag LOCUS_03610 60904 61299 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978223.1 protein_id gnl|my_center|LOCUS_03610 61292 61585 gene locus_tag LOCUS_03620 gene hisE 61292 61585 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021409.1 protein_id gnl|my_center|LOCUS_03620 62065 61619 gene locus_tag LOCUS_03630 62065 61619 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878603.1 protein_id gnl|my_center|LOCUS_03630 63152 62112 gene locus_tag LOCUS_03640 63152 62112 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023080.1 protein_id gnl|my_center|LOCUS_03640 63886 63425 gene locus_tag LOCUS_03650 63886 63425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 64312 63887 gene locus_tag LOCUS_03660 64312 63887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 64636 64361 gene locus_tag LOCUS_03670 64636 64361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 64931 65773 gene locus_tag LOCUS_03680 64931 65773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 66433 65867 gene locus_tag LOCUS_03690 66433 65867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 66582 66436 gene locus_tag LOCUS_03700 66582 66436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 67867 66650 gene locus_tag LOCUS_03710 67867 66650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 68581 68012 gene locus_tag LOCUS_03720 68581 68012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 69330 68578 gene locus_tag LOCUS_03730 gene dph5 69330 68578 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021388.1 protein_id gnl|my_center|LOCUS_03730 71351 69501 gene locus_tag LOCUS_03740 gene feoB 71351 69501 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024217.1 protein_id gnl|my_center|LOCUS_03740 71986 71348 gene locus_tag LOCUS_03750 71986 71348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 72241 72696 gene locus_tag LOCUS_03760 72241 72696 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928468.1 protein_id gnl|my_center|LOCUS_03760 72798 74477 gene locus_tag LOCUS_03770 gene polX 72798 74477 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_03770 74474 75064 gene locus_tag LOCUS_03780 74474 75064 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289377.1 protein_id gnl|my_center|LOCUS_03780 76066 75338 gene locus_tag LOCUS_03790 76066 75338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 77127 76117 gene locus_tag LOCUS_03800 77127 76117 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023617.1 protein_id gnl|my_center|LOCUS_03800 78417 77239 gene locus_tag LOCUS_03810 78417 77239 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_03810 79073 78699 gene locus_tag LOCUS_03820 79073 78699 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066022.1 protein_id gnl|my_center|LOCUS_03820 79451 79095 gene locus_tag LOCUS_03830 79451 79095 CDS product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289500.1 protein_id gnl|my_center|LOCUS_03830 80110 79469 gene locus_tag LOCUS_03840 80110 79469 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289501.1 protein_id gnl|my_center|LOCUS_03840 80390 80163 gene locus_tag LOCUS_03850 80390 80163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 80322 80885 gene locus_tag LOCUS_03860 80322 80885 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876850.1 protein_id gnl|my_center|LOCUS_03860 80882 81637 gene locus_tag LOCUS_03870 80882 81637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 81676 82623 gene locus_tag LOCUS_03880 81676 82623 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048168954.1 protein_id gnl|my_center|LOCUS_03880 82631 83470 gene locus_tag LOCUS_03890 82631 83470 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024518.1 protein_id gnl|my_center|LOCUS_03890 83467 84249 gene locus_tag LOCUS_03900 83467 84249 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060996.1 protein_id gnl|my_center|LOCUS_03900 85244 86209 gene locus_tag LOCUS_03910 85244 86209 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 protein_id gnl|my_center|LOCUS_03910 86326 86411 gene locus_tag LOCUS_t00050 86326 86411 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 86445 86894 gene locus_tag LOCUS_03920 86445 86894 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902812.1 protein_id gnl|my_center|LOCUS_03920 86906 87454 gene locus_tag LOCUS_03930 86906 87454 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021137.1 protein_id gnl|my_center|LOCUS_03930 87459 87848 gene locus_tag LOCUS_03940 87459 87848 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021138.1 protein_id gnl|my_center|LOCUS_03940 87848 88678 gene locus_tag LOCUS_03950 87848 88678 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875678.1 protein_id gnl|my_center|LOCUS_03950 88675 89043 gene locus_tag LOCUS_03960 88675 89043 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064921.1 protein_id gnl|my_center|LOCUS_03960 89049 89471 gene locus_tag LOCUS_03970 gene rplM 89049 89471 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250452.1 protein_id gnl|my_center|LOCUS_03970 89485 89886 gene locus_tag LOCUS_03980 89485 89886 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020646.1 protein_id gnl|my_center|LOCUS_03980 90110 90183 gene locus_tag LOCUS_t00060 90110 90183 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 90389 91576 gene locus_tag LOCUS_03990 gene eno 90389 91576 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064335.1 protein_id gnl|my_center|LOCUS_03990 91578 92186 gene locus_tag LOCUS_04000 gene rpsB 91578 92186 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020649.1 protein_id gnl|my_center|LOCUS_04000 92244 93002 gene locus_tag LOCUS_04010 92244 93002 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020650.1 protein_id gnl|my_center|LOCUS_04010 93003 93872 gene locus_tag LOCUS_04020 93003 93872 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064922.1 protein_id gnl|my_center|LOCUS_04020 93865 94626 gene locus_tag LOCUS_04030 93865 94626 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020652.1 protein_id gnl|my_center|LOCUS_04030 94623 95675 gene locus_tag LOCUS_04040 gene fni 94623 95675 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064552.1 protein_id gnl|my_center|LOCUS_04040 95708 97045 gene locus_tag LOCUS_04050 95708 97045 CDS product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020654.1 protein_id gnl|my_center|LOCUS_04050 97057 98022 gene locus_tag LOCUS_04060 97057 98022 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066119.1 protein_id gnl|my_center|LOCUS_04060 98027 99712 gene locus_tag LOCUS_04070 gene gltX 98027 99712 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870894.1 protein_id gnl|my_center|LOCUS_04070 100612 101139 gene locus_tag LOCUS_04080 100612 101139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 101123 101332 gene locus_tag LOCUS_04090 101123 101332 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496448.1 protein_id gnl|my_center|LOCUS_04090 102437 103681 gene locus_tag LOCUS_04100 102437 103681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 103310 103213 gene locus_tag LOCUS_t00070 103310 103213 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 103700 104371 gene locus_tag LOCUS_04110 103700 104371 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187151961.1 protein_id gnl|my_center|LOCUS_04110 104368 105606 gene locus_tag LOCUS_04120 104368 105606 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064397.1 protein_id gnl|my_center|LOCUS_04120 106294 105653 gene locus_tag LOCUS_04130 106294 105653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 106382 106888 gene locus_tag LOCUS_04140 106382 106888 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065297.1 protein_id gnl|my_center|LOCUS_04140 106964 108712 gene locus_tag LOCUS_04150 106964 108712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 109661 108741 gene locus_tag LOCUS_04160 109661 108741 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_04160 111190 110351 gene locus_tag LOCUS_04170 111190 110351 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_04170 112631 111315 gene locus_tag LOCUS_04180 112631 111315 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023306.1 protein_id gnl|my_center|LOCUS_04180 112594 112866 gene locus_tag LOCUS_04190 112594 112866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 112998 113435 gene locus_tag LOCUS_04200 112998 113435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 113641 115404 gene locus_tag LOCUS_04210 113641 115404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 116203 116087 gene locus_tag LOCUS_r00010 116203 116087 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 116367 116296 gene locus_tag LOCUS_t00080 116367 116296 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 119388 116485 gene locus_tag LOCUS_r00020 119388 116485 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 119606 119533 gene locus_tag LOCUS_t00090 119606 119533 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 121135 119675 gene locus_tag LOCUS_r00030 121135 119675 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 122948 122184 gene locus_tag LOCUS_04220 122948 122184 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902207.1 protein_id gnl|my_center|LOCUS_04220 126384 122941 gene locus_tag LOCUS_04230 gene smc 126384 122941 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024214.1 protein_id gnl|my_center|LOCUS_04230 127009 126410 gene locus_tag LOCUS_04240 127009 126410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 127189 128460 gene locus_tag LOCUS_04250 127189 128460 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986909.1 protein_id gnl|my_center|LOCUS_04250 128457 129290 gene locus_tag LOCUS_04260 gene folD 128457 129290 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941526.1 protein_id gnl|my_center|LOCUS_04260 129284 130102 gene locus_tag LOCUS_04270 129284 130102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 130099 130905 gene locus_tag LOCUS_04280 gene cofE 130099 130905 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023428.1 protein_id gnl|my_center|LOCUS_04280 131478 130831 gene locus_tag LOCUS_04290 gene cofC 131478 130831 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021502.1 protein_id gnl|my_center|LOCUS_04290 >Feature sequence04 259 1341 gene locus_tag LOCUS_04300 gene dinB 259 1341 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172312.1 protein_id gnl|my_center|LOCUS_04300 1396 2229 gene locus_tag LOCUS_04310 1396 2229 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228704.1 protein_id gnl|my_center|LOCUS_04310 2313 2837 gene locus_tag LOCUS_04320 2313 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 2834 3313 gene locus_tag LOCUS_04330 2834 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 3409 4239 gene locus_tag LOCUS_04340 3409 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 4233 4439 gene locus_tag LOCUS_04350 4233 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 5416 4703 gene locus_tag LOCUS_04360 5416 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04360 6621 5410 gene locus_tag LOCUS_04370 6621 5410 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_04370 6756 7838 gene locus_tag LOCUS_04380 6756 7838 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584144.1 protein_id gnl|my_center|LOCUS_04380 8680 7877 gene locus_tag LOCUS_04390 8680 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 9935 8883 gene locus_tag LOCUS_04400 9935 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 11394 10087 gene locus_tag LOCUS_04410 11394 10087 CDS product methyl-coenzyme M reductase glutamine C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496936.1 protein_id gnl|my_center|LOCUS_04410 12126 11449 gene locus_tag LOCUS_04420 12126 11449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 13327 12245 gene locus_tag LOCUS_04430 13327 12245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 15129 13324 gene locus_tag LOCUS_04440 15129 13324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 15210 16097 gene locus_tag LOCUS_04450 15210 16097 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902476.1 protein_id gnl|my_center|LOCUS_04450 18329 16122 gene locus_tag LOCUS_04460 18329 16122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 18606 19328 gene locus_tag LOCUS_04470 18606 19328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 22483 19433 gene locus_tag LOCUS_04480 22483 19433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 22823 22644 gene locus_tag LOCUS_04490 22823 22644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 22810 24573 gene locus_tag LOCUS_04500 22810 24573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 24583 25074 gene locus_tag LOCUS_04510 24583 25074 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249580.1 protein_id gnl|my_center|LOCUS_04510 25511 25435 gene locus_tag LOCUS_t00100 25511 25435 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 25582 27084 gene locus_tag LOCUS_04520 25582 27084 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065053.1 protein_id gnl|my_center|LOCUS_04520 27081 27701 gene locus_tag LOCUS_04530 27081 27701 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022401.1 protein_id gnl|my_center|LOCUS_04530 27691 29337 gene locus_tag LOCUS_04540 27691 29337 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022802.1 protein_id gnl|my_center|LOCUS_04540 30985 29849 gene locus_tag LOCUS_04550 30985 29849 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020066.1 protein_id gnl|my_center|LOCUS_04550 31038 31301 gene locus_tag LOCUS_04560 31038 31301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 31343 32077 gene locus_tag LOCUS_04570 31343 32077 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_04570 35239 32060 gene locus_tag LOCUS_04580 gene ileS 35239 32060 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022402.1 protein_id gnl|my_center|LOCUS_04580 35554 36117 gene locus_tag LOCUS_04590 35554 36117 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_04590 37954 36044 gene locus_tag LOCUS_04600 37954 36044 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986480.1 protein_id gnl|my_center|LOCUS_04600 39150 37948 gene locus_tag LOCUS_04610 39150 37948 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250233.1 protein_id gnl|my_center|LOCUS_04610 39329 39147 gene locus_tag LOCUS_04620 39329 39147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 39414 40736 gene locus_tag LOCUS_04630 39414 40736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 40733 41830 gene locus_tag LOCUS_04640 gene ftsZ 40733 41830 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064630.1 protein_id gnl|my_center|LOCUS_04640 41837 42046 gene locus_tag LOCUS_04650 41837 42046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 42043 42525 gene locus_tag LOCUS_04660 42043 42525 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065945.1 protein_id gnl|my_center|LOCUS_04660 42720 43196 gene locus_tag LOCUS_04670 42720 43196 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024155.1 protein_id gnl|my_center|LOCUS_04670 43248 43889 gene locus_tag LOCUS_04680 43248 43889 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061119.1 protein_id gnl|my_center|LOCUS_04680 43889 44914 gene locus_tag LOCUS_04690 43889 44914 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024157.1 protein_id gnl|my_center|LOCUS_04690 44943 45260 gene locus_tag LOCUS_04700 gene rpl12p 44943 45260 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024158.1 protein_id gnl|my_center|LOCUS_04700 48364 46154 gene locus_tag LOCUS_04710 gene hypF 48364 46154 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250947.1 protein_id gnl|my_center|LOCUS_04710 48422 48934 gene locus_tag LOCUS_04720 48422 48934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 48918 49727 gene locus_tag LOCUS_04730 48918 49727 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589532.1 protein_id gnl|my_center|LOCUS_04730 49724 51733 gene locus_tag LOCUS_04740 49724 51733 CDS product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021427.1 protein_id gnl|my_center|LOCUS_04740 53397 52345 gene locus_tag LOCUS_04750 53397 52345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 54866 53673 gene locus_tag LOCUS_04760 54866 53673 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350283.1 protein_id gnl|my_center|LOCUS_04760 55821 54985 gene locus_tag LOCUS_04770 55821 54985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 56666 55818 gene locus_tag LOCUS_04780 56666 55818 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902335.1 protein_id gnl|my_center|LOCUS_04780 57918 56683 gene locus_tag LOCUS_04790 57918 56683 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879247.1 protein_id gnl|my_center|LOCUS_04790 58413 57946 gene locus_tag LOCUS_04800 58413 57946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 59140 58547 gene locus_tag LOCUS_04810 59140 58547 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023341.1 protein_id gnl|my_center|LOCUS_04810 59445 59161 gene locus_tag LOCUS_04820 59445 59161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 60659 59442 gene locus_tag LOCUS_04830 60659 59442 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878202.1 protein_id gnl|my_center|LOCUS_04830 61124 60666 gene locus_tag LOCUS_04840 61124 60666 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020987.1 protein_id gnl|my_center|LOCUS_04840 61315 63630 gene locus_tag LOCUS_04850 61315 63630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 63675 63749 gene locus_tag LOCUS_t00110 63675 63749 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 65321 63867 gene locus_tag LOCUS_04860 65321 63867 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392514.1 protein_id gnl|my_center|LOCUS_04860 65749 65318 gene locus_tag LOCUS_04870 65749 65318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 66696 65890 gene locus_tag LOCUS_04880 66696 65890 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021472.1 protein_id gnl|my_center|LOCUS_04880 66781 67992 gene locus_tag LOCUS_04890 66781 67992 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392801.1 protein_id gnl|my_center|LOCUS_04890 69214 68039 gene locus_tag LOCUS_04900 69214 68039 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545988.1 protein_id gnl|my_center|LOCUS_04900 69459 70505 gene locus_tag LOCUS_04910 69459 70505 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023080.1 protein_id gnl|my_center|LOCUS_04910 70607 71284 gene locus_tag LOCUS_04920 70607 71284 CDS product DUF5612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878900.1 protein_id gnl|my_center|LOCUS_04920 71286 71861 gene locus_tag LOCUS_04930 71286 71861 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903724.1 protein_id gnl|my_center|LOCUS_04930 71864 72790 gene locus_tag LOCUS_04940 71864 72790 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065056.1 protein_id gnl|my_center|LOCUS_04940 73473 72787 gene locus_tag LOCUS_04950 73473 72787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 73564 73869 gene locus_tag LOCUS_04960 73564 73869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 73943 74014 gene locus_tag LOCUS_t00120 73943 74014 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 74401 74757 gene locus_tag LOCUS_04970 74401 74757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 75684 74971 gene locus_tag LOCUS_04980 75684 74971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 76144 77184 gene locus_tag LOCUS_04990 76144 77184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 77171 77917 gene locus_tag LOCUS_05000 77171 77917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 78595 78035 gene locus_tag LOCUS_05010 78595 78035 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065467.1 protein_id gnl|my_center|LOCUS_05010 79378 78908 gene locus_tag LOCUS_05020 79378 78908 CDS product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022592.1 protein_id gnl|my_center|LOCUS_05020 81827 79479 gene locus_tag LOCUS_05030 81827 79479 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727677.1 protein_id gnl|my_center|LOCUS_05030 83239 81938 gene locus_tag LOCUS_05040 83239 81938 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_05040 84354 83989 gene locus_tag LOCUS_05050 84354 83989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 84955 84566 gene locus_tag LOCUS_05060 84955 84566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 85753 85199 gene locus_tag LOCUS_05070 85753 85199 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810481.1 protein_id gnl|my_center|LOCUS_05070 86132 85860 gene locus_tag LOCUS_05080 86132 85860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 86213 88237 gene locus_tag LOCUS_05090 86213 88237 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939577.1 protein_id gnl|my_center|LOCUS_05090 88598 89044 gene locus_tag LOCUS_05100 88598 89044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 90222 89269 gene locus_tag LOCUS_05110 90222 89269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 91190 90348 gene locus_tag LOCUS_05120 91190 90348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 91517 92728 gene locus_tag LOCUS_05130 91517 92728 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_05130 92914 93159 gene locus_tag LOCUS_05140 92914 93159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 93893 93222 gene locus_tag LOCUS_05150 93893 93222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 96042 93940 gene locus_tag LOCUS_05160 96042 93940 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008002.1 protein_id gnl|my_center|LOCUS_05160 96913 96035 gene locus_tag LOCUS_05170 96913 96035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 99821 97050 gene locus_tag LOCUS_05180 99821 97050 CDS product Z1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383504.1 protein_id gnl|my_center|LOCUS_05180 101326 99821 gene locus_tag LOCUS_05190 101326 99821 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383503.1 protein_id gnl|my_center|LOCUS_05190 102681 101419 gene locus_tag LOCUS_05200 102681 101419 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876134.1 protein_id gnl|my_center|LOCUS_05200 102697 103122 gene locus_tag LOCUS_05210 102697 103122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 103165 104016 gene locus_tag LOCUS_05220 103165 104016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 104292 104002 gene locus_tag LOCUS_05230 104292 104002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 104556 104335 gene locus_tag LOCUS_05240 104556 104335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 104810 104553 gene locus_tag LOCUS_05250 104810 104553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 104721 105152 gene locus_tag LOCUS_05260 104721 105152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 105256 106047 gene locus_tag LOCUS_05270 105256 106047 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020389.1 protein_id gnl|my_center|LOCUS_05270 106763 106065 gene locus_tag LOCUS_05280 106763 106065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 109293 107035 gene locus_tag LOCUS_05290 109293 107035 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020344.1 protein_id gnl|my_center|LOCUS_05290 109709 109290 gene locus_tag LOCUS_05300 109709 109290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 109957 110268 gene locus_tag LOCUS_05310 109957 110268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 110663 111418 gene locus_tag LOCUS_05320 110663 111418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 112749 111445 gene locus_tag LOCUS_05330 112749 111445 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250733.1 protein_id gnl|my_center|LOCUS_05330 113078 112851 gene locus_tag LOCUS_05340 113078 112851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 113831 114160 gene locus_tag LOCUS_05350 113831 114160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 114839 114060 gene locus_tag LOCUS_05360 114839 114060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05360 115731 115300 gene locus_tag LOCUS_05370 115731 115300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 115867 115795 gene locus_tag LOCUS_t00130 115867 115795 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 116378 118159 gene locus_tag LOCUS_05380 gene infB 116378 118159 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065143.1 protein_id gnl|my_center|LOCUS_05380 118281 118679 gene locus_tag LOCUS_05390 118281 118679 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021540.1 protein_id gnl|my_center|LOCUS_05390 119649 118759 gene locus_tag LOCUS_05400 119649 118759 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876607.1 protein_id gnl|my_center|LOCUS_05400 119871 120428 gene locus_tag LOCUS_05410 119871 120428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 120685 121248 gene locus_tag LOCUS_05420 120685 121248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 121732 121265 gene locus_tag LOCUS_05430 121732 121265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 122151 121729 gene locus_tag LOCUS_05440 122151 121729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 122241 123680 gene locus_tag LOCUS_05450 122241 123680 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877102.1 protein_id gnl|my_center|LOCUS_05450 123745 123912 gene locus_tag LOCUS_05460 123745 123912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 124304 123927 gene locus_tag LOCUS_05470 124304 123927 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020961.1 protein_id gnl|my_center|LOCUS_05470 125075 124410 gene locus_tag LOCUS_05480 gene hypB 125075 124410 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876419.1 protein_id gnl|my_center|LOCUS_05480 125113 125385 gene locus_tag LOCUS_05490 125113 125385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 125391 126035 gene locus_tag LOCUS_05500 125391 126035 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065077.1 protein_id gnl|my_center|LOCUS_05500 126374 127387 gene locus_tag LOCUS_05510 126374 127387 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020659.1 protein_id gnl|my_center|LOCUS_05510 127400 127471 gene locus_tag LOCUS_t00140 127400 127471 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence05 548 369 gene locus_tag LOCUS_05520 548 369 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582562.1 protein_id gnl|my_center|LOCUS_05520 640 1161 gene locus_tag LOCUS_05530 640 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05530 1097 1579 gene locus_tag LOCUS_05540 1097 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05540 3114 1588 gene locus_tag LOCUS_05550 3114 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 5153 3138 gene locus_tag LOCUS_05560 5153 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 5473 5219 gene locus_tag LOCUS_05570 5473 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 6318 5749 gene locus_tag LOCUS_05580 6318 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 7692 6823 gene locus_tag LOCUS_05590 7692 6823 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879868.1 protein_id gnl|my_center|LOCUS_05590 8492 7689 gene locus_tag LOCUS_05600 8492 7689 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_05600 8895 8554 gene locus_tag LOCUS_05610 8895 8554 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876799.1 protein_id gnl|my_center|LOCUS_05610 9133 8960 gene locus_tag LOCUS_05620 9133 8960 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024079.1 protein_id gnl|my_center|LOCUS_05620 9495 9136 gene locus_tag LOCUS_05630 9495 9136 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047760.1 protein_id gnl|my_center|LOCUS_05630 9681 12065 gene locus_tag LOCUS_05640 9681 12065 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_05640 12071 13243 gene locus_tag LOCUS_05650 gene nifS 12071 13243 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066396.1 protein_id gnl|my_center|LOCUS_05650 13244 14590 gene locus_tag LOCUS_05660 13244 14590 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255954.1 protein_id gnl|my_center|LOCUS_05660 14717 14792 gene locus_tag LOCUS_t00150 14717 14792 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 15230 14844 gene locus_tag LOCUS_05670 15230 14844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 15880 17529 gene locus_tag LOCUS_05680 15880 17529 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459981.1 protein_id gnl|my_center|LOCUS_05680 17585 18607 gene locus_tag LOCUS_05690 17585 18607 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_05690 18681 19202 gene locus_tag LOCUS_05700 18681 19202 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065464.1 protein_id gnl|my_center|LOCUS_05700 19307 19876 gene locus_tag LOCUS_05710 19307 19876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 19931 20545 gene locus_tag LOCUS_05720 19931 20545 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987073.1 protein_id gnl|my_center|LOCUS_05720 20588 20989 gene locus_tag LOCUS_05730 20588 20989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 21087 21953 gene locus_tag LOCUS_05740 21087 21953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 23218 22085 gene locus_tag LOCUS_05750 23218 22085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05750 23199 23600 gene locus_tag LOCUS_05760 23199 23600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 23593 23985 gene locus_tag LOCUS_05770 23593 23985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 24143 24478 gene locus_tag LOCUS_05780 24143 24478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 24483 25391 gene locus_tag LOCUS_05790 24483 25391 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022593.1 protein_id gnl|my_center|LOCUS_05790 25608 26294 gene locus_tag LOCUS_05800 25608 26294 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022978.1 protein_id gnl|my_center|LOCUS_05800 26307 26534 gene locus_tag LOCUS_05810 26307 26534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 26782 27459 gene locus_tag LOCUS_05820 26782 27459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 27967 27740 gene locus_tag LOCUS_05830 27967 27740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 28205 28615 gene locus_tag LOCUS_05840 28205 28615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 28631 29728 gene locus_tag LOCUS_05850 28631 29728 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066378.1 protein_id gnl|my_center|LOCUS_05850 29962 31779 gene locus_tag LOCUS_05860 29962 31779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 31833 32858 gene locus_tag LOCUS_05870 31833 32858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 33192 34145 gene locus_tag LOCUS_05880 33192 34145 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875827.1 protein_id gnl|my_center|LOCUS_05880 34493 34170 gene locus_tag LOCUS_05890 34493 34170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 35239 34637 gene locus_tag LOCUS_05900 35239 34637 CDS product amino acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021487.1 protein_id gnl|my_center|LOCUS_05900 35280 36956 gene locus_tag LOCUS_05910 35280 36956 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361675.1 protein_id gnl|my_center|LOCUS_05910 37278 36961 gene locus_tag LOCUS_05920 37278 36961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 37508 37275 gene locus_tag LOCUS_05930 37508 37275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 37579 37944 gene locus_tag LOCUS_05940 37579 37944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 38161 37946 gene locus_tag LOCUS_05950 38161 37946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 38620 38183 gene locus_tag LOCUS_05960 38620 38183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 38567 38791 gene locus_tag LOCUS_05970 38567 38791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 39287 38784 gene locus_tag LOCUS_05980 39287 38784 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065175.1 protein_id gnl|my_center|LOCUS_05980 39561 39280 gene locus_tag LOCUS_05990 39561 39280 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877185.1 protein_id gnl|my_center|LOCUS_05990 41285 39642 gene locus_tag LOCUS_06000 41285 39642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 41444 42001 gene locus_tag LOCUS_06010 41444 42001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 43380 42025 gene locus_tag LOCUS_06020 gene ftsA 43380 42025 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755965.1 protein_id gnl|my_center|LOCUS_06020 44931 43423 gene locus_tag LOCUS_06030 44931 43423 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_06030 45135 46142 gene locus_tag LOCUS_06040 45135 46142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 46460 46149 gene locus_tag LOCUS_06050 46460 46149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 46822 46457 gene locus_tag LOCUS_06060 46822 46457 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872145.1 protein_id gnl|my_center|LOCUS_06060 47859 46909 gene locus_tag LOCUS_06070 47859 46909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 49797 47974 gene locus_tag LOCUS_06080 49797 47974 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871102.1 protein_id gnl|my_center|LOCUS_06080 50379 49804 gene locus_tag LOCUS_06090 50379 49804 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871101.1 protein_id gnl|my_center|LOCUS_06090 52115 50502 gene locus_tag LOCUS_06100 52115 50502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 52666 53022 gene locus_tag LOCUS_06110 52666 53022 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884017.1 protein_id gnl|my_center|LOCUS_06110 53051 54418 gene locus_tag LOCUS_06120 53051 54418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 54418 54828 gene locus_tag LOCUS_06130 54418 54828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 55707 54820 gene locus_tag LOCUS_06140 55707 54820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 55743 56234 gene locus_tag LOCUS_06150 55743 56234 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 protein_id gnl|my_center|LOCUS_06150 56320 58164 gene locus_tag LOCUS_06160 56320 58164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879350.1 protein_id gnl|my_center|LOCUS_06160 58181 59473 gene locus_tag LOCUS_06170 gene larC 58181 59473 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_06170 60434 59742 gene locus_tag LOCUS_06180 60434 59742 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022238.1 protein_id gnl|my_center|LOCUS_06180 60509 60883 gene locus_tag LOCUS_06190 60509 60883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 61650 60913 gene locus_tag LOCUS_06200 61650 60913 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943078.1 protein_id gnl|my_center|LOCUS_06200 61855 62529 gene locus_tag LOCUS_06210 61855 62529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 63443 62850 gene locus_tag LOCUS_06220 63443 62850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 64402 63449 gene locus_tag LOCUS_06230 64402 63449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 64516 64740 gene locus_tag LOCUS_06240 64516 64740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 66857 64644 gene locus_tag LOCUS_06250 gene glgP 66857 64644 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880430.1 protein_id gnl|my_center|LOCUS_06250 67090 66854 gene locus_tag LOCUS_06260 67090 66854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 67382 68116 gene locus_tag LOCUS_06270 67382 68116 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022197.1 protein_id gnl|my_center|LOCUS_06270 68109 69515 gene locus_tag LOCUS_06280 68109 69515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990833.1 protein_id gnl|my_center|LOCUS_06280 69589 69981 gene locus_tag LOCUS_06290 69589 69981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 70178 70417 gene locus_tag LOCUS_06300 70178 70417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 70827 70318 gene locus_tag LOCUS_06310 70827 70318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 71830 70844 gene locus_tag LOCUS_06320 71830 70844 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903967.1 protein_id gnl|my_center|LOCUS_06320 71933 72175 gene locus_tag LOCUS_06330 71933 72175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 72172 73887 gene locus_tag LOCUS_06340 72172 73887 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869281.1 protein_id gnl|my_center|LOCUS_06340 73900 74322 gene locus_tag LOCUS_06350 73900 74322 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249062.1 protein_id gnl|my_center|LOCUS_06350 74572 74336 gene locus_tag LOCUS_06360 74572 74336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 74845 74633 gene locus_tag LOCUS_06370 74845 74633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 75323 74925 gene locus_tag LOCUS_06380 75323 74925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 75437 75721 gene locus_tag LOCUS_06390 75437 75721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065696.1 protein_id gnl|my_center|LOCUS_06390 76094 75726 gene locus_tag LOCUS_06400 76094 75726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 76970 76383 gene locus_tag LOCUS_06410 76970 76383 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477468.1 protein_id gnl|my_center|LOCUS_06410 77551 76982 gene locus_tag LOCUS_06420 77551 76982 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266683.1 protein_id gnl|my_center|LOCUS_06420 77843 78868 gene locus_tag LOCUS_06430 77843 78868 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021053.1 protein_id gnl|my_center|LOCUS_06430 78933 79880 gene locus_tag LOCUS_06440 78933 79880 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020859.1 protein_id gnl|my_center|LOCUS_06440 79888 80664 gene locus_tag LOCUS_06450 79888 80664 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020938.1 protein_id gnl|my_center|LOCUS_06450 80688 81230 gene locus_tag LOCUS_06460 80688 81230 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249751.1 protein_id gnl|my_center|LOCUS_06460 81313 83460 gene locus_tag LOCUS_06470 81313 83460 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_06470 83457 83975 gene locus_tag LOCUS_06480 gene cgi121 83457 83975 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021174.1 protein_id gnl|my_center|LOCUS_06480 84463 83966 gene locus_tag LOCUS_06490 84463 83966 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064607.1 protein_id gnl|my_center|LOCUS_06490 85449 86732 gene locus_tag LOCUS_06500 85449 86732 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064787.1 protein_id gnl|my_center|LOCUS_06500 86737 87228 gene locus_tag LOCUS_06510 86737 87228 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 protein_id gnl|my_center|LOCUS_06510 87239 88399 gene locus_tag LOCUS_06520 87239 88399 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020963.1 protein_id gnl|my_center|LOCUS_06520 89097 90107 gene locus_tag LOCUS_06530 89097 90107 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878344.1 protein_id gnl|my_center|LOCUS_06530 90119 90289 gene locus_tag LOCUS_06540 90119 90289 CDS product methytransferase partner Trm112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023214.1 protein_id gnl|my_center|LOCUS_06540 90298 90822 gene locus_tag LOCUS_06550 90298 90822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 90801 91721 gene locus_tag LOCUS_06560 gene cbiB 90801 91721 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877021.1 protein_id gnl|my_center|LOCUS_06560 91727 92623 gene locus_tag LOCUS_06570 gene pdxS 91727 92623 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876304.1 protein_id gnl|my_center|LOCUS_06570 92613 93191 gene locus_tag LOCUS_06580 gene pdxT 92613 93191 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728706.1 protein_id gnl|my_center|LOCUS_06580 93596 93171 gene locus_tag LOCUS_06590 93596 93171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 93885 94964 gene locus_tag LOCUS_06600 93885 94964 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023833.1 protein_id gnl|my_center|LOCUS_06600 94975 95238 gene locus_tag LOCUS_06610 94975 95238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 95235 95474 gene locus_tag LOCUS_06620 95235 95474 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_06620 95627 96034 gene locus_tag LOCUS_06630 95627 96034 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_06630 96282 97400 gene locus_tag LOCUS_06640 gene arsB 96282 97400 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876533.1 protein_id gnl|my_center|LOCUS_06640 97397 97786 gene locus_tag LOCUS_06650 97397 97786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 97786 98136 gene locus_tag LOCUS_06660 97786 98136 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024086.1 protein_id gnl|my_center|LOCUS_06660 98525 99613 gene locus_tag LOCUS_06670 98525 99613 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066011.1 protein_id gnl|my_center|LOCUS_06670 99624 100265 gene locus_tag LOCUS_06680 99624 100265 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927082.1 protein_id gnl|my_center|LOCUS_06680 100332 102005 gene locus_tag LOCUS_06690 100332 102005 CDS product 4Fe-4S cluster-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024408.1 protein_id gnl|my_center|LOCUS_06690 102886 102083 gene locus_tag LOCUS_06700 102886 102083 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066010.1 protein_id gnl|my_center|LOCUS_06700 104067 102883 gene locus_tag LOCUS_06710 104067 102883 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392937.1 protein_id gnl|my_center|LOCUS_06710 105194 104502 gene locus_tag LOCUS_06720 105194 104502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 105444 105929 gene locus_tag LOCUS_06730 105444 105929 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065176.1 protein_id gnl|my_center|LOCUS_06730 105940 106404 gene locus_tag LOCUS_06740 105940 106404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 107704 106415 gene locus_tag LOCUS_06750 107704 106415 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544926.1 protein_id gnl|my_center|LOCUS_06750 109600 107711 gene locus_tag LOCUS_06760 gene acs 109600 107711 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228545.1 protein_id gnl|my_center|LOCUS_06760 110940 109999 gene locus_tag LOCUS_06770 110940 109999 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963617.1 protein_id gnl|my_center|LOCUS_06770 113064 111040 gene locus_tag LOCUS_06780 113064 111040 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066544.1 protein_id gnl|my_center|LOCUS_06780 114567 113155 gene locus_tag LOCUS_06790 114567 113155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 114677 115345 gene locus_tag LOCUS_06800 114677 115345 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020095.1 protein_id gnl|my_center|LOCUS_06800 115374 116462 gene locus_tag LOCUS_06810 gene cofH 115374 116462 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060905.1 protein_id gnl|my_center|LOCUS_06810 >Feature sequence06 342 1466 gene locus_tag LOCUS_06820 342 1466 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319644.1 protein_id gnl|my_center|LOCUS_06820 1477 2121 gene locus_tag LOCUS_06830 1477 2121 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903575.1 protein_id gnl|my_center|LOCUS_06830 2663 2118 gene locus_tag LOCUS_06840 2663 2118 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879393.1 protein_id gnl|my_center|LOCUS_06840 3283 2663 gene locus_tag LOCUS_06850 3283 2663 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021131.1 protein_id gnl|my_center|LOCUS_06850 3865 3290 gene locus_tag LOCUS_06860 3865 3290 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496506.1 protein_id gnl|my_center|LOCUS_06860 5526 4093 gene locus_tag LOCUS_06870 gene secY 5526 4093 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021124.1 protein_id gnl|my_center|LOCUS_06870 5972 5547 gene locus_tag LOCUS_06880 5972 5547 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021123.1 protein_id gnl|my_center|LOCUS_06880 6439 5978 gene locus_tag LOCUS_06890 6439 5978 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021122.1 protein_id gnl|my_center|LOCUS_06890 7056 6439 gene locus_tag LOCUS_06900 gene rpsE 7056 6439 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879398.1 protein_id gnl|my_center|LOCUS_06900 7585 7058 gene locus_tag LOCUS_06910 7585 7058 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021120.1 protein_id gnl|my_center|LOCUS_06910 8037 7585 gene locus_tag LOCUS_06920 8037 7585 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021119.1 protein_id gnl|my_center|LOCUS_06920 8464 8030 gene locus_tag LOCUS_06930 8464 8030 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066173.1 protein_id gnl|my_center|LOCUS_06930 8994 8470 gene locus_tag LOCUS_06940 8994 8470 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250476.1 protein_id gnl|my_center|LOCUS_06940 9403 9011 gene locus_tag LOCUS_06950 9403 9011 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867448.1 protein_id gnl|my_center|LOCUS_06950 9595 9416 gene locus_tag LOCUS_06960 9595 9416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 10102 9599 gene locus_tag LOCUS_06970 10102 9599 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021114.1 protein_id gnl|my_center|LOCUS_06970 10833 10099 gene locus_tag LOCUS_06980 10833 10099 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879406.1 protein_id gnl|my_center|LOCUS_06980 11198 10833 gene locus_tag LOCUS_06990 gene rplX 11198 10833 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065039.1 protein_id gnl|my_center|LOCUS_06990 11610 11212 gene locus_tag LOCUS_07000 gene rpl14p 11610 11212 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879408.1 protein_id gnl|my_center|LOCUS_07000 11933 11607 gene locus_tag LOCUS_07010 11933 11607 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021110.1 protein_id gnl|my_center|LOCUS_07010 12219 11947 gene locus_tag LOCUS_07020 12219 11947 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875653.1 protein_id gnl|my_center|LOCUS_07020 12419 12216 gene locus_tag LOCUS_07030 gene rpmC 12419 12216 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869962.1 protein_id gnl|my_center|LOCUS_07030 13127 12420 gene locus_tag LOCUS_07040 13127 12420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 13588 13127 gene locus_tag LOCUS_07050 gene rplV 13588 13127 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064485.1 protein_id gnl|my_center|LOCUS_07050 14007 13594 gene locus_tag LOCUS_07060 14007 13594 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021105.1 protein_id gnl|my_center|LOCUS_07060 14737 14018 gene locus_tag LOCUS_07070 14737 14018 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879415.1 protein_id gnl|my_center|LOCUS_07070 14997 14749 gene locus_tag LOCUS_07080 14997 14749 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250491.1 protein_id gnl|my_center|LOCUS_07080 15743 14994 gene locus_tag LOCUS_07090 gene rpl4p 15743 14994 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879417.1 protein_id gnl|my_center|LOCUS_07090 16619 15750 gene locus_tag LOCUS_07100 gene rpl3p 16619 15750 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021101.1 protein_id gnl|my_center|LOCUS_07100 17978 17574 gene locus_tag LOCUS_07110 17978 17574 CDS product Tfx family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496415.1 protein_id gnl|my_center|LOCUS_07110 18169 18960 gene locus_tag LOCUS_07120 18169 18960 CDS product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878217.1 protein_id gnl|my_center|LOCUS_07120 21140 19719 gene locus_tag LOCUS_07130 21140 19719 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880071.1 protein_id gnl|my_center|LOCUS_07130 22095 21166 gene locus_tag LOCUS_07140 22095 21166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878828.1 protein_id gnl|my_center|LOCUS_07140 23248 22280 gene locus_tag LOCUS_07150 gene mer 23248 22280 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_07150 23632 25536 gene locus_tag LOCUS_07160 23632 25536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 26488 25520 gene locus_tag LOCUS_07170 26488 25520 CDS product DUF128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065980.1 protein_id gnl|my_center|LOCUS_07170 26973 26485 gene locus_tag LOCUS_07180 gene dcd 26973 26485 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902137.1 protein_id gnl|my_center|LOCUS_07180 26966 27037 gene locus_tag LOCUS_t00160 26966 27037 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 27439 27209 gene locus_tag LOCUS_07190 27439 27209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 27702 27436 gene locus_tag LOCUS_07200 27702 27436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 31409 28395 gene locus_tag LOCUS_07210 31409 28395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 33083 31689 gene locus_tag LOCUS_07220 33083 31689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 34646 33123 gene locus_tag LOCUS_07230 34646 33123 CDS product AMP phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023176.1 protein_id gnl|my_center|LOCUS_07230 34827 35045 gene locus_tag LOCUS_07240 34827 35045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 35060 35287 gene locus_tag LOCUS_07250 35060 35287 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065315.1 protein_id gnl|my_center|LOCUS_07250 35894 35628 gene locus_tag LOCUS_07260 35894 35628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 36292 35990 gene locus_tag LOCUS_07270 36292 35990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 39183 36868 gene locus_tag LOCUS_07280 39183 36868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 39680 40501 gene locus_tag LOCUS_07290 39680 40501 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870012.1 protein_id gnl|my_center|LOCUS_07290 40554 40627 gene locus_tag LOCUS_t00170 40554 40627 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 40678 41724 gene locus_tag LOCUS_07300 40678 41724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 41702 41974 gene locus_tag LOCUS_07310 41702 41974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 42271 41996 gene locus_tag LOCUS_07320 42271 41996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 42690 42274 gene locus_tag LOCUS_07330 42690 42274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 42908 43294 gene locus_tag LOCUS_07340 42908 43294 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875944.1 protein_id gnl|my_center|LOCUS_07340 43291 43731 gene locus_tag LOCUS_07350 43291 43731 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875943.1 protein_id gnl|my_center|LOCUS_07350 44580 43846 gene locus_tag LOCUS_07360 44580 43846 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064937.1 protein_id gnl|my_center|LOCUS_07360 45212 44610 gene locus_tag LOCUS_07370 45212 44610 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020399.1 protein_id gnl|my_center|LOCUS_07370 46069 45209 gene locus_tag LOCUS_07380 46069 45209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 46151 47074 gene locus_tag LOCUS_07390 46151 47074 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_07390 48341 47067 gene locus_tag LOCUS_07400 48341 47067 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892580.1 protein_id gnl|my_center|LOCUS_07400 48368 49048 gene locus_tag LOCUS_07410 48368 49048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 49054 49965 gene locus_tag LOCUS_07420 49054 49965 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869643.1 protein_id gnl|my_center|LOCUS_07420 50036 50124 gene locus_tag LOCUS_t00180 50036 50124 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 50294 50950 gene locus_tag LOCUS_07430 50294 50950 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990768.1 protein_id gnl|my_center|LOCUS_07430 52161 51004 gene locus_tag LOCUS_07440 52161 51004 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257886.1 protein_id gnl|my_center|LOCUS_07440 53410 52199 gene locus_tag LOCUS_07450 53410 52199 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941437.1 protein_id gnl|my_center|LOCUS_07450 54351 53503 gene locus_tag LOCUS_07460 54351 53503 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929171.1 protein_id gnl|my_center|LOCUS_07460 54450 54803 gene locus_tag LOCUS_07470 54450 54803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 55110 55736 gene locus_tag LOCUS_07480 55110 55736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 57117 55786 gene locus_tag LOCUS_07490 57117 55786 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064814.1 protein_id gnl|my_center|LOCUS_07490 57250 57942 gene locus_tag LOCUS_07500 57250 57942 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023469.1 protein_id gnl|my_center|LOCUS_07500 57939 58238 gene locus_tag LOCUS_07510 57939 58238 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870602.1 protein_id gnl|my_center|LOCUS_07510 58272 59048 gene locus_tag LOCUS_07520 gene cbiQ 58272 59048 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065744.1 protein_id gnl|my_center|LOCUS_07520 59045 60250 gene locus_tag LOCUS_07530 59045 60250 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023466.1 protein_id gnl|my_center|LOCUS_07530 60364 61863 gene locus_tag LOCUS_07540 gene pyk 60364 61863 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066546.1 protein_id gnl|my_center|LOCUS_07540 62085 63035 gene locus_tag LOCUS_07550 62085 63035 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393185.1 protein_id gnl|my_center|LOCUS_07550 63730 63050 gene locus_tag LOCUS_07560 63730 63050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 64353 63805 gene locus_tag LOCUS_07570 64353 63805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 64473 65738 gene locus_tag LOCUS_07580 64473 65738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265931.1 protein_id gnl|my_center|LOCUS_07580 65979 65713 gene locus_tag LOCUS_07590 65979 65713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 66092 66808 gene locus_tag LOCUS_07600 66092 66808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 66900 67739 gene locus_tag LOCUS_07610 66900 67739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 69428 67791 gene locus_tag LOCUS_07620 69428 67791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 69643 70653 gene locus_tag LOCUS_07630 69643 70653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 70763 71689 gene locus_tag LOCUS_07640 70763 71689 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_07640 71901 72071 gene locus_tag LOCUS_07650 71901 72071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 72647 72075 gene locus_tag LOCUS_07660 72647 72075 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020569.1 protein_id gnl|my_center|LOCUS_07660 73654 72644 gene locus_tag LOCUS_07670 73654 72644 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020570.1 protein_id gnl|my_center|LOCUS_07670 74324 73635 gene locus_tag LOCUS_07680 74324 73635 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024140.1 protein_id gnl|my_center|LOCUS_07680 75042 74263 gene locus_tag LOCUS_07690 gene cobJ 75042 74263 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024141.1 protein_id gnl|my_center|LOCUS_07690 75898 75026 gene locus_tag LOCUS_07700 gene cbiG 75898 75026 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903134.1 protein_id gnl|my_center|LOCUS_07700 76611 75895 gene locus_tag LOCUS_07710 76611 75895 CDS product cobalt-precorrin-4/precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024142.1 protein_id gnl|my_center|LOCUS_07710 77221 76604 gene locus_tag LOCUS_07720 77221 76604 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024143.1 protein_id gnl|my_center|LOCUS_07720 77742 77212 gene locus_tag LOCUS_07730 gene cbiT 77742 77212 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024144.1 protein_id gnl|my_center|LOCUS_07730 77933 78109 gene locus_tag LOCUS_07740 77933 78109 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065133.1 protein_id gnl|my_center|LOCUS_07740 78099 79295 gene locus_tag LOCUS_07750 78099 79295 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 protein_id gnl|my_center|LOCUS_07750 79952 79287 gene locus_tag LOCUS_07760 79952 79287 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904055.1 protein_id gnl|my_center|LOCUS_07760 79976 80635 gene locus_tag LOCUS_07770 gene rnhB 79976 80635 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249756.1 protein_id gnl|my_center|LOCUS_07770 80676 82007 gene locus_tag LOCUS_07780 80676 82007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 82865 82098 gene locus_tag LOCUS_07790 82865 82098 CDS product PaeR7I family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176598.1 protein_id gnl|my_center|LOCUS_07790 83793 82879 gene locus_tag LOCUS_07800 83793 82879 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227916.1 protein_id gnl|my_center|LOCUS_07800 85590 84499 gene locus_tag LOCUS_07810 85590 84499 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080738.1 protein_id gnl|my_center|LOCUS_07810 86050 85592 gene locus_tag LOCUS_07820 86050 85592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 86712 86101 gene locus_tag LOCUS_07830 86712 86101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 87719 86745 gene locus_tag LOCUS_07840 87719 86745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 88159 87716 gene locus_tag LOCUS_07850 88159 87716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 89387 88218 gene locus_tag LOCUS_07860 89387 88218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 89957 89655 gene locus_tag LOCUS_07870 89957 89655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 91172 89979 gene locus_tag LOCUS_07880 91172 89979 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064397.1 protein_id gnl|my_center|LOCUS_07880 92391 91192 gene locus_tag LOCUS_07890 92391 91192 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064397.1 protein_id gnl|my_center|LOCUS_07890 93065 92391 gene locus_tag LOCUS_07900 93065 92391 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_07900 94105 93062 gene locus_tag LOCUS_07910 94105 93062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 94329 95951 gene locus_tag LOCUS_07920 94329 95951 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_238581565.1 protein_id gnl|my_center|LOCUS_07920 97286 95967 gene locus_tag LOCUS_07930 97286 95967 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892604.1 protein_id gnl|my_center|LOCUS_07930 98258 97293 gene locus_tag LOCUS_07940 98258 97293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 98417 99163 gene locus_tag LOCUS_07950 98417 99163 CDS product NrpR regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020866.1 protein_id gnl|my_center|LOCUS_07950 99951 99157 gene locus_tag LOCUS_07960 99951 99157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 100016 101302 gene locus_tag LOCUS_07970 100016 101302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 101299 102021 gene locus_tag LOCUS_07980 101299 102021 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020865.1 protein_id gnl|my_center|LOCUS_07980 103413 102517 gene locus_tag LOCUS_07990 103413 102517 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021969.1 protein_id gnl|my_center|LOCUS_07990 103463 104320 gene locus_tag LOCUS_08000 103463 104320 CDS product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022486.1 protein_id gnl|my_center|LOCUS_08000 104317 106269 gene locus_tag LOCUS_08010 104317 106269 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990592.1 protein_id gnl|my_center|LOCUS_08010 106262 107122 gene locus_tag LOCUS_08020 gene thiL 106262 107122 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066048.1 protein_id gnl|my_center|LOCUS_08020 107262 107870 gene locus_tag LOCUS_08030 107262 107870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020530.1 protein_id gnl|my_center|LOCUS_08030 108429 109502 gene locus_tag LOCUS_08040 108429 109502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 110338 109556 gene locus_tag LOCUS_08050 110338 109556 CDS product YhfC family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013710.1 protein_id gnl|my_center|LOCUS_08050 110406 111512 gene locus_tag LOCUS_08060 110406 111512 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081140.1 protein_id gnl|my_center|LOCUS_08060 111954 111484 gene locus_tag LOCUS_08070 111954 111484 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932326.1 protein_id gnl|my_center|LOCUS_08070 112091 113257 gene locus_tag LOCUS_08080 112091 113257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 >Feature sequence07 193 1113 gene locus_tag LOCUS_08090 193 1113 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879724.1 protein_id gnl|my_center|LOCUS_08090 1677 1117 gene locus_tag LOCUS_08100 1677 1117 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023653.1 protein_id gnl|my_center|LOCUS_08100 1775 3709 gene locus_tag LOCUS_08110 1775 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 4295 3669 gene locus_tag LOCUS_08120 4295 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 6159 4678 gene locus_tag LOCUS_08130 6159 4678 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148183489.1 protein_id gnl|my_center|LOCUS_08130 6737 7171 gene locus_tag LOCUS_08140 6737 7171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 8339 7107 gene locus_tag LOCUS_08150 8339 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 9046 8837 gene locus_tag LOCUS_08160 9046 8837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 9127 9396 gene locus_tag LOCUS_08170 9127 9396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 9437 11839 gene locus_tag LOCUS_08180 9437 11839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 11836 12537 gene locus_tag LOCUS_08190 11836 12537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 13438 12554 gene locus_tag LOCUS_08200 13438 12554 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249767.1 protein_id gnl|my_center|LOCUS_08200 15093 13435 gene locus_tag LOCUS_08210 15093 13435 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878252.1 protein_id gnl|my_center|LOCUS_08210 15350 15517 gene locus_tag LOCUS_08220 15350 15517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 16197 15451 gene locus_tag LOCUS_08230 16197 15451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870951.1 protein_id gnl|my_center|LOCUS_08230 17385 16252 gene locus_tag LOCUS_08240 17385 16252 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533192.1 protein_id gnl|my_center|LOCUS_08240 19158 17569 gene locus_tag LOCUS_08250 19158 17569 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080443.1 protein_id gnl|my_center|LOCUS_08250 19406 19873 gene locus_tag LOCUS_08260 19406 19873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 21052 20372 gene locus_tag LOCUS_08270 21052 20372 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023984.1 protein_id gnl|my_center|LOCUS_08270 21275 23074 gene locus_tag LOCUS_08280 21275 23074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 23078 23503 gene locus_tag LOCUS_08290 23078 23503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 23608 24933 gene locus_tag LOCUS_08300 23608 24933 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978370.1 protein_id gnl|my_center|LOCUS_08300 25000 25338 gene locus_tag LOCUS_08310 25000 25338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 25792 25256 gene locus_tag LOCUS_08320 25792 25256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 26156 27400 gene locus_tag LOCUS_08330 26156 27400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 28665 27463 gene locus_tag LOCUS_08340 28665 27463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 31801 28778 gene locus_tag LOCUS_08350 31801 28778 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023457.1 protein_id gnl|my_center|LOCUS_08350 34551 32170 gene locus_tag LOCUS_08360 34551 32170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 35425 34775 gene locus_tag LOCUS_08370 35425 34775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 35653 36090 gene locus_tag LOCUS_08380 35653 36090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 36522 36448 gene locus_tag LOCUS_t00190 36522 36448 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 36661 37635 gene locus_tag LOCUS_08390 36661 37635 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978561.1 protein_id gnl|my_center|LOCUS_08390 38356 37622 gene locus_tag LOCUS_08400 38356 37622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 38450 40444 gene locus_tag LOCUS_08410 gene metG 38450 40444 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878950.1 protein_id gnl|my_center|LOCUS_08410 41565 41490 gene locus_tag LOCUS_t00200 41565 41490 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 42140 41751 gene locus_tag LOCUS_08420 42140 41751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 42871 42146 gene locus_tag LOCUS_08430 42871 42146 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066594.1 protein_id gnl|my_center|LOCUS_08430 42919 43245 gene locus_tag LOCUS_08440 42919 43245 CDS product DUF5611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065922.1 protein_id gnl|my_center|LOCUS_08440 43636 43289 gene locus_tag LOCUS_08450 43636 43289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 46617 43840 gene locus_tag LOCUS_08460 gene leuS 46617 43840 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061305.1 protein_id gnl|my_center|LOCUS_08460 48550 46658 gene locus_tag LOCUS_08470 48550 46658 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020947.1 protein_id gnl|my_center|LOCUS_08470 48939 48574 gene locus_tag LOCUS_08480 gene hisI 48939 48574 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879442.1 protein_id gnl|my_center|LOCUS_08480 49749 48946 gene locus_tag LOCUS_08490 49749 48946 CDS product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020568.1 protein_id gnl|my_center|LOCUS_08490 50121 50759 gene locus_tag LOCUS_08500 50121 50759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 50776 53256 gene locus_tag LOCUS_08510 50776 53256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 53253 54176 gene locus_tag LOCUS_08520 53253 54176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08520 54178 55221 gene locus_tag LOCUS_08530 54178 55221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08530 57216 55726 gene locus_tag LOCUS_08540 57216 55726 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023184.1 protein_id gnl|my_center|LOCUS_08540 57274 58920 gene locus_tag LOCUS_08550 57274 58920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 58962 59267 gene locus_tag LOCUS_08560 gene yciH 58962 59267 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023951.1 protein_id gnl|my_center|LOCUS_08560 59419 59754 gene locus_tag LOCUS_08570 59419 59754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 60019 59759 gene locus_tag LOCUS_08580 60019 59759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 60509 60012 gene locus_tag LOCUS_08590 60509 60012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 60624 61787 gene locus_tag LOCUS_08600 60624 61787 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023078.1 protein_id gnl|my_center|LOCUS_08600 62599 61784 gene locus_tag LOCUS_08610 62599 61784 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878754.1 protein_id gnl|my_center|LOCUS_08610 63111 62641 gene locus_tag LOCUS_08620 63111 62641 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880818.1 protein_id gnl|my_center|LOCUS_08620 63267 63968 gene locus_tag LOCUS_08630 63267 63968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 64014 64292 gene locus_tag LOCUS_08640 64014 64292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 64812 64297 gene locus_tag LOCUS_08650 64812 64297 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020594.1 protein_id gnl|my_center|LOCUS_08650 64726 64914 gene locus_tag LOCUS_08660 64726 64914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 64920 65396 gene locus_tag LOCUS_08670 64920 65396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 65690 67267 gene locus_tag LOCUS_08680 65690 67267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 67427 67242 gene locus_tag LOCUS_08690 67427 67242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 68658 67411 gene locus_tag LOCUS_08700 gene xseA 68658 67411 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393024.1 protein_id gnl|my_center|LOCUS_08700 68698 69522 gene locus_tag LOCUS_08710 68698 69522 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496750.1 protein_id gnl|my_center|LOCUS_08710 69618 70895 gene locus_tag LOCUS_08720 69618 70895 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_08720 70919 71545 gene locus_tag LOCUS_08730 gene purN 70919 71545 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_08730 71616 71933 gene locus_tag LOCUS_08740 71616 71933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 71930 72190 gene locus_tag LOCUS_08750 71930 72190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 72242 72691 gene locus_tag LOCUS_08760 72242 72691 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024008.1 protein_id gnl|my_center|LOCUS_08760 72712 73050 gene locus_tag LOCUS_08770 72712 73050 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877223.1 protein_id gnl|my_center|LOCUS_08770 73050 73640 gene locus_tag LOCUS_08780 73050 73640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496581.1 protein_id gnl|my_center|LOCUS_08780 73818 74081 gene locus_tag LOCUS_08790 73818 74081 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024004.1 protein_id gnl|my_center|LOCUS_08790 74083 74745 gene locus_tag LOCUS_08800 74083 74745 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024003.1 protein_id gnl|my_center|LOCUS_08800 74753 74944 gene locus_tag LOCUS_08810 74753 74944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 74937 75392 gene locus_tag LOCUS_08820 74937 75392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 75395 76462 gene locus_tag LOCUS_08830 gene ftsY 75395 76462 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903840.1 protein_id gnl|my_center|LOCUS_08830 76462 77793 gene locus_tag LOCUS_08840 76462 77793 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024460.1 protein_id gnl|my_center|LOCUS_08840 77790 78359 gene locus_tag LOCUS_08850 gene trmY 77790 78359 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066221.1 protein_id gnl|my_center|LOCUS_08850 78359 79597 gene locus_tag LOCUS_08860 78359 79597 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903457.1 protein_id gnl|my_center|LOCUS_08860 79600 79893 gene locus_tag LOCUS_08870 79600 79893 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021460.1 protein_id gnl|my_center|LOCUS_08870 79915 80265 gene locus_tag LOCUS_08880 79915 80265 CDS product RNA polymerase Rpb4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021458.1 protein_id gnl|my_center|LOCUS_08880 80284 80847 gene locus_tag LOCUS_08890 80284 80847 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879028.1 protein_id gnl|my_center|LOCUS_08890 80844 81620 gene locus_tag LOCUS_08900 80844 81620 CDS product 16S ribosomal RNA methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902839.1 protein_id gnl|my_center|LOCUS_08900 81614 82219 gene locus_tag LOCUS_08910 81614 82219 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021454.1 protein_id gnl|my_center|LOCUS_08910 82349 83029 gene locus_tag LOCUS_08920 82349 83029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 83885 84619 gene locus_tag LOCUS_08930 83885 84619 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021804.1 protein_id gnl|my_center|LOCUS_08930 84825 88154 gene locus_tag LOCUS_08940 84825 88154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 90990 89239 gene locus_tag LOCUS_08950 90990 89239 CDS product 4Fe-4S cluster-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024408.1 protein_id gnl|my_center|LOCUS_08950 91638 90997 gene locus_tag LOCUS_08960 91638 90997 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927082.1 protein_id gnl|my_center|LOCUS_08960 92441 91635 gene locus_tag LOCUS_08970 92441 91635 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065064.1 protein_id gnl|my_center|LOCUS_08970 93544 92435 gene locus_tag LOCUS_08980 93544 92435 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021255.1 protein_id gnl|my_center|LOCUS_08980 94662 93541 gene locus_tag LOCUS_08990 94662 93541 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101420.1 protein_id gnl|my_center|LOCUS_08990 94999 95886 gene locus_tag LOCUS_09000 94999 95886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 95939 96619 gene locus_tag LOCUS_09010 95939 96619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 96960 96787 gene locus_tag LOCUS_09020 96960 96787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 98884 97130 gene locus_tag LOCUS_09030 gene mutL 98884 97130 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732291.1 protein_id gnl|my_center|LOCUS_09030 101502 98881 gene locus_tag LOCUS_09040 gene mutS 101502 98881 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020572.1 protein_id gnl|my_center|LOCUS_09040 101721 102902 gene locus_tag LOCUS_09050 101721 102902 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589524.1 protein_id gnl|my_center|LOCUS_09050 102906 103397 gene locus_tag LOCUS_09060 102906 103397 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020260.1 protein_id gnl|my_center|LOCUS_09060 103382 104503 gene locus_tag LOCUS_09070 103382 104503 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020259.1 protein_id gnl|my_center|LOCUS_09070 105353 104553 gene locus_tag LOCUS_09080 105353 104553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 105270 105485 gene locus_tag LOCUS_09090 105270 105485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 106284 105463 gene locus_tag LOCUS_09100 106284 105463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 107019 106318 gene locus_tag LOCUS_09110 107019 106318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 106966 107256 gene locus_tag LOCUS_09120 106966 107256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 107441 109486 gene locus_tag LOCUS_09130 107441 109486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 109630 110796 gene locus_tag LOCUS_09140 109630 110796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 110885 111253 gene locus_tag LOCUS_09150 110885 111253 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090034.1 protein_id gnl|my_center|LOCUS_09150 111348 111557 gene locus_tag LOCUS_09160 111348 111557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 111640 112119 gene locus_tag LOCUS_09170 111640 112119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 112135 112719 gene locus_tag LOCUS_09180 112135 112719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence08 1996 158 gene locus_tag LOCUS_09190 1996 158 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_09190 2193 2510 gene locus_tag LOCUS_09200 2193 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09200 2471 3016 gene locus_tag LOCUS_09210 2471 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09210 3082 3258 gene locus_tag LOCUS_09220 3082 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 3705 3313 gene locus_tag LOCUS_09230 3705 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 4112 3690 gene locus_tag LOCUS_09240 4112 3690 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879658.1 protein_id gnl|my_center|LOCUS_09240 4567 4253 gene locus_tag LOCUS_09250 4567 4253 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943454.1 protein_id gnl|my_center|LOCUS_09250 5230 4652 gene locus_tag LOCUS_09260 5230 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09260 5334 5870 gene locus_tag LOCUS_09270 5334 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 5935 6297 gene locus_tag LOCUS_09280 5935 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 6981 6544 gene locus_tag LOCUS_09290 6981 6544 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939839.1 protein_id gnl|my_center|LOCUS_09290 7436 7092 gene locus_tag LOCUS_09300 7436 7092 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_09300 7765 7433 gene locus_tag LOCUS_09310 7765 7433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 7971 7899 gene locus_tag LOCUS_t00210 7971 7899 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8783 8052 gene locus_tag LOCUS_09320 8783 8052 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877099.1 protein_id gnl|my_center|LOCUS_09320 8993 9919 gene locus_tag LOCUS_09330 8993 9919 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940313.1 protein_id gnl|my_center|LOCUS_09330 10412 9921 gene locus_tag LOCUS_09340 10412 9921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09340 11006 12037 gene locus_tag LOCUS_09350 gene hypD 11006 12037 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876696.1 protein_id gnl|my_center|LOCUS_09350 12090 12161 gene locus_tag LOCUS_t00220 12090 12161 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13449 12307 gene locus_tag LOCUS_09360 13449 12307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 14581 13433 gene locus_tag LOCUS_09370 14581 13433 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939815.1 protein_id gnl|my_center|LOCUS_09370 16435 14915 gene locus_tag LOCUS_09380 16435 14915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 18431 16644 gene locus_tag LOCUS_09390 18431 16644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 18765 19451 gene locus_tag LOCUS_09400 18765 19451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 20822 19911 gene locus_tag LOCUS_09410 20822 19911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 21914 21675 gene locus_tag LOCUS_09420 21914 21675 CDS product MTH865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060916.1 protein_id gnl|my_center|LOCUS_09420 22208 22948 gene locus_tag LOCUS_09430 22208 22948 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020795.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09430 23092 23490 gene locus_tag LOCUS_09440 23092 23490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 25246 23669 gene locus_tag LOCUS_09450 25246 23669 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021335.1 protein_id gnl|my_center|LOCUS_09450 25993 26472 gene locus_tag LOCUS_09460 25993 26472 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023518.1 protein_id gnl|my_center|LOCUS_09460 26678 27076 gene locus_tag LOCUS_09470 26678 27076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 27506 27192 gene locus_tag LOCUS_09480 27506 27192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 27998 27612 gene locus_tag LOCUS_09490 27998 27612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 28947 28111 gene locus_tag LOCUS_09500 28947 28111 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921011.1 protein_id gnl|my_center|LOCUS_09500 29752 28958 gene locus_tag LOCUS_09510 29752 28958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 29941 30174 gene locus_tag LOCUS_09520 29941 30174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 30256 30906 gene locus_tag LOCUS_09530 30256 30906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 30903 31520 gene locus_tag LOCUS_09540 30903 31520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 33898 31721 gene locus_tag LOCUS_09550 33898 31721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 34314 34616 gene locus_tag LOCUS_09560 34314 34616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 35437 35084 gene locus_tag LOCUS_09570 35437 35084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 36525 35944 gene locus_tag LOCUS_09580 36525 35944 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990826.1 protein_id gnl|my_center|LOCUS_09580 37432 36725 gene locus_tag LOCUS_09590 37432 36725 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878772.1 protein_id gnl|my_center|LOCUS_09590 39236 37593 gene locus_tag LOCUS_09600 39236 37593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 40407 39220 gene locus_tag LOCUS_09610 40407 39220 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020137.1 protein_id gnl|my_center|LOCUS_09610 40964 40572 gene locus_tag LOCUS_09620 gene glxB 40964 40572 CDS product methylglyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243237.1 protein_id gnl|my_center|LOCUS_09620 41186 41464 gene locus_tag LOCUS_09630 41186 41464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 41704 41417 gene locus_tag LOCUS_09640 41704 41417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 41926 42204 gene locus_tag LOCUS_09650 41926 42204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 42850 42638 gene locus_tag LOCUS_09660 42850 42638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 43226 42906 gene locus_tag LOCUS_09670 43226 42906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 43576 43358 gene locus_tag LOCUS_09680 43576 43358 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 protein_id gnl|my_center|LOCUS_09680 44030 45448 gene locus_tag LOCUS_09690 44030 45448 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090936308.1 protein_id gnl|my_center|LOCUS_09690 46563 47174 gene locus_tag LOCUS_09700 46563 47174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 47821 48114 gene locus_tag LOCUS_09710 47821 48114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 48373 48813 gene locus_tag LOCUS_09720 48373 48813 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928468.1 protein_id gnl|my_center|LOCUS_09720 49010 50047 gene locus_tag LOCUS_09730 49010 50047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 50237 50683 gene locus_tag LOCUS_09740 50237 50683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 53946 50959 gene locus_tag LOCUS_09750 53946 50959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 54287 54646 gene locus_tag LOCUS_09760 54287 54646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09760 54775 55341 gene locus_tag LOCUS_09770 54775 55341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09770 55951 55415 gene locus_tag LOCUS_09780 55951 55415 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_09780 56346 56113 gene locus_tag LOCUS_09790 56346 56113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 57963 56761 gene locus_tag LOCUS_09800 57963 56761 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065939.1 protein_id gnl|my_center|LOCUS_09800 58246 58908 gene locus_tag LOCUS_09810 58246 58908 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294685.1 protein_id gnl|my_center|LOCUS_09810 59892 58939 gene locus_tag LOCUS_09820 gene rsgA 59892 58939 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023368.1 protein_id gnl|my_center|LOCUS_09820 60461 60781 gene locus_tag LOCUS_09830 60461 60781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 62808 61024 gene locus_tag LOCUS_09840 62808 61024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 63137 63943 gene locus_tag LOCUS_09850 63137 63943 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065502.1 protein_id gnl|my_center|LOCUS_09850 64444 63971 gene locus_tag LOCUS_09860 64444 63971 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979808.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09860 65741 64677 gene locus_tag LOCUS_09870 65741 64677 CDS product TIGR04083 family peptide-modifying radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023249.1 protein_id gnl|my_center|LOCUS_09870 66087 66689 gene locus_tag LOCUS_09880 66087 66689 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226951.1 protein_id gnl|my_center|LOCUS_09880 66739 67173 gene locus_tag LOCUS_09890 66739 67173 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814175.1 protein_id gnl|my_center|LOCUS_09890 67900 67187 gene locus_tag LOCUS_09900 67900 67187 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023580.1 protein_id gnl|my_center|LOCUS_09900 68274 67789 gene locus_tag LOCUS_09910 68274 67789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 70559 68457 gene locus_tag LOCUS_09920 70559 68457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 70823 71677 gene locus_tag LOCUS_09930 70823 71677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 73666 71741 gene locus_tag LOCUS_09940 73666 71741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 75009 73702 gene locus_tag LOCUS_09950 75009 73702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 76489 75179 gene locus_tag LOCUS_09960 76489 75179 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860110.1 protein_id gnl|my_center|LOCUS_09960 76547 76864 gene locus_tag LOCUS_09970 76547 76864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 77387 76797 gene locus_tag LOCUS_09980 77387 76797 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020434.1 protein_id gnl|my_center|LOCUS_09980 77694 78005 gene locus_tag LOCUS_09990 77694 78005 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943454.1 protein_id gnl|my_center|LOCUS_09990 78414 78815 gene locus_tag LOCUS_10000 78414 78815 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023551.1 protein_id gnl|my_center|LOCUS_10000 79203 78940 gene locus_tag LOCUS_10010 79203 78940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 80374 79289 gene locus_tag LOCUS_10020 80374 79289 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066378.1 protein_id gnl|my_center|LOCUS_10020 80684 81412 gene locus_tag LOCUS_10030 80684 81412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 82334 81690 gene locus_tag LOCUS_10040 82334 81690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 83257 82340 gene locus_tag LOCUS_10050 83257 82340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 84163 83438 gene locus_tag LOCUS_10060 84163 83438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 84581 84255 gene locus_tag LOCUS_10070 84581 84255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 84973 84584 gene locus_tag LOCUS_10080 84973 84584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 85060 85245 gene locus_tag LOCUS_10090 85060 85245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 85728 85438 gene locus_tag LOCUS_10100 85728 85438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 86285 85725 gene locus_tag LOCUS_10110 86285 85725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 87583 86591 gene locus_tag LOCUS_10120 87583 86591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 88311 87856 gene locus_tag LOCUS_10130 88311 87856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 91178 88308 gene locus_tag LOCUS_10140 91178 88308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 91630 91355 gene locus_tag LOCUS_10150 91630 91355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 91832 91599 gene locus_tag LOCUS_10160 91832 91599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 92127 93119 gene locus_tag LOCUS_10170 92127 93119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 94314 93124 gene locus_tag LOCUS_10180 94314 93124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 94956 96059 gene locus_tag LOCUS_10190 94956 96059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10190 97086 96280 gene locus_tag LOCUS_10200 97086 96280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 97454 99139 gene locus_tag LOCUS_10210 97454 99139 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023304.1 protein_id gnl|my_center|LOCUS_10210 99254 100021 gene locus_tag LOCUS_10220 99254 100021 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021582.1 protein_id gnl|my_center|LOCUS_10220 100875 100108 gene locus_tag LOCUS_10230 100875 100108 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202917.1 protein_id gnl|my_center|LOCUS_10230 102220 101012 gene locus_tag LOCUS_10240 102220 101012 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022271.1 protein_id gnl|my_center|LOCUS_10240 102839 102261 gene locus_tag LOCUS_10250 102839 102261 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020425.1 protein_id gnl|my_center|LOCUS_10250 103076 103522 gene locus_tag LOCUS_10260 103076 103522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024361.1 protein_id gnl|my_center|LOCUS_10260 103519 104124 gene locus_tag LOCUS_10270 103519 104124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 104121 104822 gene locus_tag LOCUS_10280 104121 104822 CDS product DUF1673 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860405.1 protein_id gnl|my_center|LOCUS_10280 104822 105307 gene locus_tag LOCUS_10290 104822 105307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 105298 106041 gene locus_tag LOCUS_10300 105298 106041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 106150 106968 gene locus_tag LOCUS_10310 106150 106968 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065769.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence09 1348 425 gene locus_tag LOCUS_10320 1348 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1588 2052 gene locus_tag LOCUS_10330 1588 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 2743 2291 gene locus_tag LOCUS_10340 2743 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 3032 4210 gene locus_tag LOCUS_10350 3032 4210 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_10350 4262 4924 gene locus_tag LOCUS_10360 4262 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 5622 5059 gene locus_tag LOCUS_10370 5622 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 5979 5626 gene locus_tag LOCUS_10380 5979 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 6100 5963 gene locus_tag LOCUS_10390 6100 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 7518 6307 gene locus_tag LOCUS_10400 7518 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10400 8774 7407 gene locus_tag LOCUS_10410 8774 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 8975 11629 gene locus_tag LOCUS_10420 8975 11629 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461688.1 protein_id gnl|my_center|LOCUS_10420 11802 13919 gene locus_tag LOCUS_10430 11802 13919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 13957 14346 gene locus_tag LOCUS_10440 13957 14346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 14782 14441 gene locus_tag LOCUS_10450 14782 14441 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546264.1 protein_id gnl|my_center|LOCUS_10450 15167 14775 gene locus_tag LOCUS_10460 15167 14775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 15465 15154 gene locus_tag LOCUS_10470 15465 15154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 18790 15542 gene locus_tag LOCUS_10480 18790 15542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 21869 18777 gene locus_tag LOCUS_10490 21869 18777 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839231.1 protein_id gnl|my_center|LOCUS_10490 22220 22987 gene locus_tag LOCUS_10500 22220 22987 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 protein_id gnl|my_center|LOCUS_10500 23225 23644 gene locus_tag LOCUS_10510 23225 23644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 23871 24728 gene locus_tag LOCUS_10520 23871 24728 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022650.1 protein_id gnl|my_center|LOCUS_10520 25778 24822 gene locus_tag LOCUS_10530 25778 24822 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021342.1 protein_id gnl|my_center|LOCUS_10530 26021 26602 gene locus_tag LOCUS_10540 26021 26602 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023254.1 protein_id gnl|my_center|LOCUS_10540 26683 27534 gene locus_tag LOCUS_10550 26683 27534 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021378.1 protein_id gnl|my_center|LOCUS_10550 28282 30207 gene locus_tag LOCUS_10560 28282 30207 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066516.1 protein_id gnl|my_center|LOCUS_10560 30725 30321 gene locus_tag LOCUS_10570 gene tsaA 30725 30321 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877752.1 protein_id gnl|my_center|LOCUS_10570 31792 30866 gene locus_tag LOCUS_10580 31792 30866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 32705 31875 gene locus_tag LOCUS_10590 gene sitD 32705 31875 CDS product iron/manganese ABC transporter permease subunit SitD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968135.1 protein_id gnl|my_center|LOCUS_10590 33447 32698 gene locus_tag LOCUS_10600 gene mntB 33447 32698 CDS product manganese ABC transporter ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398644.1 protein_id gnl|my_center|LOCUS_10600 33897 33454 gene locus_tag LOCUS_10610 33897 33454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 33995 34717 gene locus_tag LOCUS_10620 33995 34717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 34885 35643 gene locus_tag LOCUS_10630 34885 35643 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022734.1 protein_id gnl|my_center|LOCUS_10630 35886 36995 gene locus_tag LOCUS_10640 35886 36995 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368910.1 protein_id gnl|my_center|LOCUS_10640 37126 37929 gene locus_tag LOCUS_10650 37126 37929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 39390 38029 gene locus_tag LOCUS_10660 39390 38029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 41605 39686 gene locus_tag LOCUS_10670 41605 39686 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403165.1 protein_id gnl|my_center|LOCUS_10670 43028 41613 gene locus_tag LOCUS_10680 43028 41613 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772424.1 protein_id gnl|my_center|LOCUS_10680 43528 44889 gene locus_tag LOCUS_10690 43528 44889 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_10690 44968 45981 gene locus_tag LOCUS_10700 gene gap 44968 45981 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_10700 46022 48469 gene locus_tag LOCUS_10710 gene ppsA 46022 48469 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022627.1 protein_id gnl|my_center|LOCUS_10710 50924 48480 gene locus_tag LOCUS_10720 50924 48480 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065180.1 protein_id gnl|my_center|LOCUS_10720 51205 52977 gene locus_tag LOCUS_10730 gene glgP 51205 52977 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021875.1 protein_id gnl|my_center|LOCUS_10730 54440 53028 gene locus_tag LOCUS_10740 54440 53028 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876185.1 protein_id gnl|my_center|LOCUS_10740 54781 54449 gene locus_tag LOCUS_10750 54781 54449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 54747 54974 gene locus_tag LOCUS_10760 54747 54974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 55793 55245 gene locus_tag LOCUS_10770 55793 55245 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140452.1 protein_id gnl|my_center|LOCUS_10770 57344 56307 gene locus_tag LOCUS_10780 57344 56307 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065828.1 protein_id gnl|my_center|LOCUS_10780 58458 57352 gene locus_tag LOCUS_10790 58458 57352 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021402.1 protein_id gnl|my_center|LOCUS_10790 59100 58468 gene locus_tag LOCUS_10800 gene hxlB 59100 58468 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065105.1 protein_id gnl|my_center|LOCUS_10800 59599 62226 gene locus_tag LOCUS_10810 59599 62226 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877404.1 protein_id gnl|my_center|LOCUS_10810 62223 62939 gene locus_tag LOCUS_10820 62223 62939 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892488.1 protein_id gnl|my_center|LOCUS_10820 62990 64144 gene locus_tag LOCUS_10830 62990 64144 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_10830 64724 64125 gene locus_tag LOCUS_10840 64724 64125 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459927.1 protein_id gnl|my_center|LOCUS_10840 65863 65204 gene locus_tag LOCUS_10850 65863 65204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 68600 65856 gene locus_tag LOCUS_10860 gene alaS 68600 65856 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020252.1 protein_id gnl|my_center|LOCUS_10860 68979 68662 gene locus_tag LOCUS_10870 68979 68662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 69686 68976 gene locus_tag LOCUS_10880 69686 68976 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022780.1 protein_id gnl|my_center|LOCUS_10880 69904 71199 gene locus_tag LOCUS_10890 69904 71199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 71368 72876 gene locus_tag LOCUS_10900 71368 72876 CDS product L-aspartate semialdehyde sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021823.1 protein_id gnl|my_center|LOCUS_10900 72873 73271 gene locus_tag LOCUS_10910 72873 73271 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065229.1 protein_id gnl|my_center|LOCUS_10910 73268 73984 gene locus_tag LOCUS_10920 73268 73984 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021719.1 protein_id gnl|my_center|LOCUS_10920 74680 74444 gene locus_tag LOCUS_10930 74680 74444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 75924 74683 gene locus_tag LOCUS_10940 75924 74683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 76069 76944 gene locus_tag LOCUS_10950 76069 76944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 77182 78093 gene locus_tag LOCUS_10960 77182 78093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 78691 79587 gene locus_tag LOCUS_10970 78691 79587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 79645 81108 gene locus_tag LOCUS_10980 79645 81108 CDS product thioredoxin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073595568.1 protein_id gnl|my_center|LOCUS_10980 81204 81809 gene locus_tag LOCUS_10990 81204 81809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 82102 85881 gene locus_tag LOCUS_11000 82102 85881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 86437 87321 gene locus_tag LOCUS_11010 86437 87321 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942258.1 protein_id gnl|my_center|LOCUS_11010 87371 88276 gene locus_tag LOCUS_11020 87371 88276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 88717 88292 gene locus_tag LOCUS_11030 88717 88292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 89233 88808 gene locus_tag LOCUS_11040 89233 88808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 89809 89375 gene locus_tag LOCUS_11050 89809 89375 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929440.1 protein_id gnl|my_center|LOCUS_11050 90357 89914 gene locus_tag LOCUS_11060 90357 89914 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142147.1 protein_id gnl|my_center|LOCUS_11060 91115 90546 gene locus_tag LOCUS_11070 91115 90546 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020740.1 protein_id gnl|my_center|LOCUS_11070 91885 91103 gene locus_tag LOCUS_11080 91885 91103 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020739.1 protein_id gnl|my_center|LOCUS_11080 93035 91896 gene locus_tag LOCUS_11090 93035 91896 CDS product methanogenesis marker 9 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020738.1 protein_id gnl|my_center|LOCUS_11090 93529 93032 gene locus_tag LOCUS_11100 93529 93032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020868.1 protein_id gnl|my_center|LOCUS_11100 93605 94012 gene locus_tag LOCUS_11110 gene cfbA 93605 94012 CDS product sirohydrochlorin nickelochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023539.1 protein_id gnl|my_center|LOCUS_11110 94018 95172 gene locus_tag LOCUS_11120 gene cfbE 94018 95172 CDS product coenzyme F430 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023538.1 protein_id gnl|my_center|LOCUS_11120 95177 96241 gene locus_tag LOCUS_11130 gene cfbD 95177 96241 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023536.1 protein_id gnl|my_center|LOCUS_11130 96238 97608 gene locus_tag LOCUS_11140 gene cfbB 96238 97608 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023534.1 protein_id gnl|my_center|LOCUS_11140 97849 98931 gene locus_tag LOCUS_11150 97849 98931 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023790.1 protein_id gnl|my_center|LOCUS_11150 99021 99302 gene locus_tag LOCUS_11160 99021 99302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 99529 99729 gene locus_tag LOCUS_11170 99529 99729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 99689 101110 gene locus_tag LOCUS_11180 99689 101110 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023126.1 protein_id gnl|my_center|LOCUS_11180 102660 101131 gene locus_tag LOCUS_11190 102660 101131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 104455 103007 gene locus_tag LOCUS_11200 104455 103007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 >Feature sequence10 1714 476 gene locus_tag LOCUS_11210 gene pan 1714 476 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879468.1 protein_id gnl|my_center|LOCUS_11210 1974 2261 gene locus_tag LOCUS_11220 1974 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11220 2574 3365 gene locus_tag LOCUS_11230 2574 3365 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876218.1 protein_id gnl|my_center|LOCUS_11230 3365 4156 gene locus_tag LOCUS_11240 3365 4156 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877622.1 protein_id gnl|my_center|LOCUS_11240 4153 5139 gene locus_tag LOCUS_11250 4153 5139 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881255.1 protein_id gnl|my_center|LOCUS_11250 5145 5969 gene locus_tag LOCUS_11260 5145 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 5966 6760 gene locus_tag LOCUS_11270 gene pheA 5966 6760 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060994.1 protein_id gnl|my_center|LOCUS_11270 6757 8025 gene locus_tag LOCUS_11280 gene aroA 6757 8025 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171024.1 protein_id gnl|my_center|LOCUS_11280 8022 9386 gene locus_tag LOCUS_11290 8022 9386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 9383 10384 gene locus_tag LOCUS_11300 gene aroC 9383 10384 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918475.1 protein_id gnl|my_center|LOCUS_11300 11579 10950 gene locus_tag LOCUS_11310 11579 10950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 12459 11659 gene locus_tag LOCUS_11320 gene proC 12459 11659 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931771.1 protein_id gnl|my_center|LOCUS_11320 12558 15086 gene locus_tag LOCUS_11330 12558 15086 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877365.1 protein_id gnl|my_center|LOCUS_11330 15643 16344 gene locus_tag LOCUS_11340 gene tpiA 15643 16344 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251079.1 protein_id gnl|my_center|LOCUS_11340 16857 16348 gene locus_tag LOCUS_11350 16857 16348 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021817.1 protein_id gnl|my_center|LOCUS_11350 17049 17309 gene locus_tag LOCUS_11360 17049 17309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 17736 18407 gene locus_tag LOCUS_11370 17736 18407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11370 18640 19785 gene locus_tag LOCUS_11380 18640 19785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 20160 20819 gene locus_tag LOCUS_11390 20160 20819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 21173 22279 gene locus_tag LOCUS_11400 21173 22279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 24597 23047 gene locus_tag LOCUS_11410 24597 23047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 25821 26396 gene locus_tag LOCUS_11420 25821 26396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 26426 26992 gene locus_tag LOCUS_11430 26426 26992 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879461.1 protein_id gnl|my_center|LOCUS_11430 26998 28449 gene locus_tag LOCUS_11440 gene tgtA 26998 28449 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024298.1 protein_id gnl|my_center|LOCUS_11440 28436 30073 gene locus_tag LOCUS_11450 gene arcS 28436 30073 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024500.1 protein_id gnl|my_center|LOCUS_11450 30381 30166 gene locus_tag LOCUS_11460 30381 30166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 30976 30653 gene locus_tag LOCUS_11470 30976 30653 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878370.1 protein_id gnl|my_center|LOCUS_11470 31156 30980 gene locus_tag LOCUS_11480 31156 30980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 31346 32197 gene locus_tag LOCUS_11490 31346 32197 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932161.1 protein_id gnl|my_center|LOCUS_11490 32190 33533 gene locus_tag LOCUS_11500 gene gltA 32190 33533 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023687.1 protein_id gnl|my_center|LOCUS_11500 34179 33805 gene locus_tag LOCUS_11510 34179 33805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 35659 34655 gene locus_tag LOCUS_11520 35659 34655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 36028 35732 gene locus_tag LOCUS_11530 36028 35732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 37010 36060 gene locus_tag LOCUS_11540 37010 36060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 38130 37567 gene locus_tag LOCUS_11550 38130 37567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 38653 38225 gene locus_tag LOCUS_11560 38653 38225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 38549 38818 gene locus_tag LOCUS_11570 38549 38818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 40100 38877 gene locus_tag LOCUS_11580 40100 38877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 40821 40114 gene locus_tag LOCUS_11590 40821 40114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 41306 41998 gene locus_tag LOCUS_11600 41306 41998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 42876 42103 gene locus_tag LOCUS_11610 42876 42103 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990796.1 protein_id gnl|my_center|LOCUS_11610 43415 42960 gene locus_tag LOCUS_11620 43415 42960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 44181 44861 gene locus_tag LOCUS_11630 44181 44861 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878933.1 protein_id gnl|my_center|LOCUS_11630 44858 45688 gene locus_tag LOCUS_11640 44858 45688 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544947.1 protein_id gnl|my_center|LOCUS_11640 45891 47372 gene locus_tag LOCUS_11650 45891 47372 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_11650 47606 48103 gene locus_tag LOCUS_11660 47606 48103 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064833.1 protein_id gnl|my_center|LOCUS_11660 48470 49849 gene locus_tag LOCUS_11670 48470 49849 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_11670 52160 49860 gene locus_tag LOCUS_11680 gene ldcA 52160 49860 CDS product lysine-specific pyridoxal 5'-phosphate-dependent carboxylase LdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113592.1 protein_id gnl|my_center|LOCUS_11680 53051 52233 gene locus_tag LOCUS_11690 53051 52233 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020826.1 protein_id gnl|my_center|LOCUS_11690 53288 54730 gene locus_tag LOCUS_11700 53288 54730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 54712 55866 gene locus_tag LOCUS_11710 54712 55866 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065374.1 protein_id gnl|my_center|LOCUS_11710 55863 57821 gene locus_tag LOCUS_11720 gene glgB 55863 57821 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_11720 57824 60205 gene locus_tag LOCUS_11730 57824 60205 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257049.1 protein_id gnl|my_center|LOCUS_11730 60219 61715 gene locus_tag LOCUS_11740 gene malQ 60219 61715 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940406.1 protein_id gnl|my_center|LOCUS_11740 62084 61749 gene locus_tag LOCUS_11750 62084 61749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 62464 63708 gene locus_tag LOCUS_11760 62464 63708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11760 63636 64697 gene locus_tag LOCUS_11770 63636 64697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11770 65097 64738 gene locus_tag LOCUS_11780 65097 64738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 65834 65358 gene locus_tag LOCUS_11790 65834 65358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 66728 65979 gene locus_tag LOCUS_11800 66728 65979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 67219 66791 gene locus_tag LOCUS_11810 67219 66791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 67624 68205 gene locus_tag LOCUS_11820 67624 68205 CDS product DUF2121 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022290.1 protein_id gnl|my_center|LOCUS_11820 68484 68269 gene locus_tag LOCUS_11830 68484 68269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 69096 69356 gene locus_tag LOCUS_11840 69096 69356 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_11840 69738 69992 gene locus_tag LOCUS_11850 69738 69992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 70155 70069 gene locus_tag LOCUS_t00230 70155 70069 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 71944 70241 gene locus_tag LOCUS_11860 71944 70241 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939525.1 protein_id gnl|my_center|LOCUS_11860 72073 72627 gene locus_tag LOCUS_11870 72073 72627 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903666.1 protein_id gnl|my_center|LOCUS_11870 75637 72977 gene locus_tag LOCUS_11880 75637 72977 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020807.1 protein_id gnl|my_center|LOCUS_11880 76388 75654 gene locus_tag LOCUS_11890 76388 75654 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020802.1 protein_id gnl|my_center|LOCUS_11890 77217 76396 gene locus_tag LOCUS_11900 77217 76396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 77333 78307 gene locus_tag LOCUS_11910 77333 78307 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_11910 78318 81497 gene locus_tag LOCUS_11920 78318 81497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 81785 81588 gene locus_tag LOCUS_11930 81785 81588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 82016 81882 gene locus_tag LOCUS_11940 82016 81882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 82578 81982 gene locus_tag LOCUS_11950 82578 81982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 83124 84428 gene locus_tag LOCUS_11960 83124 84428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 84438 85298 gene locus_tag LOCUS_11970 84438 85298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 85933 86880 gene locus_tag LOCUS_11980 85933 86880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 87249 87842 gene locus_tag LOCUS_11990 87249 87842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 87908 88138 gene locus_tag LOCUS_12000 87908 88138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 88406 88759 gene locus_tag LOCUS_12010 88406 88759 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020176.1 protein_id gnl|my_center|LOCUS_12010 88731 89561 gene locus_tag LOCUS_12020 88731 89561 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024147.1 protein_id gnl|my_center|LOCUS_12020 89607 89900 gene locus_tag LOCUS_12030 89607 89900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 89904 90947 gene locus_tag LOCUS_12040 89904 90947 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320030.1 protein_id gnl|my_center|LOCUS_12040 90953 91822 gene locus_tag LOCUS_12050 90953 91822 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060988.1 protein_id gnl|my_center|LOCUS_12050 91819 92949 gene locus_tag LOCUS_12060 gene coaBC 91819 92949 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065075.1 protein_id gnl|my_center|LOCUS_12060 92931 93773 gene locus_tag LOCUS_12070 92931 93773 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902142.1 protein_id gnl|my_center|LOCUS_12070 93770 94501 gene locus_tag LOCUS_12080 93770 94501 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021299.1 protein_id gnl|my_center|LOCUS_12080 94488 95498 gene locus_tag LOCUS_12090 94488 95498 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064821.1 protein_id gnl|my_center|LOCUS_12090 95473 96189 gene locus_tag LOCUS_12100 95473 96189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 96319 96861 gene locus_tag LOCUS_12110 96319 96861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 97101 98429 gene locus_tag LOCUS_12120 97101 98429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 98781 100064 gene locus_tag LOCUS_12130 98781 100064 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048040655.1 protein_id gnl|my_center|LOCUS_12130 101599 100271 gene locus_tag LOCUS_12140 101599 100271 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066157.1 protein_id gnl|my_center|LOCUS_12140 101686 102486 gene locus_tag LOCUS_12150 gene thiD 101686 102486 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228119.1 protein_id gnl|my_center|LOCUS_12150 102688 103119 gene locus_tag LOCUS_12160 gene lrp 102688 103119 CDS product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705740.1 protein_id gnl|my_center|LOCUS_12160 103140 103403 gene locus_tag LOCUS_12170 103140 103403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 103405 103866 gene locus_tag LOCUS_12180 103405 103866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 104029 104556 gene locus_tag LOCUS_12190 104029 104556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence11 286 729 gene locus_tag LOCUS_12200 286 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 726 1436 gene locus_tag LOCUS_12210 gene cobS 726 1436 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496830.1 protein_id gnl|my_center|LOCUS_12210 1474 2364 gene locus_tag LOCUS_12220 1474 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 3191 2376 gene locus_tag LOCUS_12230 3191 2376 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249696.1 protein_id gnl|my_center|LOCUS_12230 4642 3188 gene locus_tag LOCUS_12240 4642 3188 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392966.1 protein_id gnl|my_center|LOCUS_12240 5186 4632 gene locus_tag LOCUS_12250 5186 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 5977 5183 gene locus_tag LOCUS_12260 5977 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 6684 5980 gene locus_tag LOCUS_12270 6684 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 8277 6826 gene locus_tag LOCUS_12280 8277 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 9203 8274 gene locus_tag LOCUS_12290 9203 8274 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948543.1 protein_id gnl|my_center|LOCUS_12290 10091 9204 gene locus_tag LOCUS_12300 10091 9204 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_12300 11089 10094 gene locus_tag LOCUS_12310 11089 10094 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761573.1 protein_id gnl|my_center|LOCUS_12310 11612 12364 gene locus_tag LOCUS_12320 11612 12364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 12588 19610 gene locus_tag LOCUS_12330 12588 19610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 19719 23045 gene locus_tag LOCUS_12340 19719 23045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 23505 23203 gene locus_tag LOCUS_12350 23505 23203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 23684 24961 gene locus_tag LOCUS_12360 gene tuf 23684 24961 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021277.1 protein_id gnl|my_center|LOCUS_12360 24993 25301 gene locus_tag LOCUS_12370 gene rpsJ 24993 25301 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021276.1 protein_id gnl|my_center|LOCUS_12370 25314 26996 gene locus_tag LOCUS_12380 25314 26996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 28561 27473 gene locus_tag LOCUS_12390 28561 27473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 29737 28571 gene locus_tag LOCUS_12400 29737 28571 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064350.1 protein_id gnl|my_center|LOCUS_12400 29852 31084 gene locus_tag LOCUS_12410 29852 31084 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023973.1 protein_id gnl|my_center|LOCUS_12410 31077 31796 gene locus_tag LOCUS_12420 31077 31796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12420 31780 32760 gene locus_tag LOCUS_12430 31780 32760 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065794.1 protein_id gnl|my_center|LOCUS_12430 32750 34750 gene locus_tag LOCUS_12440 32750 34750 CDS product DUF2298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065896.1 protein_id gnl|my_center|LOCUS_12440 34933 35301 gene locus_tag LOCUS_12450 gene rpl7ae 34933 35301 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053601.1 protein_id gnl|my_center|LOCUS_12450 35312 35521 gene locus_tag LOCUS_12460 35312 35521 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065141.1 protein_id gnl|my_center|LOCUS_12460 35524 35715 gene locus_tag LOCUS_12470 35524 35715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 35721 36170 gene locus_tag LOCUS_12480 gene ndk 35721 36170 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_12480 36974 37627 gene locus_tag LOCUS_12490 36974 37627 CDS product NAAT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871201.1 protein_id gnl|my_center|LOCUS_12490 37624 37824 gene locus_tag LOCUS_12500 37624 37824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 37827 38624 gene locus_tag LOCUS_12510 37827 38624 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975129.1 protein_id gnl|my_center|LOCUS_12510 38634 39380 gene locus_tag LOCUS_12520 38634 39380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 39442 40647 gene locus_tag LOCUS_12530 gene thrC 39442 40647 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021620.1 protein_id gnl|my_center|LOCUS_12530 40587 41201 gene locus_tag LOCUS_12540 40587 41201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 41198 41773 gene locus_tag LOCUS_12550 41198 41773 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583025.1 protein_id gnl|my_center|LOCUS_12550 42656 41748 gene locus_tag LOCUS_12560 gene porB 42656 41748 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020090.1 protein_id gnl|my_center|LOCUS_12560 43811 42657 gene locus_tag LOCUS_12570 gene porA 43811 42657 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877345.1 protein_id gnl|my_center|LOCUS_12570 44071 43811 gene locus_tag LOCUS_12580 gene porD 44071 43811 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020092.1 protein_id gnl|my_center|LOCUS_12580 44574 44071 gene locus_tag LOCUS_12590 44574 44071 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_12590 45372 44755 gene locus_tag LOCUS_12600 45372 44755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 46345 45473 gene locus_tag LOCUS_12610 46345 45473 CDS product methanogenesis marker 12 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023754.1 protein_id gnl|my_center|LOCUS_12610 47284 46412 gene locus_tag LOCUS_12620 47284 46412 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330368.1 protein_id gnl|my_center|LOCUS_12620 47719 48651 gene locus_tag LOCUS_12630 47719 48651 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877868.1 protein_id gnl|my_center|LOCUS_12630 48715 49869 gene locus_tag LOCUS_12640 48715 49869 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060815.1 protein_id gnl|my_center|LOCUS_12640 49936 51489 gene locus_tag LOCUS_12650 49936 51489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 51788 52789 gene locus_tag LOCUS_12660 51788 52789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 53387 55564 gene locus_tag LOCUS_12670 53387 55564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 56100 57695 gene locus_tag LOCUS_12680 56100 57695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 57886 59817 gene locus_tag LOCUS_12690 57886 59817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 60704 59895 gene locus_tag LOCUS_12700 60704 59895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 60999 60739 gene locus_tag LOCUS_12710 60999 60739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 61627 63126 gene locus_tag LOCUS_12720 61627 63126 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066597.1 protein_id gnl|my_center|LOCUS_12720 64155 63238 gene locus_tag LOCUS_12730 64155 63238 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020209.1 protein_id gnl|my_center|LOCUS_12730 66128 64359 gene locus_tag LOCUS_12740 66128 64359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 67496 66471 gene locus_tag LOCUS_12750 67496 66471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 68645 67596 gene locus_tag LOCUS_12760 68645 67596 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020371.1 protein_id gnl|my_center|LOCUS_12760 69695 68646 gene locus_tag LOCUS_12770 69695 68646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 71322 70075 gene locus_tag LOCUS_12780 71322 70075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 72419 71706 gene locus_tag LOCUS_12790 72419 71706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 73963 73019 gene locus_tag LOCUS_12800 73963 73019 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990845.1 protein_id gnl|my_center|LOCUS_12800 74914 73979 gene locus_tag LOCUS_12810 gene galU 74914 73979 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065994.1 protein_id gnl|my_center|LOCUS_12810 76179 74911 gene locus_tag LOCUS_12820 76179 74911 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064256.1 protein_id gnl|my_center|LOCUS_12820 78299 76206 gene locus_tag LOCUS_12830 78299 76206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 79784 80851 gene locus_tag LOCUS_12840 79784 80851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 80862 82097 gene locus_tag LOCUS_12850 80862 82097 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296321.1 protein_id gnl|my_center|LOCUS_12850 84288 82831 gene locus_tag LOCUS_12860 84288 82831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 84833 86008 gene locus_tag LOCUS_12870 84833 86008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 86204 88411 gene locus_tag LOCUS_12880 86204 88411 CDS product DUF2206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021084.1 protein_id gnl|my_center|LOCUS_12880 89679 88438 gene locus_tag LOCUS_12890 89679 88438 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147032.1 protein_id gnl|my_center|LOCUS_12890 92524 89933 gene locus_tag LOCUS_12900 92524 89933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 94654 92999 gene locus_tag LOCUS_12910 94654 92999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 96532 94994 gene locus_tag LOCUS_12920 96532 94994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 96842 97420 gene locus_tag LOCUS_12930 96842 97420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 97495 98640 gene locus_tag LOCUS_12940 97495 98640 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903688.1 protein_id gnl|my_center|LOCUS_12940 98687 99634 gene locus_tag LOCUS_12950 gene mch 98687 99634 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879428.1 protein_id gnl|my_center|LOCUS_12950 99804 100280 gene locus_tag LOCUS_12960 99804 100280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 100390 100463 gene locus_tag LOCUS_t00240 100390 100463 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 101500 100697 gene locus_tag LOCUS_12970 101500 100697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 102167 101934 gene locus_tag LOCUS_12980 102167 101934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence12 490 1893 gene locus_tag LOCUS_12990 490 1893 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021194.1 protein_id gnl|my_center|LOCUS_12990 1952 2446 gene locus_tag LOCUS_13000 gene moaC 1952 2446 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249309.1 protein_id gnl|my_center|LOCUS_13000 2574 3164 gene locus_tag LOCUS_13010 2574 3164 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021787.1 protein_id gnl|my_center|LOCUS_13010 3195 3839 gene locus_tag LOCUS_13020 3195 3839 CDS product RNase P subunit p30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289302.1 protein_id gnl|my_center|LOCUS_13020 3836 4318 gene locus_tag LOCUS_13030 3836 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 4318 5040 gene locus_tag LOCUS_13040 gene psmA 4318 5040 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_13040 5050 5754 gene locus_tag LOCUS_13050 5050 5754 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021781.1 protein_id gnl|my_center|LOCUS_13050 5810 6100 gene locus_tag LOCUS_13060 5810 6100 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289127.1 protein_id gnl|my_center|LOCUS_13060 6235 6639 gene locus_tag LOCUS_13070 6235 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 6639 6890 gene locus_tag LOCUS_13080 6639 6890 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021744.1 protein_id gnl|my_center|LOCUS_13080 7058 7423 gene locus_tag LOCUS_13090 7058 7423 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496690.1 protein_id gnl|my_center|LOCUS_13090 8741 7470 gene locus_tag LOCUS_13100 8741 7470 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024485.1 protein_id gnl|my_center|LOCUS_13100 8703 8918 gene locus_tag LOCUS_13110 8703 8918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 9355 9939 gene locus_tag LOCUS_13120 9355 9939 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477468.1 protein_id gnl|my_center|LOCUS_13120 10423 10498 gene locus_tag LOCUS_t00250 10423 10498 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 10942 11463 gene locus_tag LOCUS_13130 10942 11463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 12188 11460 gene locus_tag LOCUS_13140 12188 11460 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525286.1 protein_id gnl|my_center|LOCUS_13140 13186 12248 gene locus_tag LOCUS_13150 13186 12248 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_13150 13395 14300 gene locus_tag LOCUS_13160 13395 14300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 14284 14871 gene locus_tag LOCUS_13170 14284 14871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 14927 15373 gene locus_tag LOCUS_13180 14927 15373 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 protein_id gnl|my_center|LOCUS_13180 15931 15347 gene locus_tag LOCUS_13190 15931 15347 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903531.1 protein_id gnl|my_center|LOCUS_13190 15971 16897 gene locus_tag LOCUS_13200 gene aglJ 15971 16897 CDS product S-layer glycoprotein N-glycosyltransferase AglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024210.1 protein_id gnl|my_center|LOCUS_13200 17410 16868 gene locus_tag LOCUS_13210 17410 16868 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251082.1 protein_id gnl|my_center|LOCUS_13210 18805 18155 gene locus_tag LOCUS_13220 gene npdG 18805 18155 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903948.1 protein_id gnl|my_center|LOCUS_13220 19071 18802 gene locus_tag LOCUS_13230 gene trxA 19071 18802 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065637.1 protein_id gnl|my_center|LOCUS_13230 20610 19150 gene locus_tag LOCUS_13240 20610 19150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 21461 20607 gene locus_tag LOCUS_13250 21461 20607 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020197.1 protein_id gnl|my_center|LOCUS_13250 21845 22159 gene locus_tag LOCUS_13260 21845 22159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 22214 22483 gene locus_tag LOCUS_13270 22214 22483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020351.1 protein_id gnl|my_center|LOCUS_13270 22487 22894 gene locus_tag LOCUS_13280 22487 22894 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020323.1 protein_id gnl|my_center|LOCUS_13280 22904 24340 gene locus_tag LOCUS_13290 22904 24340 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064301.1 protein_id gnl|my_center|LOCUS_13290 24337 24915 gene locus_tag LOCUS_13300 24337 24915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066058.1 protein_id gnl|my_center|LOCUS_13300 24947 25369 gene locus_tag LOCUS_13310 24947 25369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 25369 26355 gene locus_tag LOCUS_13320 25369 26355 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020721.1 protein_id gnl|my_center|LOCUS_13320 26544 27041 gene locus_tag LOCUS_13330 26544 27041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 27038 27709 gene locus_tag LOCUS_13340 27038 27709 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391435.1 protein_id gnl|my_center|LOCUS_13340 27706 28404 gene locus_tag LOCUS_13350 27706 28404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 28386 29039 gene locus_tag LOCUS_13360 28386 29039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 29093 30841 gene locus_tag LOCUS_13370 gene oadA 29093 30841 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_13370 30856 32331 gene locus_tag LOCUS_13380 30856 32331 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020720.1 protein_id gnl|my_center|LOCUS_13380 32769 33626 gene locus_tag LOCUS_13390 32769 33626 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867167.1 protein_id gnl|my_center|LOCUS_13390 33524 34348 gene locus_tag LOCUS_13400 33524 34348 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013747453.1 protein_id gnl|my_center|LOCUS_13400 34473 34604 gene locus_tag LOCUS_13410 34473 34604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 35619 35921 gene locus_tag LOCUS_13420 35619 35921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 37670 35829 gene locus_tag LOCUS_13430 37670 35829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 37840 38031 gene locus_tag LOCUS_13440 37840 38031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 38716 38195 gene locus_tag LOCUS_13450 38716 38195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 40066 39080 gene locus_tag LOCUS_13460 40066 39080 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704140.1 protein_id gnl|my_center|LOCUS_13460 40815 40366 gene locus_tag LOCUS_13470 40815 40366 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249295.1 protein_id gnl|my_center|LOCUS_13470 41359 40802 gene locus_tag LOCUS_13480 41359 40802 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249296.1 protein_id gnl|my_center|LOCUS_13480 41938 41633 gene locus_tag LOCUS_13490 41938 41633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 42202 42753 gene locus_tag LOCUS_13500 gene dps 42202 42753 CDS product DNA protection during starvation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065551.1 protein_id gnl|my_center|LOCUS_13500 42861 43673 gene locus_tag LOCUS_13510 42861 43673 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404186.1 protein_id gnl|my_center|LOCUS_13510 43939 44023 gene locus_tag LOCUS_t00260 43939 44023 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 44299 44066 gene locus_tag LOCUS_13520 44299 44066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 44937 44746 gene locus_tag LOCUS_13530 44937 44746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 45142 45822 gene locus_tag LOCUS_13540 45142 45822 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868261.1 protein_id gnl|my_center|LOCUS_13540 45819 46385 gene locus_tag LOCUS_13550 45819 46385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 46507 48405 gene locus_tag LOCUS_13560 46507 48405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 49612 48386 gene locus_tag LOCUS_13570 gene mmp10 49612 48386 CDS product methyl coenzyme M reductase-arginine methyltransferase Mmp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024424.1 protein_id gnl|my_center|LOCUS_13570 49735 50007 gene locus_tag LOCUS_13580 49735 50007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 50059 50131 gene locus_tag LOCUS_t00270 50059 50131 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 50411 50683 gene locus_tag LOCUS_13590 50411 50683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 50742 51611 gene locus_tag LOCUS_13600 50742 51611 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871021.1 protein_id gnl|my_center|LOCUS_13600 51648 52886 gene locus_tag LOCUS_13610 51648 52886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 52977 55037 gene locus_tag LOCUS_13620 gene fdhF 52977 55037 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774551.1 protein_id gnl|my_center|LOCUS_13620 55041 56306 gene locus_tag LOCUS_13630 55041 56306 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869498.1 protein_id gnl|my_center|LOCUS_13630 58209 56317 gene locus_tag LOCUS_13640 58209 56317 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878912.1 protein_id gnl|my_center|LOCUS_13640 59113 59985 gene locus_tag LOCUS_13650 59113 59985 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393681.1 protein_id gnl|my_center|LOCUS_13650 59997 60506 gene locus_tag LOCUS_13660 59997 60506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 62189 60591 gene locus_tag LOCUS_13670 62189 60591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 63204 62167 gene locus_tag LOCUS_13680 63204 62167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 66377 63204 gene locus_tag LOCUS_13690 66377 63204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 67524 66364 gene locus_tag LOCUS_13700 67524 66364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 67655 67837 gene locus_tag LOCUS_13710 67655 67837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 67834 69012 gene locus_tag LOCUS_13720 gene pscS 67834 69012 CDS product O-phospho-L-seryl-tRNA:Cys-tRNA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966499.1 protein_id gnl|my_center|LOCUS_13720 70706 69528 gene locus_tag LOCUS_13730 gene thiI 70706 69528 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877292.1 protein_id gnl|my_center|LOCUS_13730 71470 70694 gene locus_tag LOCUS_13740 gene larE 71470 70694 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357133.1 protein_id gnl|my_center|LOCUS_13740 71573 72211 gene locus_tag LOCUS_13750 71573 72211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 72208 72660 gene locus_tag LOCUS_13760 72208 72660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 74257 72773 gene locus_tag LOCUS_13770 74257 72773 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902753.1 protein_id gnl|my_center|LOCUS_13770 74446 75360 gene locus_tag LOCUS_13780 74446 75360 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140212.1 protein_id gnl|my_center|LOCUS_13780 75372 76811 gene locus_tag LOCUS_13790 75372 76811 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062390429.1 protein_id gnl|my_center|LOCUS_13790 76817 77896 gene locus_tag LOCUS_13800 gene wecB 76817 77896 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048109.1 protein_id gnl|my_center|LOCUS_13800 78147 79169 gene locus_tag LOCUS_13810 78147 79169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 80253 79276 gene locus_tag LOCUS_13820 80253 79276 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876007.1 protein_id gnl|my_center|LOCUS_13820 80999 80253 gene locus_tag LOCUS_13830 80999 80253 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031156.1 protein_id gnl|my_center|LOCUS_13830 82509 81322 gene locus_tag LOCUS_13840 82509 81322 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876000.1 protein_id gnl|my_center|LOCUS_13840 84370 84191 gene locus_tag LOCUS_13850 84370 84191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 86000 87136 gene locus_tag LOCUS_13860 86000 87136 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_13860 87217 87891 gene locus_tag LOCUS_13870 87217 87891 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937645.1 protein_id gnl|my_center|LOCUS_13870 87864 88532 gene locus_tag LOCUS_13880 87864 88532 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877398.1 protein_id gnl|my_center|LOCUS_13880 89672 88584 gene locus_tag LOCUS_13890 89672 88584 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878440.1 protein_id gnl|my_center|LOCUS_13890 91470 89665 gene locus_tag LOCUS_13900 91470 89665 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_13900 92689 91457 gene locus_tag LOCUS_13910 gene hisS 92689 91457 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879138.1 protein_id gnl|my_center|LOCUS_13910 93038 92706 gene locus_tag LOCUS_13920 93038 92706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 93086 93859 gene locus_tag LOCUS_13930 gene larB 93086 93859 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020480.1 protein_id gnl|my_center|LOCUS_13930 93856 94362 gene locus_tag LOCUS_13940 93856 94362 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870045.1 protein_id gnl|my_center|LOCUS_13940 94406 95695 gene locus_tag LOCUS_13950 94406 95695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 95817 96650 gene locus_tag LOCUS_13960 95817 96650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 96647 97984 gene locus_tag LOCUS_13970 96647 97984 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_13970 98900 98580 gene locus_tag LOCUS_13980 98900 98580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 100191 99022 gene locus_tag LOCUS_13990 100191 99022 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024280.1 protein_id gnl|my_center|LOCUS_13990 100405 100995 gene locus_tag LOCUS_14000 100405 100995 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877617.1 protein_id gnl|my_center|LOCUS_14000 100998 101825 gene locus_tag LOCUS_14010 100998 101825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence13 487 245 gene locus_tag LOCUS_14020 487 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 1086 568 gene locus_tag LOCUS_14030 1086 568 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878286.1 protein_id gnl|my_center|LOCUS_14030 1463 1086 gene locus_tag LOCUS_14040 gene sepF 1463 1086 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878285.1 protein_id gnl|my_center|LOCUS_14040 2011 1514 gene locus_tag LOCUS_14050 2011 1514 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876288.1 protein_id gnl|my_center|LOCUS_14050 2121 2348 gene locus_tag LOCUS_14060 2121 2348 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023130.1 protein_id gnl|my_center|LOCUS_14060 2365 2547 gene locus_tag LOCUS_14070 2365 2547 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876286.1 protein_id gnl|my_center|LOCUS_14070 2557 3996 gene locus_tag LOCUS_14080 gene purF 2557 3996 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065634.1 protein_id gnl|my_center|LOCUS_14080 4405 4331 gene locus_tag LOCUS_t00280 4405 4331 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4741 5157 gene locus_tag LOCUS_14090 gene trxA 4741 5157 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 protein_id gnl|my_center|LOCUS_14090 5501 5154 gene locus_tag LOCUS_14100 5501 5154 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042653643.1 protein_id gnl|my_center|LOCUS_14100 6123 5554 gene locus_tag LOCUS_14110 6123 5554 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197538709.1 protein_id gnl|my_center|LOCUS_14110 7228 6125 gene locus_tag LOCUS_14120 7228 6125 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023369.1 protein_id gnl|my_center|LOCUS_14120 7743 8138 gene locus_tag LOCUS_14130 7743 8138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 8894 8058 gene locus_tag LOCUS_14140 8894 8058 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022647.1 protein_id gnl|my_center|LOCUS_14140 9852 8902 gene locus_tag LOCUS_14150 9852 8902 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984847.1 protein_id gnl|my_center|LOCUS_14150 10201 10695 gene locus_tag LOCUS_14160 10201 10695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 11270 11070 gene locus_tag LOCUS_14170 11270 11070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 11498 11662 gene locus_tag LOCUS_14180 11498 11662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 11668 12966 gene locus_tag LOCUS_14190 11668 12966 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010923212.1 protein_id gnl|my_center|LOCUS_14190 12971 13915 gene locus_tag LOCUS_14200 gene arcC 12971 13915 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_14200 13978 14316 gene locus_tag LOCUS_14210 13978 14316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 14592 14732 gene locus_tag LOCUS_14220 14592 14732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 15942 14722 gene locus_tag LOCUS_14230 15942 14722 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879038.1 protein_id gnl|my_center|LOCUS_14230 16083 17141 gene locus_tag LOCUS_14240 16083 17141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14240 17153 17530 gene locus_tag LOCUS_14250 17153 17530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14250 17618 19234 gene locus_tag LOCUS_14260 17618 19234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 19320 19478 gene locus_tag LOCUS_14270 19320 19478 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670545.1 protein_id gnl|my_center|LOCUS_14270 19867 20028 gene locus_tag LOCUS_14280 19867 20028 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_14280 20641 20117 gene locus_tag LOCUS_14290 20641 20117 CDS product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990620.1 protein_id gnl|my_center|LOCUS_14290 21737 20688 gene locus_tag LOCUS_14300 21737 20688 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099211502.1 protein_id gnl|my_center|LOCUS_14300 22550 21738 gene locus_tag LOCUS_14310 22550 21738 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249669.1 protein_id gnl|my_center|LOCUS_14310 23044 22553 gene locus_tag LOCUS_14320 gene tsaA 23044 22553 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249662.1 protein_id gnl|my_center|LOCUS_14320 23868 23041 gene locus_tag LOCUS_14330 gene modA 23868 23041 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948645.1 protein_id gnl|my_center|LOCUS_14330 24085 24345 gene locus_tag LOCUS_14340 24085 24345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 24356 25366 gene locus_tag LOCUS_14350 24356 25366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 25884 25480 gene locus_tag LOCUS_14360 gene tsaA 25884 25480 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249662.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14360 26047 26346 gene locus_tag LOCUS_14370 26047 26346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 26882 26343 gene locus_tag LOCUS_14380 gene thiE 26882 26343 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006557.1 protein_id gnl|my_center|LOCUS_14380 27838 26978 gene locus_tag LOCUS_14390 gene thiM 27838 26978 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256281.1 protein_id gnl|my_center|LOCUS_14390 28117 28548 gene locus_tag LOCUS_14400 28117 28548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 28551 28712 gene locus_tag LOCUS_14410 28551 28712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 28817 30253 gene locus_tag LOCUS_14420 28817 30253 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875835.1 protein_id gnl|my_center|LOCUS_14420 31937 30969 gene locus_tag LOCUS_14430 31937 30969 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881382.1 protein_id gnl|my_center|LOCUS_14430 34588 31943 gene locus_tag LOCUS_14440 34588 31943 CDS product oligosaccharyl transferase, archaeosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065054.1 protein_id gnl|my_center|LOCUS_14440 35850 34729 gene locus_tag LOCUS_14450 35850 34729 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_14450 37082 35991 gene locus_tag LOCUS_14460 37082 35991 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_14460 37678 37079 gene locus_tag LOCUS_14470 37678 37079 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763299.1 protein_id gnl|my_center|LOCUS_14470 39414 37675 gene locus_tag LOCUS_14480 gene glmS 39414 37675 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393728.1 protein_id gnl|my_center|LOCUS_14480 40566 39415 gene locus_tag LOCUS_14490 40566 39415 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022961.1 protein_id gnl|my_center|LOCUS_14490 41770 40571 gene locus_tag LOCUS_14500 41770 40571 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022964.1 protein_id gnl|my_center|LOCUS_14500 43031 41775 gene locus_tag LOCUS_14510 gene glmM 43031 41775 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065583.1 protein_id gnl|my_center|LOCUS_14510 43674 43069 gene locus_tag LOCUS_14520 43674 43069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 44285 43677 gene locus_tag LOCUS_14530 44285 43677 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404252.1 protein_id gnl|my_center|LOCUS_14530 44944 44282 gene locus_tag LOCUS_14540 44944 44282 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545748.1 protein_id gnl|my_center|LOCUS_14540 46073 44961 gene locus_tag LOCUS_14550 46073 44961 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938320.1 protein_id gnl|my_center|LOCUS_14550 46789 46058 gene locus_tag LOCUS_14560 46789 46058 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938321.1 protein_id gnl|my_center|LOCUS_14560 47166 46981 gene locus_tag LOCUS_14570 47166 46981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 48266 47163 gene locus_tag LOCUS_14580 48266 47163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 49038 48271 gene locus_tag LOCUS_14590 49038 48271 CDS product TIGR01458 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971814.1 protein_id gnl|my_center|LOCUS_14590 49193 49696 gene locus_tag LOCUS_14600 49193 49696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 49742 50857 gene locus_tag LOCUS_14610 49742 50857 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876130.1 protein_id gnl|my_center|LOCUS_14610 50850 53102 gene locus_tag LOCUS_14620 50850 53102 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876131.1 protein_id gnl|my_center|LOCUS_14620 53154 53702 gene locus_tag LOCUS_14630 53154 53702 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584147.1 protein_id gnl|my_center|LOCUS_14630 54238 54032 gene locus_tag LOCUS_14640 54238 54032 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879289.1 protein_id gnl|my_center|LOCUS_14640 54674 54288 gene locus_tag LOCUS_14650 54674 54288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022256.1 protein_id gnl|my_center|LOCUS_14650 55132 57390 gene locus_tag LOCUS_14660 55132 57390 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_14660 58960 57365 gene locus_tag LOCUS_14670 gene sepS 58960 57365 CDS product O-phosphoserine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020149.1 protein_id gnl|my_center|LOCUS_14670 59850 58957 gene locus_tag LOCUS_14680 gene twy1 59850 58957 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020099.1 protein_id gnl|my_center|LOCUS_14680 61495 59831 gene locus_tag LOCUS_14690 gene argS 61495 59831 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064797.1 protein_id gnl|my_center|LOCUS_14690 62766 61495 gene locus_tag LOCUS_14700 gene prf1 62766 61495 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020101.1 protein_id gnl|my_center|LOCUS_14700 63367 62873 gene locus_tag LOCUS_14710 63367 62873 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_14710 64036 63371 gene locus_tag LOCUS_14720 gene queC 64036 63371 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904151.1 protein_id gnl|my_center|LOCUS_14720 64644 64036 gene locus_tag LOCUS_14730 gene queE 64644 64036 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947757.1 protein_id gnl|my_center|LOCUS_14730 65044 64631 gene locus_tag LOCUS_14740 65044 64631 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868831.1 protein_id gnl|my_center|LOCUS_14740 65218 65646 gene locus_tag LOCUS_14750 65218 65646 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021280.1 protein_id gnl|my_center|LOCUS_14750 65652 66242 gene locus_tag LOCUS_14760 65652 66242 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021279.1 protein_id gnl|my_center|LOCUS_14760 66272 68464 gene locus_tag LOCUS_14770 66272 68464 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021278.1 protein_id gnl|my_center|LOCUS_14770 69340 68798 gene locus_tag LOCUS_14780 69340 68798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 70217 69666 gene locus_tag LOCUS_14790 70217 69666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 70383 71144 gene locus_tag LOCUS_14800 70383 71144 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022003.1 protein_id gnl|my_center|LOCUS_14800 71603 71175 gene locus_tag LOCUS_14810 71603 71175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 71824 72441 gene locus_tag LOCUS_14820 71824 72441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 73150 72458 gene locus_tag LOCUS_14830 73150 72458 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880943.1 protein_id gnl|my_center|LOCUS_14830 73323 73147 gene locus_tag LOCUS_14840 73323 73147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 74127 73420 gene locus_tag LOCUS_14850 74127 73420 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755943.1 protein_id gnl|my_center|LOCUS_14850 75340 74132 gene locus_tag LOCUS_14860 75340 74132 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022791.1 protein_id gnl|my_center|LOCUS_14860 76619 75342 gene locus_tag LOCUS_14870 76619 75342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 77056 77256 gene locus_tag LOCUS_14880 77056 77256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 77250 78008 gene locus_tag LOCUS_14890 77250 78008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 78409 78017 gene locus_tag LOCUS_14900 78409 78017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 78569 79057 gene locus_tag LOCUS_14910 78569 79057 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065754.1 protein_id gnl|my_center|LOCUS_14910 79369 79914 gene locus_tag LOCUS_14920 79369 79914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 80067 80915 gene locus_tag LOCUS_14930 80067 80915 CDS product UbiA prenyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250275.1 protein_id gnl|my_center|LOCUS_14930 80912 81700 gene locus_tag LOCUS_14940 80912 81700 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228266.1 protein_id gnl|my_center|LOCUS_14940 82315 83154 gene locus_tag LOCUS_14950 82315 83154 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021957.1 protein_id gnl|my_center|LOCUS_14950 86017 83171 gene locus_tag LOCUS_14960 86017 83171 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021615.1 protein_id gnl|my_center|LOCUS_14960 86544 86014 gene locus_tag LOCUS_14970 86544 86014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 87003 86653 gene locus_tag LOCUS_14980 87003 86653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 87192 87677 gene locus_tag LOCUS_14990 87192 87677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 87720 88544 gene locus_tag LOCUS_15000 87720 88544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 89502 88762 gene locus_tag LOCUS_15010 89502 88762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870951.1 protein_id gnl|my_center|LOCUS_15010 90233 89562 gene locus_tag LOCUS_15020 90233 89562 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022982.1 protein_id gnl|my_center|LOCUS_15020 91144 90209 gene locus_tag LOCUS_15030 91144 90209 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066343.1 protein_id gnl|my_center|LOCUS_15030 91272 92204 gene locus_tag LOCUS_15040 91272 92204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 92238 92423 gene locus_tag LOCUS_15050 92238 92423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 92485 92832 gene locus_tag LOCUS_15060 92485 92832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 92883 93365 gene locus_tag LOCUS_15070 92883 93365 CDS product DUF2124 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021715.1 protein_id gnl|my_center|LOCUS_15070 94788 93349 gene locus_tag LOCUS_15080 94788 93349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 95191 97512 gene locus_tag LOCUS_15090 95191 97512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 97723 98316 gene locus_tag LOCUS_15100 97723 98316 CDS product DNA polymerase ligase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031607.1 protein_id gnl|my_center|LOCUS_15100 98316 98471 gene locus_tag LOCUS_15110 98316 98471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 99028 99474 gene locus_tag LOCUS_15120 99028 99474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence14 <1 4132 gene locus_tag LOCUS_15130 <1 4132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_137607921.1:Ig-like domain-containing protein 4146 5360 gene locus_tag LOCUS_15140 4146 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 5464 6762 gene locus_tag LOCUS_15150 5464 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 6773 7294 gene locus_tag LOCUS_15160 6773 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 7590 7793 gene locus_tag LOCUS_15170 7590 7793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 7886 8941 gene locus_tag LOCUS_15180 7886 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 8962 9570 gene locus_tag LOCUS_15190 8962 9570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 9635 9859 gene locus_tag LOCUS_15200 9635 9859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 9810 10079 gene locus_tag LOCUS_15210 9810 10079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 10122 10274 gene locus_tag LOCUS_15220 10122 10274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 10258 10794 gene locus_tag LOCUS_15230 10258 10794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023265.1 protein_id gnl|my_center|LOCUS_15230 10846 11175 gene locus_tag LOCUS_15240 10846 11175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 11162 13105 gene locus_tag LOCUS_15250 11162 13105 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589509.1 protein_id gnl|my_center|LOCUS_15250 13110 13367 gene locus_tag LOCUS_15260 13110 13367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 13379 13957 gene locus_tag LOCUS_15270 13379 13957 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903582.1 protein_id gnl|my_center|LOCUS_15270 13970 15025 gene locus_tag LOCUS_15280 13970 15025 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903581.1 protein_id gnl|my_center|LOCUS_15280 15027 15329 gene locus_tag LOCUS_15290 15027 15329 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024045.1 protein_id gnl|my_center|LOCUS_15290 15329 17083 gene locus_tag LOCUS_15300 15329 17083 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024046.1 protein_id gnl|my_center|LOCUS_15300 17086 18471 gene locus_tag LOCUS_15310 17086 18471 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024047.1 protein_id gnl|my_center|LOCUS_15310 18478 19104 gene locus_tag LOCUS_15320 18478 19104 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024048.1 protein_id gnl|my_center|LOCUS_15320 19127 20341 gene locus_tag LOCUS_15330 gene pgk 19127 20341 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023501.1 protein_id gnl|my_center|LOCUS_15330 22551 21694 gene locus_tag LOCUS_15340 22551 21694 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878600.1 protein_id gnl|my_center|LOCUS_15340 22667 22594 gene locus_tag LOCUS_t00290 22667 22594 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 22930 22730 gene locus_tag LOCUS_15350 22930 22730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 23715 22927 gene locus_tag LOCUS_15360 gene minD 23715 22927 CDS product cell division ATPase MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867687.1 protein_id gnl|my_center|LOCUS_15360 24056 24433 gene locus_tag LOCUS_15370 24056 24433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 24433 25068 gene locus_tag LOCUS_15380 24433 25068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 25637 25206 gene locus_tag LOCUS_15390 25637 25206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 25829 25902 gene locus_tag LOCUS_t00300 25829 25902 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 25981 26232 gene locus_tag LOCUS_15400 25981 26232 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870552.1 protein_id gnl|my_center|LOCUS_15400 26276 27817 gene locus_tag LOCUS_15410 26276 27817 CDS product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755883.1 protein_id gnl|my_center|LOCUS_15410 27814 29628 gene locus_tag LOCUS_15420 gene rpoB 27814 29628 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021285.1 protein_id gnl|my_center|LOCUS_15420 29652 32300 gene locus_tag LOCUS_15430 29652 32300 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021284.1 protein_id gnl|my_center|LOCUS_15430 32297 33469 gene locus_tag LOCUS_15440 gene rpoA2 32297 33469 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066196.1 protein_id gnl|my_center|LOCUS_15440 33481 33768 gene locus_tag LOCUS_15450 33481 33768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 33772 34221 gene locus_tag LOCUS_15460 33772 34221 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876680.1 protein_id gnl|my_center|LOCUS_15460 34461 35963 gene locus_tag LOCUS_15470 34461 35963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 37039 35864 gene locus_tag LOCUS_15480 37039 35864 CDS product DUF1786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392396.1 protein_id gnl|my_center|LOCUS_15480 42183 37129 gene locus_tag LOCUS_15490 42183 37129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 42347 42186 gene locus_tag LOCUS_15500 42347 42186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 42690 43229 gene locus_tag LOCUS_15510 gene thpR 42690 43229 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867226.1 protein_id gnl|my_center|LOCUS_15510 43226 44599 gene locus_tag LOCUS_15520 gene cca 43226 44599 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023473.1 protein_id gnl|my_center|LOCUS_15520 45949 44801 gene locus_tag LOCUS_15530 45949 44801 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182456.1 protein_id gnl|my_center|LOCUS_15530 46488 46027 gene locus_tag LOCUS_15540 46488 46027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 48082 46685 gene locus_tag LOCUS_15550 48082 46685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 49095 48520 gene locus_tag LOCUS_15560 49095 48520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 49098 49280 gene locus_tag LOCUS_15570 49098 49280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 50041 49292 gene locus_tag LOCUS_15580 50041 49292 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022096.1 protein_id gnl|my_center|LOCUS_15580 51063 50044 gene locus_tag LOCUS_15590 51063 50044 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_15590 51345 51085 gene locus_tag LOCUS_15600 51345 51085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 51946 51386 gene locus_tag LOCUS_15610 51946 51386 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024403.1 protein_id gnl|my_center|LOCUS_15610 52265 53593 gene locus_tag LOCUS_15620 gene glnA 52265 53593 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392808.1 protein_id gnl|my_center|LOCUS_15620 54728 53709 gene locus_tag LOCUS_15630 54728 53709 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024104.1 protein_id gnl|my_center|LOCUS_15630 55480 54734 gene locus_tag LOCUS_15640 55480 54734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024103.1 protein_id gnl|my_center|LOCUS_15640 56988 55477 gene locus_tag LOCUS_15650 56988 55477 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024102.1 protein_id gnl|my_center|LOCUS_15650 58016 56985 gene locus_tag LOCUS_15660 58016 56985 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065933.1 protein_id gnl|my_center|LOCUS_15660 58165 59493 gene locus_tag LOCUS_15670 gene glnA 58165 59493 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392808.1 protein_id gnl|my_center|LOCUS_15670 63160 59930 gene locus_tag LOCUS_15680 63160 59930 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_15680 64920 63157 gene locus_tag LOCUS_15690 64920 63157 CDS product DUF2326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969953.1 protein_id gnl|my_center|LOCUS_15690 65144 64917 gene locus_tag LOCUS_15700 65144 64917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 65914 65141 gene locus_tag LOCUS_15710 65914 65141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 67137 65911 gene locus_tag LOCUS_15720 67137 65911 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103419.1 protein_id gnl|my_center|LOCUS_15720 68149 67127 gene locus_tag LOCUS_15730 68149 67127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 70254 68146 gene locus_tag LOCUS_15740 70254 68146 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922418.1 protein_id gnl|my_center|LOCUS_15740 71049 70729 gene locus_tag LOCUS_15750 71049 70729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 71953 71051 gene locus_tag LOCUS_15760 71953 71051 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869781.1 protein_id gnl|my_center|LOCUS_15760 72478 72092 gene locus_tag LOCUS_15770 72478 72092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 72571 74370 gene locus_tag LOCUS_15780 gene aor 72571 74370 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250017.1 protein_id gnl|my_center|LOCUS_15780 74818 74381 gene locus_tag LOCUS_15790 gene tsaA 74818 74381 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877752.1 protein_id gnl|my_center|LOCUS_15790 75248 74823 gene locus_tag LOCUS_15800 75248 74823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 75426 76094 gene locus_tag LOCUS_15810 75426 76094 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526170.1 protein_id gnl|my_center|LOCUS_15810 76663 77076 gene locus_tag LOCUS_15820 76663 77076 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147291.1 protein_id gnl|my_center|LOCUS_15820 77137 77592 gene locus_tag LOCUS_15830 77137 77592 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147291.1 protein_id gnl|my_center|LOCUS_15830 78097 77645 gene locus_tag LOCUS_15840 78097 77645 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980432.1 protein_id gnl|my_center|LOCUS_15840 78398 78790 gene locus_tag LOCUS_15850 78398 78790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 78917 79144 gene locus_tag LOCUS_15860 78917 79144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 79217 79792 gene locus_tag LOCUS_15870 79217 79792 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022274.1 protein_id gnl|my_center|LOCUS_15870 80129 81577 gene locus_tag LOCUS_15880 80129 81577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 81746 81582 gene locus_tag LOCUS_15890 81746 81582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 82932 81814 gene locus_tag LOCUS_15900 82932 81814 CDS product TIGR04084 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878081.1 protein_id gnl|my_center|LOCUS_15900 83489 83253 gene locus_tag LOCUS_15910 83489 83253 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022341.1 protein_id gnl|my_center|LOCUS_15910 83609 84010 gene locus_tag LOCUS_15920 83609 84010 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940899.1 protein_id gnl|my_center|LOCUS_15920 84149 86878 gene locus_tag LOCUS_15930 84149 86878 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169981.1 protein_id gnl|my_center|LOCUS_15930 88779 86863 gene locus_tag LOCUS_15940 88779 86863 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271984.1 protein_id gnl|my_center|LOCUS_15940 90360 89428 gene locus_tag LOCUS_15950 90360 89428 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_15950 90979 91587 gene locus_tag LOCUS_15960 90979 91587 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023983.1 protein_id gnl|my_center|LOCUS_15960 92058 93458 gene locus_tag LOCUS_15970 92058 93458 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163428.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence15 2582 246 gene locus_tag LOCUS_15980 2582 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 2750 4381 gene locus_tag LOCUS_15990 2750 4381 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061070.1 protein_id gnl|my_center|LOCUS_15990 4378 5841 gene locus_tag LOCUS_16000 4378 5841 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061157.1 protein_id gnl|my_center|LOCUS_16000 6114 6716 gene locus_tag LOCUS_16010 6114 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 6700 6930 gene locus_tag LOCUS_16020 6700 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084207586.1 protein_id gnl|my_center|LOCUS_16020 8058 7219 gene locus_tag LOCUS_16030 8058 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 9361 8048 gene locus_tag LOCUS_16040 gene ablA 9361 8048 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023873.1 protein_id gnl|my_center|LOCUS_16040 10755 9496 gene locus_tag LOCUS_16050 10755 9496 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021211.1 protein_id gnl|my_center|LOCUS_16050 11387 11058 gene locus_tag LOCUS_16060 11387 11058 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250020.1 protein_id gnl|my_center|LOCUS_16060 11575 11384 gene locus_tag LOCUS_16070 11575 11384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 12012 11749 gene locus_tag LOCUS_16080 12012 11749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 12238 13503 gene locus_tag LOCUS_16090 12238 13503 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024335.1 protein_id gnl|my_center|LOCUS_16090 13525 13980 gene locus_tag LOCUS_16100 13525 13980 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020231.1 protein_id gnl|my_center|LOCUS_16100 13982 14416 gene locus_tag LOCUS_16110 13982 14416 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021853.1 protein_id gnl|my_center|LOCUS_16110 14607 15407 gene locus_tag LOCUS_16120 14607 15407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 15421 16353 gene locus_tag LOCUS_16130 15421 16353 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257444.1 protein_id gnl|my_center|LOCUS_16130 16405 17142 gene locus_tag LOCUS_16140 16405 17142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 17253 18368 gene locus_tag LOCUS_16150 17253 18368 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583323.1 protein_id gnl|my_center|LOCUS_16150 19679 18390 gene locus_tag LOCUS_16160 19679 18390 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875980.1 protein_id gnl|my_center|LOCUS_16160 20763 19666 gene locus_tag LOCUS_16170 20763 19666 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228262.1 protein_id gnl|my_center|LOCUS_16170 21041 22507 gene locus_tag LOCUS_16180 21041 22507 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 protein_id gnl|my_center|LOCUS_16180 22705 22490 gene locus_tag LOCUS_16190 22705 22490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 22808 23011 gene locus_tag LOCUS_16200 22808 23011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 24012 23095 gene locus_tag LOCUS_16210 24012 23095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 25452 24262 gene locus_tag LOCUS_16220 25452 24262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 26113 25565 gene locus_tag LOCUS_16230 26113 25565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 27018 26500 gene locus_tag LOCUS_16240 27018 26500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 27268 28224 gene locus_tag LOCUS_16250 27268 28224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 28730 28347 gene locus_tag LOCUS_16260 28730 28347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 28966 29472 gene locus_tag LOCUS_16270 28966 29472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 30382 29546 gene locus_tag LOCUS_16280 30382 29546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 31279 31482 gene locus_tag LOCUS_16290 31279 31482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 31843 32388 gene locus_tag LOCUS_16300 31843 32388 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022582.1 protein_id gnl|my_center|LOCUS_16300 32385 32804 gene locus_tag LOCUS_16310 32385 32804 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022581.1 protein_id gnl|my_center|LOCUS_16310 33002 34132 gene locus_tag LOCUS_16320 33002 34132 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903688.1 protein_id gnl|my_center|LOCUS_16320 34325 34582 gene locus_tag LOCUS_16330 34325 34582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 34579 34869 gene locus_tag LOCUS_16340 34579 34869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 34946 35104 gene locus_tag LOCUS_16350 34946 35104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 36143 35709 gene locus_tag LOCUS_16360 36143 35709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 40785 38482 gene locus_tag LOCUS_16370 40785 38482 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387755.1 protein_id gnl|my_center|LOCUS_16370 43910 43152 gene locus_tag LOCUS_16380 43910 43152 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877555.1 protein_id gnl|my_center|LOCUS_16380 44672 43911 gene locus_tag LOCUS_16390 44672 43911 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012940593.1 protein_id gnl|my_center|LOCUS_16390 45615 44659 gene locus_tag LOCUS_16400 45615 44659 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877828.1 protein_id gnl|my_center|LOCUS_16400 46369 45635 gene locus_tag LOCUS_16410 46369 45635 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023677.1 protein_id gnl|my_center|LOCUS_16410 47178 46366 gene locus_tag LOCUS_16420 gene rfbD 47178 46366 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023678.1 protein_id gnl|my_center|LOCUS_16420 48113 47151 gene locus_tag LOCUS_16430 gene rfbB 48113 47151 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023679.1 protein_id gnl|my_center|LOCUS_16430 48594 48118 gene locus_tag LOCUS_16440 48594 48118 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391711.1 protein_id gnl|my_center|LOCUS_16440 49731 48790 gene locus_tag LOCUS_16450 49731 48790 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877829.1 protein_id gnl|my_center|LOCUS_16450 50858 49773 gene locus_tag LOCUS_16460 50858 49773 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250684.1 protein_id gnl|my_center|LOCUS_16460 51166 50894 gene locus_tag LOCUS_16470 51166 50894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 51788 51279 gene locus_tag LOCUS_16480 51788 51279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 52276 51788 gene locus_tag LOCUS_16490 52276 51788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 52596 52279 gene locus_tag LOCUS_16500 52596 52279 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080550.1 protein_id gnl|my_center|LOCUS_16500 53289 53519 gene locus_tag LOCUS_16510 53289 53519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 53541 53822 gene locus_tag LOCUS_16520 53541 53822 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902003.1 protein_id gnl|my_center|LOCUS_16520 53965 56403 gene locus_tag LOCUS_16530 53965 56403 CDS product oligosaccharyl transferase, archaeosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023658.1 protein_id gnl|my_center|LOCUS_16530 56968 56366 gene locus_tag LOCUS_16540 56968 56366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 57330 57205 gene locus_tag LOCUS_16550 57330 57205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 58365 57511 gene locus_tag LOCUS_16560 58365 57511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 58662 58381 gene locus_tag LOCUS_16570 58662 58381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 58880 58668 gene locus_tag LOCUS_16580 58880 58668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 60090 58915 gene locus_tag LOCUS_16590 gene trxB 60090 58915 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229015.1 protein_id gnl|my_center|LOCUS_16590 60681 60181 gene locus_tag LOCUS_16600 60681 60181 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932995.1 protein_id gnl|my_center|LOCUS_16600 60897 61760 gene locus_tag LOCUS_16610 60897 61760 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064910.1 protein_id gnl|my_center|LOCUS_16610 62342 61752 gene locus_tag LOCUS_16620 62342 61752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 62479 62724 gene locus_tag LOCUS_16630 62479 62724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 62735 62860 gene locus_tag LOCUS_16640 62735 62860 CDS product desulfoferrodoxin FeS4 iron-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023638.1 protein_id gnl|my_center|LOCUS_16640 62857 63216 gene locus_tag LOCUS_16650 62857 63216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 63220 63864 gene locus_tag LOCUS_16660 63220 63864 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880523.1 protein_id gnl|my_center|LOCUS_16660 64096 64926 gene locus_tag LOCUS_16670 64096 64926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 64916 66409 gene locus_tag LOCUS_16680 64916 66409 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399701.1 protein_id gnl|my_center|LOCUS_16680 66460 67071 gene locus_tag LOCUS_16690 66460 67071 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459824.1 protein_id gnl|my_center|LOCUS_16690 67068 67682 gene locus_tag LOCUS_16700 67068 67682 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459824.1 protein_id gnl|my_center|LOCUS_16700 67880 71968 gene locus_tag LOCUS_16710 67880 71968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 72703 72119 gene locus_tag LOCUS_16720 72703 72119 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061267.1 protein_id gnl|my_center|LOCUS_16720 72797 73081 gene locus_tag LOCUS_16730 72797 73081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 73959 73090 gene locus_tag LOCUS_16740 gene argB 73959 73090 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875822.1 protein_id gnl|my_center|LOCUS_16740 75095 73956 gene locus_tag LOCUS_16750 gene argJ 75095 73956 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023478.1 protein_id gnl|my_center|LOCUS_16750 75574 75095 gene locus_tag LOCUS_16760 75574 75095 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065746.1 protein_id gnl|my_center|LOCUS_16760 76571 75585 gene locus_tag LOCUS_16770 gene argC 76571 75585 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879563.1 protein_id gnl|my_center|LOCUS_16770 77503 76598 gene locus_tag LOCUS_16780 77503 76598 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879220.1 protein_id gnl|my_center|LOCUS_16780 78993 77932 gene locus_tag LOCUS_16790 78993 77932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 79723 79022 gene locus_tag LOCUS_16800 79723 79022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 79956 80528 gene locus_tag LOCUS_16810 79956 80528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 80528 81007 gene locus_tag LOCUS_16820 80528 81007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 81511 81038 gene locus_tag LOCUS_16830 81511 81038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 82604 81747 gene locus_tag LOCUS_16840 82604 81747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 83918 82614 gene locus_tag LOCUS_16850 83918 82614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 85250 84552 gene locus_tag LOCUS_16860 85250 84552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 86397 85261 gene locus_tag LOCUS_16870 86397 85261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 87428 86994 gene locus_tag LOCUS_16880 87428 86994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 88204 87773 gene locus_tag LOCUS_16890 88204 87773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 89552 88239 gene locus_tag LOCUS_16900 89552 88239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence16 139 342 gene locus_tag LOCUS_16910 139 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 503 697 gene locus_tag LOCUS_16920 503 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 1473 1916 gene locus_tag LOCUS_16930 1473 1916 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879882.1 protein_id gnl|my_center|LOCUS_16930 1922 2209 gene locus_tag LOCUS_16940 1922 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 2249 2908 gene locus_tag LOCUS_16950 2249 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 2971 3894 gene locus_tag LOCUS_16960 2971 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 5872 3911 gene locus_tag LOCUS_16970 5872 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 5959 7119 gene locus_tag LOCUS_16980 5959 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 7130 8098 gene locus_tag LOCUS_16990 7130 8098 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_16990 8837 8052 gene locus_tag LOCUS_17000 8837 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 9127 8834 gene locus_tag LOCUS_17010 9127 8834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 10368 9127 gene locus_tag LOCUS_17020 10368 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 11339 10371 gene locus_tag LOCUS_17030 11339 10371 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255971.1 protein_id gnl|my_center|LOCUS_17030 12144 11332 gene locus_tag LOCUS_17040 12144 11332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 13726 12134 gene locus_tag LOCUS_17050 13726 12134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 13989 13723 gene locus_tag LOCUS_17060 13989 13723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 14254 14484 gene locus_tag LOCUS_17070 14254 14484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 14609 15025 gene locus_tag LOCUS_17080 14609 15025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 15025 15303 gene locus_tag LOCUS_17090 15025 15303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064810.1 protein_id gnl|my_center|LOCUS_17090 15484 15735 gene locus_tag LOCUS_17100 15484 15735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 15839 15654 gene locus_tag LOCUS_17110 15839 15654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 17247 18815 gene locus_tag LOCUS_17120 17247 18815 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024324.1 protein_id gnl|my_center|LOCUS_17120 18824 19582 gene locus_tag LOCUS_17130 18824 19582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 19582 20589 gene locus_tag LOCUS_17140 19582 20589 CDS product lipid II:glycine glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023745.1 protein_id gnl|my_center|LOCUS_17140 20724 21107 gene locus_tag LOCUS_17150 20724 21107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 21518 22198 gene locus_tag LOCUS_17160 21518 22198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 22195 22722 gene locus_tag LOCUS_17170 22195 22722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 22723 23925 gene locus_tag LOCUS_17180 22723 23925 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021091.1 protein_id gnl|my_center|LOCUS_17180 25642 26055 gene locus_tag LOCUS_17190 25642 26055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 28312 27059 gene locus_tag LOCUS_17200 28312 27059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 29673 28315 gene locus_tag LOCUS_17210 29673 28315 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033043268.1 protein_id gnl|my_center|LOCUS_17210 31234 29678 gene locus_tag LOCUS_17220 31234 29678 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886617.1 protein_id gnl|my_center|LOCUS_17220 31811 32029 gene locus_tag LOCUS_17230 31811 32029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 32026 32283 gene locus_tag LOCUS_17240 32026 32283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 32273 32533 gene locus_tag LOCUS_17250 32273 32533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 32964 32608 gene locus_tag LOCUS_17260 32964 32608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 33444 33172 gene locus_tag LOCUS_17270 33444 33172 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020433.1 protein_id gnl|my_center|LOCUS_17270 33674 33441 gene locus_tag LOCUS_17280 33674 33441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 34961 34455 gene locus_tag LOCUS_17290 34961 34455 CDS product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870649.1 protein_id gnl|my_center|LOCUS_17290 36047 34974 gene locus_tag LOCUS_17300 36047 34974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 36147 37385 gene locus_tag LOCUS_17310 36147 37385 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285020.1 protein_id gnl|my_center|LOCUS_17310 37589 38161 gene locus_tag LOCUS_17320 37589 38161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 38514 38789 gene locus_tag LOCUS_17330 38514 38789 CDS product pro-sigmaK processing inhibitor BofA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020585.1 protein_id gnl|my_center|LOCUS_17330 39282 38797 gene locus_tag LOCUS_17340 39282 38797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 40510 39560 gene locus_tag LOCUS_17350 40510 39560 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879191.1 protein_id gnl|my_center|LOCUS_17350 40646 41476 gene locus_tag LOCUS_17360 40646 41476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 42704 41757 gene locus_tag LOCUS_17370 gene yaeI 42704 41757 CDS product phosphodiesterase YaeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625631.1 protein_id gnl|my_center|LOCUS_17370 43428 42763 gene locus_tag LOCUS_17380 43428 42763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 43755 43985 gene locus_tag LOCUS_17390 gene eif1A 43755 43985 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064286.1 protein_id gnl|my_center|LOCUS_17390 44839 44081 gene locus_tag LOCUS_17400 44839 44081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 45301 44855 gene locus_tag LOCUS_17410 45301 44855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 45665 45282 gene locus_tag LOCUS_17420 45665 45282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 46165 45653 gene locus_tag LOCUS_17430 46165 45653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 47181 46159 gene locus_tag LOCUS_17440 47181 46159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 47786 47205 gene locus_tag LOCUS_17450 47786 47205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 48035 48676 gene locus_tag LOCUS_17460 48035 48676 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024475.1 protein_id gnl|my_center|LOCUS_17460 49561 48689 gene locus_tag LOCUS_17470 gene hisG 49561 48689 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_17470 50876 49611 gene locus_tag LOCUS_17480 50876 49611 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063044.1 protein_id gnl|my_center|LOCUS_17480 50962 51426 gene locus_tag LOCUS_17490 gene rimI 50962 51426 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980152.1 protein_id gnl|my_center|LOCUS_17490 51909 51580 gene locus_tag LOCUS_17500 51909 51580 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_17500 52208 51906 gene locus_tag LOCUS_17510 52208 51906 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_17510 53510 52302 gene locus_tag LOCUS_17520 gene hmgA 53510 52302 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876201.1 protein_id gnl|my_center|LOCUS_17520 53555 54469 gene locus_tag LOCUS_17530 53555 54469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 54669 54935 gene locus_tag LOCUS_17540 54669 54935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 55537 55145 gene locus_tag LOCUS_17550 55537 55145 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023936.1 protein_id gnl|my_center|LOCUS_17550 56700 55540 gene locus_tag LOCUS_17560 56700 55540 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_17560 57749 56697 gene locus_tag LOCUS_17570 57749 56697 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023934.1 protein_id gnl|my_center|LOCUS_17570 58417 57743 gene locus_tag LOCUS_17580 58417 57743 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023933.1 protein_id gnl|my_center|LOCUS_17580 58575 59243 gene locus_tag LOCUS_17590 58575 59243 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319832.1 protein_id gnl|my_center|LOCUS_17590 59236 59913 gene locus_tag LOCUS_17600 gene ribB 59236 59913 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020597.1 protein_id gnl|my_center|LOCUS_17600 60258 60758 gene locus_tag LOCUS_17610 60258 60758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 61889 61323 gene locus_tag LOCUS_17620 61889 61323 CDS product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903600.1 protein_id gnl|my_center|LOCUS_17620 63160 61886 gene locus_tag LOCUS_17630 63160 61886 CDS product replication protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022958.1 protein_id gnl|my_center|LOCUS_17630 63497 63691 gene locus_tag LOCUS_17640 63497 63691 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964076.1 protein_id gnl|my_center|LOCUS_17640 64604 63699 gene locus_tag LOCUS_17650 64604 63699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 64963 64601 gene locus_tag LOCUS_17660 64963 64601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 65716 65081 gene locus_tag LOCUS_17670 gene pyrF 65716 65081 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065013.1 protein_id gnl|my_center|LOCUS_17670 66648 65713 gene locus_tag LOCUS_17680 66648 65713 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021005.1 protein_id gnl|my_center|LOCUS_17680 68538 67264 gene locus_tag LOCUS_17690 68538 67264 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066507.1 protein_id gnl|my_center|LOCUS_17690 68610 69500 gene locus_tag LOCUS_17700 68610 69500 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023440.1 protein_id gnl|my_center|LOCUS_17700 69558 71222 gene locus_tag LOCUS_17710 gene thsB 69558 71222 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020145.1 protein_id gnl|my_center|LOCUS_17710 71554 73470 gene locus_tag LOCUS_17720 71554 73470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 73467 75353 gene locus_tag LOCUS_17730 73467 75353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 75550 75356 gene locus_tag LOCUS_17740 75550 75356 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014310.1 protein_id gnl|my_center|LOCUS_17740 77096 75570 gene locus_tag LOCUS_17750 gene lysS 77096 75570 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020805.1 protein_id gnl|my_center|LOCUS_17750 77424 77197 gene locus_tag LOCUS_17760 77424 77197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 78137 77544 gene locus_tag LOCUS_17770 78137 77544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 78733 78134 gene locus_tag LOCUS_17780 78733 78134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 79891 78740 gene locus_tag LOCUS_17790 79891 78740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 80984 80295 gene locus_tag LOCUS_17800 80984 80295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020614.1 protein_id gnl|my_center|LOCUS_17800 82255 81014 gene locus_tag LOCUS_17810 82255 81014 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020613.1 protein_id gnl|my_center|LOCUS_17810 82631 83290 gene locus_tag LOCUS_17820 gene udg 82631 83290 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980322.1 protein_id gnl|my_center|LOCUS_17820 83297 83728 gene locus_tag LOCUS_17830 83297 83728 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 protein_id gnl|my_center|LOCUS_17830 84079 83747 gene locus_tag LOCUS_17840 84079 83747 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787743.1 protein_id gnl|my_center|LOCUS_17840 84934 84167 gene locus_tag LOCUS_17850 84934 84167 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065008.1 protein_id gnl|my_center|LOCUS_17850 86043 84931 gene locus_tag LOCUS_17860 86043 84931 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020989.1 protein_id gnl|my_center|LOCUS_17860 86484 86074 gene locus_tag LOCUS_17870 86484 86074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence17 597 169 gene locus_tag LOCUS_17880 597 169 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496545.1 protein_id gnl|my_center|LOCUS_17880 1798 1466 gene locus_tag LOCUS_17890 1798 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 1915 2529 gene locus_tag LOCUS_17900 1915 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 2540 4045 gene locus_tag LOCUS_17910 2540 4045 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070743.1 protein_id gnl|my_center|LOCUS_17910 4146 5012 gene locus_tag LOCUS_17920 gene dinD 4146 5012 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_17920 5002 6906 gene locus_tag LOCUS_17930 5002 6906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 6903 8192 gene locus_tag LOCUS_17940 6903 8192 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876574.1 protein_id gnl|my_center|LOCUS_17940 8167 9174 gene locus_tag LOCUS_17950 8167 9174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 9171 12125 gene locus_tag LOCUS_17960 9171 12125 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070740.1 protein_id gnl|my_center|LOCUS_17960 12125 12850 gene locus_tag LOCUS_17970 12125 12850 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023421.1 protein_id gnl|my_center|LOCUS_17970 14104 13031 gene locus_tag LOCUS_17980 14104 13031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 14882 14064 gene locus_tag LOCUS_17990 gene nifH 14882 14064 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023791.1 protein_id gnl|my_center|LOCUS_17990 15113 15733 gene locus_tag LOCUS_18000 15113 15733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 17622 16165 gene locus_tag LOCUS_18010 17622 16165 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250133.1 protein_id gnl|my_center|LOCUS_18010 18726 17716 gene locus_tag LOCUS_18020 18726 17716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 20024 18834 gene locus_tag LOCUS_18030 20024 18834 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584117.1 protein_id gnl|my_center|LOCUS_18030 20897 20187 gene locus_tag LOCUS_18040 gene nfi 20897 20187 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172477.1 protein_id gnl|my_center|LOCUS_18040 20996 21952 gene locus_tag LOCUS_18050 20996 21952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 21985 22236 gene locus_tag LOCUS_18060 21985 22236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 22217 23836 gene locus_tag LOCUS_18070 22217 23836 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876115.1 protein_id gnl|my_center|LOCUS_18070 24399 24199 gene locus_tag LOCUS_18080 24399 24199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 24711 24502 gene locus_tag LOCUS_18090 24711 24502 CDS product DUF2180 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060737.1 protein_id gnl|my_center|LOCUS_18090 25981 24980 gene locus_tag LOCUS_18100 gene fen 25981 24980 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250232.1 protein_id gnl|my_center|LOCUS_18100 26344 26030 gene locus_tag LOCUS_18110 26344 26030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 26402 27307 gene locus_tag LOCUS_18120 26402 27307 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065870.1 protein_id gnl|my_center|LOCUS_18120 28226 27246 gene locus_tag LOCUS_18130 28226 27246 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589523.1 protein_id gnl|my_center|LOCUS_18130 28371 29156 gene locus_tag LOCUS_18140 28371 29156 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021408.1 protein_id gnl|my_center|LOCUS_18140 29301 29510 gene locus_tag LOCUS_18150 29301 29510 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877303.1 protein_id gnl|my_center|LOCUS_18150 29821 30036 gene locus_tag LOCUS_18160 29821 30036 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023444.1 protein_id gnl|my_center|LOCUS_18160 30716 30012 gene locus_tag LOCUS_18170 30716 30012 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876695.1 protein_id gnl|my_center|LOCUS_18170 31684 30710 gene locus_tag LOCUS_18180 gene radA 31684 30710 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023460.1 protein_id gnl|my_center|LOCUS_18180 33076 31793 gene locus_tag LOCUS_18190 33076 31793 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024513.1 protein_id gnl|my_center|LOCUS_18190 34384 33092 gene locus_tag LOCUS_18200 gene lysA 34384 33092 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878303.1 protein_id gnl|my_center|LOCUS_18200 35514 34381 gene locus_tag LOCUS_18210 35514 34381 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065191.1 protein_id gnl|my_center|LOCUS_18210 35644 36843 gene locus_tag LOCUS_18220 gene nifS 35644 36843 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065651.1 protein_id gnl|my_center|LOCUS_18220 36843 37283 gene locus_tag LOCUS_18230 gene nifU 36843 37283 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022677.1 protein_id gnl|my_center|LOCUS_18230 37309 37626 gene locus_tag LOCUS_18240 37309 37626 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240352.1 protein_id gnl|my_center|LOCUS_18240 37626 38372 gene locus_tag LOCUS_18250 gene fdhD 37626 38372 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869793.1 protein_id gnl|my_center|LOCUS_18250 38369 38845 gene locus_tag LOCUS_18260 38369 38845 CDS product DUF1890 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020187.1 protein_id gnl|my_center|LOCUS_18260 38824 39102 gene locus_tag LOCUS_18270 38824 39102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 39856 39377 gene locus_tag LOCUS_18280 39856 39377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 40578 42869 gene locus_tag LOCUS_18290 40578 42869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 43007 43492 gene locus_tag LOCUS_18300 43007 43492 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 protein_id gnl|my_center|LOCUS_18300 44192 43590 gene locus_tag LOCUS_18310 44192 43590 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020322.1 protein_id gnl|my_center|LOCUS_18310 44701 44189 gene locus_tag LOCUS_18320 44701 44189 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879493.1 protein_id gnl|my_center|LOCUS_18320 45753 44698 gene locus_tag LOCUS_18330 gene hisC 45753 44698 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064817.1 protein_id gnl|my_center|LOCUS_18330 46903 45737 gene locus_tag LOCUS_18340 46903 45737 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066055.1 protein_id gnl|my_center|LOCUS_18340 47829 46912 gene locus_tag LOCUS_18350 gene guaA 47829 46912 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024387.1 protein_id gnl|my_center|LOCUS_18350 49428 47839 gene locus_tag LOCUS_18360 gene pyrG 49428 47839 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877763.1 protein_id gnl|my_center|LOCUS_18360 49967 49557 gene locus_tag LOCUS_18370 gene paaI 49967 49557 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965794.1 protein_id gnl|my_center|LOCUS_18370 50239 51417 gene locus_tag LOCUS_18380 50239 51417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 51643 52929 gene locus_tag LOCUS_18390 51643 52929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 53728 52943 gene locus_tag LOCUS_18400 53728 52943 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_18400 55018 53933 gene locus_tag LOCUS_18410 55018 53933 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060827.1 protein_id gnl|my_center|LOCUS_18410 55724 55023 gene locus_tag LOCUS_18420 55724 55023 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060828.1 protein_id gnl|my_center|LOCUS_18420 56678 55782 gene locus_tag LOCUS_18430 56678 55782 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876118.1 protein_id gnl|my_center|LOCUS_18430 57557 56859 gene locus_tag LOCUS_18440 57557 56859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 58450 57644 gene locus_tag LOCUS_18450 gene pyrH 58450 57644 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284182.1 protein_id gnl|my_center|LOCUS_18450 58488 58781 gene locus_tag LOCUS_18460 58488 58781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 58832 59188 gene locus_tag LOCUS_18470 58832 59188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 60231 59173 gene locus_tag LOCUS_18480 60231 59173 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099211502.1 protein_id gnl|my_center|LOCUS_18480 61038 60241 gene locus_tag LOCUS_18490 61038 60241 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249669.1 protein_id gnl|my_center|LOCUS_18490 61538 61035 gene locus_tag LOCUS_18500 gene tsaA 61538 61035 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868101.1 protein_id gnl|my_center|LOCUS_18500 62383 61565 gene locus_tag LOCUS_18510 gene modA 62383 61565 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948645.1 protein_id gnl|my_center|LOCUS_18510 62563 63696 gene locus_tag LOCUS_18520 62563 63696 CDS product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057197.1 protein_id gnl|my_center|LOCUS_18520 65555 64488 gene locus_tag LOCUS_18530 65555 64488 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020340.1 protein_id gnl|my_center|LOCUS_18530 66423 65542 gene locus_tag LOCUS_18540 gene wtpB 66423 65542 CDS product tungstate ABC transporter permease WtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877607.1 protein_id gnl|my_center|LOCUS_18540 67588 66497 gene locus_tag LOCUS_18550 gene wtpA 67588 66497 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020338.1 protein_id gnl|my_center|LOCUS_18550 68807 67719 gene locus_tag LOCUS_18560 68807 67719 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060827.1 protein_id gnl|my_center|LOCUS_18560 69507 68812 gene locus_tag LOCUS_18570 69507 68812 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060828.1 protein_id gnl|my_center|LOCUS_18570 70494 69589 gene locus_tag LOCUS_18580 70494 69589 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876118.1 protein_id gnl|my_center|LOCUS_18580 70704 71954 gene locus_tag LOCUS_18590 gene hisD 70704 71954 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023136.1 protein_id gnl|my_center|LOCUS_18590 73399 72452 gene locus_tag LOCUS_18600 73399 72452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 74375 73509 gene locus_tag LOCUS_18610 74375 73509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 74544 77009 gene locus_tag LOCUS_18620 74544 77009 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877144.1 protein_id gnl|my_center|LOCUS_18620 76993 77148 gene locus_tag LOCUS_18630 76993 77148 CDS product YHS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755885.1 protein_id gnl|my_center|LOCUS_18630 78263 77307 gene locus_tag LOCUS_18640 78263 77307 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334964.1 protein_id gnl|my_center|LOCUS_18640 >Feature sequence18 1704 205 gene locus_tag LOCUS_18650 gene malQ 1704 205 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940406.1 protein_id gnl|my_center|LOCUS_18650 2554 1736 gene locus_tag LOCUS_18660 2554 1736 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224531.1 protein_id gnl|my_center|LOCUS_18660 3319 2558 gene locus_tag LOCUS_18670 3319 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 3427 3720 gene locus_tag LOCUS_18680 3427 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 4784 4074 gene locus_tag LOCUS_18690 4784 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 6082 4781 gene locus_tag LOCUS_18700 6082 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 7253 6885 gene locus_tag LOCUS_18710 7253 6885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 8252 7299 gene locus_tag LOCUS_18720 8252 7299 CDS product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020267.1 protein_id gnl|my_center|LOCUS_18720 10244 9507 gene locus_tag LOCUS_18730 gene cobA 10244 9507 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022972.1 protein_id gnl|my_center|LOCUS_18730 11125 10241 gene locus_tag LOCUS_18740 gene hemC 11125 10241 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020631.1 protein_id gnl|my_center|LOCUS_18740 12357 11110 gene locus_tag LOCUS_18750 gene hemL 12357 11110 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020630.1 protein_id gnl|my_center|LOCUS_18750 13300 12344 gene locus_tag LOCUS_18760 gene hemB 13300 12344 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236609709.1 protein_id gnl|my_center|LOCUS_18760 14577 13306 gene locus_tag LOCUS_18770 gene hemA 14577 13306 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020626.1 protein_id gnl|my_center|LOCUS_18770 15196 14570 gene locus_tag LOCUS_18780 15196 14570 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020625.1 protein_id gnl|my_center|LOCUS_18780 15341 16294 gene locus_tag LOCUS_18790 15341 16294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902695.1 protein_id gnl|my_center|LOCUS_18790 16416 17108 gene locus_tag LOCUS_18800 16416 17108 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584036.1 protein_id gnl|my_center|LOCUS_18800 17268 17341 gene locus_tag LOCUS_t00310 17268 17341 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17966 17463 gene locus_tag LOCUS_18810 gene fae 17966 17463 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022945.1 protein_id gnl|my_center|LOCUS_18810 18347 19450 gene locus_tag LOCUS_18820 18347 19450 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020134.1 protein_id gnl|my_center|LOCUS_18820 20109 19462 gene locus_tag LOCUS_18830 20109 19462 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941409.1 protein_id gnl|my_center|LOCUS_18830 21748 20588 gene locus_tag LOCUS_18840 21748 20588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 22712 21723 gene locus_tag LOCUS_18850 22712 21723 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878435.1 protein_id gnl|my_center|LOCUS_18850 23200 22712 gene locus_tag LOCUS_18860 23200 22712 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878434.1 protein_id gnl|my_center|LOCUS_18860 24082 23321 gene locus_tag LOCUS_18870 24082 23321 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876165.1 protein_id gnl|my_center|LOCUS_18870 24923 24111 gene locus_tag LOCUS_18880 24923 24111 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023273.1 protein_id gnl|my_center|LOCUS_18880 25707 24931 gene locus_tag LOCUS_18890 25707 24931 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023274.1 protein_id gnl|my_center|LOCUS_18890 25797 26174 gene locus_tag LOCUS_18900 gene eif5A 25797 26174 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878148.1 protein_id gnl|my_center|LOCUS_18900 26167 27048 gene locus_tag LOCUS_18910 gene speB 26167 27048 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023880.1 protein_id gnl|my_center|LOCUS_18910 27787 27119 gene locus_tag LOCUS_18920 27787 27119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 28141 28737 gene locus_tag LOCUS_18930 28141 28737 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023001.1 protein_id gnl|my_center|LOCUS_18930 28750 29367 gene locus_tag LOCUS_18940 28750 29367 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023001.1 protein_id gnl|my_center|LOCUS_18940 31651 29825 gene locus_tag LOCUS_18950 31651 29825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 32249 33199 gene locus_tag LOCUS_18960 32249 33199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 33231 34337 gene locus_tag LOCUS_18970 33231 34337 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021093.1 protein_id gnl|my_center|LOCUS_18970 34334 34828 gene locus_tag LOCUS_18980 34334 34828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 34859 36562 gene locus_tag LOCUS_18990 34859 36562 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698821.1 protein_id gnl|my_center|LOCUS_18990 37125 37898 gene locus_tag LOCUS_19000 37125 37898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 38859 37903 gene locus_tag LOCUS_19010 38859 37903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 40114 38861 gene locus_tag LOCUS_19020 40114 38861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 41471 40107 gene locus_tag LOCUS_19030 41471 40107 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033043268.1 protein_id gnl|my_center|LOCUS_19030 43021 41468 gene locus_tag LOCUS_19040 43021 41468 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886617.1 protein_id gnl|my_center|LOCUS_19040 43394 43089 gene locus_tag LOCUS_19050 43394 43089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 43630 44451 gene locus_tag LOCUS_19060 43630 44451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 44455 44949 gene locus_tag LOCUS_19070 44455 44949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023018.1 protein_id gnl|my_center|LOCUS_19070 44952 45431 gene locus_tag LOCUS_19080 44952 45431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 45424 46176 gene locus_tag LOCUS_19090 45424 46176 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546206.1 protein_id gnl|my_center|LOCUS_19090 46182 48035 gene locus_tag LOCUS_19100 46182 48035 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878549.1 protein_id gnl|my_center|LOCUS_19100 48037 49635 gene locus_tag LOCUS_19110 gene flaJ 48037 49635 CDS product archaellar assembly protein FlaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878548.1 protein_id gnl|my_center|LOCUS_19110 49637 50776 gene locus_tag LOCUS_19120 49637 50776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 50811 51617 gene locus_tag LOCUS_19130 50811 51617 CDS product CheF family chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878543.1 protein_id gnl|my_center|LOCUS_19130 51687 52049 gene locus_tag LOCUS_19140 51687 52049 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878542.1 protein_id gnl|my_center|LOCUS_19140 52046 53086 gene locus_tag LOCUS_19150 52046 53086 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249584.1 protein_id gnl|my_center|LOCUS_19150 53079 55037 gene locus_tag LOCUS_19160 53079 55037 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878540.1 protein_id gnl|my_center|LOCUS_19160 55049 55663 gene locus_tag LOCUS_19170 55049 55663 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065596.1 protein_id gnl|my_center|LOCUS_19170 55681 56172 gene locus_tag LOCUS_19180 55681 56172 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080666.1 protein_id gnl|my_center|LOCUS_19180 56157 57320 gene locus_tag LOCUS_19190 56157 57320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 59456 57684 gene locus_tag LOCUS_19200 59456 57684 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023139.1 protein_id gnl|my_center|LOCUS_19200 59825 59463 gene locus_tag LOCUS_19210 59825 59463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903954.1 protein_id gnl|my_center|LOCUS_19210 61473 60448 gene locus_tag LOCUS_19220 61473 60448 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020699.1 protein_id gnl|my_center|LOCUS_19220 63410 61470 gene locus_tag LOCUS_19230 gene rqcH 63410 61470 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250389.1 protein_id gnl|my_center|LOCUS_19230 64912 64163 gene locus_tag LOCUS_19240 64912 64163 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022767.1 protein_id gnl|my_center|LOCUS_19240 65169 66674 gene locus_tag LOCUS_19250 65169 66674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 66717 67247 gene locus_tag LOCUS_19260 gene cyaB 66717 67247 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879480.1 protein_id gnl|my_center|LOCUS_19260 67875 67234 gene locus_tag LOCUS_19270 67875 67234 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021463.1 protein_id gnl|my_center|LOCUS_19270 68988 67879 gene locus_tag LOCUS_19280 68988 67879 CDS product TIGR04013 family B12-binding domain/radical SAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020300.1 protein_id gnl|my_center|LOCUS_19280 68881 69162 gene locus_tag LOCUS_19290 68881 69162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 69167 69916 gene locus_tag LOCUS_19300 69167 69916 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877445.1 protein_id gnl|my_center|LOCUS_19300 70656 69886 gene locus_tag LOCUS_19310 70656 69886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 70825 72066 gene locus_tag LOCUS_19320 70825 72066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 72524 72913 gene locus_tag LOCUS_19330 72524 72913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 73231 74442 gene locus_tag LOCUS_19340 73231 74442 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_19340 74439 75410 gene locus_tag LOCUS_19350 gene pfkA 74439 75410 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173968.1 protein_id gnl|my_center|LOCUS_19350 75879 75460 gene locus_tag LOCUS_19360 75879 75460 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023052.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence19 500 189 gene locus_tag LOCUS_19370 500 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 617 1711 gene locus_tag LOCUS_19380 gene cofH 617 1711 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060905.1 protein_id gnl|my_center|LOCUS_19380 1835 1993 gene locus_tag LOCUS_19390 1835 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 2723 2172 gene locus_tag LOCUS_19400 2723 2172 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870595.1 protein_id gnl|my_center|LOCUS_19400 3175 2720 gene locus_tag LOCUS_19410 3175 2720 CDS product DUF123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990683.1 protein_id gnl|my_center|LOCUS_19410 3770 3168 gene locus_tag LOCUS_19420 3770 3168 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024487.1 protein_id gnl|my_center|LOCUS_19420 3805 5085 gene locus_tag LOCUS_19430 gene thiC 3805 5085 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021793.1 protein_id gnl|my_center|LOCUS_19430 6037 5630 gene locus_tag LOCUS_19440 6037 5630 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_19440 6467 6075 gene locus_tag LOCUS_19450 6467 6075 CDS product AIR carboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021394.1 protein_id gnl|my_center|LOCUS_19450 6669 7733 gene locus_tag LOCUS_19460 6669 7733 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878914.1 protein_id gnl|my_center|LOCUS_19460 7730 8191 gene locus_tag LOCUS_19470 gene ribC 7730 8191 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021819.1 protein_id gnl|my_center|LOCUS_19470 8249 8656 gene locus_tag LOCUS_19480 gene ribH 8249 8656 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879619.1 protein_id gnl|my_center|LOCUS_19480 8653 9783 gene locus_tag LOCUS_19490 8653 9783 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021821.1 protein_id gnl|my_center|LOCUS_19490 11474 9780 gene locus_tag LOCUS_19500 11474 9780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 11674 12342 gene locus_tag LOCUS_19510 gene radC 11674 12342 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546157.1 protein_id gnl|my_center|LOCUS_19510 12667 13323 gene locus_tag LOCUS_19520 12667 13323 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065150.1 protein_id gnl|my_center|LOCUS_19520 13325 14461 gene locus_tag LOCUS_19530 13325 14461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 14467 15138 gene locus_tag LOCUS_19540 14467 15138 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_19540 15135 16280 gene locus_tag LOCUS_19550 15135 16280 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064397.1 protein_id gnl|my_center|LOCUS_19550 16549 16286 gene locus_tag LOCUS_19560 16549 16286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 17213 16533 gene locus_tag LOCUS_19570 17213 16533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 17687 17235 gene locus_tag LOCUS_19580 17687 17235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 18551 17859 gene locus_tag LOCUS_19590 18551 17859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 18611 19969 gene locus_tag LOCUS_19600 18611 19969 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943015.1 protein_id gnl|my_center|LOCUS_19600 20226 21536 gene locus_tag LOCUS_19610 gene trpE 20226 21536 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_19610 21536 22171 gene locus_tag LOCUS_19620 21536 22171 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035720.1 protein_id gnl|my_center|LOCUS_19620 22168 23184 gene locus_tag LOCUS_19630 gene trpD 22168 23184 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_19630 23181 23939 gene locus_tag LOCUS_19640 gene trpC 23181 23939 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_19640 23936 24508 gene locus_tag LOCUS_19650 23936 24508 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903201.1 protein_id gnl|my_center|LOCUS_19650 24505 25677 gene locus_tag LOCUS_19660 gene trpB 24505 25677 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064422.1 protein_id gnl|my_center|LOCUS_19660 25674 26480 gene locus_tag LOCUS_19670 gene trpA 25674 26480 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750470.1 protein_id gnl|my_center|LOCUS_19670 26508 27611 gene locus_tag LOCUS_19680 26508 27611 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 protein_id gnl|my_center|LOCUS_19680 28198 27641 gene locus_tag LOCUS_19690 28198 27641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 28821 28258 gene locus_tag LOCUS_19700 28821 28258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 29261 29061 gene locus_tag LOCUS_19710 29261 29061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 29706 29461 gene locus_tag LOCUS_19720 29706 29461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 30029 29703 gene locus_tag LOCUS_19730 30029 29703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 31166 30204 gene locus_tag LOCUS_19740 31166 30204 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021558.1 protein_id gnl|my_center|LOCUS_19740 31553 32236 gene locus_tag LOCUS_19750 31553 32236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 33016 32306 gene locus_tag LOCUS_19760 33016 32306 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990796.1 protein_id gnl|my_center|LOCUS_19760 33524 33090 gene locus_tag LOCUS_19770 33524 33090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 33994 35112 gene locus_tag LOCUS_19780 33994 35112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 35129 35539 gene locus_tag LOCUS_19790 35129 35539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 36453 36872 gene locus_tag LOCUS_19800 36453 36872 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021864.1 protein_id gnl|my_center|LOCUS_19800 36928 39309 gene locus_tag LOCUS_19810 gene lon 36928 39309 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021863.1 protein_id gnl|my_center|LOCUS_19810 39552 39995 gene locus_tag LOCUS_19820 39552 39995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 40021 40473 gene locus_tag LOCUS_19830 40021 40473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 40891 42108 gene locus_tag LOCUS_19840 40891 42108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 42193 42954 gene locus_tag LOCUS_19850 42193 42954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 43537 43950 gene locus_tag LOCUS_19860 43537 43950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 43962 45164 gene locus_tag LOCUS_19870 43962 45164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 45252 46274 gene locus_tag LOCUS_19880 45252 46274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 46478 47578 gene locus_tag LOCUS_19890 46478 47578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 48127 47642 gene locus_tag LOCUS_19900 48127 47642 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020126.1 protein_id gnl|my_center|LOCUS_19900 48230 49009 gene locus_tag LOCUS_19910 48230 49009 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388821.1 protein_id gnl|my_center|LOCUS_19910 49006 49713 gene locus_tag LOCUS_19920 49006 49713 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388822.1 protein_id gnl|my_center|LOCUS_19920 49718 50338 gene locus_tag LOCUS_19930 49718 50338 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496401.1 protein_id gnl|my_center|LOCUS_19930 50335 51576 gene locus_tag LOCUS_19940 50335 51576 CDS product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877291.1 protein_id gnl|my_center|LOCUS_19940 51573 52862 gene locus_tag LOCUS_19950 51573 52862 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_19950 52855 53988 gene locus_tag LOCUS_19960 gene comE 52855 53988 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023231.1 protein_id gnl|my_center|LOCUS_19960 55236 54379 gene locus_tag LOCUS_19970 55236 54379 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048298.1 protein_id gnl|my_center|LOCUS_19970 55470 56117 gene locus_tag LOCUS_19980 55470 56117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 56639 56845 gene locus_tag LOCUS_19990 56639 56845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 57835 58059 gene locus_tag LOCUS_20000 57835 58059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 58371 58526 gene locus_tag LOCUS_20010 58371 58526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 58666 59034 gene locus_tag LOCUS_20020 58666 59034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 59420 59187 gene locus_tag LOCUS_20030 59420 59187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 59358 59816 gene locus_tag LOCUS_20040 59358 59816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20040 60528 61493 gene locus_tag LOCUS_20050 60528 61493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 61500 62870 gene locus_tag LOCUS_20060 61500 62870 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023037.1 protein_id gnl|my_center|LOCUS_20060 63472 62876 gene locus_tag LOCUS_20070 63472 62876 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023038.1 protein_id gnl|my_center|LOCUS_20070 63701 64171 gene locus_tag LOCUS_20080 63701 64171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065607.1 protein_id gnl|my_center|LOCUS_20080 64241 64564 gene locus_tag LOCUS_20090 64241 64564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 65357 66298 gene locus_tag LOCUS_20100 65357 66298 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023032.1 protein_id gnl|my_center|LOCUS_20100 66334 67251 gene locus_tag LOCUS_20110 gene pstC 66334 67251 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860284.1 protein_id gnl|my_center|LOCUS_20110 67261 68166 gene locus_tag LOCUS_20120 gene pstA 67261 68166 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023034.1 protein_id gnl|my_center|LOCUS_20120 68159 70324 gene locus_tag LOCUS_20130 68159 70324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 71495 70377 gene locus_tag LOCUS_20140 71495 70377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 71582 71794 gene locus_tag LOCUS_20150 71582 71794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 72727 71708 gene locus_tag LOCUS_20160 72727 71708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 73834 72902 gene locus_tag LOCUS_20170 73834 72902 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893461.1 protein_id gnl|my_center|LOCUS_20170 73818 74051 gene locus_tag LOCUS_20180 73818 74051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 74434 73961 gene locus_tag LOCUS_20190 74434 73961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 >Feature sequence20 <1 601 gene locus_tag LOCUS_20200 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060907.1:radical SAM protein 2293 1352 gene locus_tag LOCUS_20210 gene ala 2293 1352 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023186.1 protein_id gnl|my_center|LOCUS_20210 3275 2586 gene locus_tag LOCUS_20220 3275 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 3615 3262 gene locus_tag LOCUS_20230 3615 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 4987 3620 gene locus_tag LOCUS_20240 4987 3620 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_20240 5904 4984 gene locus_tag LOCUS_20250 5904 4984 CDS product F420-nonreducing hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496953.1 protein_id gnl|my_center|LOCUS_20250 6477 5911 gene locus_tag LOCUS_20260 6477 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943054.1 protein_id gnl|my_center|LOCUS_20260 6716 6474 gene locus_tag LOCUS_20270 6716 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 7882 7094 gene locus_tag LOCUS_20280 gene minD 7882 7094 CDS product cell division ATPase MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867687.1 protein_id gnl|my_center|LOCUS_20280 8447 7914 gene locus_tag LOCUS_20290 8447 7914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 9109 8471 gene locus_tag LOCUS_20300 9109 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 9686 9210 gene locus_tag LOCUS_20310 9686 9210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 9785 10579 gene locus_tag LOCUS_20320 9785 10579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 10919 10635 gene locus_tag LOCUS_20330 10919 10635 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902779.1 protein_id gnl|my_center|LOCUS_20330 12209 10983 gene locus_tag LOCUS_20340 gene dnaG 12209 10983 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879392.1 protein_id gnl|my_center|LOCUS_20340 12782 12465 gene locus_tag LOCUS_20350 12782 12465 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066569.1 protein_id gnl|my_center|LOCUS_20350 14241 12979 gene locus_tag LOCUS_20360 14241 12979 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020936.1 protein_id gnl|my_center|LOCUS_20360 15152 14238 gene locus_tag LOCUS_20370 15152 14238 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065217.1 protein_id gnl|my_center|LOCUS_20370 15587 15156 gene locus_tag LOCUS_20380 15587 15156 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083908.1 protein_id gnl|my_center|LOCUS_20380 16674 15679 gene locus_tag LOCUS_20390 gene hypE 16674 15679 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060768.1 protein_id gnl|my_center|LOCUS_20390 17012 16671 gene locus_tag LOCUS_20400 gene hypA 17012 16671 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021162.1 protein_id gnl|my_center|LOCUS_20400 17236 17012 gene locus_tag LOCUS_20410 17236 17012 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 protein_id gnl|my_center|LOCUS_20410 18536 17913 gene locus_tag LOCUS_20420 18536 17913 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020584.1 protein_id gnl|my_center|LOCUS_20420 18735 19937 gene locus_tag LOCUS_20430 18735 19937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 20000 21094 gene locus_tag LOCUS_20440 20000 21094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 21623 21129 gene locus_tag LOCUS_20450 gene msrB 21623 21129 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876350.1 protein_id gnl|my_center|LOCUS_20450 21780 22247 gene locus_tag LOCUS_20460 21780 22247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 22306 22974 gene locus_tag LOCUS_20470 22306 22974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 26438 22971 gene locus_tag LOCUS_20480 26438 22971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 26656 27708 gene locus_tag LOCUS_20490 26656 27708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877363.1 protein_id gnl|my_center|LOCUS_20490 28871 27717 gene locus_tag LOCUS_20500 28871 27717 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065374.1 protein_id gnl|my_center|LOCUS_20500 29589 29140 gene locus_tag LOCUS_20510 29589 29140 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878928.1 protein_id gnl|my_center|LOCUS_20510 30628 29615 gene locus_tag LOCUS_20520 gene amrS 30628 29615 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023404.1 protein_id gnl|my_center|LOCUS_20520 30878 31582 gene locus_tag LOCUS_20530 gene pyrH 30878 31582 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020429.1 protein_id gnl|my_center|LOCUS_20530 31638 31712 gene locus_tag LOCUS_t00320 31638 31712 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 31719 32375 gene locus_tag LOCUS_20540 gene nth 31719 32375 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227718.1 protein_id gnl|my_center|LOCUS_20540 32492 33121 gene locus_tag LOCUS_20550 32492 33121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 33230 42412 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccacgtacatggggaacgc 42880 42521 gene locus_tag LOCUS_20560 gene cas2e 42880 42521 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942042.1 protein_id gnl|my_center|LOCUS_20560 43772 42861 gene locus_tag LOCUS_20570 gene cas1e 43772 42861 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942041.1 protein_id gnl|my_center|LOCUS_20570 44468 43782 gene locus_tag LOCUS_20580 gene cas6e 44468 43782 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281463.1 protein_id gnl|my_center|LOCUS_20580 45208 44459 gene locus_tag LOCUS_20590 gene cas5e 45208 44459 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666425.1 protein_id gnl|my_center|LOCUS_20590 46304 45201 gene locus_tag LOCUS_20600 gene cas7e 46304 45201 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044180303.1 protein_id gnl|my_center|LOCUS_20600 46828 46322 gene locus_tag LOCUS_20610 46828 46322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 48460 46835 gene locus_tag LOCUS_20620 gene casA 48460 46835 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046083149.1 protein_id gnl|my_center|LOCUS_20620 51383 48672 gene locus_tag LOCUS_20630 51383 48672 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091704098.1 protein_id gnl|my_center|LOCUS_20630 53026 51842 gene locus_tag LOCUS_20640 53026 51842 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067595.1 protein_id gnl|my_center|LOCUS_20640 53661 53032 gene locus_tag LOCUS_20650 53661 53032 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_20650 54152 53859 gene locus_tag LOCUS_20660 54152 53859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 54313 56952 gene locus_tag LOCUS_20670 54313 56952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 58029 57298 gene locus_tag LOCUS_20680 gene fdhD 58029 57298 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546799.1 protein_id gnl|my_center|LOCUS_20680 59713 58475 gene locus_tag LOCUS_20690 59713 58475 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869498.1 protein_id gnl|my_center|LOCUS_20690 61781 59715 gene locus_tag LOCUS_20700 gene fdhF 61781 59715 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774551.1 protein_id gnl|my_center|LOCUS_20700 62082 62741 gene locus_tag LOCUS_20710 62082 62741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 62805 63626 gene locus_tag LOCUS_20720 62805 63626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 63647 65422 gene locus_tag LOCUS_20730 63647 65422 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940249.1 protein_id gnl|my_center|LOCUS_20730 65467 65895 gene locus_tag LOCUS_20740 65467 65895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 67373 66522 gene locus_tag LOCUS_20750 67373 66522 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764764.1 protein_id gnl|my_center|LOCUS_20750 68802 67594 gene locus_tag LOCUS_20760 68802 67594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 69040 69804 gene locus_tag LOCUS_20770 gene gpmA 69040 69804 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942257.1 protein_id gnl|my_center|LOCUS_20770 69854 69976 gene locus_tag LOCUS_20780 69854 69976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 70697 73285 gene locus_tag LOCUS_20790 70697 73285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 >Feature sequence21 887 1837 gene locus_tag LOCUS_20800 887 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 1864 2817 gene locus_tag LOCUS_20810 1864 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 3208 3612 gene locus_tag LOCUS_20820 3208 3612 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022524.1 protein_id gnl|my_center|LOCUS_20820 4130 4804 gene locus_tag LOCUS_20830 4130 4804 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022466.1 protein_id gnl|my_center|LOCUS_20830 5065 4980 gene locus_tag LOCUS_t00330 5065 4980 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6190 5105 gene locus_tag LOCUS_20840 6190 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 6219 7205 gene locus_tag LOCUS_20850 6219 7205 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878512.1 protein_id gnl|my_center|LOCUS_20850 8431 7202 gene locus_tag LOCUS_20860 8431 7202 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878773.1 protein_id gnl|my_center|LOCUS_20860 9794 9189 gene locus_tag LOCUS_20870 9794 9189 CDS product TIGR00454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457366.1 protein_id gnl|my_center|LOCUS_20870 10780 9782 gene locus_tag LOCUS_20880 10780 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 10978 11157 gene locus_tag LOCUS_20890 10978 11157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 11168 12292 gene locus_tag LOCUS_20900 gene ftsZ 11168 12292 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023772.1 protein_id gnl|my_center|LOCUS_20900 12655 13515 gene locus_tag LOCUS_20910 12655 13515 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902245.1 protein_id gnl|my_center|LOCUS_20910 13573 14700 gene locus_tag LOCUS_20920 13573 14700 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066217.1 protein_id gnl|my_center|LOCUS_20920 15414 14719 gene locus_tag LOCUS_20930 15414 14719 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_20930 15504 16577 gene locus_tag LOCUS_20940 15504 16577 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986796.1 protein_id gnl|my_center|LOCUS_20940 16584 17369 gene locus_tag LOCUS_20950 16584 17369 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927080.1 protein_id gnl|my_center|LOCUS_20950 17387 18067 gene locus_tag LOCUS_20960 17387 18067 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_20960 18728 18285 gene locus_tag LOCUS_20970 18728 18285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 19240 18965 gene locus_tag LOCUS_20980 gene albA 19240 18965 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878567.1 protein_id gnl|my_center|LOCUS_20980 20270 19254 gene locus_tag LOCUS_20990 gene asd 20270 19254 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020482.1 protein_id gnl|my_center|LOCUS_20990 20491 20318 gene locus_tag LOCUS_21000 20491 20318 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024079.1 protein_id gnl|my_center|LOCUS_21000 21311 20553 gene locus_tag LOCUS_21010 gene dapB 21311 20553 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024350.1 protein_id gnl|my_center|LOCUS_21010 22179 21304 gene locus_tag LOCUS_21020 gene dapA 22179 21304 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024349.1 protein_id gnl|my_center|LOCUS_21020 22377 22189 gene locus_tag LOCUS_21030 22377 22189 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878411.1 protein_id gnl|my_center|LOCUS_21030 22941 22390 gene locus_tag LOCUS_21040 22941 22390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 23529 22981 gene locus_tag LOCUS_21050 23529 22981 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320297.1 protein_id gnl|my_center|LOCUS_21050 23619 23801 gene locus_tag LOCUS_21060 23619 23801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 24802 23798 gene locus_tag LOCUS_21070 gene priL 24802 23798 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020168.1 protein_id gnl|my_center|LOCUS_21070 25545 24802 gene locus_tag LOCUS_21080 25545 24802 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903677.1 protein_id gnl|my_center|LOCUS_21080 25793 26404 gene locus_tag LOCUS_21090 25793 26404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 26382 27260 gene locus_tag LOCUS_21100 gene moaA 26382 27260 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020164.1 protein_id gnl|my_center|LOCUS_21100 27640 28149 gene locus_tag LOCUS_21110 27640 28149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 28161 29327 gene locus_tag LOCUS_21120 28161 29327 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979578.1 protein_id gnl|my_center|LOCUS_21120 30473 29358 gene locus_tag LOCUS_21130 30473 29358 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250860.1 protein_id gnl|my_center|LOCUS_21130 31973 30483 gene locus_tag LOCUS_21140 31973 30483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 32258 32860 gene locus_tag LOCUS_21150 32258 32860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 33015 33087 gene locus_tag LOCUS_t00340 33015 33087 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 33901 33506 gene locus_tag LOCUS_21160 33901 33506 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_21160 34215 33898 gene locus_tag LOCUS_21170 34215 33898 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020159.1 protein_id gnl|my_center|LOCUS_21170 34356 34490 gene locus_tag LOCUS_21180 34356 34490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 34853 36046 gene locus_tag LOCUS_21190 34853 36046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 36054 38228 gene locus_tag LOCUS_21200 36054 38228 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779460.1 protein_id gnl|my_center|LOCUS_21200 38232 38429 gene locus_tag LOCUS_21210 38232 38429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 38426 40408 gene locus_tag LOCUS_21220 38426 40408 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016398.1 protein_id gnl|my_center|LOCUS_21220 40401 40847 gene locus_tag LOCUS_21230 40401 40847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 41469 40867 gene locus_tag LOCUS_21240 41469 40867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 42132 41587 gene locus_tag LOCUS_21250 42132 41587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 42362 42526 gene locus_tag LOCUS_21260 42362 42526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 43915 42749 gene locus_tag LOCUS_21270 43915 42749 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_21270 44321 43905 gene locus_tag LOCUS_21280 44321 43905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 46365 44311 gene locus_tag LOCUS_21290 gene dndD 46365 44311 CDS product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 protein_id gnl|my_center|LOCUS_21290 47815 46394 gene locus_tag LOCUS_21300 gene dndC 47815 46394 CDS product DNA phosphorothioation system sulfurtransferase DndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109921.1 protein_id gnl|my_center|LOCUS_21300 48950 47802 gene locus_tag LOCUS_21310 gene dndB 48950 47802 CDS product DNA sulfur modification protein DndB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005134924.1 protein_id gnl|my_center|LOCUS_21310 49340 51985 gene locus_tag LOCUS_21320 49340 51985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 52088 52354 gene locus_tag LOCUS_21330 52088 52354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 52652 53728 gene locus_tag LOCUS_21340 52652 53728 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681769.1 protein_id gnl|my_center|LOCUS_21340 54097 54498 gene locus_tag LOCUS_21350 54097 54498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 54753 54574 gene locus_tag LOCUS_21360 54753 54574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 55221 54997 gene locus_tag LOCUS_21370 55221 54997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21370 55403 55780 gene locus_tag LOCUS_21380 55403 55780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 56710 56366 gene locus_tag LOCUS_21390 56710 56366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 >Feature sequence22 1459 227 gene locus_tag LOCUS_21400 1459 227 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978370.1 protein_id gnl|my_center|LOCUS_21400 1601 3148 gene locus_tag LOCUS_21410 1601 3148 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048142299.1 protein_id gnl|my_center|LOCUS_21410 3238 4773 gene locus_tag LOCUS_21420 3238 4773 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048142299.1 protein_id gnl|my_center|LOCUS_21420 5346 5612 gene locus_tag LOCUS_21430 5346 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 6529 5762 gene locus_tag LOCUS_21440 6529 5762 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020365.1 protein_id gnl|my_center|LOCUS_21440 8226 6526 gene locus_tag LOCUS_21450 8226 6526 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870682.1 protein_id gnl|my_center|LOCUS_21450 9512 8223 gene locus_tag LOCUS_21460 9512 8223 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774548.1 protein_id gnl|my_center|LOCUS_21460 9891 9502 gene locus_tag LOCUS_21470 9891 9502 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879421.1 protein_id gnl|my_center|LOCUS_21470 10496 9888 gene locus_tag LOCUS_21480 10496 9888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 11589 10501 gene locus_tag LOCUS_21490 11589 10501 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876037.1 protein_id gnl|my_center|LOCUS_21490 12041 11586 gene locus_tag LOCUS_21500 12041 11586 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876036.1 protein_id gnl|my_center|LOCUS_21500 12430 12038 gene locus_tag LOCUS_21510 12430 12038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 12669 12427 gene locus_tag LOCUS_21520 12669 12427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 13511 12666 gene locus_tag LOCUS_21530 13511 12666 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496528.1 protein_id gnl|my_center|LOCUS_21530 13716 13513 gene locus_tag LOCUS_21540 13716 13513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 14375 13722 gene locus_tag LOCUS_21550 14375 13722 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060807.1 protein_id gnl|my_center|LOCUS_21550 14967 14368 gene locus_tag LOCUS_21560 14967 14368 CDS product EhaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060806.1 protein_id gnl|my_center|LOCUS_21560 15416 14964 gene locus_tag LOCUS_21570 15416 14964 CDS product DUF2106 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496531.1 protein_id gnl|my_center|LOCUS_21570 15649 15410 gene locus_tag LOCUS_21580 15649 15410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 15876 15646 gene locus_tag LOCUS_21590 15876 15646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 16112 15873 gene locus_tag LOCUS_21600 16112 15873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 16594 16109 gene locus_tag LOCUS_21610 16594 16109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061212.1 protein_id gnl|my_center|LOCUS_21610 16997 17081 gene locus_tag LOCUS_t00350 16997 17081 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17258 18118 gene locus_tag LOCUS_21620 17258 18118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 18797 18447 gene locus_tag LOCUS_21630 18797 18447 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065894.1 protein_id gnl|my_center|LOCUS_21630 19143 20999 gene locus_tag LOCUS_21640 19143 20999 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_21640 21576 21743 gene locus_tag LOCUS_21650 21576 21743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 21757 22077 gene locus_tag LOCUS_21660 21757 22077 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022822.1 protein_id gnl|my_center|LOCUS_21660 22081 22281 gene locus_tag LOCUS_21670 22081 22281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 22288 23193 gene locus_tag LOCUS_21680 22288 23193 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107120.1 protein_id gnl|my_center|LOCUS_21680 23250 24329 gene locus_tag LOCUS_21690 23250 24329 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023833.1 protein_id gnl|my_center|LOCUS_21690 24340 24609 gene locus_tag LOCUS_21700 24340 24609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 24606 24839 gene locus_tag LOCUS_21710 24606 24839 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_21710 24836 25237 gene locus_tag LOCUS_21720 24836 25237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 25224 25466 gene locus_tag LOCUS_21730 25224 25466 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_21730 25468 25938 gene locus_tag LOCUS_21740 25468 25938 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065848.1 protein_id gnl|my_center|LOCUS_21740 25945 26412 gene locus_tag LOCUS_21750 25945 26412 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065848.1 protein_id gnl|my_center|LOCUS_21750 26422 27513 gene locus_tag LOCUS_21760 gene arsB 26422 27513 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_21760 27510 28388 gene locus_tag LOCUS_21770 27510 28388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 28405 28812 gene locus_tag LOCUS_21780 28405 28812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 28823 29593 gene locus_tag LOCUS_21790 28823 29593 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876976.1 protein_id gnl|my_center|LOCUS_21790 29610 30017 gene locus_tag LOCUS_21800 29610 30017 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_21800 30018 30365 gene locus_tag LOCUS_21810 30018 30365 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024086.1 protein_id gnl|my_center|LOCUS_21810 30744 30355 gene locus_tag LOCUS_21820 30744 30355 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021357.1 protein_id gnl|my_center|LOCUS_21820 30864 31220 gene locus_tag LOCUS_21830 30864 31220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 31208 32137 gene locus_tag LOCUS_21840 31208 32137 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_21840 32134 32889 gene locus_tag LOCUS_21850 32134 32889 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065164.1 protein_id gnl|my_center|LOCUS_21850 33218 34165 gene locus_tag LOCUS_21860 33218 34165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 34177 34491 gene locus_tag LOCUS_21870 34177 34491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 34484 36478 gene locus_tag LOCUS_21880 34484 36478 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060932.1 protein_id gnl|my_center|LOCUS_21880 36472 37914 gene locus_tag LOCUS_21890 36472 37914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 37929 38537 gene locus_tag LOCUS_21900 37929 38537 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868883.1 protein_id gnl|my_center|LOCUS_21900 38534 39697 gene locus_tag LOCUS_21910 38534 39697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 39694 40026 gene locus_tag LOCUS_21920 39694 40026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 40023 41816 gene locus_tag LOCUS_21930 40023 41816 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876586.1 protein_id gnl|my_center|LOCUS_21930 41809 43227 gene locus_tag LOCUS_21940 41809 43227 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_21940 43229 43870 gene locus_tag LOCUS_21950 43229 43870 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357673.1 protein_id gnl|my_center|LOCUS_21950 44041 44580 gene locus_tag LOCUS_21960 44041 44580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 44577 45293 gene locus_tag LOCUS_21970 44577 45293 CDS product aromatic aminobenezylarsenical efflux permease ArsG family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107126.1 protein_id gnl|my_center|LOCUS_21970 46846 45716 gene locus_tag LOCUS_21980 46846 45716 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903688.1 protein_id gnl|my_center|LOCUS_21980 47255 47013 gene locus_tag LOCUS_21990 47255 47013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 47437 47943 gene locus_tag LOCUS_22000 47437 47943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 50011 48095 gene locus_tag LOCUS_22010 50011 48095 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095325.1 protein_id gnl|my_center|LOCUS_22010 50278 50892 gene locus_tag LOCUS_22020 50278 50892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022016.1 protein_id gnl|my_center|LOCUS_22020 51043 51879 gene locus_tag LOCUS_22030 51043 51879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 >Feature sequence23 407 2398 gene locus_tag LOCUS_22040 407 2398 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024232.1 protein_id gnl|my_center|LOCUS_22040 2486 3688 gene locus_tag LOCUS_22050 2486 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 3743 4654 gene locus_tag LOCUS_22060 gene nifB 3743 4654 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024080.1 protein_id gnl|my_center|LOCUS_22060 4688 5578 gene locus_tag LOCUS_22070 4688 5578 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_22070 6297 5584 gene locus_tag LOCUS_22080 6297 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 7139 6297 gene locus_tag LOCUS_22090 7139 6297 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393323.1 protein_id gnl|my_center|LOCUS_22090 7935 7108 gene locus_tag LOCUS_22100 gene modA 7935 7108 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393324.1 protein_id gnl|my_center|LOCUS_22100 8594 8316 gene locus_tag LOCUS_22110 8594 8316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 10484 9258 gene locus_tag LOCUS_22120 10484 9258 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021296.1 protein_id gnl|my_center|LOCUS_22120 11028 10780 gene locus_tag LOCUS_22130 11028 10780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 11254 12060 gene locus_tag LOCUS_22140 gene hisF 11254 12060 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878322.1 protein_id gnl|my_center|LOCUS_22140 13657 12017 gene locus_tag LOCUS_22150 gene pheT 13657 12017 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021951.1 protein_id gnl|my_center|LOCUS_22150 15104 13659 gene locus_tag LOCUS_22160 15104 13659 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020229.1 protein_id gnl|my_center|LOCUS_22160 16363 15107 gene locus_tag LOCUS_22170 16363 15107 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020230.1 protein_id gnl|my_center|LOCUS_22170 17384 16374 gene locus_tag LOCUS_22180 gene endA 17384 16374 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023532.1 protein_id gnl|my_center|LOCUS_22180 17516 18697 gene locus_tag LOCUS_22190 17516 18697 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583649.1 protein_id gnl|my_center|LOCUS_22190 20839 18722 gene locus_tag LOCUS_22200 20839 18722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 22003 21155 gene locus_tag LOCUS_22210 22003 21155 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_22210 22997 22029 gene locus_tag LOCUS_22220 22997 22029 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023652.1 protein_id gnl|my_center|LOCUS_22220 23796 22975 gene locus_tag LOCUS_22230 23796 22975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023654.1 protein_id gnl|my_center|LOCUS_22230 24263 23793 gene locus_tag LOCUS_22240 gene hacB 24263 23793 CDS product homoaconitase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876462.1 protein_id gnl|my_center|LOCUS_22240 25474 24263 gene locus_tag LOCUS_22250 gene hacA 25474 24263 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066440.1 protein_id gnl|my_center|LOCUS_22250 26601 25471 gene locus_tag LOCUS_22260 26601 25471 CDS product homocitrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023272.1 protein_id gnl|my_center|LOCUS_22260 27829 26573 gene locus_tag LOCUS_22270 27829 26573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 28797 27826 gene locus_tag LOCUS_22280 28797 27826 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066092.1 protein_id gnl|my_center|LOCUS_22280 29672 28779 gene locus_tag LOCUS_22290 29672 28779 CDS product DUF1743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021976.1 protein_id gnl|my_center|LOCUS_22290 30612 29656 gene locus_tag LOCUS_22300 30612 29656 CDS product DUF1743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877003.1 protein_id gnl|my_center|LOCUS_22300 30745 31101 gene locus_tag LOCUS_22310 30745 31101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 32441 31533 gene locus_tag LOCUS_22320 gene fhcD 32441 31533 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061010.1 protein_id gnl|my_center|LOCUS_22320 33221 33493 gene locus_tag LOCUS_22330 33221 33493 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870680.1 protein_id gnl|my_center|LOCUS_22330 33509 34678 gene locus_tag LOCUS_22340 33509 34678 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870679.1 protein_id gnl|my_center|LOCUS_22340 34689 35270 gene locus_tag LOCUS_22350 gene hdrC 34689 35270 CDS product CoB--CoM heterodisulfide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261191.1 protein_id gnl|my_center|LOCUS_22350 35275 36177 gene locus_tag LOCUS_22360 gene hdrB 35275 36177 CDS product CoB--CoM heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870248.1 protein_id gnl|my_center|LOCUS_22360 36189 38210 gene locus_tag LOCUS_22370 gene hdrA 36189 38210 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_22370 38211 38636 gene locus_tag LOCUS_22380 38211 38636 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_22380 38663 39064 gene locus_tag LOCUS_22390 38663 39064 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870681.1 protein_id gnl|my_center|LOCUS_22390 39061 40374 gene locus_tag LOCUS_22400 39061 40374 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774548.1 protein_id gnl|my_center|LOCUS_22400 40378 42084 gene locus_tag LOCUS_22410 40378 42084 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870682.1 protein_id gnl|my_center|LOCUS_22410 42095 42901 gene locus_tag LOCUS_22420 42095 42901 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877167.1 protein_id gnl|my_center|LOCUS_22420 43265 44569 gene locus_tag LOCUS_22430 gene mcrB 43265 44569 CDS product coenzyme-B sulfoethylthiotransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024423.1 protein_id gnl|my_center|LOCUS_22430 44586 45062 gene locus_tag LOCUS_22440 gene mcrD 44586 45062 CDS product methyl-coenzyme M reductase operon protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876755.1 protein_id gnl|my_center|LOCUS_22440 45064 45693 gene locus_tag LOCUS_22450 gene mcrC 45064 45693 CDS product methyl-coenzyme M reductase I operon protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024421.1 protein_id gnl|my_center|LOCUS_22450 45702 46463 gene locus_tag LOCUS_22460 gene mcrG 45702 46463 CDS product coenzyme-B sulfoethylthiotransferase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060982.1 protein_id gnl|my_center|LOCUS_22460 46471 48177 gene locus_tag LOCUS_22470 gene mcrA 46471 48177 CDS product coenzyme-B sulfoethylthiotransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870360.1 protein_id gnl|my_center|LOCUS_22470 48372 49268 gene locus_tag LOCUS_22480 gene mtrE 48372 49268 CDS product tetrahydromethanopterin S-methyltransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870361.1 protein_id gnl|my_center|LOCUS_22480 49265 50116 gene locus_tag LOCUS_22490 gene mtrD 49265 50116 CDS product tetrahydromethanopterin S-methyltransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020333.1 protein_id gnl|my_center|LOCUS_22490 50117 50968 gene locus_tag LOCUS_22500 gene mtrC 50117 50968 CDS product tetrahydromethanopterin S-methyltransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020332.1 protein_id gnl|my_center|LOCUS_22500 50969 51253 gene locus_tag LOCUS_22510 50969 51253 CDS product tetrahydromethanopterin S-methyltransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876784.1 protein_id gnl|my_center|LOCUS_22510 >Feature sequence24 400 963 gene locus_tag LOCUS_22520 400 963 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023239.1 protein_id gnl|my_center|LOCUS_22520 957 1469 gene locus_tag LOCUS_22530 gene pyrE 957 1469 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868222.1 protein_id gnl|my_center|LOCUS_22530 1493 2788 gene locus_tag LOCUS_22540 gene purD 1493 2788 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065667.1 protein_id gnl|my_center|LOCUS_22540 2785 3714 gene locus_tag LOCUS_22550 gene argF 2785 3714 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878750.1 protein_id gnl|my_center|LOCUS_22550 4788 4555 gene locus_tag LOCUS_22560 4788 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 6297 4801 gene locus_tag LOCUS_22570 6297 4801 CDS product methanogenesis marker 14 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024395.1 protein_id gnl|my_center|LOCUS_22570 7143 7547 gene locus_tag LOCUS_22580 7143 7547 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022524.1 protein_id gnl|my_center|LOCUS_22580 8743 7556 gene locus_tag LOCUS_22590 8743 7556 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022128.1 protein_id gnl|my_center|LOCUS_22590 9173 10432 gene locus_tag LOCUS_22600 9173 10432 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172728.1 protein_id gnl|my_center|LOCUS_22600 10419 11261 gene locus_tag LOCUS_22610 10419 11261 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022132.1 protein_id gnl|my_center|LOCUS_22610 11662 12537 gene locus_tag LOCUS_22620 11662 12537 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022133.1 protein_id gnl|my_center|LOCUS_22620 16363 13193 gene locus_tag LOCUS_22630 gene carB 16363 13193 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022129.1 protein_id gnl|my_center|LOCUS_22630 17418 16363 gene locus_tag LOCUS_22640 gene carA 17418 16363 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022130.1 protein_id gnl|my_center|LOCUS_22640 17563 18444 gene locus_tag LOCUS_22650 17563 18444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 18473 18817 gene locus_tag LOCUS_22660 18473 18817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 19395 18814 gene locus_tag LOCUS_22670 19395 18814 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940745.1 protein_id gnl|my_center|LOCUS_22670 21373 19730 gene locus_tag LOCUS_22680 gene ilvD 21373 19730 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496775.1 protein_id gnl|my_center|LOCUS_22680 23203 22634 gene locus_tag LOCUS_22690 23203 22634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 23975 23244 gene locus_tag LOCUS_22700 23975 23244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 23892 24194 gene locus_tag LOCUS_22710 23892 24194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 24683 24246 gene locus_tag LOCUS_22720 24683 24246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 26137 25250 gene locus_tag LOCUS_22730 26137 25250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 27468 26326 gene locus_tag LOCUS_22740 gene dnaJ 27468 26326 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_22740 29300 27474 gene locus_tag LOCUS_22750 gene dnaK 29300 27474 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_22750 29814 29305 gene locus_tag LOCUS_22760 29814 29305 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_22760 30082 31566 gene locus_tag LOCUS_22770 gene purH 30082 31566 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545749.1 protein_id gnl|my_center|LOCUS_22770 31544 32230 gene locus_tag LOCUS_22780 31544 32230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 32149 32337 gene locus_tag LOCUS_22790 32149 32337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 32518 33192 gene locus_tag LOCUS_22800 32518 33192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 33282 34793 gene locus_tag LOCUS_22810 33282 34793 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589535.1 protein_id gnl|my_center|LOCUS_22810 34765 36441 gene locus_tag LOCUS_22820 34765 36441 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_22820 36438 36941 gene locus_tag LOCUS_22830 gene ilvN 36438 36941 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_22830 37149 38735 gene locus_tag LOCUS_22840 37149 38735 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274408.1 protein_id gnl|my_center|LOCUS_22840 38873 39760 gene locus_tag LOCUS_22850 38873 39760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 39757 40560 gene locus_tag LOCUS_22860 39757 40560 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434727.1 protein_id gnl|my_center|LOCUS_22860 40799 42118 gene locus_tag LOCUS_22870 40799 42118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 42115 43092 gene locus_tag LOCUS_22880 42115 43092 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583324.1 protein_id gnl|my_center|LOCUS_22880 43089 43787 gene locus_tag LOCUS_22890 43089 43787 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228266.1 protein_id gnl|my_center|LOCUS_22890 43986 44192 gene locus_tag LOCUS_22900 43986 44192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 >Feature sequence25 392 1429 gene locus_tag LOCUS_22910 gene mtrH 392 1429 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020327.1 protein_id gnl|my_center|LOCUS_22910 1544 1822 gene locus_tag LOCUS_22920 1544 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 2140 1961 gene locus_tag LOCUS_22930 2140 1961 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755892.1 protein_id gnl|my_center|LOCUS_22930 3564 2569 gene locus_tag LOCUS_22940 3564 2569 CDS product EF-Tu/IF-2/RF-3 family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869822.1 protein_id gnl|my_center|LOCUS_22940 3718 4668 gene locus_tag LOCUS_22950 3718 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 4665 5936 gene locus_tag LOCUS_22960 4665 5936 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932623.1 protein_id gnl|my_center|LOCUS_22960 6762 6481 gene locus_tag LOCUS_22970 6762 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 7036 7365 gene locus_tag LOCUS_22980 7036 7365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 8154 7648 gene locus_tag LOCUS_22990 8154 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 8634 9251 gene locus_tag LOCUS_23000 8634 9251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 9248 9937 gene locus_tag LOCUS_23010 9248 9937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 12190 10340 gene locus_tag LOCUS_23020 12190 10340 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948377.1 protein_id gnl|my_center|LOCUS_23020 12323 16075 gene locus_tag LOCUS_23030 gene cobN 12323 16075 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932109.1 protein_id gnl|my_center|LOCUS_23030 16151 17107 gene locus_tag LOCUS_23040 16151 17107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 17071 17829 gene locus_tag LOCUS_23050 17071 17829 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020911.1 protein_id gnl|my_center|LOCUS_23050 18272 18078 gene locus_tag LOCUS_23060 18272 18078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 19743 18463 gene locus_tag LOCUS_23070 19743 18463 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022026.1 protein_id gnl|my_center|LOCUS_23070 21926 19740 gene locus_tag LOCUS_23080 21926 19740 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022025.1 protein_id gnl|my_center|LOCUS_23080 22950 21913 gene locus_tag LOCUS_23090 22950 21913 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256222.1 protein_id gnl|my_center|LOCUS_23090 24068 22947 gene locus_tag LOCUS_23100 24068 22947 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256221.1 protein_id gnl|my_center|LOCUS_23100 25318 24065 gene locus_tag LOCUS_23110 25318 24065 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_23110 27207 25318 gene locus_tag LOCUS_23120 27207 25318 CDS product magnesium chelatase subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932111.1 protein_id gnl|my_center|LOCUS_23120 28247 27204 gene locus_tag LOCUS_23130 28247 27204 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461434.1 protein_id gnl|my_center|LOCUS_23130 29394 28258 gene locus_tag LOCUS_23140 29394 28258 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932105.1 protein_id gnl|my_center|LOCUS_23140 29862 31454 gene locus_tag LOCUS_23150 29862 31454 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878496.1 protein_id gnl|my_center|LOCUS_23150 31438 33255 gene locus_tag LOCUS_23160 31438 33255 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878495.1 protein_id gnl|my_center|LOCUS_23160 33258 33665 gene locus_tag LOCUS_23170 33258 33665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 33666 34604 gene locus_tag LOCUS_23180 33666 34604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 35120 35650 gene locus_tag LOCUS_23190 35120 35650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 36021 35680 gene locus_tag LOCUS_23200 36021 35680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 36083 37186 gene locus_tag LOCUS_23210 36083 37186 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249816.1 protein_id gnl|my_center|LOCUS_23210 37204 37938 gene locus_tag LOCUS_23220 37204 37938 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871139.1 protein_id gnl|my_center|LOCUS_23220 38343 37945 gene locus_tag LOCUS_23230 38343 37945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 39135 38350 gene locus_tag LOCUS_23240 39135 38350 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065114.1 protein_id gnl|my_center|LOCUS_23240 40598 39066 gene locus_tag LOCUS_23250 40598 39066 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021434.1 protein_id gnl|my_center|LOCUS_23250 41154 40588 gene locus_tag LOCUS_23260 41154 40588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065113.1 protein_id gnl|my_center|LOCUS_23260 42291 41638 gene locus_tag LOCUS_23270 42291 41638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 43252 42260 gene locus_tag LOCUS_23280 43252 42260 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881382.1 protein_id gnl|my_center|LOCUS_23280 >Feature sequence26 551 282 gene locus_tag LOCUS_23290 551 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 573 1205 gene locus_tag LOCUS_23300 573 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 1315 1713 gene locus_tag LOCUS_23310 1315 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 1826 2545 gene locus_tag LOCUS_23320 1826 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 2788 2564 gene locus_tag LOCUS_23330 2788 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 3785 2781 gene locus_tag LOCUS_23340 3785 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 4324 5229 gene locus_tag LOCUS_23350 4324 5229 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249310.1 protein_id gnl|my_center|LOCUS_23350 5233 6336 gene locus_tag LOCUS_23360 5233 6336 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878633.1 protein_id gnl|my_center|LOCUS_23360 6338 7771 gene locus_tag LOCUS_23370 6338 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 10665 7849 gene locus_tag LOCUS_23380 10665 7849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 10821 11513 gene locus_tag LOCUS_23390 10821 11513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 12555 11527 gene locus_tag LOCUS_23400 12555 11527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 12781 13524 gene locus_tag LOCUS_23410 12781 13524 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020313.1 protein_id gnl|my_center|LOCUS_23410 13533 13811 gene locus_tag LOCUS_23420 gene moaD 13533 13811 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251068.1 protein_id gnl|my_center|LOCUS_23420 13827 14240 gene locus_tag LOCUS_23430 13827 14240 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251065.1 protein_id gnl|my_center|LOCUS_23430 14237 15451 gene locus_tag LOCUS_23440 14237 15451 CDS product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876618.1 protein_id gnl|my_center|LOCUS_23440 15414 16067 gene locus_tag LOCUS_23450 15414 16067 CDS product TfuA-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020222.1 protein_id gnl|my_center|LOCUS_23450 16541 16233 gene locus_tag LOCUS_23460 16541 16233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 16736 16575 gene locus_tag LOCUS_23470 16736 16575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 16763 17086 gene locus_tag LOCUS_23480 16763 17086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 17073 17414 gene locus_tag LOCUS_23490 17073 17414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 18063 17725 gene locus_tag LOCUS_23500 18063 17725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 18566 18078 gene locus_tag LOCUS_23510 18566 18078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 18695 19987 gene locus_tag LOCUS_23520 gene rbcL 18695 19987 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146906.1 protein_id gnl|my_center|LOCUS_23520 21209 20484 gene locus_tag LOCUS_23530 21209 20484 CDS product DUF5591 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020965.1 protein_id gnl|my_center|LOCUS_23530 21456 24260 gene locus_tag LOCUS_23540 gene uvrA 21456 24260 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023257.1 protein_id gnl|my_center|LOCUS_23540 24257 25807 gene locus_tag LOCUS_23550 gene uvrC 24257 25807 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023256.1 protein_id gnl|my_center|LOCUS_23550 25804 27744 gene locus_tag LOCUS_23560 gene uvrB 25804 27744 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023255.1 protein_id gnl|my_center|LOCUS_23560 28412 28185 gene locus_tag LOCUS_23570 28412 28185 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023998.1 protein_id gnl|my_center|LOCUS_23570 29772 28498 gene locus_tag LOCUS_23580 29772 28498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 30645 29854 gene locus_tag LOCUS_23590 30645 29854 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529713.1 protein_id gnl|my_center|LOCUS_23590 31602 31108 gene locus_tag LOCUS_23600 31602 31108 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249766.1 protein_id gnl|my_center|LOCUS_23600 31819 33135 gene locus_tag LOCUS_23610 31819 33135 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140384.1 protein_id gnl|my_center|LOCUS_23610 34443 33928 gene locus_tag LOCUS_23620 34443 33928 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933554.1 protein_id gnl|my_center|LOCUS_23620 37643 34440 gene locus_tag LOCUS_23630 37643 34440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 38329 37934 gene locus_tag LOCUS_23640 38329 37934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 38876 38439 gene locus_tag LOCUS_23650 38876 38439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 39274 38876 gene locus_tag LOCUS_23660 39274 38876 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020302.1 protein_id gnl|my_center|LOCUS_23660 39318 40490 gene locus_tag LOCUS_23670 39318 40490 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289167.1 protein_id gnl|my_center|LOCUS_23670 41024 41533 gene locus_tag LOCUS_23680 41024 41533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 41965 42561 gene locus_tag LOCUS_23690 41965 42561 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506639.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence27 2188 1937 gene locus_tag LOCUS_23700 2188 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 2310 2489 gene locus_tag LOCUS_23710 2310 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 3178 2498 gene locus_tag LOCUS_23720 3178 2498 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870952.1 protein_id gnl|my_center|LOCUS_23720 4770 3178 gene locus_tag LOCUS_23730 4770 3178 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 protein_id gnl|my_center|LOCUS_23730 5166 6356 gene locus_tag LOCUS_23740 5166 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 6366 7598 gene locus_tag LOCUS_23750 6366 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 7820 7650 gene locus_tag LOCUS_23760 7820 7650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 8101 8622 gene locus_tag LOCUS_23770 8101 8622 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867756.1 protein_id gnl|my_center|LOCUS_23770 10050 8653 gene locus_tag LOCUS_23780 10050 8653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 10412 10888 gene locus_tag LOCUS_23790 10412 10888 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876721.1 protein_id gnl|my_center|LOCUS_23790 10941 11933 gene locus_tag LOCUS_23800 10941 11933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 12477 11935 gene locus_tag LOCUS_23810 12477 11935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 12568 13446 gene locus_tag LOCUS_23820 12568 13446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 14703 13453 gene locus_tag LOCUS_23830 14703 13453 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020830.1 protein_id gnl|my_center|LOCUS_23830 15795 14788 gene locus_tag LOCUS_23840 15795 14788 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021397.1 protein_id gnl|my_center|LOCUS_23840 15934 18033 gene locus_tag LOCUS_23850 15934 18033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 18040 18804 gene locus_tag LOCUS_23860 gene pstB 18040 18804 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020934.1 protein_id gnl|my_center|LOCUS_23860 18812 19462 gene locus_tag LOCUS_23870 gene phoU 18812 19462 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_23870 20453 19485 gene locus_tag LOCUS_23880 20453 19485 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966531.1 protein_id gnl|my_center|LOCUS_23880 20452 20760 gene locus_tag LOCUS_23890 20452 20760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 22139 21177 gene locus_tag LOCUS_23900 22139 21177 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876261.1 protein_id gnl|my_center|LOCUS_23900 23592 22918 gene locus_tag LOCUS_23910 23592 22918 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021328.1 protein_id gnl|my_center|LOCUS_23910 24313 23657 gene locus_tag LOCUS_23920 24313 23657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 24576 26306 gene locus_tag LOCUS_23930 gene glyS 24576 26306 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096515.1 protein_id gnl|my_center|LOCUS_23930 26303 28552 gene locus_tag LOCUS_23940 26303 28552 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878955.1 protein_id gnl|my_center|LOCUS_23940 28923 28543 gene locus_tag LOCUS_23950 28923 28543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 28990 29253 gene locus_tag LOCUS_23960 28990 29253 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064806.1 protein_id gnl|my_center|LOCUS_23960 29803 29390 gene locus_tag LOCUS_23970 29803 29390 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_23970 29996 30211 gene locus_tag LOCUS_23980 29996 30211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 32758 30329 gene locus_tag LOCUS_23990 gene gyrA 32758 30329 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_23990 34718 32748 gene locus_tag LOCUS_24000 gene gyrB 34718 32748 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021594.1 protein_id gnl|my_center|LOCUS_24000 35248 34934 gene locus_tag LOCUS_24010 35248 34934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 36636 35821 gene locus_tag LOCUS_24020 gene cbiQ 36636 35821 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023913.1 protein_id gnl|my_center|LOCUS_24020 37466 36633 gene locus_tag LOCUS_24030 37466 36633 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023914.1 protein_id gnl|my_center|LOCUS_24030 37847 37497 gene locus_tag LOCUS_24040 37847 37497 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065875.1 protein_id gnl|my_center|LOCUS_24040 38485 37847 gene locus_tag LOCUS_24050 gene cbiM 38485 37847 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065876.1 protein_id gnl|my_center|LOCUS_24050 39682 38549 gene locus_tag LOCUS_24060 39682 38549 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_24060 39117 39026 gene locus_tag LOCUS_t00360 39117 39026 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence28 994 2076 gene locus_tag LOCUS_24070 994 2076 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878512.1 protein_id gnl|my_center|LOCUS_24070 4826 2679 gene locus_tag LOCUS_24080 4826 2679 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 protein_id gnl|my_center|LOCUS_24080 6019 4823 gene locus_tag LOCUS_24090 6019 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 7212 6004 gene locus_tag LOCUS_24100 7212 6004 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461038.1 protein_id gnl|my_center|LOCUS_24100 8645 7287 gene locus_tag LOCUS_24110 8645 7287 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869927.1 protein_id gnl|my_center|LOCUS_24110 9759 8680 gene locus_tag LOCUS_24120 gene wecB 9759 8680 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_24120 10715 9798 gene locus_tag LOCUS_24130 10715 9798 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876013.1 protein_id gnl|my_center|LOCUS_24130 12171 11362 gene locus_tag LOCUS_24140 gene truA 12171 11362 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249878.1 protein_id gnl|my_center|LOCUS_24140 12833 12168 gene locus_tag LOCUS_24150 12833 12168 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289241.1 protein_id gnl|my_center|LOCUS_24150 12878 14302 gene locus_tag LOCUS_24160 12878 14302 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023773.1 protein_id gnl|my_center|LOCUS_24160 14547 15827 gene locus_tag LOCUS_24170 14547 15827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 15957 16292 gene locus_tag LOCUS_24180 15957 16292 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250213.1 protein_id gnl|my_center|LOCUS_24180 16289 16729 gene locus_tag LOCUS_24190 16289 16729 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064389.1 protein_id gnl|my_center|LOCUS_24190 16777 17457 gene locus_tag LOCUS_24200 16777 17457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 17825 19309 gene locus_tag LOCUS_24210 17825 19309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 20002 19319 gene locus_tag LOCUS_24220 20002 19319 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879203.1 protein_id gnl|my_center|LOCUS_24220 20128 20727 gene locus_tag LOCUS_24230 20128 20727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 20896 21168 gene locus_tag LOCUS_24240 20896 21168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 21548 21165 gene locus_tag LOCUS_24250 21548 21165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 21878 22840 gene locus_tag LOCUS_24260 21878 22840 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023151.1 protein_id gnl|my_center|LOCUS_24260 23063 23362 gene locus_tag LOCUS_24270 23063 23362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 24416 23490 gene locus_tag LOCUS_24280 24416 23490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 24619 25227 gene locus_tag LOCUS_24290 24619 25227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 25354 26046 gene locus_tag LOCUS_24300 25354 26046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 27535 26066 gene locus_tag LOCUS_24310 27535 26066 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932680.1 protein_id gnl|my_center|LOCUS_24310 28455 27616 gene locus_tag LOCUS_24320 28455 27616 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066550.1 protein_id gnl|my_center|LOCUS_24320 28918 30102 gene locus_tag LOCUS_24330 28918 30102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 30305 30898 gene locus_tag LOCUS_24340 30305 30898 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022152.1 protein_id gnl|my_center|LOCUS_24340 31489 30962 gene locus_tag LOCUS_24350 31489 30962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 31909 31505 gene locus_tag LOCUS_24360 31909 31505 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064953.1 protein_id gnl|my_center|LOCUS_24360 33377 32013 gene locus_tag LOCUS_24370 33377 32013 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_24370 33659 33387 gene locus_tag LOCUS_24380 33659 33387 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053740.1 protein_id gnl|my_center|LOCUS_24380 33824 34156 gene locus_tag LOCUS_24390 33824 34156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 34845 35246 gene locus_tag LOCUS_24400 34845 35246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 35284 35466 gene locus_tag LOCUS_24410 35284 35466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 35640 36047 gene locus_tag LOCUS_24420 35640 36047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 36816 36406 gene locus_tag LOCUS_24430 36816 36406 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227906.1 protein_id gnl|my_center|LOCUS_24430 36858 37127 gene locus_tag LOCUS_24440 36858 37127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 37292 38449 gene locus_tag LOCUS_24450 37292 38449 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940843.1 protein_id gnl|my_center|LOCUS_24450 38460 38951 gene locus_tag LOCUS_24460 38460 38951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 >Feature sequence29 406 861 gene locus_tag LOCUS_24470 406 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 2134 947 gene locus_tag LOCUS_24480 2134 947 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173522.1 protein_id gnl|my_center|LOCUS_24480 2243 3439 gene locus_tag LOCUS_24490 2243 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 3863 3405 gene locus_tag LOCUS_24500 3863 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 4030 5430 gene locus_tag LOCUS_24510 4030 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 6083 5856 gene locus_tag LOCUS_24520 6083 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 6401 6329 gene locus_tag LOCUS_t00370 6401 6329 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7911 6559 gene locus_tag LOCUS_24530 7911 6559 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250060.1 protein_id gnl|my_center|LOCUS_24530 8633 8190 gene locus_tag LOCUS_24540 8633 8190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 9121 8747 gene locus_tag LOCUS_24550 9121 8747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24550 9684 9397 gene locus_tag LOCUS_24560 9684 9397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24560 10954 9974 gene locus_tag LOCUS_24570 10954 9974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 12312 12857 gene locus_tag LOCUS_24580 12312 12857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 12854 13612 gene locus_tag LOCUS_24590 12854 13612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 13618 14973 gene locus_tag LOCUS_24600 gene glmM 13618 14973 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868348.1 protein_id gnl|my_center|LOCUS_24600 15275 18841 gene locus_tag LOCUS_24610 15275 18841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 18838 19125 gene locus_tag LOCUS_24620 18838 19125 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081975.1 protein_id gnl|my_center|LOCUS_24620 20042 19107 gene locus_tag LOCUS_24630 gene cas1 20042 19107 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546247.1 protein_id gnl|my_center|LOCUS_24630 20385 20083 gene locus_tag LOCUS_24640 20385 20083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 20490 21779 gene locus_tag LOCUS_24650 20490 21779 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879505.1 protein_id gnl|my_center|LOCUS_24650 21779 23080 gene locus_tag LOCUS_24660 21779 23080 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023751.1 protein_id gnl|my_center|LOCUS_24660 23080 23511 gene locus_tag LOCUS_24670 23080 23511 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023752.1 protein_id gnl|my_center|LOCUS_24670 25420 24131 gene locus_tag LOCUS_24680 25420 24131 CDS product bifunctional hexulose-6-phosphate synthase/ribonuclease regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878362.1 protein_id gnl|my_center|LOCUS_24680 26009 25692 gene locus_tag LOCUS_24690 26009 25692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 26138 26545 gene locus_tag LOCUS_24700 26138 26545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24700 27403 27065 gene locus_tag LOCUS_24710 27403 27065 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064662.1 protein_id gnl|my_center|LOCUS_24710 28610 27414 gene locus_tag LOCUS_24720 28610 27414 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879245.1 protein_id gnl|my_center|LOCUS_24720 29370 29032 gene locus_tag LOCUS_24730 29370 29032 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064662.1 protein_id gnl|my_center|LOCUS_24730 30574 29381 gene locus_tag LOCUS_24740 30574 29381 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879245.1 protein_id gnl|my_center|LOCUS_24740 30878 32341 gene locus_tag LOCUS_24750 30878 32341 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879242.1 protein_id gnl|my_center|LOCUS_24750 32338 32676 gene locus_tag LOCUS_24760 32338 32676 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024093.1 protein_id gnl|my_center|LOCUS_24760 32880 33473 gene locus_tag LOCUS_24770 32880 33473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 33973 33833 gene locus_tag LOCUS_24780 33973 33833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 34521 34054 gene locus_tag LOCUS_24790 34521 34054 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582742.1 protein_id gnl|my_center|LOCUS_24790 35854 34658 gene locus_tag LOCUS_24800 35854 34658 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020067.1 protein_id gnl|my_center|LOCUS_24800 36389 35847 gene locus_tag LOCUS_24810 36389 35847 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902169.1 protein_id gnl|my_center|LOCUS_24810 36931 36377 gene locus_tag LOCUS_24820 36931 36377 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024463.1 protein_id gnl|my_center|LOCUS_24820 37934 36969 gene locus_tag LOCUS_24830 37934 36969 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867162.1 protein_id gnl|my_center|LOCUS_24830 >Feature sequence30 <1 887 gene locus_tag LOCUS_24840 <1 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000495305.1:exopolysaccharide biosynthesis protein VpsH 893 2002 gene locus_tag LOCUS_24850 893 2002 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940714.1 protein_id gnl|my_center|LOCUS_24850 2278 3075 gene locus_tag LOCUS_24860 gene porB 2278 3075 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762255.1 protein_id gnl|my_center|LOCUS_24860 3069 4181 gene locus_tag LOCUS_24870 3069 4181 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250930.1 protein_id gnl|my_center|LOCUS_24870 4174 4701 gene locus_tag LOCUS_24880 4174 4701 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_24880 4698 4943 gene locus_tag LOCUS_24890 4698 4943 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762253.1 protein_id gnl|my_center|LOCUS_24890 5310 4921 gene locus_tag LOCUS_24900 5310 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496739.1 protein_id gnl|my_center|LOCUS_24900 5470 5772 gene locus_tag LOCUS_24910 5470 5772 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065930.1 protein_id gnl|my_center|LOCUS_24910 6479 7903 gene locus_tag LOCUS_24920 6479 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 7913 9019 gene locus_tag LOCUS_24930 7913 9019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 9031 13359 gene locus_tag LOCUS_24940 9031 13359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 13362 15656 gene locus_tag LOCUS_24950 13362 15656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 15680 19333 gene locus_tag LOCUS_24960 15680 19333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098509933.1 protein_id gnl|my_center|LOCUS_24960 19674 21839 gene locus_tag LOCUS_24970 19674 21839 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_24970 22203 22496 gene locus_tag LOCUS_24980 22203 22496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 22763 23788 gene locus_tag LOCUS_24990 22763 23788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 23721 24449 gene locus_tag LOCUS_25000 23721 24449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 24644 24913 gene locus_tag LOCUS_25010 24644 24913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 25080 25400 gene locus_tag LOCUS_25020 25080 25400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 25773 26093 gene locus_tag LOCUS_25030 25773 26093 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_25030 26077 26430 gene locus_tag LOCUS_25040 26077 26430 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_25040 26427 26609 gene locus_tag LOCUS_25050 26427 26609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 26606 26770 gene locus_tag LOCUS_25060 26606 26770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 27711 27481 gene locus_tag LOCUS_25070 27711 27481 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250461.1 protein_id gnl|my_center|LOCUS_25070 27970 27698 gene locus_tag LOCUS_25080 27970 27698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 29779 28409 gene locus_tag LOCUS_25090 29779 28409 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022297.1 protein_id gnl|my_center|LOCUS_25090 31982 29934 gene locus_tag LOCUS_25100 31982 29934 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226412.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence31 896 288 gene locus_tag LOCUS_25110 gene hisH 896 288 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020951.1 protein_id gnl|my_center|LOCUS_25110 2280 871 gene locus_tag LOCUS_25120 2280 871 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496383.1 protein_id gnl|my_center|LOCUS_25120 2745 3041 gene locus_tag LOCUS_25130 2745 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 4909 3398 gene locus_tag LOCUS_25140 4909 3398 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903259.1 protein_id gnl|my_center|LOCUS_25140 4996 5241 gene locus_tag LOCUS_25150 4996 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 5543 7939 gene locus_tag LOCUS_25160 5543 7939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 8015 10165 gene locus_tag LOCUS_25170 8015 10165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 10372 11520 gene locus_tag LOCUS_25180 10372 11520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 12015 13010 gene locus_tag LOCUS_25190 12015 13010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 13213 13437 gene locus_tag LOCUS_25200 13213 13437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 13616 13759 gene locus_tag LOCUS_25210 13616 13759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 13738 14019 gene locus_tag LOCUS_25220 13738 14019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 14012 14353 gene locus_tag LOCUS_25230 14012 14353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 14350 17223 gene locus_tag LOCUS_25240 14350 17223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 17530 18135 gene locus_tag LOCUS_25250 17530 18135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 18421 19446 gene locus_tag LOCUS_25260 18421 19446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 19379 20110 gene locus_tag LOCUS_25270 19379 20110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 20250 20567 gene locus_tag LOCUS_25280 20250 20567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 20688 23660 gene locus_tag LOCUS_25290 20688 23660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 23937 25490 gene locus_tag LOCUS_25300 23937 25490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 26148 25552 gene locus_tag LOCUS_25310 26148 25552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 27299 27144 gene locus_tag LOCUS_25320 27299 27144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 27435 27698 gene locus_tag LOCUS_25330 27435 27698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 27699 28025 gene locus_tag LOCUS_25340 27699 28025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 28025 28168 gene locus_tag LOCUS_25350 28025 28168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 28165 28320 gene locus_tag LOCUS_25360 28165 28320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 28323 29288 gene locus_tag LOCUS_25370 28323 29288 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011313588.1 protein_id gnl|my_center|LOCUS_25370 >Feature sequence32 4488 361 gene locus_tag LOCUS_25380 4488 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 5093 4776 gene locus_tag LOCUS_25390 5093 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 5841 5236 gene locus_tag LOCUS_25400 5841 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 6149 6661 gene locus_tag LOCUS_25410 6149 6661 CDS product DUF1887 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250154.1 protein_id gnl|my_center|LOCUS_25410 6658 7665 gene locus_tag LOCUS_25420 6658 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250153.1 protein_id gnl|my_center|LOCUS_25420 7629 8324 gene locus_tag LOCUS_25430 7629 8324 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021381.1 protein_id gnl|my_center|LOCUS_25430 9179 8325 gene locus_tag LOCUS_25440 9179 8325 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066046.1 protein_id gnl|my_center|LOCUS_25440 9552 9283 gene locus_tag LOCUS_25450 9552 9283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 9481 10227 gene locus_tag LOCUS_25460 9481 10227 CDS product heparan-alpha-glucosaminide N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065998.1 protein_id gnl|my_center|LOCUS_25460 12273 10666 gene locus_tag LOCUS_25470 gene ade 12273 10666 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_25470 12776 12372 gene locus_tag LOCUS_25480 12776 12372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 13141 13821 gene locus_tag LOCUS_25490 13141 13821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 14045 14926 gene locus_tag LOCUS_25500 14045 14926 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102075.1 protein_id gnl|my_center|LOCUS_25500 14930 18166 gene locus_tag LOCUS_25510 14930 18166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 18179 18658 gene locus_tag LOCUS_25520 18179 18658 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868676.1 protein_id gnl|my_center|LOCUS_25520 18686 19480 gene locus_tag LOCUS_25530 18686 19480 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023002.1 protein_id gnl|my_center|LOCUS_25530 19762 19502 gene locus_tag LOCUS_25540 19762 19502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 19945 20544 gene locus_tag LOCUS_25550 19945 20544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 20813 20628 gene locus_tag LOCUS_25560 20813 20628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 21094 20843 gene locus_tag LOCUS_25570 21094 20843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902537.1 protein_id gnl|my_center|LOCUS_25570 22025 21405 gene locus_tag LOCUS_25580 22025 21405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 24395 22560 gene locus_tag LOCUS_25590 24395 22560 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064996.1 protein_id gnl|my_center|LOCUS_25590 25612 24410 gene locus_tag LOCUS_25600 25612 24410 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021450.1 protein_id gnl|my_center|LOCUS_25600 26841 25645 gene locus_tag LOCUS_25610 26841 25645 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750457.1 protein_id gnl|my_center|LOCUS_25610 27816 26863 gene locus_tag LOCUS_25620 gene rnz 27816 26863 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_25620 28577 27804 gene locus_tag LOCUS_25630 28577 27804 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024526.1 protein_id gnl|my_center|LOCUS_25630 29125 28574 gene locus_tag LOCUS_25640 29125 28574 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024528.1 protein_id gnl|my_center|LOCUS_25640 29972 29274 gene locus_tag LOCUS_25650 29972 29274 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020130.1 protein_id gnl|my_center|LOCUS_25650 30148 31422 gene locus_tag LOCUS_25660 gene thiC 30148 31422 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024209.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence33 990 277 gene locus_tag LOCUS_25670 990 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 1499 984 gene locus_tag LOCUS_25680 1499 984 CDS product DJ-1/PfpI/YhbO family deglycase/protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870481.1 protein_id gnl|my_center|LOCUS_25680 1919 4525 gene locus_tag LOCUS_25690 1919 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 4877 5368 gene locus_tag LOCUS_25700 4877 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 5633 5400 gene locus_tag LOCUS_25710 5633 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 5730 7382 gene locus_tag LOCUS_25720 5730 7382 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320246.1 protein_id gnl|my_center|LOCUS_25720 8527 7379 gene locus_tag LOCUS_25730 8527 7379 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023953.1 protein_id gnl|my_center|LOCUS_25730 9550 8531 gene locus_tag LOCUS_25740 9550 8531 CDS product DUF2117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990783.1 protein_id gnl|my_center|LOCUS_25740 10274 9585 gene locus_tag LOCUS_25750 10274 9585 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403082.1 protein_id gnl|my_center|LOCUS_25750 10616 10912 gene locus_tag LOCUS_25760 10616 10912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 10987 11214 gene locus_tag LOCUS_25770 10987 11214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 13037 11217 gene locus_tag LOCUS_25780 13037 11217 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024488.1 protein_id gnl|my_center|LOCUS_25780 13483 13034 gene locus_tag LOCUS_25790 13483 13034 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021674.1 protein_id gnl|my_center|LOCUS_25790 13613 14734 gene locus_tag LOCUS_25800 13613 14734 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392524.1 protein_id gnl|my_center|LOCUS_25800 15114 14749 gene locus_tag LOCUS_25810 15114 14749 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022005.1 protein_id gnl|my_center|LOCUS_25810 15665 15240 gene locus_tag LOCUS_25820 15665 15240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 16049 15720 gene locus_tag LOCUS_25830 16049 15720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 16197 16358 gene locus_tag LOCUS_25840 16197 16358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 16888 16574 gene locus_tag LOCUS_25850 16888 16574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 17077 16898 gene locus_tag LOCUS_25860 17077 16898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 17433 17359 gene locus_tag LOCUS_t00380 17433 17359 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 19153 17570 gene locus_tag LOCUS_25870 gene serA 19153 17570 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020641.1 protein_id gnl|my_center|LOCUS_25870 19248 21542 gene locus_tag LOCUS_25880 gene ppsA 19248 21542 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878213.1 protein_id gnl|my_center|LOCUS_25880 21535 22632 gene locus_tag LOCUS_25890 gene mfnA 21535 22632 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879496.1 protein_id gnl|my_center|LOCUS_25890 22625 23176 gene locus_tag LOCUS_25900 gene hpt 22625 23176 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871179.1 protein_id gnl|my_center|LOCUS_25900 23160 24107 gene locus_tag LOCUS_25910 gene dph2 23160 24107 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020763.1 protein_id gnl|my_center|LOCUS_25910 24104 24715 gene locus_tag LOCUS_25920 24104 24715 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020764.1 protein_id gnl|my_center|LOCUS_25920 24720 25886 gene locus_tag LOCUS_25930 24720 25886 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808460.1 protein_id gnl|my_center|LOCUS_25930 25930 27579 gene locus_tag LOCUS_25940 25930 27579 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_25940 28439 28158 gene locus_tag LOCUS_25950 28439 28158 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022822.1 protein_id gnl|my_center|LOCUS_25950 29166 28450 gene locus_tag LOCUS_25960 gene purQ 29166 28450 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021958.1 protein_id gnl|my_center|LOCUS_25960 29412 29170 gene locus_tag LOCUS_25970 gene purS 29412 29170 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066286.1 protein_id gnl|my_center|LOCUS_25970 30134 29409 gene locus_tag LOCUS_25980 30134 29409 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875809.1 protein_id gnl|my_center|LOCUS_25980 31059 30178 gene locus_tag LOCUS_25990 gene cofG 31059 30178 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755891.1 protein_id gnl|my_center|LOCUS_25990 >Feature sequence34 965 333 gene locus_tag LOCUS_26000 965 333 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060758.1 protein_id gnl|my_center|LOCUS_26000 1368 2915 gene locus_tag LOCUS_26010 1368 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 5011 2969 gene locus_tag LOCUS_26020 5011 2969 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226412.1 protein_id gnl|my_center|LOCUS_26020 6500 5316 gene locus_tag LOCUS_26030 6500 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 6381 6617 gene locus_tag LOCUS_26040 6381 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 7036 6623 gene locus_tag LOCUS_26050 7036 6623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26050 7976 9196 gene locus_tag LOCUS_26060 7976 9196 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176674.1 protein_id gnl|my_center|LOCUS_26060 10615 9245 gene locus_tag LOCUS_26070 10615 9245 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022104.1 protein_id gnl|my_center|LOCUS_26070 12815 10608 gene locus_tag LOCUS_26080 12815 10608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 13865 13473 gene locus_tag LOCUS_26090 13865 13473 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066227.1 protein_id gnl|my_center|LOCUS_26090 14091 13852 gene locus_tag LOCUS_26100 14091 13852 CDS product antitoxin VapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021528.1 protein_id gnl|my_center|LOCUS_26100 15355 14147 gene locus_tag LOCUS_26110 15355 14147 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943960.1 protein_id gnl|my_center|LOCUS_26110 15468 15394 gene locus_tag LOCUS_t00390 15468 15394 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 15657 16772 gene locus_tag LOCUS_26120 15657 16772 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024231.1 protein_id gnl|my_center|LOCUS_26120 17766 16759 gene locus_tag LOCUS_26130 17766 16759 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021469.1 protein_id gnl|my_center|LOCUS_26130 17943 18020 gene locus_tag LOCUS_t00400 17943 18020 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18091 18930 gene locus_tag LOCUS_26140 18091 18930 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250907.1 protein_id gnl|my_center|LOCUS_26140 19098 19508 gene locus_tag LOCUS_26150 19098 19508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020121.1 protein_id gnl|my_center|LOCUS_26150 20177 19473 gene locus_tag LOCUS_26160 20177 19473 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892283.1 protein_id gnl|my_center|LOCUS_26160 21235 20174 gene locus_tag LOCUS_26170 21235 20174 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064802.1 protein_id gnl|my_center|LOCUS_26170 22512 21238 gene locus_tag LOCUS_26180 22512 21238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 22996 22505 gene locus_tag LOCUS_26190 22996 22505 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776788.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence35 2434 728 gene locus_tag LOCUS_26200 gene mcrA 2434 728 CDS product coenzyme-B sulfoethylthiotransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870360.1 protein_id gnl|my_center|LOCUS_26200 3204 2440 gene locus_tag LOCUS_26210 gene mcrG 3204 2440 CDS product coenzyme-B sulfoethylthiotransferase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060982.1 protein_id gnl|my_center|LOCUS_26210 3765 3295 gene locus_tag LOCUS_26220 gene mcrD 3765 3295 CDS product methyl-coenzyme M reductase operon protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320037.1 protein_id gnl|my_center|LOCUS_26220 5086 3782 gene locus_tag LOCUS_26230 gene mcrB 5086 3782 CDS product coenzyme-B sulfoethylthiotransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024423.1 protein_id gnl|my_center|LOCUS_26230 6193 6606 gene locus_tag LOCUS_26240 6193 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 6606 7982 gene locus_tag LOCUS_26250 6606 7982 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061087.1 protein_id gnl|my_center|LOCUS_26250 7979 9685 gene locus_tag LOCUS_26260 7979 9685 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870682.1 protein_id gnl|my_center|LOCUS_26260 9699 10499 gene locus_tag LOCUS_26270 9699 10499 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877167.1 protein_id gnl|my_center|LOCUS_26270 10563 11828 gene locus_tag LOCUS_26280 10563 11828 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785364.1 protein_id gnl|my_center|LOCUS_26280 12591 11842 gene locus_tag LOCUS_26290 12591 11842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 12820 13494 gene locus_tag LOCUS_26300 gene rnc 12820 13494 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742189.1 protein_id gnl|my_center|LOCUS_26300 13496 14674 gene locus_tag LOCUS_26310 13496 14674 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436749.1 protein_id gnl|my_center|LOCUS_26310 14724 15089 gene locus_tag LOCUS_26320 14724 15089 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674794.1 protein_id gnl|my_center|LOCUS_26320 15247 17151 gene locus_tag LOCUS_26330 15247 17151 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937741.1 protein_id gnl|my_center|LOCUS_26330 17148 18017 gene locus_tag LOCUS_26340 17148 18017 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937740.1 protein_id gnl|my_center|LOCUS_26340 18023 18505 gene locus_tag LOCUS_26350 18023 18505 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937739.1 protein_id gnl|my_center|LOCUS_26350 18502 18882 gene locus_tag LOCUS_26360 18502 18882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 18867 19946 gene locus_tag LOCUS_26370 18867 19946 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937737.1 protein_id gnl|my_center|LOCUS_26370 19969 20352 gene locus_tag LOCUS_26380 19969 20352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 >Feature sequence36 787 353 gene locus_tag LOCUS_26390 787 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 1264 818 gene locus_tag LOCUS_26400 1264 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 2659 1427 gene locus_tag LOCUS_26410 2659 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 3103 2867 gene locus_tag LOCUS_26420 3103 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 3233 3628 gene locus_tag LOCUS_26430 3233 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 5818 3947 gene locus_tag LOCUS_26440 5818 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 9345 6145 gene locus_tag LOCUS_26450 9345 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 9612 11546 gene locus_tag LOCUS_26460 9612 11546 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086363.1 protein_id gnl|my_center|LOCUS_26460 12440 11577 gene locus_tag LOCUS_26470 12440 11577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 14993 12585 gene locus_tag LOCUS_26480 14993 12585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 15813 15622 gene locus_tag LOCUS_26490 15813 15622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 15969 17750 gene locus_tag LOCUS_26500 15969 17750 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_26500 17852 18694 gene locus_tag LOCUS_26510 17852 18694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 18810 19160 gene locus_tag LOCUS_26520 18810 19160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 >Feature sequence37 382 1380 gene locus_tag LOCUS_26530 gene mch 382 1380 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879428.1 protein_id gnl|my_center|LOCUS_26530 1830 1543 gene locus_tag LOCUS_26540 1830 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 2324 1845 gene locus_tag LOCUS_26550 2324 1845 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876052.1 protein_id gnl|my_center|LOCUS_26550 2822 2337 gene locus_tag LOCUS_26560 2822 2337 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496452.1 protein_id gnl|my_center|LOCUS_26560 3791 2841 gene locus_tag LOCUS_26570 3791 2841 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879345.1 protein_id gnl|my_center|LOCUS_26570 4273 4455 gene locus_tag LOCUS_26580 4273 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 6360 4492 gene locus_tag LOCUS_26590 6360 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 6924 7262 gene locus_tag LOCUS_26600 6924 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 7447 7361 gene locus_tag LOCUS_t00410 7447 7361 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7499 7702 gene locus_tag LOCUS_26610 7499 7702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 9293 7704 gene locus_tag LOCUS_26620 gene thsB 9293 7704 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020145.1 protein_id gnl|my_center|LOCUS_26620 10126 9512 gene locus_tag LOCUS_26630 10126 9512 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876509.1 protein_id gnl|my_center|LOCUS_26630 10604 10149 gene locus_tag LOCUS_26640 10604 10149 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147315.1 protein_id gnl|my_center|LOCUS_26640 11587 10601 gene locus_tag LOCUS_26650 gene rtcA 11587 10601 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878932.1 protein_id gnl|my_center|LOCUS_26650 12431 11574 gene locus_tag LOCUS_26660 12431 11574 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021191.1 protein_id gnl|my_center|LOCUS_26660 12513 14450 gene locus_tag LOCUS_26670 gene lonB 12513 14450 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023222.1 protein_id gnl|my_center|LOCUS_26670 14457 15785 gene locus_tag LOCUS_26680 14457 15785 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990640.1 protein_id gnl|my_center|LOCUS_26680 15782 17074 gene locus_tag LOCUS_26690 15782 17074 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876694.1 protein_id gnl|my_center|LOCUS_26690 17075 17338 gene locus_tag LOCUS_26700 17075 17338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence38 369 785 gene locus_tag LOCUS_26710 369 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 843 1430 gene locus_tag LOCUS_26720 843 1430 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_26720 1482 3908 gene locus_tag LOCUS_26730 1482 3908 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_26730 3981 4442 gene locus_tag LOCUS_26740 3981 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 4890 5987 gene locus_tag LOCUS_26750 gene fbp 4890 5987 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393749.1 protein_id gnl|my_center|LOCUS_26750 6269 6505 gene locus_tag LOCUS_26760 6269 6505 CDS product Like-Sm ribonucleoprotein core inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094490.1 protein_id gnl|my_center|LOCUS_26760 6511 6852 gene locus_tag LOCUS_26770 6511 6852 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589516.1 protein_id gnl|my_center|LOCUS_26770 8043 7624 gene locus_tag LOCUS_26780 8043 7624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 8656 8033 gene locus_tag LOCUS_26790 8656 8033 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270482.1 protein_id gnl|my_center|LOCUS_26790 10160 8694 gene locus_tag LOCUS_26800 gene guaB 10160 8694 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871141.1 protein_id gnl|my_center|LOCUS_26800 10853 10164 gene locus_tag LOCUS_26810 10853 10164 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024314.1 protein_id gnl|my_center|LOCUS_26810 10898 11578 gene locus_tag LOCUS_26820 10898 11578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 11572 12189 gene locus_tag LOCUS_26830 gene tmk 11572 12189 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024311.1 protein_id gnl|my_center|LOCUS_26830 14737 12146 gene locus_tag LOCUS_26840 14737 12146 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022991.1 protein_id gnl|my_center|LOCUS_26840 14920 16116 gene locus_tag LOCUS_26850 14920 16116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 >Feature sequence39 469 1092 gene locus_tag LOCUS_26860 469 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26860 1034 1420 gene locus_tag LOCUS_26870 1034 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 2107 1970 gene locus_tag LOCUS_26880 2107 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 2670 2599 gene locus_tag LOCUS_t00420 2670 2599 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3850 2729 gene locus_tag LOCUS_26890 3850 2729 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878324.1 protein_id gnl|my_center|LOCUS_26890 4011 4682 gene locus_tag LOCUS_26900 gene mtnP 4011 4682 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879284.1 protein_id gnl|my_center|LOCUS_26900 4679 5986 gene locus_tag LOCUS_26910 4679 5986 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_26910 6656 6063 gene locus_tag LOCUS_26920 6656 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26920 6546 6797 gene locus_tag LOCUS_26930 6546 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 8586 6886 gene locus_tag LOCUS_26940 8586 6886 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941764.1 protein_id gnl|my_center|LOCUS_26940 9216 10397 gene locus_tag LOCUS_26950 9216 10397 CDS product bifunctional 5,6,7,8-tetrahydromethanopterin hydro-lyase/3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024481.1 protein_id gnl|my_center|LOCUS_26950 10815 10594 gene locus_tag LOCUS_26960 10815 10594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 11962 10805 gene locus_tag LOCUS_26970 11962 10805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 12035 12256 gene locus_tag LOCUS_26980 12035 12256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 12463 12681 gene locus_tag LOCUS_26990 12463 12681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 14250 13150 gene locus_tag LOCUS_27000 14250 13150 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879581.1 protein_id gnl|my_center|LOCUS_27000 14814 14263 gene locus_tag LOCUS_27010 14814 14263 CDS product ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020770.1 protein_id gnl|my_center|LOCUS_27010 14902 15393 gene locus_tag LOCUS_27020 gene msrA 14902 15393 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943782.1 protein_id gnl|my_center|LOCUS_27020 >Feature sequence40 483 845 gene locus_tag LOCUS_27030 gene pth2 483 845 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023203.1 protein_id gnl|my_center|LOCUS_27030 842 2113 gene locus_tag LOCUS_27040 gene truD 842 2113 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_27040 2828 2136 gene locus_tag LOCUS_27050 2828 2136 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880245.1 protein_id gnl|my_center|LOCUS_27050 2974 3606 gene locus_tag LOCUS_27060 2974 3606 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880790.1 protein_id gnl|my_center|LOCUS_27060 4751 3930 gene locus_tag LOCUS_27070 4751 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 4881 5192 gene locus_tag LOCUS_27080 4881 5192 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878730.1 protein_id gnl|my_center|LOCUS_27080 5548 7446 gene locus_tag LOCUS_27090 gene acs 5548 7446 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056731.1 protein_id gnl|my_center|LOCUS_27090 7488 8051 gene locus_tag LOCUS_27100 7488 8051 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903666.1 protein_id gnl|my_center|LOCUS_27100 8384 8761 gene locus_tag LOCUS_27110 8384 8761 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064265.1 protein_id gnl|my_center|LOCUS_27110 9472 8753 gene locus_tag LOCUS_27120 gene rpiA 9472 8753 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057113.1 protein_id gnl|my_center|LOCUS_27120 10249 9473 gene locus_tag LOCUS_27130 gene surE 10249 9473 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020163.1 protein_id gnl|my_center|LOCUS_27130 10346 11233 gene locus_tag LOCUS_27140 10346 11233 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021489.1 protein_id gnl|my_center|LOCUS_27140 11230 12156 gene locus_tag LOCUS_27150 11230 12156 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021488.1 protein_id gnl|my_center|LOCUS_27150 12857 12234 gene locus_tag LOCUS_27160 12857 12234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 13249 15315 gene locus_tag LOCUS_27170 gene fdhF 13249 15315 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774551.1 protein_id gnl|my_center|LOCUS_27170 >Feature sequence41 493 335 gene locus_tag LOCUS_27180 493 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 848 546 gene locus_tag LOCUS_27190 848 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 1410 1336 gene locus_tag LOCUS_t00430 1410 1336 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1483 1413 gene locus_tag LOCUS_t00440 1483 1413 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2394 1555 gene locus_tag LOCUS_27200 gene htpX 2394 1555 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022098.1 protein_id gnl|my_center|LOCUS_27200 2575 3339 gene locus_tag LOCUS_27210 2575 3339 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867913.1 protein_id gnl|my_center|LOCUS_27210 3383 4033 gene locus_tag LOCUS_27220 3383 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 4864 4286 gene locus_tag LOCUS_27230 gene rdgB 4864 4286 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903503.1 protein_id gnl|my_center|LOCUS_27230 6444 4861 gene locus_tag LOCUS_27240 6444 4861 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023612.1 protein_id gnl|my_center|LOCUS_27240 6692 6537 gene locus_tag LOCUS_27250 6692 6537 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878609.1 protein_id gnl|my_center|LOCUS_27250 6991 6698 gene locus_tag LOCUS_27260 6991 6698 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869893.1 protein_id gnl|my_center|LOCUS_27260 7554 7069 gene locus_tag LOCUS_27270 7554 7069 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023601.1 protein_id gnl|my_center|LOCUS_27270 7754 7554 gene locus_tag LOCUS_27280 7754 7554 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903509.1 protein_id gnl|my_center|LOCUS_27280 8325 7756 gene locus_tag LOCUS_27290 8325 7756 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023599.1 protein_id gnl|my_center|LOCUS_27290 8713 8333 gene locus_tag LOCUS_27300 8713 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903511.1 protein_id gnl|my_center|LOCUS_27300 9945 8710 gene locus_tag LOCUS_27310 9945 8710 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066527.1 protein_id gnl|my_center|LOCUS_27310 10157 10579 gene locus_tag LOCUS_27320 gene nikR 10157 10579 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023967.1 protein_id gnl|my_center|LOCUS_27320 10890 10576 gene locus_tag LOCUS_27330 10890 10576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 11007 12098 gene locus_tag LOCUS_27340 11007 12098 CDS product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020223.1 protein_id gnl|my_center|LOCUS_27340 12702 14102 gene locus_tag LOCUS_27350 12702 14102 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868417.1 protein_id gnl|my_center|LOCUS_27350 >Feature sequence42 420 348 gene locus_tag LOCUS_t00450 420 348 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1399 530 gene locus_tag LOCUS_27360 gene ilvE 1399 530 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878433.1 protein_id gnl|my_center|LOCUS_27360 2243 1851 gene locus_tag LOCUS_27370 2243 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 2375 2656 gene locus_tag LOCUS_27380 2375 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 2649 3185 gene locus_tag LOCUS_27390 2649 3185 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023175.1 protein_id gnl|my_center|LOCUS_27390 3224 4258 gene locus_tag LOCUS_27400 3224 4258 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023766.1 protein_id gnl|my_center|LOCUS_27400 4411 4932 gene locus_tag LOCUS_27410 4411 4932 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066543.1 protein_id gnl|my_center|LOCUS_27410 4925 5410 gene locus_tag LOCUS_27420 4925 5410 CDS product TIGR00295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023768.1 protein_id gnl|my_center|LOCUS_27420 5906 5403 gene locus_tag LOCUS_27430 5906 5403 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021413.1 protein_id gnl|my_center|LOCUS_27430 6088 6172 gene locus_tag LOCUS_t00460 6088 6172 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6459 7274 gene locus_tag LOCUS_27440 6459 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 8580 7390 gene locus_tag LOCUS_27450 8580 7390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 9473 9955 gene locus_tag LOCUS_27460 9473 9955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 11407 10187 gene locus_tag LOCUS_27470 11407 10187 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755904.1 protein_id gnl|my_center|LOCUS_27470 11710 12996 gene locus_tag LOCUS_27480 11710 12996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 >Feature sequence43 71 1309 gene locus_tag LOCUS_27490 71 1309 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869498.1 protein_id gnl|my_center|LOCUS_27490 2567 2073 gene locus_tag LOCUS_27500 2567 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 3616 2645 gene locus_tag LOCUS_27510 3616 2645 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868724.1 protein_id gnl|my_center|LOCUS_27510 3812 4372 gene locus_tag LOCUS_27520 3812 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 4350 4973 gene locus_tag LOCUS_27530 4350 4973 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023000.1 protein_id gnl|my_center|LOCUS_27530 5665 4979 gene locus_tag LOCUS_27540 5665 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 6666 5929 gene locus_tag LOCUS_27550 6666 5929 CDS product DUF5714 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673563.1 protein_id gnl|my_center|LOCUS_27550 8541 6688 gene locus_tag LOCUS_27560 8541 6688 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_27560 9785 9489 gene locus_tag LOCUS_27570 9785 9489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 11257 10223 gene locus_tag LOCUS_27580 11257 10223 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224333.1 protein_id gnl|my_center|LOCUS_27580 12183 11254 gene locus_tag LOCUS_27590 12183 11254 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065835.1 protein_id gnl|my_center|LOCUS_27590 >Feature sequence44 404 1162 gene locus_tag LOCUS_27600 gene cofE 404 1162 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879745.1 protein_id gnl|my_center|LOCUS_27600 1362 2408 gene locus_tag LOCUS_27610 1362 2408 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023987.1 protein_id gnl|my_center|LOCUS_27610 2445 2873 gene locus_tag LOCUS_27620 2445 2873 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 protein_id gnl|my_center|LOCUS_27620 2888 3748 gene locus_tag LOCUS_27630 2888 3748 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023985.1 protein_id gnl|my_center|LOCUS_27630 3919 4539 gene locus_tag LOCUS_27640 gene psmB 3919 4539 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023769.1 protein_id gnl|my_center|LOCUS_27640 4560 6452 gene locus_tag LOCUS_27650 4560 6452 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023770.1 protein_id gnl|my_center|LOCUS_27650 6455 7522 gene locus_tag LOCUS_27660 6455 7522 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066545.1 protein_id gnl|my_center|LOCUS_27660 7563 8993 gene locus_tag LOCUS_27670 7563 8993 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589538.1 protein_id gnl|my_center|LOCUS_27670 9212 9982 gene locus_tag LOCUS_27680 9212 9982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 >Feature sequence45 397 1074 gene locus_tag LOCUS_27690 397 1074 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937694.1 protein_id gnl|my_center|LOCUS_27690 1078 1833 gene locus_tag LOCUS_27700 1078 1833 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_27700 1842 2528 gene locus_tag LOCUS_27710 1842 2528 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937696.1 protein_id gnl|my_center|LOCUS_27710 3919 3032 gene locus_tag LOCUS_27720 3919 3032 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528582.1 protein_id gnl|my_center|LOCUS_27720 4985 4215 gene locus_tag LOCUS_27730 4985 4215 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937693.1 protein_id gnl|my_center|LOCUS_27730 5338 5592 gene locus_tag LOCUS_27740 5338 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 5736 6002 gene locus_tag LOCUS_27750 5736 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 6086 6790 gene locus_tag LOCUS_27760 6086 6790 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027567.1 protein_id gnl|my_center|LOCUS_27760 7443 6799 gene locus_tag LOCUS_27770 7443 6799 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020781.1 protein_id gnl|my_center|LOCUS_27770 7852 8754 gene locus_tag LOCUS_27780 7852 8754 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928937.1 protein_id gnl|my_center|LOCUS_27780 9532 8945 gene locus_tag LOCUS_27790 9532 8945 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065212.1 protein_id gnl|my_center|LOCUS_27790 9861 11603 gene locus_tag LOCUS_27800 9861 11603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 >Feature sequence46 <1 675 gene locus_tag LOCUS_27810 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903435.1:surface glycoprotein 1107 832 gene locus_tag LOCUS_27820 1107 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 1447 1112 gene locus_tag LOCUS_27830 1447 1112 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790218.1 protein_id gnl|my_center|LOCUS_27830 2271 1489 gene locus_tag LOCUS_27840 2271 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 2617 2279 gene locus_tag LOCUS_27850 2617 2279 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023100.1 protein_id gnl|my_center|LOCUS_27850 3470 2649 gene locus_tag LOCUS_27860 3470 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 3509 4339 gene locus_tag LOCUS_27870 3509 4339 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064189.1 protein_id gnl|my_center|LOCUS_27870 5032 4346 gene locus_tag LOCUS_27880 5032 4346 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938888.1 protein_id gnl|my_center|LOCUS_27880 5648 5133 gene locus_tag LOCUS_27890 5648 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 6089 5745 gene locus_tag LOCUS_27900 6089 5745 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_27900 6240 7004 gene locus_tag LOCUS_27910 6240 7004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 7399 8667 gene locus_tag LOCUS_27920 7399 8667 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064511.1 protein_id gnl|my_center|LOCUS_27920 <11611 8768 gene locus_tag LOCUS_27930 <11611 8768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389449.1:glycoside hydrolase N-terminal domain-containing protein >Feature sequence47 999 355 gene locus_tag LOCUS_27940 999 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 2330 3325 gene locus_tag LOCUS_27950 2330 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27950 4737 3796 gene locus_tag LOCUS_27960 4737 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 4895 5437 gene locus_tag LOCUS_27970 4895 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 7301 5673 gene locus_tag LOCUS_27980 7301 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 7776 7483 gene locus_tag LOCUS_27990 7776 7483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 8034 8228 gene locus_tag LOCUS_28000 8034 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 8382 8627 gene locus_tag LOCUS_28010 8382 8627 CDS product type II toxin-antitoxin system MqsA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065704.1 protein_id gnl|my_center|LOCUS_28010 9213 9034 gene locus_tag LOCUS_28020 9213 9034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 9158 9334 gene locus_tag LOCUS_28030 9158 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 >Feature sequence48 2340 1924 gene locus_tag LOCUS_28040 2340 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 2815 2423 gene locus_tag LOCUS_28050 2815 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 3080 2817 gene locus_tag LOCUS_28060 3080 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 3316 3077 gene locus_tag LOCUS_28070 3316 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 3894 3463 gene locus_tag LOCUS_28080 3894 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 4103 4375 gene locus_tag LOCUS_28090 4103 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 4372 4704 gene locus_tag LOCUS_28100 4372 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 4846 5220 gene locus_tag LOCUS_28110 4846 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 5342 5665 gene locus_tag LOCUS_28120 5342 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 6155 5940 gene locus_tag LOCUS_28130 6155 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 6473 6718 gene locus_tag LOCUS_28140 6473 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 6958 7188 gene locus_tag LOCUS_28150 6958 7188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 8767 8528 gene locus_tag LOCUS_28160 8767 8528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 8736 9074 gene locus_tag LOCUS_28170 8736 9074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 9479 9126 gene locus_tag LOCUS_28180 9479 9126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 >Feature sequence49 698 507 gene locus_tag LOCUS_28190 698 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 890 1906 gene locus_tag LOCUS_28200 890 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 2404 3090 gene locus_tag LOCUS_28210 2404 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 3231 4262 gene locus_tag LOCUS_28220 3231 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 5697 4267 gene locus_tag LOCUS_28230 gene vpsH 5697 4267 CDS product exopolysaccharide biosynthesis protein VpsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495305.1 protein_id gnl|my_center|LOCUS_28230 <6594 5672 gene locus_tag LOCUS_28240 <6594 5672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000495305.1:exopolysaccharide biosynthesis protein VpsH >Feature sequence50 1013 246 gene locus_tag LOCUS_28250 1013 246 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392394.1 protein_id gnl|my_center|LOCUS_28250 1902 1021 gene locus_tag LOCUS_28260 1902 1021 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018271.1 protein_id gnl|my_center|LOCUS_28260 2147 2566 gene locus_tag LOCUS_28270 2147 2566 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021683.1 protein_id gnl|my_center|LOCUS_28270 3564 3055 gene locus_tag LOCUS_28280 3564 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 3876 3667 gene locus_tag LOCUS_28290 3876 3667 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021259.1 protein_id gnl|my_center|LOCUS_28290 5108 4116 gene locus_tag LOCUS_28300 5108 4116 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404376.1 protein_id gnl|my_center|LOCUS_28300 5298 6194 gene locus_tag LOCUS_28310 5298 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 >Feature sequence51 374 1117 gene locus_tag LOCUS_28320 374 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 1127 2089 gene locus_tag LOCUS_28330 1127 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020555.1 protein_id gnl|my_center|LOCUS_28330 2130 2705 gene locus_tag LOCUS_28340 2130 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 3217 4536 gene locus_tag LOCUS_28350 3217 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 4654 5502 gene locus_tag LOCUS_28360 4654 5502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 6050 5577 gene locus_tag LOCUS_28370 6050 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 >Feature sequence52 339 1742 gene locus_tag LOCUS_28380 339 1742 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903741.1 protein_id gnl|my_center|LOCUS_28380 1687 2184 gene locus_tag LOCUS_28390 1687 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878211.1 protein_id gnl|my_center|LOCUS_28390 2166 2507 gene locus_tag LOCUS_28400 2166 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 2504 3229 gene locus_tag LOCUS_28410 2504 3229 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877727.1 protein_id gnl|my_center|LOCUS_28410 3419 3234 gene locus_tag LOCUS_28420 3419 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 3604 4500 gene locus_tag LOCUS_28430 gene pyrB 3604 4500 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064165.1 protein_id gnl|my_center|LOCUS_28430 4497 4964 gene locus_tag LOCUS_28440 gene pyrI 4497 4964 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060913.1 protein_id gnl|my_center|LOCUS_28440 5415 4957 gene locus_tag LOCUS_28450 5415 4957 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879695.1 protein_id gnl|my_center|LOCUS_28450 >Feature sequence53 1327 578 gene locus_tag LOCUS_28460 1327 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28460 1764 1931 gene locus_tag LOCUS_28470 1764 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 3619 1865 gene locus_tag LOCUS_28480 3619 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 4090 3641 gene locus_tag LOCUS_28490 4090 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 >Feature sequence54 390 845 gene locus_tag LOCUS_28500 390 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 2279 846 gene locus_tag LOCUS_28510 gene proS 2279 846 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023782.1 protein_id gnl|my_center|LOCUS_28510 2882 2316 gene locus_tag LOCUS_28520 2882 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 3720 2875 gene locus_tag LOCUS_28530 3720 2875 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066525.1 protein_id gnl|my_center|LOCUS_28530 3733 4815 gene locus_tag LOCUS_28540 3733 4815 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023593.1 protein_id gnl|my_center|LOCUS_28540 4822 5274 gene locus_tag LOCUS_28550 4822 5274 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023592.1 protein_id gnl|my_center|LOCUS_28550 >Feature sequence55 160 441 gene locus_tag LOCUS_28560 160 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 1191 1634 gene locus_tag LOCUS_28570 1191 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 2430 2206 gene locus_tag LOCUS_28580 2430 2206 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103638.1 protein_id gnl|my_center|LOCUS_28580 2659 2423 gene locus_tag LOCUS_28590 2659 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 4703 2787 gene locus_tag LOCUS_28600 4703 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 >Feature sequence56 71 1222 gene locus_tag LOCUS_28610 71 1222 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869498.1 protein_id gnl|my_center|LOCUS_28610 1438 3504 gene locus_tag LOCUS_28620 gene fdhF 1438 3504 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774551.1 protein_id gnl|my_center|LOCUS_28620 >Feature sequence57 3067 2570 gene locus_tag LOCUS_28630 3067 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 >Feature sequence58 697 2073 gene locus_tag LOCUS_28640 697 2073 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_28640 2881 2606 gene locus_tag LOCUS_28650 2881 2606 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_28650 >Feature sequence59 180 872 gene locus_tag LOCUS_28660 180 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 888 1664 gene locus_tag LOCUS_28670 888 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 >Feature sequence60 402 205 gene locus_tag LOCUS_28680 402 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 840 571 gene locus_tag LOCUS_28690 840 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 829 969 gene locus_tag LOCUS_28700 829 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 1995 1033 gene locus_tag LOCUS_28710 1995 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020555.1 protein_id gnl|my_center|LOCUS_28710 >Feature sequence61 <1176 220 gene locus_tag LOCUS_28720 <1176 220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020207.1:ISNCY-like element ISMac19 family transposase >Feature sequence62 2 412 gene locus_tag LOCUS_28730 2 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 >Feature sequence63 853 266 gene locus_tag LOCUS_28740 853 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740