COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..21793 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 658..1749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1843..2553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(2568..3827) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096334.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene rho CDS complement(4047..4370) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene trxA CDS complement(4479..5471) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096352.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene hemB CDS complement(5579..7447) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(7477..7977) product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207954.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(8059..8667) product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405918.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(8664..10208) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene gshA CDS complement(10214..10411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(10448..12655) product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(12652..13128) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940875.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 13341..14696 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926605.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 14693..15925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 15922..17127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 17145..17879 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931160.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 18167..18865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 18852..19613 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974643.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(19814..20206) product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895698.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(20203..20883) product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769873.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene yrfG CDS 20977..21792 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818748.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene cysQ sequence002 source 1..19131 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(404..1219) product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262642.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(1216..2472) product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(2472..3071) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100631.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene petA CDS complement(3238..3624) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829815.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene rpsI CDS complement(3705..4133) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948407.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene rplM CDS complement(4359..5477) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094297.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene zapE CDS complement(5697..6998) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268859.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene hisD CDS complement(6995..7657) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098837.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene hisG CDS complement(7662..8924) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946583.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene murA CDS complement(8930..9157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 9366..9998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 10103..10627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 10624..11370 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094355.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene lptB CDS 11515..13128 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377556.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 13203..13664 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400244.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene ptsN CDS 13661..14548 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094361.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene rapZ CDS 14558..14830 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090869.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 14834..16174 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073704.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene mgtE CDS 16184..16771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(16737..17546) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 sequence003 source 1..18717 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1084..1707) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687611.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(1742..2548) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706494.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene truA CDS complement(2554..4290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(4388..5407) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948008.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(5544..6638) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209711.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene aroC CDS 6711..7259 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346200.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene folE CDS complement(7285..8055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(8156..8608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(8648..10570) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087446.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene htpG CDS complement(10738..11613) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087428.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene sucD CDS complement(11610..12779) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087425.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene sucC CDS complement(13213..14667) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087422.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene lpdA CDS complement(14677..15903) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114264.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene odhB misc_feature complement(16215..>18717) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003087413.1:2-oxoglutarate dehydrogenase E1 component locus_tag LOCUS_00550 sequence004 source 1..16984 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 245..766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 756..1997 product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 2099..3217 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943508.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene leuB CDS complement(3322..3549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(3659..4270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 4312..5448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 5576..6205 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 6408..6962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 note possible pseudo, internal stop codon CDS complement(7477..8271) product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117193320.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(8280..10634) product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(10631..11104) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027560187.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(11272..11754) product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528005.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(12285..13082) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(13264..14376) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946659.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene ald CDS 14892..15377 product transcriptional regulator DadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096535.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene dadR CDS 15620..16273 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918213.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 sequence005 source 1..16345 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 602..1909 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265814.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(1970..2443) product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266315.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(2488..2673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 2781..3233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089069.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 3326..3610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 3671..3994 product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023310.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 4090..4872 product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 4874..6343 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933713.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 6340..7239 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957537.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(7263..8873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 9224..9436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 9654..10076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(10101..10472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 10660..11058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 11207..12061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 12293..13393 product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897309.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(13456..14568) product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene pilU CDS complement(14588..15583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 misc_feature complement(15761..>16345) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140202.1:bacteriorhodopsin-like locus_tag LOCUS_00900 sequence006 source 1..15581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 391..1620 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945874.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 1627..2736 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073009.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene tgt CDS 2910..3236 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092856.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene yajC CDS 3272..5143 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100609.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene secD CDS 5140..6066 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460198.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene secF CDS complement(6126..6941) product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092845.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene suhB CDS 7026..7772 product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406500.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene trmJ CDS 8259..8720 product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380601.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene iscR CDS 9158..10372 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092832.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 10403..10789 product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213175.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene iscU CDS 10851..11174 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117986.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene iscA CDS 11179..11706 product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209833.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene hscB CDS 11708..13582 product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100622.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene hscA CDS 13611..13949 product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092818.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene fdx CDS 13959..14153 product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812452.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene iscX CDS 14282..14707 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552482.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene ndk sequence007 source 1..15543 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1100 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727996.1:acyl-CoA dehydrogenase family protein locus_tag LOCUS_01070 CDS complement(2080..3261) product mutanobactin A system MFS transporter MubZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074614.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene mubZ CDS 3724..4275 product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459965.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene trmY CDS 4667..5338 product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene npdG CDS 5448..6227 product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene cofE CDS 6261..7235 product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene cofD CDS 7187..7924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 7921..10416 product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455006.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 10698..11693 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 11703..12707 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 13078..14112 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 14142..15287 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969253.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 sequence008 source 1..15495 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1230..2087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(2087..2791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(2791..3288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(3360..3842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(3844..4680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(4684..5067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(5205..5678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(5701..6336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(6354..7496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 7678..8292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 8273..8761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 8924..9145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 9195..9635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 9660..11729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 11769..12191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 12353..12673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(12670..12867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(12867..14039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(13978..14256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(14290..14619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 sequence009 source 1..14636 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 41..601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(670..885) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761125.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(889..1131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(1136..1525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(1908..2507) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940850.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 2825..3868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927783.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 3998..5050 product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338724.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(5260..6762) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263552.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 7003..7389 product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918415.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 7442..7786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 note possible pseudo, frameshifted CDS 7806..7985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 8073..9335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(9393..10325) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 10504..11307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 11747..12502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 12690..13175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 13252..13776 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112705.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(13780..14559) product coniferyl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730142.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 sequence010 source 1..14318 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2098..3630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(3668..3913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(3910..4419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(4419..5093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(5099..5575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(5582..6199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(6199..6951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(6990..7748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(7823..8227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(8234..8689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(8689..9978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(9978..10529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(10532..10915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(10949..11089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(11086..13044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(13584..13766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 13822..14019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 sequence011 source 1..13357 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1252..2877 product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931517.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(2947..3822) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727159.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(4271..5029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 5253..6437 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967050.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 6742..7776 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(7773..8702) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332819.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(8771..9928) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109755.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(9969..11138) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416097.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(11604..12494) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917983.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 misc_feature complement(12607..>13357) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072022.1:efflux RND transporter permease subunit locus_tag LOCUS_01830 sequence012 source 1..12654 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 485..1435 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275252.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene xerC CDS 1428..2126 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768510.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(2123..3493) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene thrC CDS complement(3993..4331) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555808.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene glnK CDS 4811..6337 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926358.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(6459..6842) product cytochrome c5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455203.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(6930..8444) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802512.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(8796..9434) product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene dsbA CDS complement(9451..10056) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 10194..10793 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341625.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene yihA misc_feature complement(11155..>12654) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704214.1:DNA polymerase I locus_tag LOCUS_01940 sequence013 source 1..12645 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(484..1437) product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092045.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(1434..2318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(2315..2899) product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302262.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene rsxA CDS complement(2908..4920) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764864.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene metG CDS 5171..6007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 6609..7172 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092017.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene dcd CDS complement(7162..7923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 8270..9373 product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706622.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 9578..10753 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 10755..11447 product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443937.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene hda CDS 11444..12520 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965529.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 sequence014 source 1..12638 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005616363.1:cysteine synthase CysM locus_tag LOCUS_02060 CDS 620..1924 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039993.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene rlmD CDS 1917..4136 product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene relA CDS 4164..4817 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064094.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene adk repeat_region 5023..5360 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aagaaagctgctgccaagaaagc CDS complement(5466..6065) product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050076897.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene mobA CDS 6090..8003 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925684.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 8024..8707 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478795.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene tsaB CDS 8704..9363 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113853.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(9319..11721) product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245401.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene plsB CDS complement(11708..12637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 sequence015 source 1..12226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 75..410 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313628.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene secG tRNA 482..568 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA 739..815 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 951..1430 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene rimP CDS 1437..2921 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095192.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene nusA CDS 2960..5557 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113908.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene infB CDS 5572..5931 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268880.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene rbfA CDS 5937..6863 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351717.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene truB CDS 6961..7230 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417682.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene rpsO CDS 7257..9518 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095181.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene pnp CDS complement(9606..11549) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113911.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene acs misc_feature complement(11711..>12226) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095142.1:polynucleotide adenylyltransferase PcnB locus_tag LOCUS_02250 sequence016 source 1..11889 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(111..716) product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004412070.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene ribA CDS 909..1331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 1422..2957 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640504.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(3173..3631) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208527.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(3798..4310) product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(4594..5376) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080010657.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(5529..5963) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816908.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene pgpA CDS complement(5996..7003) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752139.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene thiL CDS complement(7007..7444) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958215.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene nusB CDS complement(7441..7908) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093311.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene ribE CDS complement(7985..9094) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035932.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene ribD CDS complement(9078..9572) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317051.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene nrdR CDS 9850..11517 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946440.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene ettA sequence017 source 1..11864 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1353 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074287.1:oligopeptidase A locus_tag LOCUS_02390 CDS 1350..1595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 1635..1862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 2654..3313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 3303..5660 product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037666.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 5657..6886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 7853..9031 product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106288.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene coxB CDS 9041..10636 product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083723.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene ctaD CDS 10663..11214 product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 sequence018 source 1..11829 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(264..734) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024691.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(776..997) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424060.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene atpE CDS complement(1026..1880) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100237.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene atpB CDS complement(2145..2489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(2640..3542) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(3551..4399) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707916.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(4525..5154) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377883.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene rsmG CDS complement(5151..7022) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481156.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene mnmG CDS complement(7372..8823) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244945.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene mnmE CDS complement(8816..10504) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114648.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene yidC CDS complement(10733..11038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 sequence019 source 1..11631 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(110..1933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 note possible pseudo, internal stop codon CDS complement(1998..6068) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene rpoB CDS complement(6171..6548) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946072.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene rplL CDS complement(6578..7105) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023073.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene rplJ CDS complement(7310..8005) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400443.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene rplA CDS complement(8005..8439) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218414.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene rplK CDS complement(8553..9086) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108028.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene nusG CDS complement(9185..9550) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555502.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene secE tRNA complement(9667..9742) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(9794..10984) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115146.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene tuf tRNA complement(11299..11374) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 sequence020 source 1..11568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(204..1043) product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267244.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(1645..3315) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946763.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(3326..4012) product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477215.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene ppiA CDS complement(4066..4977) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921140.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 5110..5817 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941468.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(5935..8070) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266824.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 misc_feature complement(8067..>11568) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108531.1:hybrid sensor histidine kinase/response regulator transcription factor locus_tag LOCUS_02740 sequence021 source 1..11403 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 616..1536 product TIGR03854 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225293.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(1533..2480) product TIGR03564 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727013.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 2678..2893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(2864..3721) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036345.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene tesB CDS complement(3718..4029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(4086..5720) product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110588.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 5932..7314 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(7292..8194) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090970.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(8191..9111) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012532645.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene rarD CDS complement(9184..9795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 sequence022 source 1..10950 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(36..1121) product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230778.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 1281..2609 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531119.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 2735..3784 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731394.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 3831..5135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 5325..6494 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064985.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 6494..7732 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930304.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 7729..8577 product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089916.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(8560..9447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(9444..9965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 10056..10550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 sequence023 source 1..10811 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(726..1592) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407877.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(1582..1824) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771337.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 2252..2683 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073278.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(2735..3475) product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(3512..6706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(6738..8009) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931796.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(8068..9267) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880602.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 9386..9961 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 misc_feature complement(9958..>10811) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030032.1:MBL fold metallo-hydrolase locus_tag LOCUS_03030 sequence024 source 1..10717 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(166..1296) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083842.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(1537..2736) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 2881..3861 product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728687.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(4023..5024) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392248.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene pdxA CDS complement(5021..5911) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(6292..7503) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228589.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(8243..8677) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770885.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 misc_feature complement(8744..>10717) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_110170977.1:VWA domain-containing protein locus_tag LOCUS_03110 sequence025 source 1..10689 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..525 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727065.1:carboxylesterase family protein locus_tag LOCUS_03120 CDS complement(499..933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 1287..2696 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(2729..2935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 2864..3691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(3893..4603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(4587..5162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 5282..7162 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706745.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 7187..7546 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530464.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 7643..10474 product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705867.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 sequence026 source 1..10562 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1191..1547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(1760..3025) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924850.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 3060..3239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(3228..4415) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 4800..5837 product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165691202.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 5869..7614 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223119.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(7675..8115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 8307..9560 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(9698..10258) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965232.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 sequence027 source 1..10491 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 584..1600 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730894.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 1616..2086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(2120..2788) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207453.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 3007..4236 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348045.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 4233..5594 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 5584..6255 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727713.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(6292..7461) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229312.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(7527..8459) product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057715.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene garL CDS complement(8563..9417) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459931.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(9446..9823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 sequence028 source 1..10210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(205..1131) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097276.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene glyQ CDS 1396..2205 product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(2195..2818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(2818..4263) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704169.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(4267..5640) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene trkA CDS complement(5640..6905) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958533.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene rsmB CDS complement(6915..7868) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768186.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene fmt CDS complement(7875..8402) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107059.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene def CDS 8500..9525 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 sequence029 source 1..9997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1056..3779) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112752.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene secA CDS complement(3828..4847) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 4893..5297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(5298..6230) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957401.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene lpxC CDS complement(6612..7763) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011997353.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene ftsZ CDS complement(7797..9029) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364017.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene ftsA CDS complement(9026..9748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 sequence030 source 1..9898 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..762 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966515.1:gamma-glutamyltransferase locus_tag LOCUS_03570 CDS complement(745..1884) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994167.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(2029..3270) product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083145.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene ccmI CDS complement(3267..3788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(3785..4339) product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083138.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene dsbE CDS complement(4350..6320) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268402.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(6310..6774) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107323.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene ccmE CDS complement(6771..6953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(6950..7684) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083135.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(7739..8386) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457672.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene ccmB CDS complement(8386..8973) product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457758.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene ccmA sequence031 source 1..9859 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..938 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003368786.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB locus_tag LOCUS_03680 CDS 1017..2012 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 2106..2540 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003039643.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene ybeY CDS 2537..3385 product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368790.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 3378..4868 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105186.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene lnt CDS 4971..7430 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154223677.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene leuS CDS 7430..7939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 7944..8945 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268982.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene holA sequence032 source 1..9854 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 285..791 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093697.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene rpsE CDS 798..983 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083582.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene rpmD CDS 999..1433 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450562.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene rplO CDS 1496..2821 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555469.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene secY CDS 2985..3341 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093692.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene rpsM CDS 3460..3858 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083577.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene rpsK CDS 3874..4494 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070631.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene rpsD CDS 4530..5531 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555464.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene rpoA CDS 5566..5970 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093672.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene rplQ CDS 6175..7353 product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(7350..9779) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357724.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene uvrA sequence033 source 1..9442 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(434..1468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(1446..4898) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113980.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene mfd CDS 5384..6850 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244218.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 7346..8686 product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001906078.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 sequence034 source 1..9404 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 52..2454 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918875.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 2954..4480 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011541218.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 4480..5136 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081572.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 5120..6274 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895326.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 6277..7527 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006095218.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 7646..8620 product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533083.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 misc_feature complement(8888..>9404) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267273.1:NADP-dependent oxidoreductase locus_tag LOCUS_03970 sequence035 source 1..9375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1829..2965) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072024.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 3592..4683 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 4848..6086 product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 6310..6708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 7044..7733 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072357.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 7787..8179 product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209690.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene tusD CDS 8187..8534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 8536..8799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 8801..9109 product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119979.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 sequence036 source 1..9229 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 212..991 product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549540.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 1165..2013 product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813616.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 2130..3617 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455226.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene ilvC CDS 3625..5055 product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704776.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene modF CDS complement(5158..6048) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919954.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(6281..8452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 sequence037 source 1..9155 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..776 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809481.1:M23 family metallopeptidase locus_tag LOCUS_04130 CDS complement(794..2260) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092786.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene der CDS complement(2269..3462) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092789.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene bamB CDS complement(3459..4184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(4413..5681) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209816.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene hisS CDS complement(5678..6802) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380613.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene ispG CDS complement(6792..7925) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115257.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(7922..8674) product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771019.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene pilW sequence038 source 1..9107 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(417..905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(1071..3140) product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(3374..3550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 3895..5697 product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(5870..7039) product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085491.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(7176..8516) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 sequence039 source 1..8910 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1677 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046463506.1:DNA polymerase Y family protein locus_tag LOCUS_04270 CDS 2126..2320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 note possible pseudo, internal stop codon CDS 2919..3683 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229721.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 3781..5685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(5678..6631) product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 6949..7839 product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230665.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 sequence040 source 1..8899 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(172..1323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 1841..3589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 3860..6265 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920963.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(6507..7442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 misc_feature complement(7439..>8899) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920964.1:tetratricopeptide repeat-containing sulfotransferase family protein locus_tag LOCUS_04370 sequence041 source 1..8793 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..737 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114646.1:glycine--tRNA ligase subunit beta locus_tag LOCUS_04380 CDS 734..2113 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649434.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(2331..4766) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097268.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene gyrB CDS complement(4919..5995) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377871.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene recF CDS complement(6015..7127) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097262.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene dnaN CDS complement(7209..8600) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307141.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene dnaA sequence042 source 1..8784 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2343..2666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(2685..3776) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002050104.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene ychF CDS complement(3780..4388) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816544.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene pth CDS complement(4422..5075) product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099279.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(5146..6126) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120445.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 tRNA complement(6154..6229) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(6255..7100) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195241.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene ispE CDS complement(7097..7423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 misc_feature complement(7620..>8784) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_074907579.1:tetratricopeptide repeat protein locus_tag LOCUS_04510 sequence043 source 1..8762 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1183..1425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 1422..1721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 1752..2444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 2578..3105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 3145..3714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 3821..4546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 4536..4811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 4804..5250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 5443..5994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 5994..6422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 6419..6619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(6612..7004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 7115..7486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(7489..7857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(7883..8386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 sequence044 source 1..8659 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(396..1040) product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104701.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene miaE CDS 1164..3752 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070790.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene acnB CDS complement(4112..6136) product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267406.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(6133..7101) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(7109..8026) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036211.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 misc_feature complement(8036..>8659) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003381064.1:amidophosphoribosyltransferase locus_tag LOCUS_04720 sequence045 source 1..8625 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..792 product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021949.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 952..2628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 2671..5559 product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 5949..6620 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 6855..7553 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446421.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 sequence046 source 1..8517 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 243..554 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555491.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene rpsJ CDS 579..1229 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417224.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene rplC CDS 1226..1852 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422344.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene rplD CDS 1849..2148 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093736.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene rplW CDS 2186..3019 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317104.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene rplB CDS 3030..3308 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307960.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene rpsS CDS 3396..3731 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103908.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene rplV CDS 3759..4424 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093727.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene rpsC CDS 4442..4855 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093723.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene rplP CDS 4868..5062 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644741.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene rpmC CDS 5086..5352 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093717.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene rpsQ CDS 5391..5759 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555479.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene rplN CDS 5770..6087 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093711.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene rplX CDS 6089..6631 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116961.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene rplE CDS 6685..6990 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400428.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene rpsN CDS 7002..7400 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093700.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene rpsH CDS 7442..7975 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene rplF CDS 8053..8349 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555473.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene rplR sequence047 source 1..8407 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1578..2807 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918154.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(3205..4017) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(4099..5385) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene hisC CDS complement(5438..6268) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384626.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 misc_feature complement(6689..>8407) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957473.1:excinuclease ABC subunit UvrA locus_tag LOCUS_05000 sequence048 source 1..8271 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 284..1168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 1165..2136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 2557..3732 product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228948.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 3754..4626 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064791.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 4772..5722 product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530313.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(6259..7569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 sequence049 source 1..8080 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 752..2320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(2348..3301) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918245.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(3456..4727) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087142.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 4869..5876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 6006..6809 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388938.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene dapF CDS 6847..7911 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261604.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 sequence050 source 1..8065 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(334..522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 460..981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(961..1848) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104987.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 1964..2983 product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203434.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 3024..3635 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267648.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(3623..4501) product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382947.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 4650..5444 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208974.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene cysE CDS complement(5554..6459) product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(6446..6820) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919492.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(6897..7481) product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(7483..7956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05230 sequence051 source 1..8017 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..824 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002224845.1:aminoglycoside phosphotransferase family protein locus_tag LOCUS_05240 CDS 821..1504 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237801.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 1579..2241 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351625.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene rpe CDS 2261..3856 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035712.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene trpE CDS 3860..4444 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035720.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 4447..5469 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103215.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene trpD CDS 5466..6251 product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113174.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene trpC CDS 6577..7041 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 7038..7436 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098688.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 misc_feature complement(7433..>8017) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003085224.1:2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase locus_tag LOCUS_05330 sequence052 source 1..8010 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..641 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704900.1:heme ABC transporter ATP-binding protein locus_tag LOCUS_05340 CDS complement(604..1599) product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(1656..2945) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093150.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene hemL CDS complement(2984..4726) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 4866..5567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 5683..6141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 6551..6904 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551953.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene erpA misc_feature complement(6919..>8010) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003129241.1:peptidoglycan DD-metalloendopeptidase family protein locus_tag LOCUS_05410 sequence053 source 1..7997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(25..1041) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266969.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene dapD CDS complement(1093..2310) product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103591.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene dapC CDS complement(2307..5018) product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(4990..5769) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene map CDS 6083..6964 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092394.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene rpsB sequence054 source 1..7918 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 301..1368 product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 1365..1934 product type 4a pilus biogenesis protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene pilN CDS 1934..2566 product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene pilO CDS 2570..3139 product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene pilP CDS 3286..5352 product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093473135.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 5365..5910 product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095833.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene aroK CDS 5900..6997 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706965.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene aroB CDS complement(6994..7917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 sequence055 source 1..7791 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(199..2283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(2746..3849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 4309..5109 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730868.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(5120..6139) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 6275..7105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 sequence056 source 1..7779 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..637 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005081822.1:carboxymuconolactone decarboxylase family protein locus_tag LOCUS_05600 CDS complement(606..1823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 2216..3034 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994123.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(3054..3605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(3592..4713) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090004.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(4717..5871) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(5960..6808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(6805..7743) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088843.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 sequence057 source 1..7760 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(218..679) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095206.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene greA CDS complement(726..3953) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095207.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene carB CDS complement(3943..5106) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095209.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene carA CDS complement(5536..6336) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706537.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene dapB CDS complement(6633..7754) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095211.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene dnaJ sequence058 source 1..7681 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 128..203 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 416..892 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804308.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 1197..1748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(1973..3118) product monooxygenase YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232789.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene yjiB CDS complement(3578..4429) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104915.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene nadC CDS complement(4426..4935) product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113919.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 4966..5517 product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051592.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene ampD CDS 5572..6360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 6620..7495 product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095645.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene btuF sequence059 source 1..7650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 381..2171 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071595.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 2224..3903 product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 3958..5337 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947991.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene asnS CDS complement(5338..6021) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403266.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(6050..6409) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083946.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(6467..7045) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262424.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene rnhB misc_feature complement(7042..>7650) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192608.1:lipid-A-disaccharide synthase locus_tag LOCUS_05870 sequence060 source 1..7642 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(375..1253) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057737.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(1241..1435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 1634..1807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 1817..3013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(3167..5443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(6188..6880) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114770.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 7080..7382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 sequence061 source 1..7493 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 440..2248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 2337..3158 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644758.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(3262..3495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(3496..3774) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555777.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(3837..4877) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946634.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene mutY CDS complement(4877..6949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 sequence062 source 1..7448 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(735..1085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(1419..2195) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(2222..3574) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920685.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(3597..4265) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(4386..5255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(5255..6019) product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126699554.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(6023..6715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087917.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 sequence063 source 1..7413 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..949 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258877.1:S-methyl-5-thioribose-1-phosphate isomerase locus_tag LOCUS_06080 CDS 946..1581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 1852..2709 product DUF3014 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074019.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 2718..3899 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040422.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 3936..4739 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(4899..6209) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 misc_feature complement(6206..>7413) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016356916.1:type I secretion system permease/ATPase locus_tag LOCUS_06140 sequence064 source 1..7409 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..925 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704627.1:CNNM domain-containing protein locus_tag LOCUS_06150 CDS complement(981..4058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(4282..5949) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389681.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene leuA CDS complement(6366..6887) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092662.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 sequence065 source 1..7408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(532..1662) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450234.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(1791..2402) product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765713.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene gstA CDS 3038..4909 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 4902..6755 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 sequence066 source 1..7314 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061040.1:3-isopropylmalate dehydrogenase locus_tag LOCUS_06230 CDS complement(1204..2442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(2625..2831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(2967..3995) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(4123..4944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 5562..6413 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256256.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 tRNA complement(6851..6925) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 sequence067 source 1..7184 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 135..1640 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707134.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene lysS CDS 1643..2335 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528805.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene ung CDS 2337..3302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(3299..4159) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032622187.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 4306..4761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 misc_feature complement(5610..>7184) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114182.1:L-aspartate oxidase locus_tag LOCUS_06340 sequence068 source 1..7172 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1277..2155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(2181..4577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 5015..5677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 5703..6842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 sequence069 source 1..7169 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(104..901) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123301.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(1112..1264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 1496..2572 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 2569..4011 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920791.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 sequence070 source 1..7081 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 279..2024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 2167..3054 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385602.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(3112..3690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(3831..4880) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296328.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(4886..6217) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 misc_feature complement(6480..>7081) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090625.1:enoyl-CoA hydratase locus_tag LOCUS_06480 sequence071 source 1..7064 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(428..1708) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487368.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene serS CDS complement(1759..2136) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405171.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene crcB CDS complement(2181..3548) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(3532..4239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(4244..6622) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405080.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene ftsK sequence072 source 1..7031 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2944..4146) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728237.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(5284..6261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 sequence073 source 1..7026 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(95..808) product serine/threonine phosphatase PppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106965.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene pppA CDS complement(882..1829) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328819.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 2180..2599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 tRNA 2747..2823 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 2920..3396 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene rimP CDS 3410..4963 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095192.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene nusA sequence074 source 1..6932 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..700 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000164216.1:colanic acid biosynthesis phosphomannomutase CpsG locus_tag LOCUS_06610 CDS 746..1486 product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167009.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene djlA CDS 1550..2746 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921936.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 2743..3453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(3537..4598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(4616..5707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 5824..6501 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 sequence075 source 1..6903 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1012..1683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 1933..2649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 2700..3149 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707111.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene aroQ CDS 3462..4334 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112237.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene prmA CDS 4304..5080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 5282..6178 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095402.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene dusB CDS 6175..6441 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946289.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 sequence076 source 1..6805 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 641..1225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(1363..1737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 2111..2953 product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086755.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 3318..4304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(4388..4834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(5004..5510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 sequence077 source 1..6802 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1327..1608) product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(1612..2751) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063838431.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 3297..4856 product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 sequence078 source 1..6731 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 89..748 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727608.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(1004..1792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(1792..2490) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918530.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(2533..3039) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859521.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 3257..6262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 sequence079 source 1..6717 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 339..512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 516..968 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769445.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene mraZ CDS 981..1898 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047697615.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene rsmH CDS 1895..2239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 2239..3891 product peptidoglycan D,D-transpeptidase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene ftsI CDS 3888..5336 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994100.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 5329..6681 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103104.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene murD sequence080 source 1..6709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(349..1857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 2243..3685 product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095844.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(3697..4608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 4726..6195 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877761.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 sequence081 source 1..6689 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1097..2587) product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039038.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(2584..3612) product cupin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039037.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(3615..4343) product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944588.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(4363..5967) product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073349.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 misc_feature complement(6051..>6689) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039035.1:TonB-dependent receptor locus_tag LOCUS_07050 sequence082 source 1..6665 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 644..2050 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(2061..2483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(2543..3535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(3633..4235) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312247.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(4513..5745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 misc_feature complement(5760..>6665) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228505.1:formate dehydrogenase accessory sulfurtransferase FdhD locus_tag LOCUS_07110 sequence083 source 1..6661 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(282..632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(636..1670) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220126.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene tsaD CDS 2026..2241 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085057.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene rpsU CDS 2526..2993 product lpg2359 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948065.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 3055..4869 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244455.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene dnaG sequence084 source 1..6626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 389..1804 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173294.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene leuC CDS 1801..2388 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057076.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene leuD CDS 2385..4025 product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393734.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene cimA CDS 4511..5158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 5354..6361 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 sequence085 source 1..6601 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 820..1278 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037970.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 1288..2724 product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340179.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 2742..3662 product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325200.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(3672..4424) product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920648.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(4591..4947) product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409617.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(5075..6082) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453965.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 misc_feature complement(6079..>6601) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091125.1:dTMP kinase locus_tag LOCUS_07280 sequence086 source 1..6587 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(51..3068) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039035.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 4200..5036 product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403037.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 5090..6460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 sequence087 source 1..6565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1404..2246 product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267244.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(2478..2801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(2942..4165) product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114854.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene kynU CDS complement(4224..5057) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975294.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 5168..5911 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083339.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 sequence088 source 1..6396 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(386..2059) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706784.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene recN CDS 2168..3220 product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene hrcA CDS 3570..4175 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021933.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene grpE CDS 4295..6217 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105024.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene dnaK sequence089 source 1..6371 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(394..1731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(1728..2480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(2615..3388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(3398..4498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(4633..5820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07450 sequence090 source 1..6155 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(286..1158) product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 sequence091 source 1..6031 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048146.1:ABC transporter permease locus_tag LOCUS_07470 CDS 873..1904 product oligopeptide ABC transporter ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886477.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene oppD CDS 1901..2842 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048144.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(2935..3468) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108825999.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(3471..5291) product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529369.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene cobT misc_feature complement(5311..>6031) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387959.1:cobaltochelatase subunit CobS locus_tag LOCUS_07520 sequence092 source 1..6016 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1539..1868 product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 1874..3400 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173812.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(3394..3906) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886816.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene folK CDS 4081..5166 product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920865.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 5178..5399 product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985297.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 misc_feature complement(5396..>6016) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010925816.1:enoyl-CoA hydratase/isomerase family protein locus_tag LOCUS_07580 sequence093 source 1..5956 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..815 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222813.1:amidohydrolase family protein locus_tag LOCUS_07590 CDS 861..1862 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294634.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 2066..2794 product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705446.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(2908..4353) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688837.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene gatB CDS complement(4350..5804) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772005.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene gatA sequence094 source 1..5952 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 936..1292 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940795.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(1610..2860) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120625.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 3079..4275 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(4272..5597) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060993309.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 sequence095 source 1..5944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(854..1192) product translation initiation factor Sui1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941351.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(1196..1621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(1635..2084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(2172..2936) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035270.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(2933..3649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(3671..3970) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481648.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(3975..4562) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210436297.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 4792..5391 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 sequence096 source 1..5932 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(322..1368) product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109196.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene aroG CDS complement(1509..1739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 2307..2648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 2710..4869 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037788.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 misc_feature complement(4995..>5932) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003419601.1:phytanoyl-CoA dioxygenase family protein locus_tag LOCUS_07800 sequence097 source 1..5931 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(642..1268) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215614.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(1237..1680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(1680..2348) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(2293..3093) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804294.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene proC CDS complement(3132..3827) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266427.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 4013..5050 product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084552.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene pilT CDS complement(5078..5470) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084575.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene ruvX sequence098 source 1..5923 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 371..2518 product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887727.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene scpA CDS 2496..3467 product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene meaB CDS complement(3568..4671) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097663.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 misc_feature complement(4693..>5923) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705315.1:adenylosuccinate lyase locus_tag LOCUS_07910 sequence099 source 1..5904 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1363..2256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(2595..3659) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265540.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 3768..5003 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350283.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 sequence100 source 1..5904 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093745.1:DNA-directed RNA polymerase subunit beta' locus_tag LOCUS_07950 CDS 2881..3255 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555494.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene rpsL CDS 3419..3889 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397077.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene rpsG sequence101 source 1..5886 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1245 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003020815.1:FAD-binding domain-containing protein locus_tag LOCUS_07980 CDS 1411..1944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 2392..2817 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103658.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(2951..4288) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 sequence102 source 1..5885 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(699..1544) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067739.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene rsmI CDS 2092..3927 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268851.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 4328..4876 product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766550.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(4887..5321) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958412.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(5327..5884) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406040.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 sequence103 source 1..5868 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1484..2065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(2199..3083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 3241..3681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(3703..4323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(4375..5208) product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813616.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(5210..5725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 sequence104 source 1..5840 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 189..965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 1054..1506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 1724..2095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(2240..3583) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929838.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 3843..4619 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(4644..5534) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 sequence105 source 1..5796 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 244..1200 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 1320..3434 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356916.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 3431..4741 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(4859..5662) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 sequence106 source 1..5782 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 858..2366 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932668.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene pgi CDS 2363..3121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 3194..4738 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 4764..5495 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230560.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 sequence107 source 1..5776 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 26..1315 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 1397..1819 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140245.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 1896..3398 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103171.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(3658..4530) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705372.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene surE CDS 4590..5429 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731540.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 sequence108 source 1..5753 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(191..1030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 1884..2654 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207208.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene yaaA CDS 2651..3652 product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259505.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 3781..4455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 4452..5228 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 sequence109 source 1..5671 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..532 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206819032.1:DUF3450 domain-containing protein locus_tag LOCUS_08370 CDS 535..1902 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 1919..2437 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 2463..2864 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 2881..3537 product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071948.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 3539..4903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(5067..5669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 sequence110 source 1..5607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(53..922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(1043..1633) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731215.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(2009..2410) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(3063..3911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 4344..4841 product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086612.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 4857..5279 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034360.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 sequence111 source 1..5576 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(516..695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 771..1364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 note possible pseudo, frameshifted CDS 1361..2257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(2280..3818) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173812.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(3893..4060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(4174..4953) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918135.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 sequence112 source 1..5575 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(451..1644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 1914..3554 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086372.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(3543..3680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 4184..4990 product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969784.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene paaG sequence113 source 1..5546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(52..1398) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073704.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene mgtE CDS complement(1473..1742) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812598.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(1739..2614) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377550.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene rapZ CDS complement(2611..3072) product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098853.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene ptsN CDS complement(3076..3363) product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene hpf CDS complement(3393..4793) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073699.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 misc_feature complement(4941..>5546) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002210116.1:LPS export ABC transporter ATP-binding protein locus_tag LOCUS_08660 sequence114 source 1..5523 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 4837..5034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 sequence115 source 1..5517 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 365..1477 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 1584..2621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(2711..3385) product anti-sigma-E factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338712.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene chrR CDS complement(3382..3978) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352315.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(4039..4662) product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039192.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(4685..5374) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419880.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene folE sequence116 source 1..5498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039526.1:protease HtpX locus_tag LOCUS_08740 CDS 652..1809 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089980.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(1923..2759) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104598.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 2807..3559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088487.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 3800..4027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 4073..4303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 sequence117 source 1..5492 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 423..794 product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425238.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 794..1390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 1384..1926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 1923..3020 product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037627.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 3023..3571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 sequence118 source 1..5476 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(405..2279) product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(2829..4295) product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 sequence119 source 1..5469 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 775..1944 product L-lactate dehydrogenase LldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104946.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene lldA CDS 2056..2835 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192152.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 3048..3848 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965766.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 3851..5209 product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225764.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 sequence120 source 1..5468 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 570..1943 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262278.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene tyrS tRNA complement(2429..2504) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA complement(2569..2645) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 2855..3850 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658158.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene birA CDS 3852..4586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 tRNA 4627..4702 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 4904..4987 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 5173..5246 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 sequence121 source 1..5448 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1209..3164 product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207705.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 3161..4807 product geranyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114738.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene atuC sequence122 source 1..5438 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(105..1241) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(1251..2462) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(3223..3921) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532554.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 tRNA complement(4226..4301) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA complement(4423..4499) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA complement(4564..4640) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 sequence123 source 1..5433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1384..2301 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085343.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(2306..3337) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(3525..4220) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771635.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 4368..5300 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 sequence124 source 1..5423 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(636..1259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(1259..3079) product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(3114..3998) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070713.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 misc_feature complement(4086..>5423) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119251.1:SLC13 family permease locus_tag LOCUS_09060 sequence125 source 1..5386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 53..1375 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112297.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 1530..2723 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814691.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 3218..4243 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene gap CDS 4240..5238 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene gap sequence126 source 1..5377 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(437..1225) product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406382.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene dsbC CDS complement(1285..2199) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene xerD CDS complement(2294..3610) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206913.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(4040..4390) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092637.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene rplS CDS complement(4387..5079) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469802.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene trmD sequence127 source 1..5351 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1279 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705444.1:bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase locus_tag LOCUS_09160 CDS complement(1477..2559) product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087591.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 2687..2812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 2837..3418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(3404..4501) product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172946.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 4680..5135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 sequence128 source 1..5279 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 486..2549 product PEGA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008292761.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 3189..3986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 3991..5259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 sequence129 source 1..5277 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 612..827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 928..1746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(1776..2486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 3088..3591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 3905..4549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 sequence130 source 1..5264 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1454..2233) product enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085727.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(2350..3930) product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083665.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 sequence131 source 1..5200 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..856 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185551.1:acyl-CoA dehydrogenase family protein locus_tag LOCUS_09320 CDS complement(839..1306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 1475..2095 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389783.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 2085..2906 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083381.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 2906..3757 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 sequence132 source 1..5192 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3021..4013) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107420.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(4051..4644) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932011.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene purN sequence133 source 1..5133 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 239..1231 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222377.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 1289..2128 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391964.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 2155..3075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 3204..4922 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926642.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 sequence134 source 1..5106 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(333..1178) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 1397..2179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(2161..2502) product Lin0512 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086800.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(2587..2949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 3039..3911 product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(4017..4955) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693444.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene tal sequence135 source 1..5075 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3..431) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004882435.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(521..1897) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097130.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene atpD CDS complement(1929..2789) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene atpG CDS complement(2812..4356) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097134.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene atpA CDS complement(4380..4919) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 sequence136 source 1..5068 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(309..980) product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946950.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene flgD CDS complement(992..1405) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946949.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene flgC CDS complement(1407..1796) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370068.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene flgB CDS 2890..3726 product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068813073.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene flgA CDS 3820..4107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 4139..4630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 sequence137 source 1..5024 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 168..1001 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992443.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 1172..2215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 2749..3213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 3206..3646 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921473.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 misc_feature complement(3648..>5024) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258705.1:dihydroxy-acid dehydratase locus_tag LOCUS_09640 sequence138 source 1..4998 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(216..629) product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815546.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(629..1822) product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967073.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 2003..2611 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene coaE CDS 2611..3381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 3634..4413 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529312.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 sequence139 source 1..4962 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 329..919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(1526..1771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(2364..3416) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071353.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 3558..3959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 3946..4941 product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867187.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 sequence140 source 1..4950 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(786..1088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(1165..1662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(2322..2654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(2916..4067) product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957639.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene lapB CDS complement(4101..4346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(4508..4843) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091441.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene ihfB sequence141 source 1..4937 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 222..2576 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946660.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 sequence142 source 1..4931 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 117..899 product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(912..2183) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866776.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene purD CDS complement(2417..3994) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035747.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene purH CDS complement(4170..4436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 sequence143 source 1..4908 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1293 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003363717.1:DegQ family serine endoprotease locus_tag LOCUS_09860 CDS 1480..3162 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085555.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene lepA CDS 3185..3940 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101969.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene lepB CDS 3999..4367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 sequence144 source 1..4903 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 150..848 product proteobacterial dedicated sortase system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene pdsR CDS 852..2993 product proteobacterial dedicated sortase system histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072224.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene pdsS CDS complement(3033..3653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 3813..4814 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763555.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 sequence145 source 1..4873 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 434..1489 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409396.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene ruvB CDS 1564..2241 product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086125.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene tolQ CDS 2245..2676 product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086126.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene tolR CDS 2676..3398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 3409..4785 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003339472.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene tolB sequence146 source 1..4825 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1031 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920866.1:MFS transporter locus_tag LOCUS_09990 CDS 1099..1440 product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071074.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 1437..2189 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480002.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 2415..2951 product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072197.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 2961..3845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 sequence147 source 1..4809 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(248..1213) product transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092181.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene metR CDS 1587..2837 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 2828..3547 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731310.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 3623..4654 product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 sequence148 source 1..4776 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(823..2346) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173812.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(2451..3059) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406575.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 3840..4469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 sequence149 source 1..4739 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(422..1321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 1815..2585 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789007.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 2590..3402 product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 3353..3859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 3979..4428 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 sequence150 source 1..4726 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(550..1281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(1278..2195) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217854.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene hemC CDS 2322..3749 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103000.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene argH CDS complement(3733..4071) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121284.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene cyaY sequence151 source 1..4676 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1838..2707 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020166.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(3102..4004) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932752.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 sequence152 source 1..4675 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 871..1185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 1491..1769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 2215..3399 product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225687.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(3484..4203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 sequence153 source 1..4657 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(80..946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(974..2038) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092260.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene recA sequence154 source 1..4629 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 538..987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 1129..3354 product DUF5916 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925729.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 misc_feature complement(3359..>4629) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261868.1:Na+/H+ antiporter NhaC locus_tag LOCUS_10300 sequence155 source 1..4604 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 314..1705 product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481484.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 2189..3367 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 3474..4001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 sequence156 source 1..4602 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..803 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268273.1:tRNA 2-thiouridine(34) synthase MnmA locus_tag LOCUS_10340 CDS 800..1423 product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029217215.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene hflD CDS 1446..2834 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705315.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene purB CDS 2827..4227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 sequence157 source 1..4599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..862 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003109274.1:sulfurtransferase locus_tag LOCUS_10380 CDS 843..2633 product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265612.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene mnmD CDS complement(2638..3813) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(3916..4149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 sequence158 source 1..4592 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..859 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032728485.1:rhodanese-related sulfurtransferase locus_tag LOCUS_10420 CDS complement(861..1472) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088446.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 1534..2346 product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(2384..3406) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 3539..4561 product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640058.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 sequence159 source 1..4571 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(691..2433) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 2833..4104 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868824.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 sequence160 source 1..4566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1082 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640165.1:DsbA family protein locus_tag LOCUS_10490 CDS 1601..2410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337106.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 2490..3278 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111854.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 3340..4074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 sequence161 source 1..4559 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(106..1128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(1318..2226) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532449.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 2387..3361 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840054.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 sequence162 source 1..4548 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 553..2172 product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404756.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 2442..3821 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707798.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 misc_feature complement(3961..>4548) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919715.1:coniferyl aldehyde dehydrogenase locus_tag LOCUS_10580 sequence163 source 1..4532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 479..2299 product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529369.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene cobT CDS 2302..2835 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108825999.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(2955..3896) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048144.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 misc_feature complement(3893..>4532) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966899.1:ABC transporter ATP-binding protein locus_tag LOCUS_10620 sequence164 source 1..4515 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(601..2142) product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262057.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(2204..2986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(2983..3414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(3411..3938) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083551.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 4169..4495 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811313.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 sequence165 source 1..4515 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..786 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005080499.1:carboxylesterase family protein locus_tag LOCUS_10680 CDS complement(980..2356) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707798.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 sequence166 source 1..4514 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2878..3987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 sequence167 source 1..4507 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..962 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003098594.1:sigma E protease regulator RseP locus_tag LOCUS_10710 CDS 1076..3703 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092382.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene bamA CDS 3730..4245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 sequence168 source 1..4507 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..511 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002208915.1:transcription elongation factor GreB locus_tag LOCUS_10740 CDS 501..1589 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121508.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene hisC CDS 1595..2071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(2037..2945) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242473.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene tesB misc_feature complement(3012..>4507) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113988.1:DNA internalization-related competence protein ComEC/Rec2 locus_tag LOCUS_10780 sequence169 source 1..4496 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(210..1124) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 1235..3004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 misc_feature complement(3126..>4496) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003414579.1:glutamine synthetase family protein locus_tag LOCUS_10810 sequence170 source 1..4494 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(567..1496) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267475.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(1493..2245) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930110.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 2650..4293 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102932.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 sequence171 source 1..4493 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 162..317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(700..1719) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113798.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene queA tRNA 2041..2127 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(2423..2701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(2698..3309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 3836..4453 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041322404.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 sequence172 source 1..4481 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(714..989) product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087931.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene hupB CDS complement(1099..3519) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087926.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene lon misc_feature complement(3654..>4481) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005770751.1:ATP-dependent Clp protease ATP-binding subunit ClpX locus_tag LOCUS_10920 sequence173 source 1..4472 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(309..500) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094656.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene yacG CDS complement(497..1093) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770017.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene coaE CDS complement(1093..1962) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(1988..3202) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266635.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 misc_feature complement(3217..>4472) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208227.1:type IV-A pilus assembly ATPase PilB locus_tag LOCUS_10970 sequence174 source 1..4458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1040..2134) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616461.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene pheA misc_feature complement(2127..>4458) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815974.1:DNA topoisomerase (ATP-hydrolyzing) subunit A locus_tag LOCUS_10990 sequence175 source 1..4452 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..951 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265494.1:cytochrome P450 locus_tag LOCUS_11000 CDS 965..2344 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(2372..3226) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918831.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 misc_feature complement(3274..>4452) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038934.1:tetratricopeptide repeat protein locus_tag LOCUS_11030 sequence176 source 1..4442 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1603 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919715.1:coniferyl aldehyde dehydrogenase locus_tag LOCUS_11040 CDS complement(1691..2116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 2346..3587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 sequence177 source 1..4439 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(197..2950) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073282.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(3042..3419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(3422..3841) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764092.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 misc_feature complement(3894..>4439) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092867.1:leucyl aminopeptidase locus_tag LOCUS_11100 sequence178 source 1..4434 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(644..1576) product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245554.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene oppB CDS complement(1584..1748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(1767..3185) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727515.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 note possible pseudo, internal stop codon CDS 3243..3392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(3385..4398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 sequence179 source 1..4415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(418..1341) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147872.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene fabD CDS complement(1574..1756) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210931.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene rpmF CDS complement(1937..2602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 2680..3273 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137608.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(3270..4253) product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846324.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene rluC sequence180 source 1..4408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..590 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102590.1:outer membrane protein assembly factor BamD locus_tag LOCUS_11210 misc_feature complement(1457..>4408) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704651.1:PilC/PilY family type IV pilus protein locus_tag LOCUS_11220 sequence181 source 1..4389 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 81..1268 product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114496.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(1534..2394) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726959.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(2466..3599) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265695.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 3719..3958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 sequence182 source 1..4386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 736..1797 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 sequence183 source 1..4382 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(439..1005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1442..2665) product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112579.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 2707..3063 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314592.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene arsC CDS complement(3370..3747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 misc_feature complement(3787..>4382) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940872.1:SDR family oxidoreductase locus_tag LOCUS_11320 sequence184 source 1..4358 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(413..1057) product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101790.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(1041..1796) product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839717.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(1810..2508) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367190.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene fabG CDS complement(2505..2996) product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330217.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 3399..4175 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965382.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 sequence185 source 1..4356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 87..701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088431.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 702..1256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(1527..3746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(3907..4149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 sequence186 source 1..4328 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(503..1312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(1380..2318) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114835.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene scpB CDS complement(2311..3192) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396554.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(3189..4328) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 sequence187 source 1..4324 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(729..1646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(1673..2395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(2395..2778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082373.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(2775..3935) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457682.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene dapE sequence188 source 1..4320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 161..772 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256153.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(857..2761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(2775..3173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 misc_feature complement(3353..>4320) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040401.1:TolC family outer membrane protein locus_tag LOCUS_11530 sequence189 source 1..4294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 45..545 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560983.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene dtd CDS complement(751..1527) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115041.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene tatC CDS complement(1502..1879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(1892..2104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(2114..2455) product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202813.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(2448..2846) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815804.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene hisI misc_feature complement(2843..>4294) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095885.1:ubiquinone biosynthesis regulatory protein kinase UbiB locus_tag LOCUS_11600 sequence190 source 1..4280 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 703..1875 product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399610.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(1876..2343) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(2340..3146) product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969790.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene paaG misc_feature complement(3665..>4280) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478452.1:metal-dependent hydrolase locus_tag LOCUS_11640 sequence191 source 1..4245 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(342..539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 1135..1494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 2363..4096 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102377.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 sequence192 source 1..4244 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1336..2184 product DNA-binding transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213148.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene hexR CDS complement(2263..3474) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 sequence193 source 1..4201 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 322..1200 product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(1197..2459) product Sb-PDE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054959405.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(2491..2988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 3075..3947 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 sequence194 source 1..4164 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(290..928) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092485.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene adk CDS complement(1010..1825) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112589.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene mazG CDS complement(1919..2821) product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616363.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene cysM CDS complement(2903..3637) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378472.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene recO misc_feature complement(3627..>4164) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003363707.1:GTPase Era locus_tag LOCUS_11780 sequence195 source 1..4163 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(646..1662) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112547.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene nadA CDS 1951..2880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 tRNA 2916..2991 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(3053..3559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 misc_feature complement(3561..>4163) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003111415.1:7-cyano-7-deazaguanine synthase QueC locus_tag LOCUS_11830 sequence196 source 1..4129 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 267..3812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 sequence197 source 1..4068 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1108..2256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(2591..3808) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447207.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 sequence198 source 1..4012 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(375..1937) product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727481.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(2013..2561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(2841..2960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 misc_feature complement(3105..>4012) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266601.1:class I adenylate-forming enzyme family protein locus_tag LOCUS_11900 sequence199 source 1..4007 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1711 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003084404.1:phosphoenolpyruvate--protein phosphotransferase locus_tag LOCUS_11910 CDS complement(1665..2405) product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 2541..3314 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112963.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene lgt sequence200 source 1..4003 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..657 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051618882.1:serine hydrolase domain-containing protein locus_tag LOCUS_11940 CDS 851..1909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(2041..4002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 sequence201 source 1..4003 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2339..3031) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406778.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 3102..3749 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447512.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 sequence202 source 1..4002 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1144 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994173.1:tRNA lysidine(34) synthetase TilS locus_tag LOCUS_11990 CDS 1304..2950 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 3002..3832 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003041978.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene kdsA sequence203 source 1..3976 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(306..1397) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103430.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene prfA CDS complement(1378..2655) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095001.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene hemA sequence204 source 1..3965 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2587..3237) product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525162.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene rluA sequence205 source 1..3955 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(431..506) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 604..2634 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104590.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene uvrB tRNA 2735..2811 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 sequence206 source 1..3945 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 531..1829 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464216.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(2015..2962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 sequence207 source 1..3943 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 433..1290 product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083090.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene motD CDS 1797..2492 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(2599..3846) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172378.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 sequence208 source 1..3938 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 328..1512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 1554..2477 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971730.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 sequence209 source 1..3934 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(33..2123) product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 2198..2899 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086937.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 2930..3490 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 sequence210 source 1..3930 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..503 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095330.1:Gfo/Idh/MocA family oxidoreductase locus_tag LOCUS_12160 CDS 500..1576 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 misc_feature complement(2006..>3930) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071225.1:efflux RND transporter permease subunit locus_tag LOCUS_12180 sequence211 source 1..3919 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1520..3559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 sequence212 source 1..3909 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 130..1272 product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090103.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(1284..2168) product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(2253..2630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(2630..3352) product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038304.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(3539..3829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 note possible pseudo, internal stop codon sequence213 source 1..3906 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(424..744) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(853..2064) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921354.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 2321..2611 product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346198.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 2623..3072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 misc_feature complement(3216..>3906) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203420.1:thymidylate synthase locus_tag LOCUS_12290 sequence214 source 1..3896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(723..1328) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947139.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(1325..3370) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478506.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene ligA sequence215 source 1..3870 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 207..1391 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922398.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 sequence216 source 1..3857 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1193..1804) product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene nqrE CDS complement(1813..2472) product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119802.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene nqrD CDS complement(2489..3301) product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 misc_feature complement(3294..>3857) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003109478.1:NADH:ubiquinone reductase (Na(+)-transporting) subunit B locus_tag LOCUS_12360 sequence217 source 1..3849 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1914 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206764.1:TonB-dependent receptor locus_tag LOCUS_12370 CDS complement(2051..3415) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224741.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 sequence218 source 1..3849 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(532..1308) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene fabG CDS complement(1343..2374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(2399..3718) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 sequence219 source 1..3844 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..799 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887868.1:glycosyltransferase family 4 protein locus_tag LOCUS_12420 CDS 860..3361 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387818.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 sequence220 source 1..3841 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 442..1761 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707799.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 1769..3073 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338191.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 sequence221 source 1..3837 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(638..2065) product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene xdhA CDS 2522..3148 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083903.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 sequence222 source 1..3820 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(610..1230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(1252..2370) product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 misc_feature complement(2408..>3820) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095699.1:efflux transporter outer membrane subunit OpmH locus_tag LOCUS_12500 sequence223 source 1..3812 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(757..1779) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367019.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene pheS CDS complement(1820..2182) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300683.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene rplT CDS complement(2244..2435) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072303.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene rpmI CDS complement(2553..3080) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367017.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene infC misc_feature complement(3181..>3812) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003090677.1:threonine--tRNA ligase locus_tag LOCUS_12550 sequence224 source 1..3780 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 266..427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 464..1450 product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782748.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(1559..2338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 misc_feature complement(2584..>3780) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125657.1:GTP-binding protein locus_tag LOCUS_12590 sequence225 source 1..3743 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(306..1145) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530979.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(1278..1559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 1697..2137 product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986776.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 2247..3302 product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921634.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 sequence226 source 1..3737 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..885 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_036462348.1:acyl-CoA dehydrogenase family protein locus_tag LOCUS_12640 CDS complement(1012..1818) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(2176..2730) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767695.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 2764..3486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 sequence227 source 1..3695 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(20..1009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 1322..2971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 sequence228 source 1..3693 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(19..1023) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267273.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 1434..2834 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 2947..3441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 sequence229 source 1..3693 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 639..1067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(1064..1567) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766190.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene gloA tRNA complement(1732..1824) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 misc_feature complement(2361..>3693) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_036891662.1:selenide, water dikinase SelD locus_tag LOCUS_12750 sequence230 source 1..3678 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 332..1717 product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459963.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 1714..3042 product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707049.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 sequence231 source 1..3675 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1899 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120560.1:glutamate synthase large subunit locus_tag LOCUS_12780 CDS 1910..3349 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 sequence232 source 1..3668 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(635..2278) product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 misc_feature complement(2283..>3668) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003107432.1:VWA domain-containing protein locus_tag LOCUS_12810 sequence233 source 1..3660 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(80..155) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA complement(205..280) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(371..1480) product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096677.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(1508..3493) product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706257.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene pqqU sequence234 source 1..3638 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(406..2106) product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 2170..3378 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965460.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(3366..3638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 sequence235 source 1..3625 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1941 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813909.1:TonB-dependent siderophore receptor locus_tag LOCUS_12870 CDS complement(2031..2834) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 sequence236 source 1..3614 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 647..1030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(1099..2274) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140055.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(2271..2993) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039041.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 misc_feature complement(2986..>3614) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039042.1:alpha/beta hydrolase locus_tag LOCUS_12920 sequence237 source 1..3608 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1772 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930895.1:Fe/S-dependent 2-methylisocitrate dehydratase AcnD locus_tag LOCUS_12930 CDS 1801..2973 product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187247.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene prpF sequence238 source 1..3589 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(195..1277) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764084.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene lptG CDS complement(1274..2338) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene lptF sequence239 source 1..3585 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1247 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002118240.1:acyl-CoA dehydrogenase family protein locus_tag LOCUS_12970 CDS 1506..3050 product long-chain-fatty-acid--CoA ligase FadD13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416081.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene fadD13 sequence240 source 1..3580 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 831..904 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 1817..2596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 sequence241 source 1..3580 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 397..2403 product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 sequence242 source 1..3576 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(556..1539) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707194.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(1544..3505) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706661.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 sequence243 source 1..3572 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(768..1250) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084400.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(1796..3262) product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945875.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene gcvPB sequence244 source 1..3557 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(225..1430) product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(1434..2957) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091383.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene purF misc_feature complement(2972..>3557) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072963.1:CvpA family protein locus_tag LOCUS_13070 sequence245 source 1..3555 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 593..3019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 sequence246 source 1..3553 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 374..517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 514..1587 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266123.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene recF sequence247 source 1..3549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(522..3197) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114556.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene aceE sequence248 source 1..3546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 303..1247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 1484..2359 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967074.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 2367..2591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(2484..3347) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728081.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 sequence249 source 1..3531 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1331..2671) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796577.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 sequence250 source 1..3531 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1044..1547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(1548..2102) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267160.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(2112..3353) product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043123896.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene folC sequence251 source 1..3515 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1473..2141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 sequence252 source 1..3488 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(191..733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(850..1971) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707098.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene ribBA sequence253 source 1..3487 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 771..2087 product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085289.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 2167..2463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 sequence254 source 1..3474 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(734..1291) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626366.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(1482..2123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 sequence255 source 1..3453 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1241..2011) product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 sequence256 source 1..3438 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 772..1245 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405434.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene ybaK CDS 1818..2396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 misc_feature complement(2397..>3438) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086713.1:TRAP transporter permease locus_tag LOCUS_13300 sequence257 source 1..3408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 630..1649 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(1769..3010) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640554.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 sequence258 source 1..3395 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(746..1378) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640531.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(1460..1801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265866.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(2018..3265) product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704814.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene rhlE sequence259 source 1..3383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1777..1902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 sequence260 source 1..3383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 54..1691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 1827..2231 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083442.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(2245..3144) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640156.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 sequence261 source 1..3381 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 287..1099 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016510.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene lpxA CDS 1271..1912 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918133.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(2093..3286) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286858.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 sequence262 source 1..3377 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(597..2237) product DNA alkylation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027581.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(2372..3049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 sequence263 source 1..3355 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 296..1489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 1521..2729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 sequence264 source 1..3326 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 663..1997 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(1985..2785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(2863..3270) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087706.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 sequence265 source 1..3311 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(823..2229) product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088534.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 2427..2561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(2805..3284) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477269.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 sequence266 source 1..3309 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 503..1156 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 1211..2233 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458995.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 2233..3300 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707196.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 sequence267 source 1..3305 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..763 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206559.1:tRNA epoxyqueuosine(34) reductase QueG locus_tag LOCUS_13570 CDS complement(819..1364) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704162.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene orn CDS complement(1457..1624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 1773..2576 product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207963.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene asd misc_feature complement(2577..>3305) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005175550.1:elongation factor P--(R)-beta-lysine ligase locus_tag LOCUS_13610 sequence268 source 1..3294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(47..394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(394..1158) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(1355..2269) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(2403..2981) product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339294.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 sequence269 source 1..3294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..697 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113457.1:tRNA (uridine(54)-C5)-methyltransferase TrmA locus_tag LOCUS_13660 CDS 694..1020 product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201313.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 1037..1558 product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(1623..2477) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923326.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(2474..3094) product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene dut sequence270 source 1..3290 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 516..947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 982..2124 product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 2188..2673 product MJ0936 family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870450.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 2670..3263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 sequence271 source 1..3272 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1320..2186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 2674..3180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 sequence272 source 1..3268 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 867..1730 product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 2320..2832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 sequence273 source 1..3257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(355..1275) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 1582..2652 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895326.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 sequence274 source 1..3245 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1298..3166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 sequence275 source 1..3239 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 435..1514 product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920865.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 1535..2143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 2242..2982 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917897.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 sequence276 source 1..3239 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence277 source 1..3238 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(429..1892) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228965.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 misc_feature complement(1883..>3238) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730162.1:fatty acid--CoA ligase family protein locus_tag LOCUS_13870 sequence278 source 1..3234 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 412..1590 product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878493.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(1729..2352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(2382..2876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 sequence279 source 1..3230 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 427..1176 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027763.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 1339..1848 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707436.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(1845..2183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 tRNA 2234..2310 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 sequence280 source 1..3228 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(100..726) product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564165.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 934..2631 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 sequence281 source 1..3228 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1264..1710) product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090359.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 sequence282 source 1..3227 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(689..1993) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 2100..2657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 misc_feature complement(2667..>3227) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009564165.1:TetR family transcriptional regulator C-terminal domain-containing protein locus_tag LOCUS_13990 sequence283 source 1..3218 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(390..1880) product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119269.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene rhlB misc_feature complement(1994..>3218) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224310.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme locus_tag LOCUS_14010 sequence284 source 1..3207 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(8..83) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(292..2016) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111066.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 misc_feature complement(2013..>3207) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023175504.1:amidohydrolase family protein locus_tag LOCUS_14030 sequence285 source 1..3200 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1064 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256085.1:2-methylfumaryl-CoA isomerase locus_tag LOCUS_14040 CDS 1217..1876 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 1889..2317 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902525.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 sequence286 source 1..3185 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(844..2322) product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878569.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 misc_feature complement(2465..>3185) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528042.1:FAD-binding oxidoreductase locus_tag LOCUS_14080 sequence287 source 1..3185 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 322..726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 1114..2571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919016.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 sequence288 source 1..3179 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1482 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083814.1:AMP-binding protein locus_tag LOCUS_14110 CDS complement(1700..2551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 sequence289 source 1..3176 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1236..2423) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967232.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 misc_feature complement(2499..>3176) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256492.1:amidase locus_tag LOCUS_14140 sequence290 source 1..3174 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(611..1291) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966804.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 1671..2870 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 sequence291 source 1..3169 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..509 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073927.1:S9 family peptidase locus_tag LOCUS_14170 sequence292 source 1..3164 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1074 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090524.1:acyl-CoA dehydrogenase locus_tag LOCUS_14180 CDS complement(1258..2757) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 sequence293 source 1..3158 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 487..1851 product proton-coupled multidrug efflux MATE transporter PmpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112388.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene pmpM CDS complement(1848..2714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 sequence294 source 1..3154 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1451 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704827.1:acetolactate synthase 3 large subunit locus_tag LOCUS_14230 CDS 1448..1942 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095069.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene ilvN CDS 2118..2885 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene pssA sequence295 source 1..3147 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(716..1720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(1717..2811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 sequence296 source 1..3133 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1414 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265753.1:amidohydrolase locus_tag LOCUS_14280 CDS 1411..2670 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919839.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 sequence297 source 1..3124 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1117..1962 product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813616.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(2074..2712) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930283.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 2666..2881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14320 sequence298 source 1..3118 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(18..2192) product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 misc_feature complement(2546..>3118) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404763.1:S9 family peptidase locus_tag LOCUS_14340 sequence299 source 1..3114 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1024..2034 product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922049.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 sequence300 source 1..3087 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 209..847 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937594.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene hisH CDS 837..1616 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene hisF CDS 1632..1832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 2077..3045 product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114796.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 sequence301 source 1..3080 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 316..391 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 440..826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 842..1429 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene hisB CDS 1430..2167 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246848.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene hisA misc_feature complement(2388..>3080) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096067.1:proteolytic complex protein CptA locus_tag LOCUS_14430 sequence302 source 1..3070 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(799..2067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(2086..2613) product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 sequence303 source 1..3068 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 592..1059 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308887.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene rpsF CDS 1063..1290 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene rpsR CDS 1305..2144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957858.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 2156..2617 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317208.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene rplI sequence304 source 1..3064 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1041 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232789.1:monooxygenase YjiB locus_tag LOCUS_14510 CDS complement(1200..2684) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 sequence305 source 1..3039 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(503..1507) product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(1544..2590) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020487294.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 sequence306 source 1..3037 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 823..1188 product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095857.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 1329..1469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 1420..2217 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103462.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene ubiE sequence307 source 1..3028 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1294..1416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(1433..2689) product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719549.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 sequence308 source 1..3027 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..548 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265494.1:cytochrome P450 locus_tag LOCUS_14610 CDS 554..1603 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813471.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 1743..2345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 misc_feature complement(2379..>3027) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003098462.1:alpha/beta hydrolase locus_tag LOCUS_14640 sequence309 source 1..2979 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(453..980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(1589..2101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 sequence310 source 1..2978 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 216..1481 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105195.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 1478..2125 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838879.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene nadD CDS 2129..2485 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037745.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene rsfS CDS 2475..2942 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701620.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene rlmH sequence311 source 1..2974 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1283 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338014.1:Na+/H+ antiporter NhaC locus_tag LOCUS_14710 sequence312 source 1..2972 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(380..1753) product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027026.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 1995..2444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 2537..2710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(2759..2920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 sequence313 source 1..2964 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1123..1323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(1346..2527) product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118590.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 sequence314 source 1..2962 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(50..1009) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119196.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene lipA CDS complement(1025..1684) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313884.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene lipB CDS complement(1687..1950) product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763243.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 misc_feature complement(1965..>2962) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093182.1:D-alanyl-D-alanine carboxypeptidase family protein locus_tag LOCUS_14810 sequence315 source 1..2957 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 717..1007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 1029..1259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 1313..2392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 sequence316 source 1..2951 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(136..672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(673..1128) product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene xcpT CDS complement(1286..2506) product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene xcpS sequence317 source 1..2951 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1525..1713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(1883..2737) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327314.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 sequence318 source 1..2944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 331..1233 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727159.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 1394..2494 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 sequence319 source 1..2939 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2861 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929325.1:tetratricopeptide repeat protein locus_tag LOCUS_14920 sequence320 source 1..2938 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(945..2027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 misc_feature complement(2233..>2938) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267273.1:NADP-dependent oxidoreductase locus_tag LOCUS_14940 sequence321 source 1..2933 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(35..904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(1077..1538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(1571..2068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(2069..2899) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003105.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 sequence322 source 1..2905 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(312..1268) product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114230.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(1338..2297) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087749.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 sequence323 source 1..2902 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(742..1554) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409413.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 misc_feature complement(1723..>2902) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919912.1:acyl-CoA dehydrogenase family protein locus_tag LOCUS_15020 sequence324 source 1..2899 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(83..880) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(877..2028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 2121..2534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 sequence325 source 1..2898 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 509..1645 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088879.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 sequence326 source 1..2887 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 102..449 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707590.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 459..1031 product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418801.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 1035..1622 product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766550.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(1615..1989) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377610.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(2006..2653) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406040.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 sequence327 source 1..2886 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1489..1974) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863309.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 sequence328 source 1..2877 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence329 source 1..2876 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..883 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084309.1:TauD/TfdA family dioxygenase locus_tag LOCUS_15130 CDS complement(949..1458) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920716.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 1942..2694 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312247.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 sequence330 source 1..2871 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071057.1:FMN-binding glutamate synthase family protein locus_tag LOCUS_15160 CDS complement(867..1142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 1343..2164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 misc_feature complement(2223..>2871) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967075.1:S8 family serine peptidase locus_tag LOCUS_15190 sequence331 source 1..2871 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 82..924 product 2OG-Fe(II) oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262215.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(1096..2283) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037833.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 sequence332 source 1..2868 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(515..1534) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019960.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene prfA misc_feature complement(1636..>2868) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095001.1:glutamyl-tRNA reductase locus_tag LOCUS_15230 sequence333 source 1..2867 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 337..1299 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768186.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene fmt CDS 1296..2594 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266131.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene rsmB sequence334 source 1..2866 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(598..1704) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920254.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 misc_feature complement(1847..>2866) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943389.1:glycerol-3-phosphate dehydrogenase/oxidase locus_tag LOCUS_15270 sequence335 source 1..2855 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(216..1079) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112994.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(1461..1862) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809511.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 sequence336 source 1..2854 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(840..2360) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066658.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(2599..2772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15310 sequence337 source 1..2850 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..739 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965832.1:alkyl sulfatase dimerization domain-containing protein locus_tag LOCUS_15320 CDS 763..891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(926..1855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(1869..2285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 sequence338 source 1..2847 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 460..1515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 sequence339 source 1..2841 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..657 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809053.1:HlyD family type I secretion periplasmic adaptor subunit locus_tag LOCUS_15370 CDS 657..1274 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809051.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 sequence340 source 1..2836 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1306..2301 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262762.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(2337..2789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 sequence341 source 1..2829 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 61..1734 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932748.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene recD CDS 1731..2591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 sequence342 source 1..2813 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 567..1499 product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417821.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene rluD CDS 1496..2218 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602844.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene pgeF sequence343 source 1..2800 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 402..1637 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089117.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(1760..2599) product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948031.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 sequence344 source 1..2793 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..743 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728413.1:alpha/beta hydrolase locus_tag LOCUS_15470 CDS 980..1819 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(2023..2631) product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064232.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 sequence345 source 1..2784 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 407..1237 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467169.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene galU CDS complement(1257..2135) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839117.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(2224..2487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 sequence346 source 1..2784 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1108..2550 product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 sequence347 source 1..2783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1528 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940770.1:ABC transporter ATP-binding protein locus_tag LOCUS_15540 sequence348 source 1..2781 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(132..989) product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548604.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(993..2165) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 misc_feature complement(2202..>2781) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337380.1:gamma-glutamylcyclotransferase locus_tag LOCUS_15570 sequence349 source 1..2776 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 sequence350 source 1..2773 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..829 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003106427.1:FtsH protease activity modulator HflK locus_tag LOCUS_15590 CDS 849..1721 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366315.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene hflC CDS 1775..1966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 sequence351 source 1..2767 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1168 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003083059.1:flagellar biosynthesis protein FlhA locus_tag LOCUS_15620 sequence352 source 1..2765 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(571..1989) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 sequence353 source 1..2763 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(422..1024) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113746.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 1186..1950 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804205.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 1992..2447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 sequence354 source 1..2754 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(810..2375) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001911253.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene murJ sequence355 source 1..2753 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(672..1361) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106707.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene cmk CDS complement(1468..2343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 sequence356 source 1..2752 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1318..2655 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314634.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene pabB sequence357 source 1..2752 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 971..1468 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085194.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 misc_feature complement(1478..>2752) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037392671.1:aromatic ring-hydroxylating dioxygenase subunit alpha locus_tag LOCUS_15720 sequence358 source 1..2750 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..930 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000445244.1:3-phosphoshikimate 1-carboxyvinyltransferase locus_tag LOCUS_15730 CDS complement(970..1947) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 sequence359 source 1..2749 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(820..2052) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920352.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 sequence360 source 1..2738 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1012 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112397.1:bifunctional isocitrate dehydrogenase kinase/phosphatase locus_tag LOCUS_15760 CDS 1012..1656 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070937794.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 1653..2408 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229011.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 sequence361 source 1..2735 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 303..902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 note possible pseudo, internal stop codon misc_feature complement(935..>2735) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001271572.1:polyphosphate kinase 1 locus_tag LOCUS_15800 sequence362 source 1..2734 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1131..1790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 sequence363 source 1..2733 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..771 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115030.1:cytochrome c oxidase subunit 3 locus_tag LOCUS_15820 CDS complement(1074..1289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 1373..2146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119510.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 2118..2690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 sequence364 source 1..2731 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(480..2309) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097047.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene sppA sequence365 source 1..2727 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(416..1237) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 1550..2650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 sequence366 source 1..2724 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(177..2276) product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640693.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 sequence367 source 1..2720 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(755..1435) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966058.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 sequence368 source 1..2713 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(83..784) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986243.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 1313..2464 product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731135.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 sequence369 source 1..2708 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 619..703 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 780..2171 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087920.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene tig sequence370 source 1..2693 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(414..1106) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(1173..2390) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene fabB sequence371 source 1..2691 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..1022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 1159..1698 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene pgsA CDS complement(1695..2000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(1997..2575) product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 sequence372 source 1..2689 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..704 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943409.1:efflux RND transporter permease subunit locus_tag LOCUS_16000 tRNA 787..862 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(952..1182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(1189..1440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 1773..2084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 sequence373 source 1..2683 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2076..2561) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 sequence374 source 1..2671 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1092 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102294.1:selenocysteine-specific translation elongation factor locus_tag LOCUS_16050 CDS 1233..2291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 sequence375 source 1..2646 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(528..1157) product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098558.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(1180..2121) product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036881.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene truD CDS complement(2118..2594) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115651.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene ispF sequence376 source 1..2642 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence377 source 1..2632 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence378 source 1..2628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(462..614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(619..888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 968..1663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(1733..2446) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419060.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 sequence379 source 1..2624 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 479..727 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419207.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 803..1642 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 1639..2616 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583317.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 sequence380 source 1..2620 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(292..579) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003650103.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 763..1125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(1049..2422) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 sequence381 source 1..2620 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 53..640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 711..1796 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 1808..2527 product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 sequence382 source 1..2618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1603..>2618) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256388.1:nucleoside hydrolase locus_tag LOCUS_16230 sequence383 source 1..2618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 937..1674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 1693..2046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 misc_feature complement(2085..>2618) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867337.1:MFS transporter locus_tag LOCUS_16260 sequence384 source 1..2615 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(206..1384) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 1487..2533 product ornithine utilization transcriptional regulator OruR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114220.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene oruR sequence385 source 1..2614 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence386 source 1..2612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 359..478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 sequence387 source 1..2603 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(188..658) product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490611.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene moaE CDS complement(660..914) product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193789.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene moaD CDS complement(911..1393) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986478.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene moaC CDS 1433..1876 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 sequence388 source 1..2601 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1636 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640166.1:sulfatase-like hydrolase/transferase locus_tag LOCUS_16340 CDS 1650..2354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 sequence389 source 1..2598 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..623 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948060.1:radical SAM family heme chaperone HemW locus_tag LOCUS_16360 CDS complement(620..1282) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411920.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene trmB CDS complement(1299..1682) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261343.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(1679..2542) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084510.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene rpoH sequence390 source 1..2593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(580..1107) product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104708.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(1117..2058) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376303.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 misc_feature complement(2066..>2593) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969434.1:AAA family ATPase locus_tag LOCUS_16420 sequence391 source 1..2593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2026 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104597.1:transglycosylase SLT domain-containing protein locus_tag LOCUS_16430 sequence392 source 1..2590 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 281..925 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479800.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(915..2531) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064742.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 sequence393 source 1..2586 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..564 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003400979.1:SDR family oxidoreductase locus_tag LOCUS_16460 misc_feature complement(571..>2586) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204428.1:acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha locus_tag LOCUS_16470 sequence394 source 1..2576 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 313..900 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene rpoE CDS 1415..2005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 sequence395 source 1..2568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..814 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532911.1:aminomethyltransferase family protein locus_tag LOCUS_16500 CDS 896..2170 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528000.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 sequence396 source 1..2567 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1413 product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene oadA CDS 1416..2555 product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 sequence397 source 1..2563 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(267..1757) product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene amiB CDS complement(2010..2486) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457080.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene tsaE sequence398 source 1..2549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence399 source 1..2544 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(46..804) product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene metF CDS complement(886..2040) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706910.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene metK sequence400 source 1..2542 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(259..1644) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496557.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene hemL sequence401 source 1..2537 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 257..2215 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 sequence402 source 1..2534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence403 source 1..2529 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(250..1092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(1089..2108) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223398.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(2119..2469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 sequence404 source 1..2526 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1062..2210) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 sequence405 source 1..2526 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(76..609) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071567.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene rimM CDS complement(626..901) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092643.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene rpsP misc_feature complement(1227..>2526) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004406399.1:signal recognition particle protein locus_tag LOCUS_16660 sequence406 source 1..2523 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(822..1367) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937593.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(1454..2155) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125332.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 sequence407 source 1..2518 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1322..2002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(2220..2516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 sequence408 source 1..2513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence409 source 1..2513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1163..1972 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404449.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 1962..2414 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene rnhA sequence410 source 1..2512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(243..890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(1055..1612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 misc_feature complement(1640..>2512) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728663.1:NAD(P)/FAD-dependent oxidoreductase locus_tag LOCUS_16750 sequence411 source 1..2507 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(587..1660) product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919059.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 sequence412 source 1..2507 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1425 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102062.1:DNA topoisomerase IV subunit B locus_tag LOCUS_16770 sequence413 source 1..2504 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1013..2041) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919916.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 sequence414 source 1..2503 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(494..>2503) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918879.1:TonB-dependent receptor locus_tag LOCUS_16790