>Feature sequence001 658 1749 gene locus_tag LOCUS_00010 658 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2553 1843 gene locus_tag LOCUS_00020 2553 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3827 2568 gene locus_tag LOCUS_00030 gene rho 3827 2568 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096334.1 protein_id gnl|my_center|LOCUS_00030 4370 4047 gene locus_tag LOCUS_00040 gene trxA 4370 4047 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_00040 5471 4479 gene locus_tag LOCUS_00050 gene hemB 5471 4479 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096352.1 protein_id gnl|my_center|LOCUS_00050 7447 5579 gene locus_tag LOCUS_00060 7447 5579 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 protein_id gnl|my_center|LOCUS_00060 7977 7477 gene locus_tag LOCUS_00070 7977 7477 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207954.1 protein_id gnl|my_center|LOCUS_00070 8667 8059 gene locus_tag LOCUS_00080 8667 8059 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405918.1 protein_id gnl|my_center|LOCUS_00080 10208 8664 gene locus_tag LOCUS_00090 gene gshA 10208 8664 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 protein_id gnl|my_center|LOCUS_00090 10411 10214 gene locus_tag LOCUS_00100 10411 10214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12655 10448 gene locus_tag LOCUS_00110 12655 10448 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_00110 13128 12652 gene locus_tag LOCUS_00120 13128 12652 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940875.1 protein_id gnl|my_center|LOCUS_00120 13341 14696 gene locus_tag LOCUS_00130 13341 14696 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926605.1 protein_id gnl|my_center|LOCUS_00130 14693 15925 gene locus_tag LOCUS_00140 14693 15925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15922 17127 gene locus_tag LOCUS_00150 15922 17127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 17145 17879 gene locus_tag LOCUS_00160 17145 17879 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931160.1 protein_id gnl|my_center|LOCUS_00160 18167 18865 gene locus_tag LOCUS_00170 18167 18865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18852 19613 gene locus_tag LOCUS_00180 18852 19613 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974643.1 protein_id gnl|my_center|LOCUS_00180 20206 19814 gene locus_tag LOCUS_00190 20206 19814 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895698.1 protein_id gnl|my_center|LOCUS_00190 20883 20203 gene locus_tag LOCUS_00200 gene yrfG 20883 20203 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769873.1 protein_id gnl|my_center|LOCUS_00200 20977 21792 gene locus_tag LOCUS_00210 gene cysQ 20977 21792 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818748.1 protein_id gnl|my_center|LOCUS_00210 >Feature sequence002 1219 404 gene locus_tag LOCUS_00220 1219 404 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262642.1 protein_id gnl|my_center|LOCUS_00220 2472 1216 gene locus_tag LOCUS_00230 2472 1216 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_00230 3071 2472 gene locus_tag LOCUS_00240 gene petA 3071 2472 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100631.1 protein_id gnl|my_center|LOCUS_00240 3624 3238 gene locus_tag LOCUS_00250 gene rpsI 3624 3238 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829815.1 protein_id gnl|my_center|LOCUS_00250 4133 3705 gene locus_tag LOCUS_00260 gene rplM 4133 3705 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948407.1 protein_id gnl|my_center|LOCUS_00260 5477 4359 gene locus_tag LOCUS_00270 gene zapE 5477 4359 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094297.1 protein_id gnl|my_center|LOCUS_00270 6998 5697 gene locus_tag LOCUS_00280 gene hisD 6998 5697 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268859.1 protein_id gnl|my_center|LOCUS_00280 7657 6995 gene locus_tag LOCUS_00290 gene hisG 7657 6995 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098837.1 protein_id gnl|my_center|LOCUS_00290 8924 7662 gene locus_tag LOCUS_00300 gene murA 8924 7662 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946583.1 protein_id gnl|my_center|LOCUS_00300 9157 8930 gene locus_tag LOCUS_00310 9157 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 9366 9998 gene locus_tag LOCUS_00320 9366 9998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 10103 10627 gene locus_tag LOCUS_00330 10103 10627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 10624 11370 gene locus_tag LOCUS_00340 gene lptB 10624 11370 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094355.1 protein_id gnl|my_center|LOCUS_00340 11515 13128 gene locus_tag LOCUS_00350 11515 13128 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377556.1 protein_id gnl|my_center|LOCUS_00350 13203 13664 gene locus_tag LOCUS_00360 gene ptsN 13203 13664 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400244.1 protein_id gnl|my_center|LOCUS_00360 13661 14548 gene locus_tag LOCUS_00370 gene rapZ 13661 14548 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094361.1 protein_id gnl|my_center|LOCUS_00370 14558 14830 gene locus_tag LOCUS_00380 14558 14830 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090869.1 protein_id gnl|my_center|LOCUS_00380 14834 16174 gene locus_tag LOCUS_00390 gene mgtE 14834 16174 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073704.1 protein_id gnl|my_center|LOCUS_00390 16184 16771 gene locus_tag LOCUS_00400 16184 16771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 17546 16737 gene locus_tag LOCUS_00410 17546 16737 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_00410 >Feature sequence003 1707 1084 gene locus_tag LOCUS_00420 1707 1084 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687611.1 protein_id gnl|my_center|LOCUS_00420 2548 1742 gene locus_tag LOCUS_00430 gene truA 2548 1742 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706494.1 protein_id gnl|my_center|LOCUS_00430 4290 2554 gene locus_tag LOCUS_00440 4290 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 5407 4388 gene locus_tag LOCUS_00450 5407 4388 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948008.1 protein_id gnl|my_center|LOCUS_00450 6638 5544 gene locus_tag LOCUS_00460 gene aroC 6638 5544 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209711.1 protein_id gnl|my_center|LOCUS_00460 6711 7259 gene locus_tag LOCUS_00470 gene folE 6711 7259 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346200.1 protein_id gnl|my_center|LOCUS_00470 8055 7285 gene locus_tag LOCUS_00480 8055 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 8608 8156 gene locus_tag LOCUS_00490 8608 8156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 10570 8648 gene locus_tag LOCUS_00500 gene htpG 10570 8648 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087446.1 protein_id gnl|my_center|LOCUS_00500 11613 10738 gene locus_tag LOCUS_00510 gene sucD 11613 10738 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087428.1 protein_id gnl|my_center|LOCUS_00510 12779 11610 gene locus_tag LOCUS_00520 gene sucC 12779 11610 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087425.1 protein_id gnl|my_center|LOCUS_00520 14667 13213 gene locus_tag LOCUS_00530 gene lpdA 14667 13213 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087422.1 protein_id gnl|my_center|LOCUS_00530 15903 14677 gene locus_tag LOCUS_00540 gene odhB 15903 14677 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114264.1 protein_id gnl|my_center|LOCUS_00540 <18717 16215 gene locus_tag LOCUS_00550 <18717 16215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003087413.1:2-oxoglutarate dehydrogenase E1 component >Feature sequence004 245 766 gene locus_tag LOCUS_00560 245 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 756 1997 gene locus_tag LOCUS_00570 756 1997 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_00570 2099 3217 gene locus_tag LOCUS_00580 gene leuB 2099 3217 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943508.1 protein_id gnl|my_center|LOCUS_00580 3549 3322 gene locus_tag LOCUS_00590 3549 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 4270 3659 gene locus_tag LOCUS_00600 4270 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 4312 5448 gene locus_tag LOCUS_00610 4312 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 5576 6205 gene locus_tag LOCUS_00620 5576 6205 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_00620 6408 6962 gene locus_tag LOCUS_00630 6408 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00630 8271 7477 gene locus_tag LOCUS_00640 8271 7477 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117193320.1 protein_id gnl|my_center|LOCUS_00640 10634 8280 gene locus_tag LOCUS_00650 10634 8280 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_00650 11104 10631 gene locus_tag LOCUS_00660 11104 10631 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027560187.1 protein_id gnl|my_center|LOCUS_00660 11754 11272 gene locus_tag LOCUS_00670 11754 11272 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528005.1 protein_id gnl|my_center|LOCUS_00670 13082 12285 gene locus_tag LOCUS_00680 13082 12285 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_00680 14376 13264 gene locus_tag LOCUS_00690 gene ald 14376 13264 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946659.1 protein_id gnl|my_center|LOCUS_00690 14892 15377 gene locus_tag LOCUS_00700 gene dadR 14892 15377 CDS product transcriptional regulator DadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096535.1 protein_id gnl|my_center|LOCUS_00700 15620 16273 gene locus_tag LOCUS_00710 15620 16273 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918213.1 protein_id gnl|my_center|LOCUS_00710 >Feature sequence005 602 1909 gene locus_tag LOCUS_00720 602 1909 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265814.1 protein_id gnl|my_center|LOCUS_00720 2443 1970 gene locus_tag LOCUS_00730 2443 1970 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266315.1 protein_id gnl|my_center|LOCUS_00730 2673 2488 gene locus_tag LOCUS_00740 2673 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 2781 3233 gene locus_tag LOCUS_00750 2781 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089069.1 protein_id gnl|my_center|LOCUS_00750 3326 3610 gene locus_tag LOCUS_00760 3326 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 3671 3994 gene locus_tag LOCUS_00770 3671 3994 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023310.1 protein_id gnl|my_center|LOCUS_00770 4090 4872 gene locus_tag LOCUS_00780 4090 4872 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_00780 4874 6343 gene locus_tag LOCUS_00790 4874 6343 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933713.1 protein_id gnl|my_center|LOCUS_00790 6340 7239 gene locus_tag LOCUS_00800 6340 7239 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957537.1 protein_id gnl|my_center|LOCUS_00800 8873 7263 gene locus_tag LOCUS_00810 8873 7263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 9224 9436 gene locus_tag LOCUS_00820 9224 9436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 9654 10076 gene locus_tag LOCUS_00830 9654 10076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 10472 10101 gene locus_tag LOCUS_00840 10472 10101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 10660 11058 gene locus_tag LOCUS_00850 10660 11058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 11207 12061 gene locus_tag LOCUS_00860 11207 12061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 12293 13393 gene locus_tag LOCUS_00870 12293 13393 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897309.1 protein_id gnl|my_center|LOCUS_00870 14568 13456 gene locus_tag LOCUS_00880 gene pilU 14568 13456 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_00880 15583 14588 gene locus_tag LOCUS_00890 15583 14588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 <16345 15761 gene locus_tag LOCUS_00900 <16345 15761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140202.1:bacteriorhodopsin-like >Feature sequence006 391 1620 gene locus_tag LOCUS_00910 391 1620 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945874.1 protein_id gnl|my_center|LOCUS_00910 1627 2736 gene locus_tag LOCUS_00920 gene tgt 1627 2736 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073009.1 protein_id gnl|my_center|LOCUS_00920 2910 3236 gene locus_tag LOCUS_00930 gene yajC 2910 3236 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092856.1 protein_id gnl|my_center|LOCUS_00930 3272 5143 gene locus_tag LOCUS_00940 gene secD 3272 5143 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100609.1 protein_id gnl|my_center|LOCUS_00940 5140 6066 gene locus_tag LOCUS_00950 gene secF 5140 6066 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460198.1 protein_id gnl|my_center|LOCUS_00950 6941 6126 gene locus_tag LOCUS_00960 gene suhB 6941 6126 CDS product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092845.1 protein_id gnl|my_center|LOCUS_00960 7026 7772 gene locus_tag LOCUS_00970 gene trmJ 7026 7772 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406500.1 protein_id gnl|my_center|LOCUS_00970 8259 8720 gene locus_tag LOCUS_00980 gene iscR 8259 8720 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380601.1 protein_id gnl|my_center|LOCUS_00980 9158 10372 gene locus_tag LOCUS_00990 9158 10372 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092832.1 protein_id gnl|my_center|LOCUS_00990 10403 10789 gene locus_tag LOCUS_01000 gene iscU 10403 10789 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213175.1 protein_id gnl|my_center|LOCUS_01000 10851 11174 gene locus_tag LOCUS_01010 gene iscA 10851 11174 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117986.1 protein_id gnl|my_center|LOCUS_01010 11179 11706 gene locus_tag LOCUS_01020 gene hscB 11179 11706 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209833.1 protein_id gnl|my_center|LOCUS_01020 11708 13582 gene locus_tag LOCUS_01030 gene hscA 11708 13582 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100622.1 protein_id gnl|my_center|LOCUS_01030 13611 13949 gene locus_tag LOCUS_01040 gene fdx 13611 13949 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092818.1 protein_id gnl|my_center|LOCUS_01040 13959 14153 gene locus_tag LOCUS_01050 gene iscX 13959 14153 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812452.1 protein_id gnl|my_center|LOCUS_01050 14282 14707 gene locus_tag LOCUS_01060 gene ndk 14282 14707 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552482.1 protein_id gnl|my_center|LOCUS_01060 >Feature sequence007 <1 1100 gene locus_tag LOCUS_01070 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727996.1:acyl-CoA dehydrogenase family protein 3261 2080 gene locus_tag LOCUS_01080 gene mubZ 3261 2080 CDS product mutanobactin A system MFS transporter MubZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074614.1 protein_id gnl|my_center|LOCUS_01080 3724 4275 gene locus_tag LOCUS_01090 gene trmY 3724 4275 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459965.1 protein_id gnl|my_center|LOCUS_01090 4667 5338 gene locus_tag LOCUS_01100 gene npdG 4667 5338 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_01100 5448 6227 gene locus_tag LOCUS_01110 gene cofE 5448 6227 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_01110 6261 7235 gene locus_tag LOCUS_01120 gene cofD 6261 7235 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_01120 7187 7924 gene locus_tag LOCUS_01130 7187 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 7921 10416 gene locus_tag LOCUS_01140 7921 10416 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455006.1 protein_id gnl|my_center|LOCUS_01140 10698 11693 gene locus_tag LOCUS_01150 10698 11693 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_01150 11703 12707 gene locus_tag LOCUS_01160 11703 12707 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_01160 13078 14112 gene locus_tag LOCUS_01170 13078 14112 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_01170 14142 15287 gene locus_tag LOCUS_01180 14142 15287 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969253.1 protein_id gnl|my_center|LOCUS_01180 >Feature sequence008 2087 1230 gene locus_tag LOCUS_01190 2087 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 2791 2087 gene locus_tag LOCUS_01200 2791 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 3288 2791 gene locus_tag LOCUS_01210 3288 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 3842 3360 gene locus_tag LOCUS_01220 3842 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 4680 3844 gene locus_tag LOCUS_01230 4680 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 5067 4684 gene locus_tag LOCUS_01240 5067 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 5678 5205 gene locus_tag LOCUS_01250 5678 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 6336 5701 gene locus_tag LOCUS_01260 6336 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 7496 6354 gene locus_tag LOCUS_01270 7496 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 7678 8292 gene locus_tag LOCUS_01280 7678 8292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 8273 8761 gene locus_tag LOCUS_01290 8273 8761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 8924 9145 gene locus_tag LOCUS_01300 8924 9145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 9195 9635 gene locus_tag LOCUS_01310 9195 9635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 9660 11729 gene locus_tag LOCUS_01320 9660 11729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 11769 12191 gene locus_tag LOCUS_01330 11769 12191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 12353 12673 gene locus_tag LOCUS_01340 12353 12673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 12867 12670 gene locus_tag LOCUS_01350 12867 12670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 14039 12867 gene locus_tag LOCUS_01360 14039 12867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 14256 13978 gene locus_tag LOCUS_01370 14256 13978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 14619 14290 gene locus_tag LOCUS_01380 14619 14290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 >Feature sequence009 41 601 gene locus_tag LOCUS_01390 41 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 885 670 gene locus_tag LOCUS_01400 885 670 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761125.1 protein_id gnl|my_center|LOCUS_01400 1131 889 gene locus_tag LOCUS_01410 1131 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 1525 1136 gene locus_tag LOCUS_01420 1525 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 2507 1908 gene locus_tag LOCUS_01430 2507 1908 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940850.1 protein_id gnl|my_center|LOCUS_01430 2825 3868 gene locus_tag LOCUS_01440 2825 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927783.1 protein_id gnl|my_center|LOCUS_01440 3998 5050 gene locus_tag LOCUS_01450 3998 5050 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338724.1 protein_id gnl|my_center|LOCUS_01450 6762 5260 gene locus_tag LOCUS_01460 6762 5260 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263552.1 protein_id gnl|my_center|LOCUS_01460 7003 7389 gene locus_tag LOCUS_01470 7003 7389 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918415.1 protein_id gnl|my_center|LOCUS_01470 7442 7786 gene locus_tag LOCUS_01480 7442 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01480 7806 7985 gene locus_tag LOCUS_01490 7806 7985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 8073 9335 gene locus_tag LOCUS_01500 8073 9335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 10325 9393 gene locus_tag LOCUS_01510 10325 9393 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 protein_id gnl|my_center|LOCUS_01510 10504 11307 gene locus_tag LOCUS_01520 10504 11307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 11747 12502 gene locus_tag LOCUS_01530 11747 12502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 12690 13175 gene locus_tag LOCUS_01540 12690 13175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 13252 13776 gene locus_tag LOCUS_01550 13252 13776 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112705.1 protein_id gnl|my_center|LOCUS_01550 14559 13780 gene locus_tag LOCUS_01560 14559 13780 CDS product coniferyl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730142.1 protein_id gnl|my_center|LOCUS_01560 >Feature sequence010 3630 2098 gene locus_tag LOCUS_01570 3630 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 3913 3668 gene locus_tag LOCUS_01580 3913 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 4419 3910 gene locus_tag LOCUS_01590 4419 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 5093 4419 gene locus_tag LOCUS_01600 5093 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 5575 5099 gene locus_tag LOCUS_01610 5575 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 6199 5582 gene locus_tag LOCUS_01620 6199 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 6951 6199 gene locus_tag LOCUS_01630 6951 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 7748 6990 gene locus_tag LOCUS_01640 7748 6990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 8227 7823 gene locus_tag LOCUS_01650 8227 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 8689 8234 gene locus_tag LOCUS_01660 8689 8234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 9978 8689 gene locus_tag LOCUS_01670 9978 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 10529 9978 gene locus_tag LOCUS_01680 10529 9978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 10915 10532 gene locus_tag LOCUS_01690 10915 10532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 11089 10949 gene locus_tag LOCUS_01700 11089 10949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 13044 11086 gene locus_tag LOCUS_01710 13044 11086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 13766 13584 gene locus_tag LOCUS_01720 13766 13584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 13822 14019 gene locus_tag LOCUS_01730 13822 14019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 >Feature sequence011 1252 2877 gene locus_tag LOCUS_01740 1252 2877 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931517.1 protein_id gnl|my_center|LOCUS_01740 3822 2947 gene locus_tag LOCUS_01750 3822 2947 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727159.1 protein_id gnl|my_center|LOCUS_01750 5029 4271 gene locus_tag LOCUS_01760 5029 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 5253 6437 gene locus_tag LOCUS_01770 5253 6437 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967050.1 protein_id gnl|my_center|LOCUS_01770 6742 7776 gene locus_tag LOCUS_01780 6742 7776 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_01780 8702 7773 gene locus_tag LOCUS_01790 8702 7773 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332819.1 protein_id gnl|my_center|LOCUS_01790 9928 8771 gene locus_tag LOCUS_01800 9928 8771 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109755.1 protein_id gnl|my_center|LOCUS_01800 11138 9969 gene locus_tag LOCUS_01810 11138 9969 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416097.1 protein_id gnl|my_center|LOCUS_01810 12494 11604 gene locus_tag LOCUS_01820 12494 11604 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917983.1 protein_id gnl|my_center|LOCUS_01820 <13357 12607 gene locus_tag LOCUS_01830 <13357 12607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072022.1:efflux RND transporter permease subunit >Feature sequence012 485 1435 gene locus_tag LOCUS_01840 gene xerC 485 1435 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275252.1 protein_id gnl|my_center|LOCUS_01840 1428 2126 gene locus_tag LOCUS_01850 1428 2126 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768510.1 protein_id gnl|my_center|LOCUS_01850 3493 2123 gene locus_tag LOCUS_01860 gene thrC 3493 2123 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_01860 4331 3993 gene locus_tag LOCUS_01870 gene glnK 4331 3993 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555808.1 protein_id gnl|my_center|LOCUS_01870 4811 6337 gene locus_tag LOCUS_01880 4811 6337 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926358.1 protein_id gnl|my_center|LOCUS_01880 6842 6459 gene locus_tag LOCUS_01890 6842 6459 CDS product cytochrome c5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455203.1 protein_id gnl|my_center|LOCUS_01890 8444 6930 gene locus_tag LOCUS_01900 8444 6930 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802512.1 protein_id gnl|my_center|LOCUS_01900 9434 8796 gene locus_tag LOCUS_01910 gene dsbA 9434 8796 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 protein_id gnl|my_center|LOCUS_01910 10056 9451 gene locus_tag LOCUS_01920 10056 9451 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_01920 10194 10793 gene locus_tag LOCUS_01930 gene yihA 10194 10793 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341625.1 protein_id gnl|my_center|LOCUS_01930 <12654 11155 gene locus_tag LOCUS_01940 <12654 11155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704214.1:DNA polymerase I >Feature sequence013 1437 484 gene locus_tag LOCUS_01950 1437 484 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092045.1 protein_id gnl|my_center|LOCUS_01950 2318 1434 gene locus_tag LOCUS_01960 2318 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 2899 2315 gene locus_tag LOCUS_01970 gene rsxA 2899 2315 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302262.1 protein_id gnl|my_center|LOCUS_01970 4920 2908 gene locus_tag LOCUS_01980 gene metG 4920 2908 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764864.1 protein_id gnl|my_center|LOCUS_01980 5171 6007 gene locus_tag LOCUS_01990 5171 6007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 6609 7172 gene locus_tag LOCUS_02000 gene dcd 6609 7172 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092017.1 protein_id gnl|my_center|LOCUS_02000 7923 7162 gene locus_tag LOCUS_02010 7923 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 8270 9373 gene locus_tag LOCUS_02020 8270 9373 CDS product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706622.1 protein_id gnl|my_center|LOCUS_02020 9578 10753 gene locus_tag LOCUS_02030 9578 10753 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 protein_id gnl|my_center|LOCUS_02030 10755 11447 gene locus_tag LOCUS_02040 gene hda 10755 11447 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443937.1 protein_id gnl|my_center|LOCUS_02040 11444 12520 gene locus_tag LOCUS_02050 11444 12520 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965529.1 protein_id gnl|my_center|LOCUS_02050 >Feature sequence014 <1 580 gene locus_tag LOCUS_02060 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005616363.1:cysteine synthase CysM 620 1924 gene locus_tag LOCUS_02070 gene rlmD 620 1924 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039993.1 protein_id gnl|my_center|LOCUS_02070 1917 4136 gene locus_tag LOCUS_02080 gene relA 1917 4136 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_02080 4164 4817 gene locus_tag LOCUS_02090 gene adk 4164 4817 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064094.1 protein_id gnl|my_center|LOCUS_02090 5023 5360 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aagaaagctgctgccaagaaagc 6065 5466 gene locus_tag LOCUS_02100 gene mobA 6065 5466 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050076897.1 protein_id gnl|my_center|LOCUS_02100 6090 8003 gene locus_tag LOCUS_02110 6090 8003 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925684.1 protein_id gnl|my_center|LOCUS_02110 8024 8707 gene locus_tag LOCUS_02120 gene tsaB 8024 8707 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478795.1 protein_id gnl|my_center|LOCUS_02120 8704 9363 gene locus_tag LOCUS_02130 8704 9363 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113853.1 protein_id gnl|my_center|LOCUS_02130 11721 9319 gene locus_tag LOCUS_02140 gene plsB 11721 9319 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245401.1 protein_id gnl|my_center|LOCUS_02140 12637 11708 gene locus_tag LOCUS_02150 12637 11708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 >Feature sequence015 75 410 gene locus_tag LOCUS_02160 gene secG 75 410 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313628.1 protein_id gnl|my_center|LOCUS_02160 482 568 gene locus_tag LOCUS_t00010 482 568 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 739 815 gene locus_tag LOCUS_t00020 739 815 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 951 1430 gene locus_tag LOCUS_02170 gene rimP 951 1430 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_02170 1437 2921 gene locus_tag LOCUS_02180 gene nusA 1437 2921 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095192.1 protein_id gnl|my_center|LOCUS_02180 2960 5557 gene locus_tag LOCUS_02190 gene infB 2960 5557 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113908.1 protein_id gnl|my_center|LOCUS_02190 5572 5931 gene locus_tag LOCUS_02200 gene rbfA 5572 5931 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268880.1 protein_id gnl|my_center|LOCUS_02200 5937 6863 gene locus_tag LOCUS_02210 gene truB 5937 6863 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351717.1 protein_id gnl|my_center|LOCUS_02210 6961 7230 gene locus_tag LOCUS_02220 gene rpsO 6961 7230 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417682.1 protein_id gnl|my_center|LOCUS_02220 7257 9518 gene locus_tag LOCUS_02230 gene pnp 7257 9518 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095181.1 protein_id gnl|my_center|LOCUS_02230 11549 9606 gene locus_tag LOCUS_02240 gene acs 11549 9606 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113911.1 protein_id gnl|my_center|LOCUS_02240 <12226 11711 gene locus_tag LOCUS_02250 <12226 11711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095142.1:polynucleotide adenylyltransferase PcnB >Feature sequence016 716 111 gene locus_tag LOCUS_02260 gene ribA 716 111 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004412070.1 protein_id gnl|my_center|LOCUS_02260 909 1331 gene locus_tag LOCUS_02270 909 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 1422 2957 gene locus_tag LOCUS_02280 1422 2957 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640504.1 protein_id gnl|my_center|LOCUS_02280 3631 3173 gene locus_tag LOCUS_02290 3631 3173 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208527.1 protein_id gnl|my_center|LOCUS_02290 4310 3798 gene locus_tag LOCUS_02300 4310 3798 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 protein_id gnl|my_center|LOCUS_02300 5376 4594 gene locus_tag LOCUS_02310 5376 4594 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080010657.1 protein_id gnl|my_center|LOCUS_02310 5963 5529 gene locus_tag LOCUS_02320 gene pgpA 5963 5529 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816908.1 protein_id gnl|my_center|LOCUS_02320 7003 5996 gene locus_tag LOCUS_02330 gene thiL 7003 5996 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752139.1 protein_id gnl|my_center|LOCUS_02330 7444 7007 gene locus_tag LOCUS_02340 gene nusB 7444 7007 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958215.1 protein_id gnl|my_center|LOCUS_02340 7908 7441 gene locus_tag LOCUS_02350 gene ribE 7908 7441 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093311.1 protein_id gnl|my_center|LOCUS_02350 9094 7985 gene locus_tag LOCUS_02360 gene ribD 9094 7985 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035932.1 protein_id gnl|my_center|LOCUS_02360 9572 9078 gene locus_tag LOCUS_02370 gene nrdR 9572 9078 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317051.1 protein_id gnl|my_center|LOCUS_02370 9850 11517 gene locus_tag LOCUS_02380 gene ettA 9850 11517 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946440.1 protein_id gnl|my_center|LOCUS_02380 >Feature sequence017 <1 1353 gene locus_tag LOCUS_02390 <1 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074287.1:oligopeptidase A 1350 1595 gene locus_tag LOCUS_02400 1350 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 1635 1862 gene locus_tag LOCUS_02410 1635 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 2654 3313 gene locus_tag LOCUS_02420 2654 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 3303 5660 gene locus_tag LOCUS_02430 3303 5660 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037666.1 protein_id gnl|my_center|LOCUS_02430 5657 6886 gene locus_tag LOCUS_02440 5657 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 7853 9031 gene locus_tag LOCUS_02450 gene coxB 7853 9031 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106288.1 protein_id gnl|my_center|LOCUS_02450 9041 10636 gene locus_tag LOCUS_02460 gene ctaD 9041 10636 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083723.1 protein_id gnl|my_center|LOCUS_02460 10663 11214 gene locus_tag LOCUS_02470 10663 11214 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 protein_id gnl|my_center|LOCUS_02470 >Feature sequence018 734 264 gene locus_tag LOCUS_02480 734 264 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024691.1 protein_id gnl|my_center|LOCUS_02480 997 776 gene locus_tag LOCUS_02490 gene atpE 997 776 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424060.1 protein_id gnl|my_center|LOCUS_02490 1880 1026 gene locus_tag LOCUS_02500 gene atpB 1880 1026 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100237.1 protein_id gnl|my_center|LOCUS_02500 2489 2145 gene locus_tag LOCUS_02510 2489 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 3542 2640 gene locus_tag LOCUS_02520 3542 2640 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_02520 4399 3551 gene locus_tag LOCUS_02530 4399 3551 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707916.1 protein_id gnl|my_center|LOCUS_02530 5154 4525 gene locus_tag LOCUS_02540 gene rsmG 5154 4525 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377883.1 protein_id gnl|my_center|LOCUS_02540 7022 5151 gene locus_tag LOCUS_02550 gene mnmG 7022 5151 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481156.1 protein_id gnl|my_center|LOCUS_02550 8823 7372 gene locus_tag LOCUS_02560 gene mnmE 8823 7372 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244945.1 protein_id gnl|my_center|LOCUS_02560 10504 8816 gene locus_tag LOCUS_02570 gene yidC 10504 8816 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114648.1 protein_id gnl|my_center|LOCUS_02570 11038 10733 gene locus_tag LOCUS_02580 11038 10733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 >Feature sequence019 1933 110 gene locus_tag LOCUS_02590 1933 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02590 6068 1998 gene locus_tag LOCUS_02600 gene rpoB 6068 1998 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 protein_id gnl|my_center|LOCUS_02600 6548 6171 gene locus_tag LOCUS_02610 gene rplL 6548 6171 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946072.1 protein_id gnl|my_center|LOCUS_02610 7105 6578 gene locus_tag LOCUS_02620 gene rplJ 7105 6578 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023073.1 protein_id gnl|my_center|LOCUS_02620 8005 7310 gene locus_tag LOCUS_02630 gene rplA 8005 7310 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400443.1 protein_id gnl|my_center|LOCUS_02630 8439 8005 gene locus_tag LOCUS_02640 gene rplK 8439 8005 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218414.1 protein_id gnl|my_center|LOCUS_02640 9086 8553 gene locus_tag LOCUS_02650 gene nusG 9086 8553 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108028.1 protein_id gnl|my_center|LOCUS_02650 9550 9185 gene locus_tag LOCUS_02660 gene secE 9550 9185 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555502.1 protein_id gnl|my_center|LOCUS_02660 9742 9667 gene locus_tag LOCUS_t00030 9742 9667 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 10984 9794 gene locus_tag LOCUS_02670 gene tuf 10984 9794 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115146.1 protein_id gnl|my_center|LOCUS_02670 11374 11299 gene locus_tag LOCUS_t00040 11374 11299 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence020 1043 204 gene locus_tag LOCUS_02680 1043 204 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267244.1 protein_id gnl|my_center|LOCUS_02680 3315 1645 gene locus_tag LOCUS_02690 3315 1645 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946763.1 protein_id gnl|my_center|LOCUS_02690 4012 3326 gene locus_tag LOCUS_02700 gene ppiA 4012 3326 CDS product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477215.1 protein_id gnl|my_center|LOCUS_02700 4977 4066 gene locus_tag LOCUS_02710 4977 4066 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921140.1 protein_id gnl|my_center|LOCUS_02710 5110 5817 gene locus_tag LOCUS_02720 5110 5817 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941468.1 protein_id gnl|my_center|LOCUS_02720 8070 5935 gene locus_tag LOCUS_02730 8070 5935 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266824.1 protein_id gnl|my_center|LOCUS_02730 <11568 8067 gene locus_tag LOCUS_02740 <11568 8067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108531.1:hybrid sensor histidine kinase/response regulator transcription factor >Feature sequence021 616 1536 gene locus_tag LOCUS_02750 616 1536 CDS product TIGR03854 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225293.1 protein_id gnl|my_center|LOCUS_02750 2480 1533 gene locus_tag LOCUS_02760 2480 1533 CDS product TIGR03564 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727013.1 protein_id gnl|my_center|LOCUS_02760 2678 2893 gene locus_tag LOCUS_02770 2678 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 3721 2864 gene locus_tag LOCUS_02780 gene tesB 3721 2864 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036345.1 protein_id gnl|my_center|LOCUS_02780 4029 3718 gene locus_tag LOCUS_02790 4029 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 5720 4086 gene locus_tag LOCUS_02800 5720 4086 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110588.1 protein_id gnl|my_center|LOCUS_02800 5932 7314 gene locus_tag LOCUS_02810 5932 7314 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_02810 8194 7292 gene locus_tag LOCUS_02820 8194 7292 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090970.1 protein_id gnl|my_center|LOCUS_02820 9111 8191 gene locus_tag LOCUS_02830 gene rarD 9111 8191 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012532645.1 protein_id gnl|my_center|LOCUS_02830 9795 9184 gene locus_tag LOCUS_02840 9795 9184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 >Feature sequence022 1121 36 gene locus_tag LOCUS_02850 1121 36 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230778.1 protein_id gnl|my_center|LOCUS_02850 1281 2609 gene locus_tag LOCUS_02860 1281 2609 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531119.1 protein_id gnl|my_center|LOCUS_02860 2735 3784 gene locus_tag LOCUS_02870 2735 3784 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731394.1 protein_id gnl|my_center|LOCUS_02870 3831 5135 gene locus_tag LOCUS_02880 3831 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 5325 6494 gene locus_tag LOCUS_02890 5325 6494 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064985.1 protein_id gnl|my_center|LOCUS_02890 6494 7732 gene locus_tag LOCUS_02900 6494 7732 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930304.1 protein_id gnl|my_center|LOCUS_02900 7729 8577 gene locus_tag LOCUS_02910 7729 8577 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089916.1 protein_id gnl|my_center|LOCUS_02910 9447 8560 gene locus_tag LOCUS_02920 9447 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 9965 9444 gene locus_tag LOCUS_02930 9965 9444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 10056 10550 gene locus_tag LOCUS_02940 10056 10550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 >Feature sequence023 1592 726 gene locus_tag LOCUS_02950 1592 726 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407877.1 protein_id gnl|my_center|LOCUS_02950 1824 1582 gene locus_tag LOCUS_02960 1824 1582 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771337.1 protein_id gnl|my_center|LOCUS_02960 2252 2683 gene locus_tag LOCUS_02970 2252 2683 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073278.1 protein_id gnl|my_center|LOCUS_02970 3475 2735 gene locus_tag LOCUS_02980 3475 2735 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 protein_id gnl|my_center|LOCUS_02980 6706 3512 gene locus_tag LOCUS_02990 6706 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 8009 6738 gene locus_tag LOCUS_03000 8009 6738 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931796.1 protein_id gnl|my_center|LOCUS_03000 9267 8068 gene locus_tag LOCUS_03010 9267 8068 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880602.1 protein_id gnl|my_center|LOCUS_03010 9386 9961 gene locus_tag LOCUS_03020 9386 9961 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 protein_id gnl|my_center|LOCUS_03020 <10811 9958 gene locus_tag LOCUS_03030 <10811 9958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030032.1:MBL fold metallo-hydrolase >Feature sequence024 1296 166 gene locus_tag LOCUS_03040 1296 166 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083842.1 protein_id gnl|my_center|LOCUS_03040 2736 1537 gene locus_tag LOCUS_03050 2736 1537 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_03050 2881 3861 gene locus_tag LOCUS_03060 2881 3861 CDS product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728687.1 protein_id gnl|my_center|LOCUS_03060 5024 4023 gene locus_tag LOCUS_03070 gene pdxA 5024 4023 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392248.1 protein_id gnl|my_center|LOCUS_03070 5911 5021 gene locus_tag LOCUS_03080 5911 5021 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 protein_id gnl|my_center|LOCUS_03080 7503 6292 gene locus_tag LOCUS_03090 7503 6292 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228589.1 protein_id gnl|my_center|LOCUS_03090 8677 8243 gene locus_tag LOCUS_03100 8677 8243 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770885.1 protein_id gnl|my_center|LOCUS_03100 <10717 8744 gene locus_tag LOCUS_03110 <10717 8744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_110170977.1:VWA domain-containing protein >Feature sequence025 <1 525 gene locus_tag LOCUS_03120 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727065.1:carboxylesterase family protein 933 499 gene locus_tag LOCUS_03130 933 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 1287 2696 gene locus_tag LOCUS_03140 1287 2696 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_03140 2935 2729 gene locus_tag LOCUS_03150 2935 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 2864 3691 gene locus_tag LOCUS_03160 2864 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 4603 3893 gene locus_tag LOCUS_03170 4603 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 5162 4587 gene locus_tag LOCUS_03180 5162 4587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 5282 7162 gene locus_tag LOCUS_03190 5282 7162 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706745.1 protein_id gnl|my_center|LOCUS_03190 7187 7546 gene locus_tag LOCUS_03200 7187 7546 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530464.1 protein_id gnl|my_center|LOCUS_03200 7643 10474 gene locus_tag LOCUS_03210 7643 10474 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705867.1 protein_id gnl|my_center|LOCUS_03210 >Feature sequence026 1547 1191 gene locus_tag LOCUS_03220 1547 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 3025 1760 gene locus_tag LOCUS_03230 3025 1760 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924850.1 protein_id gnl|my_center|LOCUS_03230 3060 3239 gene locus_tag LOCUS_03240 3060 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 4415 3228 gene locus_tag LOCUS_03250 4415 3228 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_03250 4800 5837 gene locus_tag LOCUS_03260 4800 5837 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165691202.1 protein_id gnl|my_center|LOCUS_03260 5869 7614 gene locus_tag LOCUS_03270 5869 7614 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223119.1 protein_id gnl|my_center|LOCUS_03270 8115 7675 gene locus_tag LOCUS_03280 8115 7675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 8307 9560 gene locus_tag LOCUS_03290 8307 9560 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_03290 10258 9698 gene locus_tag LOCUS_03300 10258 9698 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965232.1 protein_id gnl|my_center|LOCUS_03300 >Feature sequence027 584 1600 gene locus_tag LOCUS_03310 584 1600 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730894.1 protein_id gnl|my_center|LOCUS_03310 1616 2086 gene locus_tag LOCUS_03320 1616 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 2788 2120 gene locus_tag LOCUS_03330 2788 2120 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207453.1 protein_id gnl|my_center|LOCUS_03330 3007 4236 gene locus_tag LOCUS_03340 3007 4236 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348045.1 protein_id gnl|my_center|LOCUS_03340 4233 5594 gene locus_tag LOCUS_03350 4233 5594 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_03350 5584 6255 gene locus_tag LOCUS_03360 5584 6255 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727713.1 protein_id gnl|my_center|LOCUS_03360 7461 6292 gene locus_tag LOCUS_03370 7461 6292 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229312.1 protein_id gnl|my_center|LOCUS_03370 8459 7527 gene locus_tag LOCUS_03380 gene garL 8459 7527 CDS product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057715.1 protein_id gnl|my_center|LOCUS_03380 9417 8563 gene locus_tag LOCUS_03390 9417 8563 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459931.1 protein_id gnl|my_center|LOCUS_03390 9823 9446 gene locus_tag LOCUS_03400 9823 9446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 >Feature sequence028 1131 205 gene locus_tag LOCUS_03410 gene glyQ 1131 205 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097276.1 protein_id gnl|my_center|LOCUS_03410 1396 2205 gene locus_tag LOCUS_03420 1396 2205 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 protein_id gnl|my_center|LOCUS_03420 2818 2195 gene locus_tag LOCUS_03430 2818 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 4263 2818 gene locus_tag LOCUS_03440 4263 2818 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704169.1 protein_id gnl|my_center|LOCUS_03440 5640 4267 gene locus_tag LOCUS_03450 gene trkA 5640 4267 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_03450 6905 5640 gene locus_tag LOCUS_03460 gene rsmB 6905 5640 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958533.1 protein_id gnl|my_center|LOCUS_03460 7868 6915 gene locus_tag LOCUS_03470 gene fmt 7868 6915 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768186.1 protein_id gnl|my_center|LOCUS_03470 8402 7875 gene locus_tag LOCUS_03480 gene def 8402 7875 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107059.1 protein_id gnl|my_center|LOCUS_03480 8500 9525 gene locus_tag LOCUS_03490 8500 9525 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_03490 >Feature sequence029 3779 1056 gene locus_tag LOCUS_03500 gene secA 3779 1056 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112752.1 protein_id gnl|my_center|LOCUS_03500 4847 3828 gene locus_tag LOCUS_03510 4847 3828 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_03510 4893 5297 gene locus_tag LOCUS_03520 4893 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 6230 5298 gene locus_tag LOCUS_03530 gene lpxC 6230 5298 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957401.1 protein_id gnl|my_center|LOCUS_03530 7763 6612 gene locus_tag LOCUS_03540 gene ftsZ 7763 6612 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011997353.1 protein_id gnl|my_center|LOCUS_03540 9029 7797 gene locus_tag LOCUS_03550 gene ftsA 9029 7797 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364017.1 protein_id gnl|my_center|LOCUS_03550 9748 9026 gene locus_tag LOCUS_03560 9748 9026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 >Feature sequence030 <1 762 gene locus_tag LOCUS_03570 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966515.1:gamma-glutamyltransferase 1884 745 gene locus_tag LOCUS_03580 1884 745 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994167.1 protein_id gnl|my_center|LOCUS_03580 3270 2029 gene locus_tag LOCUS_03590 gene ccmI 3270 2029 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083145.1 protein_id gnl|my_center|LOCUS_03590 3788 3267 gene locus_tag LOCUS_03600 3788 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 4339 3785 gene locus_tag LOCUS_03610 gene dsbE 4339 3785 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083138.1 protein_id gnl|my_center|LOCUS_03610 6320 4350 gene locus_tag LOCUS_03620 6320 4350 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268402.1 protein_id gnl|my_center|LOCUS_03620 6774 6310 gene locus_tag LOCUS_03630 gene ccmE 6774 6310 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107323.1 protein_id gnl|my_center|LOCUS_03630 6953 6771 gene locus_tag LOCUS_03640 6953 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 7684 6950 gene locus_tag LOCUS_03650 7684 6950 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083135.1 protein_id gnl|my_center|LOCUS_03650 8386 7739 gene locus_tag LOCUS_03660 gene ccmB 8386 7739 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457672.1 protein_id gnl|my_center|LOCUS_03660 8973 8386 gene locus_tag LOCUS_03670 gene ccmA 8973 8386 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457758.1 protein_id gnl|my_center|LOCUS_03670 >Feature sequence031 <1 938 gene locus_tag LOCUS_03680 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003368786.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB 1017 2012 gene locus_tag LOCUS_03690 1017 2012 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_03690 2106 2540 gene locus_tag LOCUS_03700 gene ybeY 2106 2540 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003039643.1 protein_id gnl|my_center|LOCUS_03700 2537 3385 gene locus_tag LOCUS_03710 2537 3385 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368790.1 protein_id gnl|my_center|LOCUS_03710 3378 4868 gene locus_tag LOCUS_03720 gene lnt 3378 4868 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105186.1 protein_id gnl|my_center|LOCUS_03720 4971 7430 gene locus_tag LOCUS_03730 gene leuS 4971 7430 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154223677.1 protein_id gnl|my_center|LOCUS_03730 7430 7939 gene locus_tag LOCUS_03740 7430 7939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 7944 8945 gene locus_tag LOCUS_03750 gene holA 7944 8945 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268982.1 protein_id gnl|my_center|LOCUS_03750 >Feature sequence032 285 791 gene locus_tag LOCUS_03760 gene rpsE 285 791 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093697.1 protein_id gnl|my_center|LOCUS_03760 798 983 gene locus_tag LOCUS_03770 gene rpmD 798 983 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083582.1 protein_id gnl|my_center|LOCUS_03770 999 1433 gene locus_tag LOCUS_03780 gene rplO 999 1433 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450562.1 protein_id gnl|my_center|LOCUS_03780 1496 2821 gene locus_tag LOCUS_03790 gene secY 1496 2821 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555469.1 protein_id gnl|my_center|LOCUS_03790 2985 3341 gene locus_tag LOCUS_03800 gene rpsM 2985 3341 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093692.1 protein_id gnl|my_center|LOCUS_03800 3460 3858 gene locus_tag LOCUS_03810 gene rpsK 3460 3858 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083577.1 protein_id gnl|my_center|LOCUS_03810 3874 4494 gene locus_tag LOCUS_03820 gene rpsD 3874 4494 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070631.1 protein_id gnl|my_center|LOCUS_03820 4530 5531 gene locus_tag LOCUS_03830 gene rpoA 4530 5531 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555464.1 protein_id gnl|my_center|LOCUS_03830 5566 5970 gene locus_tag LOCUS_03840 gene rplQ 5566 5970 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093672.1 protein_id gnl|my_center|LOCUS_03840 6175 7353 gene locus_tag LOCUS_03850 6175 7353 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_03850 9779 7350 gene locus_tag LOCUS_03860 gene uvrA 9779 7350 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357724.1 protein_id gnl|my_center|LOCUS_03860 >Feature sequence033 1468 434 gene locus_tag LOCUS_03870 1468 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 4898 1446 gene locus_tag LOCUS_03880 gene mfd 4898 1446 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113980.1 protein_id gnl|my_center|LOCUS_03880 5384 6850 gene locus_tag LOCUS_03890 5384 6850 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244218.1 protein_id gnl|my_center|LOCUS_03890 7346 8686 gene locus_tag LOCUS_03900 7346 8686 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001906078.1 protein_id gnl|my_center|LOCUS_03900 >Feature sequence034 52 2454 gene locus_tag LOCUS_03910 52 2454 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918875.1 protein_id gnl|my_center|LOCUS_03910 2954 4480 gene locus_tag LOCUS_03920 2954 4480 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011541218.1 protein_id gnl|my_center|LOCUS_03920 4480 5136 gene locus_tag LOCUS_03930 4480 5136 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081572.1 protein_id gnl|my_center|LOCUS_03930 5120 6274 gene locus_tag LOCUS_03940 5120 6274 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895326.1 protein_id gnl|my_center|LOCUS_03940 6277 7527 gene locus_tag LOCUS_03950 6277 7527 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006095218.1 protein_id gnl|my_center|LOCUS_03950 7646 8620 gene locus_tag LOCUS_03960 7646 8620 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533083.1 protein_id gnl|my_center|LOCUS_03960 <9404 8888 gene locus_tag LOCUS_03970 <9404 8888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267273.1:NADP-dependent oxidoreductase >Feature sequence035 2965 1829 gene locus_tag LOCUS_03980 2965 1829 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072024.1 protein_id gnl|my_center|LOCUS_03980 3592 4683 gene locus_tag LOCUS_03990 3592 4683 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 protein_id gnl|my_center|LOCUS_03990 4848 6086 gene locus_tag LOCUS_04000 4848 6086 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_04000 6310 6708 gene locus_tag LOCUS_04010 6310 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 7044 7733 gene locus_tag LOCUS_04020 7044 7733 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072357.1 protein_id gnl|my_center|LOCUS_04020 7787 8179 gene locus_tag LOCUS_04030 gene tusD 7787 8179 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209690.1 protein_id gnl|my_center|LOCUS_04030 8187 8534 gene locus_tag LOCUS_04040 8187 8534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 8536 8799 gene locus_tag LOCUS_04050 8536 8799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 8801 9109 gene locus_tag LOCUS_04060 8801 9109 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119979.1 protein_id gnl|my_center|LOCUS_04060 >Feature sequence036 212 991 gene locus_tag LOCUS_04070 212 991 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549540.1 protein_id gnl|my_center|LOCUS_04070 1165 2013 gene locus_tag LOCUS_04080 1165 2013 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813616.1 protein_id gnl|my_center|LOCUS_04080 2130 3617 gene locus_tag LOCUS_04090 gene ilvC 2130 3617 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455226.1 protein_id gnl|my_center|LOCUS_04090 3625 5055 gene locus_tag LOCUS_04100 gene modF 3625 5055 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704776.1 protein_id gnl|my_center|LOCUS_04100 6048 5158 gene locus_tag LOCUS_04110 6048 5158 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919954.1 protein_id gnl|my_center|LOCUS_04110 8452 6281 gene locus_tag LOCUS_04120 8452 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 >Feature sequence037 <1 776 gene locus_tag LOCUS_04130 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809481.1:M23 family metallopeptidase 2260 794 gene locus_tag LOCUS_04140 gene der 2260 794 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092786.1 protein_id gnl|my_center|LOCUS_04140 3462 2269 gene locus_tag LOCUS_04150 gene bamB 3462 2269 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092789.1 protein_id gnl|my_center|LOCUS_04150 4184 3459 gene locus_tag LOCUS_04160 4184 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 5681 4413 gene locus_tag LOCUS_04170 gene hisS 5681 4413 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209816.1 protein_id gnl|my_center|LOCUS_04170 6802 5678 gene locus_tag LOCUS_04180 gene ispG 6802 5678 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380613.1 protein_id gnl|my_center|LOCUS_04180 7925 6792 gene locus_tag LOCUS_04190 7925 6792 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115257.1 protein_id gnl|my_center|LOCUS_04190 8674 7922 gene locus_tag LOCUS_04200 gene pilW 8674 7922 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771019.1 protein_id gnl|my_center|LOCUS_04200 >Feature sequence038 905 417 gene locus_tag LOCUS_04210 905 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 3140 1071 gene locus_tag LOCUS_04220 3140 1071 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 protein_id gnl|my_center|LOCUS_04220 3550 3374 gene locus_tag LOCUS_04230 3550 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 3895 5697 gene locus_tag LOCUS_04240 3895 5697 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_04240 7039 5870 gene locus_tag LOCUS_04250 7039 5870 CDS product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085491.1 protein_id gnl|my_center|LOCUS_04250 8516 7176 gene locus_tag LOCUS_04260 8516 7176 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 protein_id gnl|my_center|LOCUS_04260 >Feature sequence039 <1 1677 gene locus_tag LOCUS_04270 <1 1677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046463506.1:DNA polymerase Y family protein 2126 2320 gene locus_tag LOCUS_04280 2126 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04280 2919 3683 gene locus_tag LOCUS_04290 2919 3683 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229721.1 protein_id gnl|my_center|LOCUS_04290 3781 5685 gene locus_tag LOCUS_04300 3781 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 6631 5678 gene locus_tag LOCUS_04310 6631 5678 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_04310 6949 7839 gene locus_tag LOCUS_04320 6949 7839 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230665.1 protein_id gnl|my_center|LOCUS_04320 >Feature sequence040 1323 172 gene locus_tag LOCUS_04330 1323 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 1841 3589 gene locus_tag LOCUS_04340 1841 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_04340 3860 6265 gene locus_tag LOCUS_04350 3860 6265 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920963.1 protein_id gnl|my_center|LOCUS_04350 7442 6507 gene locus_tag LOCUS_04360 7442 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 <8899 7439 gene locus_tag LOCUS_04370 <8899 7439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920964.1:tetratricopeptide repeat-containing sulfotransferase family protein >Feature sequence041 <1 737 gene locus_tag LOCUS_04380 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114646.1:glycine--tRNA ligase subunit beta 734 2113 gene locus_tag LOCUS_04390 734 2113 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649434.1 protein_id gnl|my_center|LOCUS_04390 4766 2331 gene locus_tag LOCUS_04400 gene gyrB 4766 2331 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097268.1 protein_id gnl|my_center|LOCUS_04400 5995 4919 gene locus_tag LOCUS_04410 gene recF 5995 4919 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377871.1 protein_id gnl|my_center|LOCUS_04410 7127 6015 gene locus_tag LOCUS_04420 gene dnaN 7127 6015 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097262.1 protein_id gnl|my_center|LOCUS_04420 8600 7209 gene locus_tag LOCUS_04430 gene dnaA 8600 7209 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307141.1 protein_id gnl|my_center|LOCUS_04430 >Feature sequence042 2666 2343 gene locus_tag LOCUS_04440 2666 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 3776 2685 gene locus_tag LOCUS_04450 gene ychF 3776 2685 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002050104.1 protein_id gnl|my_center|LOCUS_04450 4388 3780 gene locus_tag LOCUS_04460 gene pth 4388 3780 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816544.1 protein_id gnl|my_center|LOCUS_04460 5075 4422 gene locus_tag LOCUS_04470 5075 4422 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099279.1 protein_id gnl|my_center|LOCUS_04470 6126 5146 gene locus_tag LOCUS_04480 6126 5146 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120445.1 protein_id gnl|my_center|LOCUS_04480 6229 6154 gene locus_tag LOCUS_t00050 6229 6154 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7100 6255 gene locus_tag LOCUS_04490 gene ispE 7100 6255 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195241.1 protein_id gnl|my_center|LOCUS_04490 7423 7097 gene locus_tag LOCUS_04500 7423 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 <8784 7620 gene locus_tag LOCUS_04510 <8784 7620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_074907579.1:tetratricopeptide repeat protein >Feature sequence043 1183 1425 gene locus_tag LOCUS_04520 1183 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 1422 1721 gene locus_tag LOCUS_04530 1422 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 1752 2444 gene locus_tag LOCUS_04540 1752 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 2578 3105 gene locus_tag LOCUS_04550 2578 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 3145 3714 gene locus_tag LOCUS_04560 3145 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 3821 4546 gene locus_tag LOCUS_04570 3821 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 4536 4811 gene locus_tag LOCUS_04580 4536 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 4804 5250 gene locus_tag LOCUS_04590 4804 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 5443 5994 gene locus_tag LOCUS_04600 5443 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 5994 6422 gene locus_tag LOCUS_04610 5994 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 6419 6619 gene locus_tag LOCUS_04620 6419 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 7004 6612 gene locus_tag LOCUS_04630 7004 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 7115 7486 gene locus_tag LOCUS_04640 7115 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 7857 7489 gene locus_tag LOCUS_04650 7857 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 8386 7883 gene locus_tag LOCUS_04660 8386 7883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 >Feature sequence044 1040 396 gene locus_tag LOCUS_04670 gene miaE 1040 396 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104701.1 protein_id gnl|my_center|LOCUS_04670 1164 3752 gene locus_tag LOCUS_04680 gene acnB 1164 3752 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070790.1 protein_id gnl|my_center|LOCUS_04680 6136 4112 gene locus_tag LOCUS_04690 6136 4112 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267406.1 protein_id gnl|my_center|LOCUS_04690 7101 6133 gene locus_tag LOCUS_04700 7101 6133 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_04700 8026 7109 gene locus_tag LOCUS_04710 8026 7109 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036211.1 protein_id gnl|my_center|LOCUS_04710 <8659 8036 gene locus_tag LOCUS_04720 <8659 8036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003381064.1:amidophosphoribosyltransferase >Feature sequence045 1 792 gene locus_tag LOCUS_04730 1 792 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021949.1 protein_id gnl|my_center|LOCUS_04730 952 2628 gene locus_tag LOCUS_04740 952 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 2671 5559 gene locus_tag LOCUS_04750 2671 5559 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_04750 5949 6620 gene locus_tag LOCUS_04760 5949 6620 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 protein_id gnl|my_center|LOCUS_04760 6855 7553 gene locus_tag LOCUS_04770 6855 7553 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446421.1 protein_id gnl|my_center|LOCUS_04770 >Feature sequence046 243 554 gene locus_tag LOCUS_04780 gene rpsJ 243 554 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555491.1 protein_id gnl|my_center|LOCUS_04780 579 1229 gene locus_tag LOCUS_04790 gene rplC 579 1229 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417224.1 protein_id gnl|my_center|LOCUS_04790 1226 1852 gene locus_tag LOCUS_04800 gene rplD 1226 1852 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422344.1 protein_id gnl|my_center|LOCUS_04800 1849 2148 gene locus_tag LOCUS_04810 gene rplW 1849 2148 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093736.1 protein_id gnl|my_center|LOCUS_04810 2186 3019 gene locus_tag LOCUS_04820 gene rplB 2186 3019 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317104.1 protein_id gnl|my_center|LOCUS_04820 3030 3308 gene locus_tag LOCUS_04830 gene rpsS 3030 3308 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307960.1 protein_id gnl|my_center|LOCUS_04830 3396 3731 gene locus_tag LOCUS_04840 gene rplV 3396 3731 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103908.1 protein_id gnl|my_center|LOCUS_04840 3759 4424 gene locus_tag LOCUS_04850 gene rpsC 3759 4424 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093727.1 protein_id gnl|my_center|LOCUS_04850 4442 4855 gene locus_tag LOCUS_04860 gene rplP 4442 4855 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093723.1 protein_id gnl|my_center|LOCUS_04860 4868 5062 gene locus_tag LOCUS_04870 gene rpmC 4868 5062 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644741.1 protein_id gnl|my_center|LOCUS_04870 5086 5352 gene locus_tag LOCUS_04880 gene rpsQ 5086 5352 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093717.1 protein_id gnl|my_center|LOCUS_04880 5391 5759 gene locus_tag LOCUS_04890 gene rplN 5391 5759 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555479.1 protein_id gnl|my_center|LOCUS_04890 5770 6087 gene locus_tag LOCUS_04900 gene rplX 5770 6087 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093711.1 protein_id gnl|my_center|LOCUS_04900 6089 6631 gene locus_tag LOCUS_04910 gene rplE 6089 6631 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116961.1 protein_id gnl|my_center|LOCUS_04910 6685 6990 gene locus_tag LOCUS_04920 gene rpsN 6685 6990 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400428.1 protein_id gnl|my_center|LOCUS_04920 7002 7400 gene locus_tag LOCUS_04930 gene rpsH 7002 7400 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093700.1 protein_id gnl|my_center|LOCUS_04930 7442 7975 gene locus_tag LOCUS_04940 gene rplF 7442 7975 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 protein_id gnl|my_center|LOCUS_04940 8053 8349 gene locus_tag LOCUS_04950 gene rplR 8053 8349 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555473.1 protein_id gnl|my_center|LOCUS_04950 >Feature sequence047 1578 2807 gene locus_tag LOCUS_04960 1578 2807 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918154.1 protein_id gnl|my_center|LOCUS_04960 4017 3205 gene locus_tag LOCUS_04970 4017 3205 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_04970 5385 4099 gene locus_tag LOCUS_04980 gene hisC 5385 4099 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_04980 6268 5438 gene locus_tag LOCUS_04990 6268 5438 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384626.1 protein_id gnl|my_center|LOCUS_04990 <8407 6689 gene locus_tag LOCUS_05000 <8407 6689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957473.1:excinuclease ABC subunit UvrA >Feature sequence048 284 1168 gene locus_tag LOCUS_05010 284 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 1165 2136 gene locus_tag LOCUS_05020 1165 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 2557 3732 gene locus_tag LOCUS_05030 2557 3732 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228948.1 protein_id gnl|my_center|LOCUS_05030 3754 4626 gene locus_tag LOCUS_05040 3754 4626 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064791.1 protein_id gnl|my_center|LOCUS_05040 4772 5722 gene locus_tag LOCUS_05050 4772 5722 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530313.1 protein_id gnl|my_center|LOCUS_05050 7569 6259 gene locus_tag LOCUS_05060 7569 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 >Feature sequence049 752 2320 gene locus_tag LOCUS_05070 752 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 3301 2348 gene locus_tag LOCUS_05080 3301 2348 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918245.1 protein_id gnl|my_center|LOCUS_05080 4727 3456 gene locus_tag LOCUS_05090 4727 3456 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087142.1 protein_id gnl|my_center|LOCUS_05090 4869 5876 gene locus_tag LOCUS_05100 4869 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 6006 6809 gene locus_tag LOCUS_05110 gene dapF 6006 6809 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388938.1 protein_id gnl|my_center|LOCUS_05110 6847 7911 gene locus_tag LOCUS_05120 6847 7911 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261604.1 protein_id gnl|my_center|LOCUS_05120 >Feature sequence050 522 334 gene locus_tag LOCUS_05130 522 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 460 981 gene locus_tag LOCUS_05140 460 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 1848 961 gene locus_tag LOCUS_05150 1848 961 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104987.1 protein_id gnl|my_center|LOCUS_05150 1964 2983 gene locus_tag LOCUS_05160 1964 2983 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203434.1 protein_id gnl|my_center|LOCUS_05160 3024 3635 gene locus_tag LOCUS_05170 3024 3635 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267648.1 protein_id gnl|my_center|LOCUS_05170 4501 3623 gene locus_tag LOCUS_05180 4501 3623 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382947.1 protein_id gnl|my_center|LOCUS_05180 4650 5444 gene locus_tag LOCUS_05190 gene cysE 4650 5444 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208974.1 protein_id gnl|my_center|LOCUS_05190 6459 5554 gene locus_tag LOCUS_05200 6459 5554 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 protein_id gnl|my_center|LOCUS_05200 6820 6446 gene locus_tag LOCUS_05210 6820 6446 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919492.1 protein_id gnl|my_center|LOCUS_05210 7481 6897 gene locus_tag LOCUS_05220 7481 6897 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_05220 7956 7483 gene locus_tag LOCUS_05230 7956 7483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 >Feature sequence051 <1 824 gene locus_tag LOCUS_05240 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002224845.1:aminoglycoside phosphotransferase family protein 821 1504 gene locus_tag LOCUS_05250 821 1504 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237801.1 protein_id gnl|my_center|LOCUS_05250 1579 2241 gene locus_tag LOCUS_05260 gene rpe 1579 2241 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351625.1 protein_id gnl|my_center|LOCUS_05260 2261 3856 gene locus_tag LOCUS_05270 gene trpE 2261 3856 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035712.1 protein_id gnl|my_center|LOCUS_05270 3860 4444 gene locus_tag LOCUS_05280 3860 4444 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035720.1 protein_id gnl|my_center|LOCUS_05280 4447 5469 gene locus_tag LOCUS_05290 gene trpD 4447 5469 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103215.1 protein_id gnl|my_center|LOCUS_05290 5466 6251 gene locus_tag LOCUS_05300 gene trpC 5466 6251 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113174.1 protein_id gnl|my_center|LOCUS_05300 6577 7041 gene locus_tag LOCUS_05310 6577 7041 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_05310 7038 7436 gene locus_tag LOCUS_05320 7038 7436 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098688.1 protein_id gnl|my_center|LOCUS_05320 <8017 7433 gene locus_tag LOCUS_05330 <8017 7433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003085224.1:2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase >Feature sequence052 <1 641 gene locus_tag LOCUS_05340 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704900.1:heme ABC transporter ATP-binding protein 1599 604 gene locus_tag LOCUS_05350 1599 604 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_05350 2945 1656 gene locus_tag LOCUS_05360 gene hemL 2945 1656 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093150.1 protein_id gnl|my_center|LOCUS_05360 4726 2984 gene locus_tag LOCUS_05370 4726 2984 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 protein_id gnl|my_center|LOCUS_05370 4866 5567 gene locus_tag LOCUS_05380 4866 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 5683 6141 gene locus_tag LOCUS_05390 5683 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 6551 6904 gene locus_tag LOCUS_05400 gene erpA 6551 6904 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551953.1 protein_id gnl|my_center|LOCUS_05400 <8010 6919 gene locus_tag LOCUS_05410 <8010 6919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003129241.1:peptidoglycan DD-metalloendopeptidase family protein >Feature sequence053 1041 25 gene locus_tag LOCUS_05420 gene dapD 1041 25 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266969.1 protein_id gnl|my_center|LOCUS_05420 2310 1093 gene locus_tag LOCUS_05430 gene dapC 2310 1093 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103591.1 protein_id gnl|my_center|LOCUS_05430 5018 2307 gene locus_tag LOCUS_05440 5018 2307 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 protein_id gnl|my_center|LOCUS_05440 5769 4990 gene locus_tag LOCUS_05450 gene map 5769 4990 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 protein_id gnl|my_center|LOCUS_05450 6083 6964 gene locus_tag LOCUS_05460 gene rpsB 6083 6964 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092394.1 protein_id gnl|my_center|LOCUS_05460 >Feature sequence054 301 1368 gene locus_tag LOCUS_05470 301 1368 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_05470 1365 1934 gene locus_tag LOCUS_05480 gene pilN 1365 1934 CDS product type 4a pilus biogenesis protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_05480 1934 2566 gene locus_tag LOCUS_05490 gene pilO 1934 2566 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_05490 2570 3139 gene locus_tag LOCUS_05500 gene pilP 2570 3139 CDS product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_05500 3286 5352 gene locus_tag LOCUS_05510 3286 5352 CDS product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093473135.1 protein_id gnl|my_center|LOCUS_05510 5365 5910 gene locus_tag LOCUS_05520 gene aroK 5365 5910 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095833.1 protein_id gnl|my_center|LOCUS_05520 5900 6997 gene locus_tag LOCUS_05530 gene aroB 5900 6997 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706965.1 protein_id gnl|my_center|LOCUS_05530 7917 6994 gene locus_tag LOCUS_05540 7917 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 >Feature sequence055 2283 199 gene locus_tag LOCUS_05550 2283 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 3849 2746 gene locus_tag LOCUS_05560 3849 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 4309 5109 gene locus_tag LOCUS_05570 4309 5109 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730868.1 protein_id gnl|my_center|LOCUS_05570 6139 5120 gene locus_tag LOCUS_05580 6139 5120 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 protein_id gnl|my_center|LOCUS_05580 6275 7105 gene locus_tag LOCUS_05590 6275 7105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 >Feature sequence056 <1 637 gene locus_tag LOCUS_05600 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005081822.1:carboxymuconolactone decarboxylase family protein 1823 606 gene locus_tag LOCUS_05610 1823 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 2216 3034 gene locus_tag LOCUS_05620 2216 3034 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994123.1 protein_id gnl|my_center|LOCUS_05620 3605 3054 gene locus_tag LOCUS_05630 3605 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 4713 3592 gene locus_tag LOCUS_05640 4713 3592 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090004.1 protein_id gnl|my_center|LOCUS_05640 5871 4717 gene locus_tag LOCUS_05650 5871 4717 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 protein_id gnl|my_center|LOCUS_05650 6808 5960 gene locus_tag LOCUS_05660 6808 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 7743 6805 gene locus_tag LOCUS_05670 7743 6805 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088843.1 protein_id gnl|my_center|LOCUS_05670 >Feature sequence057 679 218 gene locus_tag LOCUS_05680 gene greA 679 218 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095206.1 protein_id gnl|my_center|LOCUS_05680 3953 726 gene locus_tag LOCUS_05690 gene carB 3953 726 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095207.1 protein_id gnl|my_center|LOCUS_05690 5106 3943 gene locus_tag LOCUS_05700 gene carA 5106 3943 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095209.1 protein_id gnl|my_center|LOCUS_05700 6336 5536 gene locus_tag LOCUS_05710 gene dapB 6336 5536 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706537.1 protein_id gnl|my_center|LOCUS_05710 7754 6633 gene locus_tag LOCUS_05720 gene dnaJ 7754 6633 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095211.1 protein_id gnl|my_center|LOCUS_05720 >Feature sequence058 128 203 gene locus_tag LOCUS_t00060 128 203 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 416 892 gene locus_tag LOCUS_05730 416 892 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804308.1 protein_id gnl|my_center|LOCUS_05730 1197 1748 gene locus_tag LOCUS_05740 1197 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 3118 1973 gene locus_tag LOCUS_05750 gene yjiB 3118 1973 CDS product monooxygenase YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232789.1 protein_id gnl|my_center|LOCUS_05750 4429 3578 gene locus_tag LOCUS_05760 gene nadC 4429 3578 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104915.1 protein_id gnl|my_center|LOCUS_05760 4935 4426 gene locus_tag LOCUS_05770 4935 4426 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113919.1 protein_id gnl|my_center|LOCUS_05770 4966 5517 gene locus_tag LOCUS_05780 gene ampD 4966 5517 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051592.1 protein_id gnl|my_center|LOCUS_05780 5572 6360 gene locus_tag LOCUS_05790 5572 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 6620 7495 gene locus_tag LOCUS_05800 gene btuF 6620 7495 CDS product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095645.1 protein_id gnl|my_center|LOCUS_05800 >Feature sequence059 381 2171 gene locus_tag LOCUS_05810 381 2171 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071595.1 protein_id gnl|my_center|LOCUS_05810 2224 3903 gene locus_tag LOCUS_05820 2224 3903 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_05820 3958 5337 gene locus_tag LOCUS_05830 gene asnS 3958 5337 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947991.1 protein_id gnl|my_center|LOCUS_05830 6021 5338 gene locus_tag LOCUS_05840 6021 5338 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403266.1 protein_id gnl|my_center|LOCUS_05840 6409 6050 gene locus_tag LOCUS_05850 6409 6050 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083946.1 protein_id gnl|my_center|LOCUS_05850 7045 6467 gene locus_tag LOCUS_05860 gene rnhB 7045 6467 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262424.1 protein_id gnl|my_center|LOCUS_05860 <7650 7042 gene locus_tag LOCUS_05870 <7650 7042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192608.1:lipid-A-disaccharide synthase >Feature sequence060 1253 375 gene locus_tag LOCUS_05880 1253 375 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057737.1 protein_id gnl|my_center|LOCUS_05880 1435 1241 gene locus_tag LOCUS_05890 1435 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 1634 1807 gene locus_tag LOCUS_05900 1634 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 1817 3013 gene locus_tag LOCUS_05910 1817 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 5443 3167 gene locus_tag LOCUS_05920 5443 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 6880 6188 gene locus_tag LOCUS_05930 6880 6188 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114770.1 protein_id gnl|my_center|LOCUS_05930 7080 7382 gene locus_tag LOCUS_05940 7080 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 >Feature sequence061 440 2248 gene locus_tag LOCUS_05950 440 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 2337 3158 gene locus_tag LOCUS_05960 2337 3158 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644758.1 protein_id gnl|my_center|LOCUS_05960 3495 3262 gene locus_tag LOCUS_05970 3495 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 3774 3496 gene locus_tag LOCUS_05980 3774 3496 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555777.1 protein_id gnl|my_center|LOCUS_05980 4877 3837 gene locus_tag LOCUS_05990 gene mutY 4877 3837 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946634.1 protein_id gnl|my_center|LOCUS_05990 6949 4877 gene locus_tag LOCUS_06000 6949 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 >Feature sequence062 1085 735 gene locus_tag LOCUS_06010 1085 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 2195 1419 gene locus_tag LOCUS_06020 2195 1419 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_06020 3574 2222 gene locus_tag LOCUS_06030 3574 2222 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920685.1 protein_id gnl|my_center|LOCUS_06030 4265 3597 gene locus_tag LOCUS_06040 4265 3597 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_06040 5255 4386 gene locus_tag LOCUS_06050 5255 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 6019 5255 gene locus_tag LOCUS_06060 6019 5255 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126699554.1 protein_id gnl|my_center|LOCUS_06060 6715 6023 gene locus_tag LOCUS_06070 6715 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087917.1 protein_id gnl|my_center|LOCUS_06070 >Feature sequence063 <1 949 gene locus_tag LOCUS_06080 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258877.1:S-methyl-5-thioribose-1-phosphate isomerase 946 1581 gene locus_tag LOCUS_06090 946 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 1852 2709 gene locus_tag LOCUS_06100 1852 2709 CDS product DUF3014 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074019.1 protein_id gnl|my_center|LOCUS_06100 2718 3899 gene locus_tag LOCUS_06110 2718 3899 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040422.1 protein_id gnl|my_center|LOCUS_06110 3936 4739 gene locus_tag LOCUS_06120 3936 4739 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_06120 6209 4899 gene locus_tag LOCUS_06130 6209 4899 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_06130 <7413 6206 gene locus_tag LOCUS_06140 <7413 6206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016356916.1:type I secretion system permease/ATPase >Feature sequence064 <1 925 gene locus_tag LOCUS_06150 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704627.1:CNNM domain-containing protein 4058 981 gene locus_tag LOCUS_06160 4058 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 5949 4282 gene locus_tag LOCUS_06170 gene leuA 5949 4282 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389681.1 protein_id gnl|my_center|LOCUS_06170 6887 6366 gene locus_tag LOCUS_06180 6887 6366 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092662.1 protein_id gnl|my_center|LOCUS_06180 >Feature sequence065 1662 532 gene locus_tag LOCUS_06190 1662 532 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450234.1 protein_id gnl|my_center|LOCUS_06190 2402 1791 gene locus_tag LOCUS_06200 gene gstA 2402 1791 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765713.1 protein_id gnl|my_center|LOCUS_06200 3038 4909 gene locus_tag LOCUS_06210 3038 4909 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_06210 4902 6755 gene locus_tag LOCUS_06220 4902 6755 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_06220 >Feature sequence066 <1 1070 gene locus_tag LOCUS_06230 <1 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061040.1:3-isopropylmalate dehydrogenase 2442 1204 gene locus_tag LOCUS_06240 2442 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 2831 2625 gene locus_tag LOCUS_06250 2831 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 3995 2967 gene locus_tag LOCUS_06260 3995 2967 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 protein_id gnl|my_center|LOCUS_06260 4944 4123 gene locus_tag LOCUS_06270 4944 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 5562 6413 gene locus_tag LOCUS_06280 5562 6413 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256256.1 protein_id gnl|my_center|LOCUS_06280 6925 6851 gene locus_tag LOCUS_t00070 6925 6851 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence067 135 1640 gene locus_tag LOCUS_06290 gene lysS 135 1640 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707134.1 protein_id gnl|my_center|LOCUS_06290 1643 2335 gene locus_tag LOCUS_06300 gene ung 1643 2335 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528805.1 protein_id gnl|my_center|LOCUS_06300 2337 3302 gene locus_tag LOCUS_06310 2337 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 4159 3299 gene locus_tag LOCUS_06320 4159 3299 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032622187.1 protein_id gnl|my_center|LOCUS_06320 4306 4761 gene locus_tag LOCUS_06330 4306 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 <7184 5610 gene locus_tag LOCUS_06340 <7184 5610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114182.1:L-aspartate oxidase >Feature sequence068 2155 1277 gene locus_tag LOCUS_06350 2155 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 4577 2181 gene locus_tag LOCUS_06360 4577 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 5015 5677 gene locus_tag LOCUS_06370 5015 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 5703 6842 gene locus_tag LOCUS_06380 5703 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 >Feature sequence069 901 104 gene locus_tag LOCUS_06390 901 104 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123301.1 protein_id gnl|my_center|LOCUS_06390 1264 1112 gene locus_tag LOCUS_06400 1264 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 1496 2572 gene locus_tag LOCUS_06410 1496 2572 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 protein_id gnl|my_center|LOCUS_06410 2569 4011 gene locus_tag LOCUS_06420 2569 4011 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920791.1 protein_id gnl|my_center|LOCUS_06420 >Feature sequence070 279 2024 gene locus_tag LOCUS_06430 279 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 2167 3054 gene locus_tag LOCUS_06440 2167 3054 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385602.1 protein_id gnl|my_center|LOCUS_06440 3690 3112 gene locus_tag LOCUS_06450 3690 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 4880 3831 gene locus_tag LOCUS_06460 4880 3831 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296328.1 protein_id gnl|my_center|LOCUS_06460 6217 4886 gene locus_tag LOCUS_06470 6217 4886 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 protein_id gnl|my_center|LOCUS_06470 <7081 6480 gene locus_tag LOCUS_06480 <7081 6480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090625.1:enoyl-CoA hydratase >Feature sequence071 1708 428 gene locus_tag LOCUS_06490 gene serS 1708 428 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487368.1 protein_id gnl|my_center|LOCUS_06490 2136 1759 gene locus_tag LOCUS_06500 gene crcB 2136 1759 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405171.1 protein_id gnl|my_center|LOCUS_06500 3548 2181 gene locus_tag LOCUS_06510 3548 2181 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_06510 4239 3532 gene locus_tag LOCUS_06520 4239 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 6622 4244 gene locus_tag LOCUS_06530 gene ftsK 6622 4244 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405080.1 protein_id gnl|my_center|LOCUS_06530 >Feature sequence072 4146 2944 gene locus_tag LOCUS_06540 4146 2944 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728237.1 protein_id gnl|my_center|LOCUS_06540 6261 5284 gene locus_tag LOCUS_06550 6261 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence073 808 95 gene locus_tag LOCUS_06560 gene pppA 808 95 CDS product serine/threonine phosphatase PppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106965.1 protein_id gnl|my_center|LOCUS_06560 1829 882 gene locus_tag LOCUS_06570 1829 882 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328819.1 protein_id gnl|my_center|LOCUS_06570 2180 2599 gene locus_tag LOCUS_06580 2180 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 2747 2823 gene locus_tag LOCUS_t00080 2747 2823 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2920 3396 gene locus_tag LOCUS_06590 gene rimP 2920 3396 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_06590 3410 4963 gene locus_tag LOCUS_06600 gene nusA 3410 4963 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095192.1 protein_id gnl|my_center|LOCUS_06600 >Feature sequence074 <1 700 gene locus_tag LOCUS_06610 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000164216.1:colanic acid biosynthesis phosphomannomutase CpsG 746 1486 gene locus_tag LOCUS_06620 gene djlA 746 1486 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167009.1 protein_id gnl|my_center|LOCUS_06620 1550 2746 gene locus_tag LOCUS_06630 1550 2746 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921936.1 protein_id gnl|my_center|LOCUS_06630 2743 3453 gene locus_tag LOCUS_06640 2743 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 4598 3537 gene locus_tag LOCUS_06650 4598 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 5707 4616 gene locus_tag LOCUS_06660 5707 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 5824 6501 gene locus_tag LOCUS_06670 5824 6501 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_06670 >Feature sequence075 1683 1012 gene locus_tag LOCUS_06680 1683 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 1933 2649 gene locus_tag LOCUS_06690 1933 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 2700 3149 gene locus_tag LOCUS_06700 gene aroQ 2700 3149 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707111.1 protein_id gnl|my_center|LOCUS_06700 3462 4334 gene locus_tag LOCUS_06710 gene prmA 3462 4334 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112237.1 protein_id gnl|my_center|LOCUS_06710 4304 5080 gene locus_tag LOCUS_06720 4304 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 5282 6178 gene locus_tag LOCUS_06730 gene dusB 5282 6178 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095402.1 protein_id gnl|my_center|LOCUS_06730 6175 6441 gene locus_tag LOCUS_06740 6175 6441 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946289.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence076 1 648 gene locus_tag LOCUS_06750 1 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 641 1225 gene locus_tag LOCUS_06760 641 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 1737 1363 gene locus_tag LOCUS_06770 1737 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 2111 2953 gene locus_tag LOCUS_06780 2111 2953 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086755.1 protein_id gnl|my_center|LOCUS_06780 3318 4304 gene locus_tag LOCUS_06790 3318 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 4834 4388 gene locus_tag LOCUS_06800 4834 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 5510 5004 gene locus_tag LOCUS_06810 5510 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 >Feature sequence077 1608 1327 gene locus_tag LOCUS_06820 1608 1327 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_06820 2751 1612 gene locus_tag LOCUS_06830 2751 1612 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063838431.1 protein_id gnl|my_center|LOCUS_06830 3297 4856 gene locus_tag LOCUS_06840 3297 4856 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_06840 >Feature sequence078 89 748 gene locus_tag LOCUS_06850 89 748 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727608.1 protein_id gnl|my_center|LOCUS_06850 1792 1004 gene locus_tag LOCUS_06860 1792 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 2490 1792 gene locus_tag LOCUS_06870 2490 1792 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918530.1 protein_id gnl|my_center|LOCUS_06870 3039 2533 gene locus_tag LOCUS_06880 3039 2533 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859521.1 protein_id gnl|my_center|LOCUS_06880 3257 6262 gene locus_tag LOCUS_06890 3257 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 >Feature sequence079 339 512 gene locus_tag LOCUS_06900 339 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 516 968 gene locus_tag LOCUS_06910 gene mraZ 516 968 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769445.1 protein_id gnl|my_center|LOCUS_06910 981 1898 gene locus_tag LOCUS_06920 gene rsmH 981 1898 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047697615.1 protein_id gnl|my_center|LOCUS_06920 1895 2239 gene locus_tag LOCUS_06930 1895 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 2239 3891 gene locus_tag LOCUS_06940 gene ftsI 2239 3891 CDS product peptidoglycan D,D-transpeptidase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_06940 3888 5336 gene locus_tag LOCUS_06950 3888 5336 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994100.1 protein_id gnl|my_center|LOCUS_06950 5329 6681 gene locus_tag LOCUS_06960 gene murD 5329 6681 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103104.1 protein_id gnl|my_center|LOCUS_06960 >Feature sequence080 1857 349 gene locus_tag LOCUS_06970 1857 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 2243 3685 gene locus_tag LOCUS_06980 2243 3685 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095844.1 protein_id gnl|my_center|LOCUS_06980 4608 3697 gene locus_tag LOCUS_06990 4608 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 4726 6195 gene locus_tag LOCUS_07000 4726 6195 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877761.1 protein_id gnl|my_center|LOCUS_07000 >Feature sequence081 2587 1097 gene locus_tag LOCUS_07010 2587 1097 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039038.1 protein_id gnl|my_center|LOCUS_07010 3612 2584 gene locus_tag LOCUS_07020 3612 2584 CDS product cupin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039037.1 protein_id gnl|my_center|LOCUS_07020 4343 3615 gene locus_tag LOCUS_07030 4343 3615 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944588.1 protein_id gnl|my_center|LOCUS_07030 5967 4363 gene locus_tag LOCUS_07040 5967 4363 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073349.1 protein_id gnl|my_center|LOCUS_07040 <6689 6051 gene locus_tag LOCUS_07050 <6689 6051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039035.1:TonB-dependent receptor >Feature sequence082 644 2050 gene locus_tag LOCUS_07060 644 2050 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_07060 2483 2061 gene locus_tag LOCUS_07070 2483 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 3535 2543 gene locus_tag LOCUS_07080 3535 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 4235 3633 gene locus_tag LOCUS_07090 4235 3633 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312247.1 protein_id gnl|my_center|LOCUS_07090 5745 4513 gene locus_tag LOCUS_07100 5745 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 <6665 5760 gene locus_tag LOCUS_07110 <6665 5760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228505.1:formate dehydrogenase accessory sulfurtransferase FdhD >Feature sequence083 632 282 gene locus_tag LOCUS_07120 632 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 1670 636 gene locus_tag LOCUS_07130 gene tsaD 1670 636 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220126.1 protein_id gnl|my_center|LOCUS_07130 2026 2241 gene locus_tag LOCUS_07140 gene rpsU 2026 2241 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085057.1 protein_id gnl|my_center|LOCUS_07140 2526 2993 gene locus_tag LOCUS_07150 2526 2993 CDS product lpg2359 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948065.1 protein_id gnl|my_center|LOCUS_07150 3055 4869 gene locus_tag LOCUS_07160 gene dnaG 3055 4869 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244455.1 protein_id gnl|my_center|LOCUS_07160 >Feature sequence084 389 1804 gene locus_tag LOCUS_07170 gene leuC 389 1804 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173294.1 protein_id gnl|my_center|LOCUS_07170 1801 2388 gene locus_tag LOCUS_07180 gene leuD 1801 2388 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057076.1 protein_id gnl|my_center|LOCUS_07180 2385 4025 gene locus_tag LOCUS_07190 gene cimA 2385 4025 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393734.1 protein_id gnl|my_center|LOCUS_07190 4511 5158 gene locus_tag LOCUS_07200 4511 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 5354 6361 gene locus_tag LOCUS_07210 5354 6361 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_07210 >Feature sequence085 820 1278 gene locus_tag LOCUS_07220 820 1278 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037970.1 protein_id gnl|my_center|LOCUS_07220 1288 2724 gene locus_tag LOCUS_07230 1288 2724 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340179.1 protein_id gnl|my_center|LOCUS_07230 2742 3662 gene locus_tag LOCUS_07240 2742 3662 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325200.1 protein_id gnl|my_center|LOCUS_07240 4424 3672 gene locus_tag LOCUS_07250 4424 3672 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920648.1 protein_id gnl|my_center|LOCUS_07250 4947 4591 gene locus_tag LOCUS_07260 4947 4591 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409617.1 protein_id gnl|my_center|LOCUS_07260 6082 5075 gene locus_tag LOCUS_07270 6082 5075 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453965.1 protein_id gnl|my_center|LOCUS_07270 <6601 6079 gene locus_tag LOCUS_07280 <6601 6079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091125.1:dTMP kinase >Feature sequence086 3068 51 gene locus_tag LOCUS_07290 3068 51 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039035.1 protein_id gnl|my_center|LOCUS_07290 4200 5036 gene locus_tag LOCUS_07300 4200 5036 CDS product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403037.1 protein_id gnl|my_center|LOCUS_07300 5090 6460 gene locus_tag LOCUS_07310 5090 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 >Feature sequence087 1404 2246 gene locus_tag LOCUS_07320 1404 2246 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267244.1 protein_id gnl|my_center|LOCUS_07320 2801 2478 gene locus_tag LOCUS_07330 2801 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 4165 2942 gene locus_tag LOCUS_07340 gene kynU 4165 2942 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114854.1 protein_id gnl|my_center|LOCUS_07340 5057 4224 gene locus_tag LOCUS_07350 5057 4224 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975294.1 protein_id gnl|my_center|LOCUS_07350 5168 5911 gene locus_tag LOCUS_07360 5168 5911 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083339.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence088 2059 386 gene locus_tag LOCUS_07370 gene recN 2059 386 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706784.1 protein_id gnl|my_center|LOCUS_07370 2168 3220 gene locus_tag LOCUS_07380 gene hrcA 2168 3220 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_07380 3570 4175 gene locus_tag LOCUS_07390 gene grpE 3570 4175 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021933.1 protein_id gnl|my_center|LOCUS_07390 4295 6217 gene locus_tag LOCUS_07400 gene dnaK 4295 6217 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105024.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence089 1731 394 gene locus_tag LOCUS_07410 1731 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 2480 1728 gene locus_tag LOCUS_07420 2480 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 3388 2615 gene locus_tag LOCUS_07430 3388 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 4498 3398 gene locus_tag LOCUS_07440 4498 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 5820 4633 gene locus_tag LOCUS_07450 5820 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 >Feature sequence090 1158 286 gene locus_tag LOCUS_07460 1158 286 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 protein_id gnl|my_center|LOCUS_07460 >Feature sequence091 <1 870 gene locus_tag LOCUS_07470 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048146.1:ABC transporter permease 873 1904 gene locus_tag LOCUS_07480 gene oppD 873 1904 CDS product oligopeptide ABC transporter ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886477.1 protein_id gnl|my_center|LOCUS_07480 1901 2842 gene locus_tag LOCUS_07490 1901 2842 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048144.1 protein_id gnl|my_center|LOCUS_07490 3468 2935 gene locus_tag LOCUS_07500 3468 2935 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108825999.1 protein_id gnl|my_center|LOCUS_07500 5291 3471 gene locus_tag LOCUS_07510 gene cobT 5291 3471 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529369.1 protein_id gnl|my_center|LOCUS_07510 <6031 5311 gene locus_tag LOCUS_07520 <6031 5311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387959.1:cobaltochelatase subunit CobS >Feature sequence092 1539 1868 gene locus_tag LOCUS_07530 1539 1868 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_07530 1874 3400 gene locus_tag LOCUS_07540 1874 3400 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173812.1 protein_id gnl|my_center|LOCUS_07540 3906 3394 gene locus_tag LOCUS_07550 gene folK 3906 3394 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886816.1 protein_id gnl|my_center|LOCUS_07550 4081 5166 gene locus_tag LOCUS_07560 4081 5166 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920865.1 protein_id gnl|my_center|LOCUS_07560 5178 5399 gene locus_tag LOCUS_07570 5178 5399 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985297.1 protein_id gnl|my_center|LOCUS_07570 <6016 5396 gene locus_tag LOCUS_07580 <6016 5396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010925816.1:enoyl-CoA hydratase/isomerase family protein >Feature sequence093 <1 815 gene locus_tag LOCUS_07590 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222813.1:amidohydrolase family protein 861 1862 gene locus_tag LOCUS_07600 861 1862 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294634.1 protein_id gnl|my_center|LOCUS_07600 2066 2794 gene locus_tag LOCUS_07610 2066 2794 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705446.1 protein_id gnl|my_center|LOCUS_07610 4353 2908 gene locus_tag LOCUS_07620 gene gatB 4353 2908 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688837.1 protein_id gnl|my_center|LOCUS_07620 5804 4350 gene locus_tag LOCUS_07630 gene gatA 5804 4350 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772005.1 protein_id gnl|my_center|LOCUS_07630 >Feature sequence094 936 1292 gene locus_tag LOCUS_07640 936 1292 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940795.1 protein_id gnl|my_center|LOCUS_07640 2860 1610 gene locus_tag LOCUS_07650 2860 1610 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120625.1 protein_id gnl|my_center|LOCUS_07650 3079 4275 gene locus_tag LOCUS_07660 3079 4275 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_07660 5597 4272 gene locus_tag LOCUS_07670 5597 4272 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060993309.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence095 1192 854 gene locus_tag LOCUS_07680 1192 854 CDS product translation initiation factor Sui1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941351.1 protein_id gnl|my_center|LOCUS_07680 1621 1196 gene locus_tag LOCUS_07690 1621 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 2084 1635 gene locus_tag LOCUS_07700 2084 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 2936 2172 gene locus_tag LOCUS_07710 2936 2172 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035270.1 protein_id gnl|my_center|LOCUS_07710 3649 2933 gene locus_tag LOCUS_07720 3649 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 3970 3671 gene locus_tag LOCUS_07730 3970 3671 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481648.1 protein_id gnl|my_center|LOCUS_07730 4562 3975 gene locus_tag LOCUS_07740 4562 3975 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210436297.1 protein_id gnl|my_center|LOCUS_07740 4792 5391 gene locus_tag LOCUS_07750 4792 5391 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence096 1368 322 gene locus_tag LOCUS_07760 gene aroG 1368 322 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109196.1 protein_id gnl|my_center|LOCUS_07760 1739 1509 gene locus_tag LOCUS_07770 1739 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 2307 2648 gene locus_tag LOCUS_07780 2307 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 2710 4869 gene locus_tag LOCUS_07790 2710 4869 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037788.1 protein_id gnl|my_center|LOCUS_07790 <5932 4995 gene locus_tag LOCUS_07800 <5932 4995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003419601.1:phytanoyl-CoA dioxygenase family protein >Feature sequence097 1268 642 gene locus_tag LOCUS_07810 1268 642 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215614.1 protein_id gnl|my_center|LOCUS_07810 1680 1237 gene locus_tag LOCUS_07820 1680 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 2348 1680 gene locus_tag LOCUS_07830 2348 1680 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 protein_id gnl|my_center|LOCUS_07830 3093 2293 gene locus_tag LOCUS_07840 gene proC 3093 2293 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804294.1 protein_id gnl|my_center|LOCUS_07840 3827 3132 gene locus_tag LOCUS_07850 3827 3132 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266427.1 protein_id gnl|my_center|LOCUS_07850 4013 5050 gene locus_tag LOCUS_07860 gene pilT 4013 5050 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084552.1 protein_id gnl|my_center|LOCUS_07860 5470 5078 gene locus_tag LOCUS_07870 gene ruvX 5470 5078 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084575.1 protein_id gnl|my_center|LOCUS_07870 >Feature sequence098 371 2518 gene locus_tag LOCUS_07880 gene scpA 371 2518 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887727.1 protein_id gnl|my_center|LOCUS_07880 2496 3467 gene locus_tag LOCUS_07890 gene meaB 2496 3467 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_07890 4671 3568 gene locus_tag LOCUS_07900 4671 3568 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097663.1 protein_id gnl|my_center|LOCUS_07900 <5923 4693 gene locus_tag LOCUS_07910 <5923 4693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705315.1:adenylosuccinate lyase >Feature sequence099 2256 1363 gene locus_tag LOCUS_07920 2256 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 3659 2595 gene locus_tag LOCUS_07930 3659 2595 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265540.1 protein_id gnl|my_center|LOCUS_07930 3768 5003 gene locus_tag LOCUS_07940 3768 5003 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350283.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence100 <1 2720 gene locus_tag LOCUS_07950 <1 2720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093745.1:DNA-directed RNA polymerase subunit beta' 2881 3255 gene locus_tag LOCUS_07960 gene rpsL 2881 3255 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555494.1 protein_id gnl|my_center|LOCUS_07960 3419 3889 gene locus_tag LOCUS_07970 gene rpsG 3419 3889 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397077.1 protein_id gnl|my_center|LOCUS_07970 >Feature sequence101 <1 1245 gene locus_tag LOCUS_07980 <1 1245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003020815.1:FAD-binding domain-containing protein 1411 1944 gene locus_tag LOCUS_07990 1411 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 2392 2817 gene locus_tag LOCUS_08000 2392 2817 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103658.1 protein_id gnl|my_center|LOCUS_08000 4288 2951 gene locus_tag LOCUS_08010 4288 2951 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence102 1544 699 gene locus_tag LOCUS_08020 gene rsmI 1544 699 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067739.1 protein_id gnl|my_center|LOCUS_08020 2092 3927 gene locus_tag LOCUS_08030 2092 3927 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268851.1 protein_id gnl|my_center|LOCUS_08030 4328 4876 gene locus_tag LOCUS_08040 4328 4876 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766550.1 protein_id gnl|my_center|LOCUS_08040 5321 4887 gene locus_tag LOCUS_08050 5321 4887 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958412.1 protein_id gnl|my_center|LOCUS_08050 5884 5327 gene locus_tag LOCUS_08060 5884 5327 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406040.1 protein_id gnl|my_center|LOCUS_08060 >Feature sequence103 2065 1484 gene locus_tag LOCUS_08070 2065 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 3083 2199 gene locus_tag LOCUS_08080 3083 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 3241 3681 gene locus_tag LOCUS_08090 3241 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 4323 3703 gene locus_tag LOCUS_08100 4323 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 5208 4375 gene locus_tag LOCUS_08110 5208 4375 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813616.1 protein_id gnl|my_center|LOCUS_08110 5725 5210 gene locus_tag LOCUS_08120 5725 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence104 189 965 gene locus_tag LOCUS_08130 189 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1054 1506 gene locus_tag LOCUS_08140 1054 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 1724 2095 gene locus_tag LOCUS_08150 1724 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 3583 2240 gene locus_tag LOCUS_08160 3583 2240 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929838.1 protein_id gnl|my_center|LOCUS_08160 3843 4619 gene locus_tag LOCUS_08170 3843 4619 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_08170 5534 4644 gene locus_tag LOCUS_08180 5534 4644 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence105 244 1200 gene locus_tag LOCUS_08190 244 1200 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_08190 1320 3434 gene locus_tag LOCUS_08200 1320 3434 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356916.1 protein_id gnl|my_center|LOCUS_08200 3431 4741 gene locus_tag LOCUS_08210 3431 4741 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_08210 5662 4859 gene locus_tag LOCUS_08220 5662 4859 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_08220 >Feature sequence106 858 2366 gene locus_tag LOCUS_08230 gene pgi 858 2366 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932668.1 protein_id gnl|my_center|LOCUS_08230 2363 3121 gene locus_tag LOCUS_08240 2363 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 3194 4738 gene locus_tag LOCUS_08250 3194 4738 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 protein_id gnl|my_center|LOCUS_08250 4764 5495 gene locus_tag LOCUS_08260 4764 5495 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230560.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence107 26 1315 gene locus_tag LOCUS_08270 26 1315 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 protein_id gnl|my_center|LOCUS_08270 1397 1819 gene locus_tag LOCUS_08280 1397 1819 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140245.1 protein_id gnl|my_center|LOCUS_08280 1896 3398 gene locus_tag LOCUS_08290 1896 3398 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103171.1 protein_id gnl|my_center|LOCUS_08290 4530 3658 gene locus_tag LOCUS_08300 gene surE 4530 3658 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705372.1 protein_id gnl|my_center|LOCUS_08300 4590 5429 gene locus_tag LOCUS_08310 4590 5429 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731540.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence108 1030 191 gene locus_tag LOCUS_08320 1030 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 1884 2654 gene locus_tag LOCUS_08330 gene yaaA 1884 2654 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207208.1 protein_id gnl|my_center|LOCUS_08330 2651 3652 gene locus_tag LOCUS_08340 2651 3652 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259505.1 protein_id gnl|my_center|LOCUS_08340 3781 4455 gene locus_tag LOCUS_08350 3781 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 4452 5228 gene locus_tag LOCUS_08360 4452 5228 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence109 <1 532 gene locus_tag LOCUS_08370 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206819032.1:DUF3450 domain-containing protein 535 1902 gene locus_tag LOCUS_08380 535 1902 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 protein_id gnl|my_center|LOCUS_08380 1919 2437 gene locus_tag LOCUS_08390 1919 2437 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_08390 2463 2864 gene locus_tag LOCUS_08400 2463 2864 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_08400 2881 3537 gene locus_tag LOCUS_08410 2881 3537 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071948.1 protein_id gnl|my_center|LOCUS_08410 3539 4903 gene locus_tag LOCUS_08420 3539 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 5669 5067 gene locus_tag LOCUS_08430 5669 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 >Feature sequence110 922 53 gene locus_tag LOCUS_08440 922 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 1633 1043 gene locus_tag LOCUS_08450 1633 1043 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731215.1 protein_id gnl|my_center|LOCUS_08450 2410 2009 gene locus_tag LOCUS_08460 2410 2009 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_08460 3911 3063 gene locus_tag LOCUS_08470 3911 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 4344 4841 gene locus_tag LOCUS_08480 4344 4841 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086612.1 protein_id gnl|my_center|LOCUS_08480 4857 5279 gene locus_tag LOCUS_08490 4857 5279 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034360.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence111 695 516 gene locus_tag LOCUS_08500 695 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 771 1364 gene locus_tag LOCUS_08510 771 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08510 1361 2257 gene locus_tag LOCUS_08520 1361 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 3818 2280 gene locus_tag LOCUS_08530 3818 2280 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173812.1 protein_id gnl|my_center|LOCUS_08530 4060 3893 gene locus_tag LOCUS_08540 4060 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 4953 4174 gene locus_tag LOCUS_08550 4953 4174 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918135.1 protein_id gnl|my_center|LOCUS_08550 >Feature sequence112 1644 451 gene locus_tag LOCUS_08560 1644 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 1914 3554 gene locus_tag LOCUS_08570 1914 3554 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086372.1 protein_id gnl|my_center|LOCUS_08570 3680 3543 gene locus_tag LOCUS_08580 3680 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 4184 4990 gene locus_tag LOCUS_08590 gene paaG 4184 4990 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969784.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence113 1398 52 gene locus_tag LOCUS_08600 gene mgtE 1398 52 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073704.1 protein_id gnl|my_center|LOCUS_08600 1742 1473 gene locus_tag LOCUS_08610 1742 1473 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812598.1 protein_id gnl|my_center|LOCUS_08610 2614 1739 gene locus_tag LOCUS_08620 gene rapZ 2614 1739 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377550.1 protein_id gnl|my_center|LOCUS_08620 3072 2611 gene locus_tag LOCUS_08630 gene ptsN 3072 2611 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098853.1 protein_id gnl|my_center|LOCUS_08630 3363 3076 gene locus_tag LOCUS_08640 gene hpf 3363 3076 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_08640 4793 3393 gene locus_tag LOCUS_08650 4793 3393 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073699.1 protein_id gnl|my_center|LOCUS_08650 <5546 4941 gene locus_tag LOCUS_08660 <5546 4941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002210116.1:LPS export ABC transporter ATP-binding protein >Feature sequence114 4837 5034 gene locus_tag LOCUS_08670 4837 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence115 365 1477 gene locus_tag LOCUS_08680 365 1477 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_08680 1584 2621 gene locus_tag LOCUS_08690 1584 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 3385 2711 gene locus_tag LOCUS_08700 gene chrR 3385 2711 CDS product anti-sigma-E factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338712.1 protein_id gnl|my_center|LOCUS_08700 3978 3382 gene locus_tag LOCUS_08710 3978 3382 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352315.1 protein_id gnl|my_center|LOCUS_08710 4662 4039 gene locus_tag LOCUS_08720 4662 4039 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039192.1 protein_id gnl|my_center|LOCUS_08720 5374 4685 gene locus_tag LOCUS_08730 gene folE 5374 4685 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419880.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence116 <1 510 gene locus_tag LOCUS_08740 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039526.1:protease HtpX 652 1809 gene locus_tag LOCUS_08750 652 1809 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089980.1 protein_id gnl|my_center|LOCUS_08750 2759 1923 gene locus_tag LOCUS_08760 2759 1923 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104598.1 protein_id gnl|my_center|LOCUS_08760 2807 3559 gene locus_tag LOCUS_08770 2807 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088487.1 protein_id gnl|my_center|LOCUS_08770 3800 4027 gene locus_tag LOCUS_08780 3800 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 4073 4303 gene locus_tag LOCUS_08790 4073 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 >Feature sequence117 423 794 gene locus_tag LOCUS_08800 423 794 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425238.1 protein_id gnl|my_center|LOCUS_08800 794 1390 gene locus_tag LOCUS_08810 794 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 1384 1926 gene locus_tag LOCUS_08820 1384 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 1923 3020 gene locus_tag LOCUS_08830 1923 3020 CDS product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037627.1 protein_id gnl|my_center|LOCUS_08830 3023 3571 gene locus_tag LOCUS_08840 3023 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence118 2279 405 gene locus_tag LOCUS_08850 2279 405 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_08850 4295 2829 gene locus_tag LOCUS_08860 4295 2829 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_08860 >Feature sequence119 775 1944 gene locus_tag LOCUS_08870 gene lldA 775 1944 CDS product L-lactate dehydrogenase LldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104946.1 protein_id gnl|my_center|LOCUS_08870 2056 2835 gene locus_tag LOCUS_08880 2056 2835 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192152.1 protein_id gnl|my_center|LOCUS_08880 3048 3848 gene locus_tag LOCUS_08890 3048 3848 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965766.1 protein_id gnl|my_center|LOCUS_08890 3851 5209 gene locus_tag LOCUS_08900 3851 5209 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225764.1 protein_id gnl|my_center|LOCUS_08900 >Feature sequence120 570 1943 gene locus_tag LOCUS_08910 gene tyrS 570 1943 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262278.1 protein_id gnl|my_center|LOCUS_08910 2504 2429 gene locus_tag LOCUS_t00090 2504 2429 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2645 2569 gene locus_tag LOCUS_t00100 2645 2569 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2855 3850 gene locus_tag LOCUS_08920 gene birA 2855 3850 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658158.1 protein_id gnl|my_center|LOCUS_08920 3852 4586 gene locus_tag LOCUS_08930 3852 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 4627 4702 gene locus_tag LOCUS_t00110 4627 4702 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4904 4987 gene locus_tag LOCUS_t00120 4904 4987 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 5173 5246 gene locus_tag LOCUS_t00130 5173 5246 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence121 1209 3164 gene locus_tag LOCUS_08940 1209 3164 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207705.1 protein_id gnl|my_center|LOCUS_08940 3161 4807 gene locus_tag LOCUS_08950 gene atuC 3161 4807 CDS product geranyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114738.1 protein_id gnl|my_center|LOCUS_08950 >Feature sequence122 1241 105 gene locus_tag LOCUS_08960 1241 105 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_08960 2462 1251 gene locus_tag LOCUS_08970 2462 1251 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_08970 3921 3223 gene locus_tag LOCUS_08980 3921 3223 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532554.1 protein_id gnl|my_center|LOCUS_08980 4301 4226 gene locus_tag LOCUS_t00140 4301 4226 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4499 4423 gene locus_tag LOCUS_t00150 4499 4423 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4640 4564 gene locus_tag LOCUS_t00160 4640 4564 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence123 1384 2301 gene locus_tag LOCUS_08990 1384 2301 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085343.1 protein_id gnl|my_center|LOCUS_08990 3337 2306 gene locus_tag LOCUS_09000 3337 2306 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_09000 4220 3525 gene locus_tag LOCUS_09010 4220 3525 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771635.1 protein_id gnl|my_center|LOCUS_09010 4368 5300 gene locus_tag LOCUS_09020 4368 5300 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_09020 >Feature sequence124 1259 636 gene locus_tag LOCUS_09030 1259 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 3079 1259 gene locus_tag LOCUS_09040 3079 1259 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 protein_id gnl|my_center|LOCUS_09040 3998 3114 gene locus_tag LOCUS_09050 3998 3114 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070713.1 protein_id gnl|my_center|LOCUS_09050 <5423 4086 gene locus_tag LOCUS_09060 <5423 4086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119251.1:SLC13 family permease >Feature sequence125 53 1375 gene locus_tag LOCUS_09070 53 1375 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112297.1 protein_id gnl|my_center|LOCUS_09070 1530 2723 gene locus_tag LOCUS_09080 1530 2723 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814691.1 protein_id gnl|my_center|LOCUS_09080 3218 4243 gene locus_tag LOCUS_09090 gene gap 3218 4243 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 protein_id gnl|my_center|LOCUS_09090 4240 5238 gene locus_tag LOCUS_09100 gene gap 4240 5238 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 protein_id gnl|my_center|LOCUS_09100 >Feature sequence126 1225 437 gene locus_tag LOCUS_09110 gene dsbC 1225 437 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406382.1 protein_id gnl|my_center|LOCUS_09110 2199 1285 gene locus_tag LOCUS_09120 gene xerD 2199 1285 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 protein_id gnl|my_center|LOCUS_09120 3610 2294 gene locus_tag LOCUS_09130 3610 2294 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206913.1 protein_id gnl|my_center|LOCUS_09130 4390 4040 gene locus_tag LOCUS_09140 gene rplS 4390 4040 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092637.1 protein_id gnl|my_center|LOCUS_09140 5079 4387 gene locus_tag LOCUS_09150 gene trmD 5079 4387 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469802.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence127 <1 1279 gene locus_tag LOCUS_09160 <1 1279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705444.1:bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase 2559 1477 gene locus_tag LOCUS_09170 2559 1477 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087591.1 protein_id gnl|my_center|LOCUS_09170 2687 2812 gene locus_tag LOCUS_09180 2687 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 2837 3418 gene locus_tag LOCUS_09190 2837 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 4501 3404 gene locus_tag LOCUS_09200 4501 3404 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172946.1 protein_id gnl|my_center|LOCUS_09200 4680 5135 gene locus_tag LOCUS_09210 4680 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence128 486 2549 gene locus_tag LOCUS_09220 486 2549 CDS product PEGA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008292761.1 protein_id gnl|my_center|LOCUS_09220 3189 3986 gene locus_tag LOCUS_09230 3189 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 3991 5259 gene locus_tag LOCUS_09240 3991 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence129 612 827 gene locus_tag LOCUS_09250 612 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 928 1746 gene locus_tag LOCUS_09260 928 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 2486 1776 gene locus_tag LOCUS_09270 2486 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 3088 3591 gene locus_tag LOCUS_09280 3088 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 3905 4549 gene locus_tag LOCUS_09290 3905 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence130 2233 1454 gene locus_tag LOCUS_09300 2233 1454 CDS product enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085727.1 protein_id gnl|my_center|LOCUS_09300 3930 2350 gene locus_tag LOCUS_09310 3930 2350 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083665.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence131 <1 856 gene locus_tag LOCUS_09320 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185551.1:acyl-CoA dehydrogenase family protein 1306 839 gene locus_tag LOCUS_09330 1306 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1475 2095 gene locus_tag LOCUS_09340 1475 2095 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389783.1 protein_id gnl|my_center|LOCUS_09340 2085 2906 gene locus_tag LOCUS_09350 2085 2906 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083381.1 protein_id gnl|my_center|LOCUS_09350 2906 3757 gene locus_tag LOCUS_09360 2906 3757 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_09360 >Feature sequence132 4013 3021 gene locus_tag LOCUS_09370 4013 3021 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107420.1 protein_id gnl|my_center|LOCUS_09370 4644 4051 gene locus_tag LOCUS_09380 gene purN 4644 4051 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932011.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence133 239 1231 gene locus_tag LOCUS_09390 239 1231 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222377.1 protein_id gnl|my_center|LOCUS_09390 1289 2128 gene locus_tag LOCUS_09400 1289 2128 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391964.1 protein_id gnl|my_center|LOCUS_09400 2155 3075 gene locus_tag LOCUS_09410 2155 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 3204 4922 gene locus_tag LOCUS_09420 3204 4922 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926642.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence134 1178 333 gene locus_tag LOCUS_09430 1178 333 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_09430 1397 2179 gene locus_tag LOCUS_09440 1397 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 2502 2161 gene locus_tag LOCUS_09450 2502 2161 CDS product Lin0512 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086800.1 protein_id gnl|my_center|LOCUS_09450 2949 2587 gene locus_tag LOCUS_09460 2949 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 3039 3911 gene locus_tag LOCUS_09470 3039 3911 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 protein_id gnl|my_center|LOCUS_09470 4955 4017 gene locus_tag LOCUS_09480 gene tal 4955 4017 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693444.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence135 431 3 gene locus_tag LOCUS_09490 431 3 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004882435.1 protein_id gnl|my_center|LOCUS_09490 1897 521 gene locus_tag LOCUS_09500 gene atpD 1897 521 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097130.1 protein_id gnl|my_center|LOCUS_09500 2789 1929 gene locus_tag LOCUS_09510 gene atpG 2789 1929 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_09510 4356 2812 gene locus_tag LOCUS_09520 gene atpA 4356 2812 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097134.1 protein_id gnl|my_center|LOCUS_09520 4919 4380 gene locus_tag LOCUS_09530 4919 4380 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence136 980 309 gene locus_tag LOCUS_09540 gene flgD 980 309 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946950.1 protein_id gnl|my_center|LOCUS_09540 1405 992 gene locus_tag LOCUS_09550 gene flgC 1405 992 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946949.1 protein_id gnl|my_center|LOCUS_09550 1796 1407 gene locus_tag LOCUS_09560 gene flgB 1796 1407 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370068.1 protein_id gnl|my_center|LOCUS_09560 2890 3726 gene locus_tag LOCUS_09570 gene flgA 2890 3726 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068813073.1 protein_id gnl|my_center|LOCUS_09570 3820 4107 gene locus_tag LOCUS_09580 3820 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 4139 4630 gene locus_tag LOCUS_09590 4139 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 >Feature sequence137 168 1001 gene locus_tag LOCUS_09600 168 1001 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992443.1 protein_id gnl|my_center|LOCUS_09600 1172 2215 gene locus_tag LOCUS_09610 1172 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 2749 3213 gene locus_tag LOCUS_09620 2749 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 3206 3646 gene locus_tag LOCUS_09630 3206 3646 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921473.1 protein_id gnl|my_center|LOCUS_09630 <5024 3648 gene locus_tag LOCUS_09640 <5024 3648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258705.1:dihydroxy-acid dehydratase >Feature sequence138 629 216 gene locus_tag LOCUS_09650 629 216 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815546.1 protein_id gnl|my_center|LOCUS_09650 1822 629 gene locus_tag LOCUS_09660 1822 629 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967073.1 protein_id gnl|my_center|LOCUS_09660 2003 2611 gene locus_tag LOCUS_09670 gene coaE 2003 2611 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_09670 2611 3381 gene locus_tag LOCUS_09680 2611 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 3634 4413 gene locus_tag LOCUS_09690 3634 4413 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529312.1 protein_id gnl|my_center|LOCUS_09690 >Feature sequence139 329 919 gene locus_tag LOCUS_09700 329 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 1771 1526 gene locus_tag LOCUS_09710 1771 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 3416 2364 gene locus_tag LOCUS_09720 3416 2364 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071353.1 protein_id gnl|my_center|LOCUS_09720 3558 3959 gene locus_tag LOCUS_09730 3558 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 3946 4941 gene locus_tag LOCUS_09740 3946 4941 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867187.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence140 1088 786 gene locus_tag LOCUS_09750 1088 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1662 1165 gene locus_tag LOCUS_09760 1662 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 2654 2322 gene locus_tag LOCUS_09770 2654 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 4067 2916 gene locus_tag LOCUS_09780 gene lapB 4067 2916 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957639.1 protein_id gnl|my_center|LOCUS_09780 4346 4101 gene locus_tag LOCUS_09790 4346 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 4843 4508 gene locus_tag LOCUS_09800 gene ihfB 4843 4508 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091441.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence141 222 2576 gene locus_tag LOCUS_09810 222 2576 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946660.1 protein_id gnl|my_center|LOCUS_09810 >Feature sequence142 117 899 gene locus_tag LOCUS_09820 117 899 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_09820 2183 912 gene locus_tag LOCUS_09830 gene purD 2183 912 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866776.1 protein_id gnl|my_center|LOCUS_09830 3994 2417 gene locus_tag LOCUS_09840 gene purH 3994 2417 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035747.1 protein_id gnl|my_center|LOCUS_09840 4436 4170 gene locus_tag LOCUS_09850 4436 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 >Feature sequence143 <1 1293 gene locus_tag LOCUS_09860 <1 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003363717.1:DegQ family serine endoprotease 1480 3162 gene locus_tag LOCUS_09870 gene lepA 1480 3162 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085555.1 protein_id gnl|my_center|LOCUS_09870 3185 3940 gene locus_tag LOCUS_09880 gene lepB 3185 3940 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101969.1 protein_id gnl|my_center|LOCUS_09880 3999 4367 gene locus_tag LOCUS_09890 3999 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence144 150 848 gene locus_tag LOCUS_09900 gene pdsR 150 848 CDS product proteobacterial dedicated sortase system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 protein_id gnl|my_center|LOCUS_09900 852 2993 gene locus_tag LOCUS_09910 gene pdsS 852 2993 CDS product proteobacterial dedicated sortase system histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072224.1 protein_id gnl|my_center|LOCUS_09910 3653 3033 gene locus_tag LOCUS_09920 3653 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 3813 4814 gene locus_tag LOCUS_09930 3813 4814 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763555.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence145 434 1489 gene locus_tag LOCUS_09940 gene ruvB 434 1489 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409396.1 protein_id gnl|my_center|LOCUS_09940 1564 2241 gene locus_tag LOCUS_09950 gene tolQ 1564 2241 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086125.1 protein_id gnl|my_center|LOCUS_09950 2245 2676 gene locus_tag LOCUS_09960 gene tolR 2245 2676 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086126.1 protein_id gnl|my_center|LOCUS_09960 2676 3398 gene locus_tag LOCUS_09970 2676 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 3409 4785 gene locus_tag LOCUS_09980 gene tolB 3409 4785 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003339472.1 protein_id gnl|my_center|LOCUS_09980 >Feature sequence146 <1 1031 gene locus_tag LOCUS_09990 <1 1031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920866.1:MFS transporter 1099 1440 gene locus_tag LOCUS_10000 1099 1440 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071074.1 protein_id gnl|my_center|LOCUS_10000 1437 2189 gene locus_tag LOCUS_10010 1437 2189 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480002.1 protein_id gnl|my_center|LOCUS_10010 2415 2951 gene locus_tag LOCUS_10020 2415 2951 CDS product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072197.1 protein_id gnl|my_center|LOCUS_10020 2961 3845 gene locus_tag LOCUS_10030 2961 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence147 1213 248 gene locus_tag LOCUS_10040 gene metR 1213 248 CDS product transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092181.1 protein_id gnl|my_center|LOCUS_10040 1587 2837 gene locus_tag LOCUS_10050 1587 2837 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_10050 2828 3547 gene locus_tag LOCUS_10060 2828 3547 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731310.1 protein_id gnl|my_center|LOCUS_10060 3623 4654 gene locus_tag LOCUS_10070 3623 4654 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence148 2346 823 gene locus_tag LOCUS_10080 2346 823 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173812.1 protein_id gnl|my_center|LOCUS_10080 3059 2451 gene locus_tag LOCUS_10090 3059 2451 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406575.1 protein_id gnl|my_center|LOCUS_10090 3840 4469 gene locus_tag LOCUS_10100 3840 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 >Feature sequence149 1321 422 gene locus_tag LOCUS_10110 1321 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1815 2585 gene locus_tag LOCUS_10120 1815 2585 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789007.1 protein_id gnl|my_center|LOCUS_10120 2590 3402 gene locus_tag LOCUS_10130 2590 3402 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_10130 3353 3859 gene locus_tag LOCUS_10140 3353 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 3979 4428 gene locus_tag LOCUS_10150 3979 4428 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence150 1281 550 gene locus_tag LOCUS_10160 1281 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2195 1278 gene locus_tag LOCUS_10170 gene hemC 2195 1278 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217854.1 protein_id gnl|my_center|LOCUS_10170 2322 3749 gene locus_tag LOCUS_10180 gene argH 2322 3749 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103000.1 protein_id gnl|my_center|LOCUS_10180 4071 3733 gene locus_tag LOCUS_10190 gene cyaY 4071 3733 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121284.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence151 1838 2707 gene locus_tag LOCUS_10200 1838 2707 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020166.1 protein_id gnl|my_center|LOCUS_10200 4004 3102 gene locus_tag LOCUS_10210 4004 3102 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932752.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence152 871 1185 gene locus_tag LOCUS_10220 871 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1491 1769 gene locus_tag LOCUS_10230 1491 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 2215 3399 gene locus_tag LOCUS_10240 2215 3399 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225687.1 protein_id gnl|my_center|LOCUS_10240 4203 3484 gene locus_tag LOCUS_10250 4203 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence153 946 80 gene locus_tag LOCUS_10260 946 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 2038 974 gene locus_tag LOCUS_10270 gene recA 2038 974 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092260.1 protein_id gnl|my_center|LOCUS_10270 >Feature sequence154 538 987 gene locus_tag LOCUS_10280 538 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1129 3354 gene locus_tag LOCUS_10290 1129 3354 CDS product DUF5916 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925729.1 protein_id gnl|my_center|LOCUS_10290 <4629 3359 gene locus_tag LOCUS_10300 <4629 3359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261868.1:Na+/H+ antiporter NhaC >Feature sequence155 314 1705 gene locus_tag LOCUS_10310 314 1705 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481484.1 protein_id gnl|my_center|LOCUS_10310 2189 3367 gene locus_tag LOCUS_10320 2189 3367 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_10320 3474 4001 gene locus_tag LOCUS_10330 3474 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence156 <1 803 gene locus_tag LOCUS_10340 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268273.1:tRNA 2-thiouridine(34) synthase MnmA 800 1423 gene locus_tag LOCUS_10350 gene hflD 800 1423 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029217215.1 protein_id gnl|my_center|LOCUS_10350 1446 2834 gene locus_tag LOCUS_10360 gene purB 1446 2834 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705315.1 protein_id gnl|my_center|LOCUS_10360 2827 4227 gene locus_tag LOCUS_10370 2827 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence157 <1 862 gene locus_tag LOCUS_10380 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003109274.1:sulfurtransferase 843 2633 gene locus_tag LOCUS_10390 gene mnmD 843 2633 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265612.1 protein_id gnl|my_center|LOCUS_10390 3813 2638 gene locus_tag LOCUS_10400 3813 2638 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_10400 4149 3916 gene locus_tag LOCUS_10410 4149 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence158 <1 859 gene locus_tag LOCUS_10420 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032728485.1:rhodanese-related sulfurtransferase 1472 861 gene locus_tag LOCUS_10430 1472 861 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088446.1 protein_id gnl|my_center|LOCUS_10430 1534 2346 gene locus_tag LOCUS_10440 1534 2346 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_10440 3406 2384 gene locus_tag LOCUS_10450 3406 2384 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_10450 3539 4561 gene locus_tag LOCUS_10460 3539 4561 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640058.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence159 2433 691 gene locus_tag LOCUS_10470 2433 691 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_10470 2833 4104 gene locus_tag LOCUS_10480 2833 4104 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868824.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence160 <1 1082 gene locus_tag LOCUS_10490 <1 1082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640165.1:DsbA family protein 1601 2410 gene locus_tag LOCUS_10500 1601 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337106.1 protein_id gnl|my_center|LOCUS_10500 2490 3278 gene locus_tag LOCUS_10510 2490 3278 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111854.1 protein_id gnl|my_center|LOCUS_10510 3340 4074 gene locus_tag LOCUS_10520 3340 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence161 1128 106 gene locus_tag LOCUS_10530 1128 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 2226 1318 gene locus_tag LOCUS_10540 2226 1318 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532449.1 protein_id gnl|my_center|LOCUS_10540 2387 3361 gene locus_tag LOCUS_10550 2387 3361 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840054.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence162 553 2172 gene locus_tag LOCUS_10560 553 2172 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404756.1 protein_id gnl|my_center|LOCUS_10560 2442 3821 gene locus_tag LOCUS_10570 2442 3821 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707798.1 protein_id gnl|my_center|LOCUS_10570 <4548 3961 gene locus_tag LOCUS_10580 <4548 3961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919715.1:coniferyl aldehyde dehydrogenase >Feature sequence163 479 2299 gene locus_tag LOCUS_10590 gene cobT 479 2299 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529369.1 protein_id gnl|my_center|LOCUS_10590 2302 2835 gene locus_tag LOCUS_10600 2302 2835 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108825999.1 protein_id gnl|my_center|LOCUS_10600 3896 2955 gene locus_tag LOCUS_10610 3896 2955 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048144.1 protein_id gnl|my_center|LOCUS_10610 <4532 3893 gene locus_tag LOCUS_10620 <4532 3893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966899.1:ABC transporter ATP-binding protein >Feature sequence164 2142 601 gene locus_tag LOCUS_10630 2142 601 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262057.1 protein_id gnl|my_center|LOCUS_10630 2986 2204 gene locus_tag LOCUS_10640 2986 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 3414 2983 gene locus_tag LOCUS_10650 3414 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 3938 3411 gene locus_tag LOCUS_10660 3938 3411 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083551.1 protein_id gnl|my_center|LOCUS_10660 4169 4495 gene locus_tag LOCUS_10670 4169 4495 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811313.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence165 <1 786 gene locus_tag LOCUS_10680 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005080499.1:carboxylesterase family protein 2356 980 gene locus_tag LOCUS_10690 2356 980 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707798.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence166 3987 2878 gene locus_tag LOCUS_10700 3987 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence167 <1 962 gene locus_tag LOCUS_10710 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003098594.1:sigma E protease regulator RseP 1076 3703 gene locus_tag LOCUS_10720 gene bamA 1076 3703 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092382.1 protein_id gnl|my_center|LOCUS_10720 3730 4245 gene locus_tag LOCUS_10730 3730 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence168 <1 511 gene locus_tag LOCUS_10740 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002208915.1:transcription elongation factor GreB 501 1589 gene locus_tag LOCUS_10750 gene hisC 501 1589 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121508.1 protein_id gnl|my_center|LOCUS_10750 1595 2071 gene locus_tag LOCUS_10760 1595 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 2945 2037 gene locus_tag LOCUS_10770 gene tesB 2945 2037 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242473.1 protein_id gnl|my_center|LOCUS_10770 <4507 3012 gene locus_tag LOCUS_10780 <4507 3012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113988.1:DNA internalization-related competence protein ComEC/Rec2 >Feature sequence169 1124 210 gene locus_tag LOCUS_10790 1124 210 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_10790 1235 3004 gene locus_tag LOCUS_10800 1235 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 <4496 3126 gene locus_tag LOCUS_10810 <4496 3126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003414579.1:glutamine synthetase family protein >Feature sequence170 1496 567 gene locus_tag LOCUS_10820 1496 567 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267475.1 protein_id gnl|my_center|LOCUS_10820 2245 1493 gene locus_tag LOCUS_10830 2245 1493 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930110.1 protein_id gnl|my_center|LOCUS_10830 2650 4293 gene locus_tag LOCUS_10840 2650 4293 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102932.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence171 162 317 gene locus_tag LOCUS_10850 162 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1719 700 gene locus_tag LOCUS_10860 gene queA 1719 700 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113798.1 protein_id gnl|my_center|LOCUS_10860 2041 2127 gene locus_tag LOCUS_t00170 2041 2127 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2701 2423 gene locus_tag LOCUS_10870 2701 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 3309 2698 gene locus_tag LOCUS_10880 3309 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 3836 4453 gene locus_tag LOCUS_10890 3836 4453 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041322404.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence172 989 714 gene locus_tag LOCUS_10900 gene hupB 989 714 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087931.1 protein_id gnl|my_center|LOCUS_10900 3519 1099 gene locus_tag LOCUS_10910 gene lon 3519 1099 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087926.1 protein_id gnl|my_center|LOCUS_10910 <4481 3654 gene locus_tag LOCUS_10920 <4481 3654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005770751.1:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence173 500 309 gene locus_tag LOCUS_10930 gene yacG 500 309 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094656.1 protein_id gnl|my_center|LOCUS_10930 1093 497 gene locus_tag LOCUS_10940 gene coaE 1093 497 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770017.1 protein_id gnl|my_center|LOCUS_10940 1962 1093 gene locus_tag LOCUS_10950 1962 1093 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 protein_id gnl|my_center|LOCUS_10950 3202 1988 gene locus_tag LOCUS_10960 3202 1988 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266635.1 protein_id gnl|my_center|LOCUS_10960 <4472 3217 gene locus_tag LOCUS_10970 <4472 3217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208227.1:type IV-A pilus assembly ATPase PilB >Feature sequence174 2134 1040 gene locus_tag LOCUS_10980 gene pheA 2134 1040 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616461.1 protein_id gnl|my_center|LOCUS_10980 <4458 2127 gene locus_tag LOCUS_10990 <4458 2127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815974.1:DNA topoisomerase (ATP-hydrolyzing) subunit A >Feature sequence175 <1 951 gene locus_tag LOCUS_11000 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265494.1:cytochrome P450 965 2344 gene locus_tag LOCUS_11010 965 2344 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 protein_id gnl|my_center|LOCUS_11010 3226 2372 gene locus_tag LOCUS_11020 3226 2372 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918831.1 protein_id gnl|my_center|LOCUS_11020 <4452 3274 gene locus_tag LOCUS_11030 <4452 3274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038934.1:tetratricopeptide repeat protein >Feature sequence176 <1 1603 gene locus_tag LOCUS_11040 <1 1603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919715.1:coniferyl aldehyde dehydrogenase 2116 1691 gene locus_tag LOCUS_11050 2116 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 2346 3587 gene locus_tag LOCUS_11060 2346 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence177 2950 197 gene locus_tag LOCUS_11070 2950 197 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073282.1 protein_id gnl|my_center|LOCUS_11070 3419 3042 gene locus_tag LOCUS_11080 3419 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 3841 3422 gene locus_tag LOCUS_11090 3841 3422 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764092.1 protein_id gnl|my_center|LOCUS_11090 <4439 3894 gene locus_tag LOCUS_11100 <4439 3894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092867.1:leucyl aminopeptidase >Feature sequence178 1576 644 gene locus_tag LOCUS_11110 gene oppB 1576 644 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245554.1 protein_id gnl|my_center|LOCUS_11110 1748 1584 gene locus_tag LOCUS_11120 1748 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 3185 1767 gene locus_tag LOCUS_11130 3185 1767 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727515.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11130 3243 3392 gene locus_tag LOCUS_11140 3243 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 4398 3385 gene locus_tag LOCUS_11150 4398 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence179 1341 418 gene locus_tag LOCUS_11160 gene fabD 1341 418 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147872.1 protein_id gnl|my_center|LOCUS_11160 1756 1574 gene locus_tag LOCUS_11170 gene rpmF 1756 1574 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210931.1 protein_id gnl|my_center|LOCUS_11170 2602 1937 gene locus_tag LOCUS_11180 2602 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 2680 3273 gene locus_tag LOCUS_11190 2680 3273 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137608.1 protein_id gnl|my_center|LOCUS_11190 4253 3270 gene locus_tag LOCUS_11200 gene rluC 4253 3270 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846324.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence180 <1 590 gene locus_tag LOCUS_11210 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102590.1:outer membrane protein assembly factor BamD <4408 1457 gene locus_tag LOCUS_11220 <4408 1457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704651.1:PilC/PilY family type IV pilus protein >Feature sequence181 81 1268 gene locus_tag LOCUS_11230 81 1268 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114496.1 protein_id gnl|my_center|LOCUS_11230 2394 1534 gene locus_tag LOCUS_11240 2394 1534 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726959.1 protein_id gnl|my_center|LOCUS_11240 3599 2466 gene locus_tag LOCUS_11250 3599 2466 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265695.1 protein_id gnl|my_center|LOCUS_11250 3719 3958 gene locus_tag LOCUS_11260 3719 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence182 736 1797 gene locus_tag LOCUS_11270 736 1797 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence183 1005 439 gene locus_tag LOCUS_11280 1005 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2665 1442 gene locus_tag LOCUS_11290 2665 1442 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112579.1 protein_id gnl|my_center|LOCUS_11290 2707 3063 gene locus_tag LOCUS_11300 gene arsC 2707 3063 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314592.1 protein_id gnl|my_center|LOCUS_11300 3747 3370 gene locus_tag LOCUS_11310 3747 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 <4382 3787 gene locus_tag LOCUS_11320 <4382 3787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940872.1:SDR family oxidoreductase >Feature sequence184 1057 413 gene locus_tag LOCUS_11330 1057 413 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101790.1 protein_id gnl|my_center|LOCUS_11330 1796 1041 gene locus_tag LOCUS_11340 1796 1041 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839717.1 protein_id gnl|my_center|LOCUS_11340 2508 1810 gene locus_tag LOCUS_11350 gene fabG 2508 1810 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367190.1 protein_id gnl|my_center|LOCUS_11350 2996 2505 gene locus_tag LOCUS_11360 2996 2505 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330217.1 protein_id gnl|my_center|LOCUS_11360 3399 4175 gene locus_tag LOCUS_11370 3399 4175 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965382.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence185 87 701 gene locus_tag LOCUS_11380 87 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088431.1 protein_id gnl|my_center|LOCUS_11380 702 1256 gene locus_tag LOCUS_11390 702 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 3746 1527 gene locus_tag LOCUS_11400 3746 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 4149 3907 gene locus_tag LOCUS_11410 4149 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence186 1312 503 gene locus_tag LOCUS_11420 1312 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 2318 1380 gene locus_tag LOCUS_11430 gene scpB 2318 1380 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114835.1 protein_id gnl|my_center|LOCUS_11430 3192 2311 gene locus_tag LOCUS_11440 3192 2311 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396554.1 protein_id gnl|my_center|LOCUS_11440 4328 3189 gene locus_tag LOCUS_11450 4328 3189 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_11450 >Feature sequence187 1646 729 gene locus_tag LOCUS_11460 1646 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 2395 1673 gene locus_tag LOCUS_11470 2395 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 2778 2395 gene locus_tag LOCUS_11480 2778 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082373.1 protein_id gnl|my_center|LOCUS_11480 3935 2775 gene locus_tag LOCUS_11490 gene dapE 3935 2775 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457682.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence188 161 772 gene locus_tag LOCUS_11500 161 772 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256153.1 protein_id gnl|my_center|LOCUS_11500 2761 857 gene locus_tag LOCUS_11510 2761 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 3173 2775 gene locus_tag LOCUS_11520 3173 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 <4320 3353 gene locus_tag LOCUS_11530 <4320 3353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040401.1:TolC family outer membrane protein >Feature sequence189 45 545 gene locus_tag LOCUS_11540 gene dtd 45 545 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560983.1 protein_id gnl|my_center|LOCUS_11540 1527 751 gene locus_tag LOCUS_11550 gene tatC 1527 751 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115041.1 protein_id gnl|my_center|LOCUS_11550 1879 1502 gene locus_tag LOCUS_11560 1879 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 2104 1892 gene locus_tag LOCUS_11570 2104 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 2455 2114 gene locus_tag LOCUS_11580 2455 2114 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202813.1 protein_id gnl|my_center|LOCUS_11580 2846 2448 gene locus_tag LOCUS_11590 gene hisI 2846 2448 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815804.1 protein_id gnl|my_center|LOCUS_11590 <4294 2843 gene locus_tag LOCUS_11600 <4294 2843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095885.1:ubiquinone biosynthesis regulatory protein kinase UbiB >Feature sequence190 703 1875 gene locus_tag LOCUS_11610 703 1875 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399610.1 protein_id gnl|my_center|LOCUS_11610 2343 1876 gene locus_tag LOCUS_11620 2343 1876 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 protein_id gnl|my_center|LOCUS_11620 3146 2340 gene locus_tag LOCUS_11630 gene paaG 3146 2340 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969790.1 protein_id gnl|my_center|LOCUS_11630 <4280 3665 gene locus_tag LOCUS_11640 <4280 3665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478452.1:metal-dependent hydrolase >Feature sequence191 539 342 gene locus_tag LOCUS_11650 539 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1135 1494 gene locus_tag LOCUS_11660 1135 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 2363 4096 gene locus_tag LOCUS_11670 2363 4096 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102377.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence192 1336 2184 gene locus_tag LOCUS_11680 gene hexR 1336 2184 CDS product DNA-binding transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213148.1 protein_id gnl|my_center|LOCUS_11680 3474 2263 gene locus_tag LOCUS_11690 3474 2263 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence193 322 1200 gene locus_tag LOCUS_11700 322 1200 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_11700 2459 1197 gene locus_tag LOCUS_11710 2459 1197 CDS product Sb-PDE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054959405.1 protein_id gnl|my_center|LOCUS_11710 2988 2491 gene locus_tag LOCUS_11720 2988 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 3075 3947 gene locus_tag LOCUS_11730 3075 3947 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence194 928 290 gene locus_tag LOCUS_11740 gene adk 928 290 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092485.1 protein_id gnl|my_center|LOCUS_11740 1825 1010 gene locus_tag LOCUS_11750 gene mazG 1825 1010 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112589.1 protein_id gnl|my_center|LOCUS_11750 2821 1919 gene locus_tag LOCUS_11760 gene cysM 2821 1919 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616363.1 protein_id gnl|my_center|LOCUS_11760 3637 2903 gene locus_tag LOCUS_11770 gene recO 3637 2903 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378472.1 protein_id gnl|my_center|LOCUS_11770 <4164 3627 gene locus_tag LOCUS_11780 <4164 3627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003363707.1:GTPase Era >Feature sequence195 2 628 gene locus_tag LOCUS_11790 2 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 1662 646 gene locus_tag LOCUS_11800 gene nadA 1662 646 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112547.1 protein_id gnl|my_center|LOCUS_11800 1951 2880 gene locus_tag LOCUS_11810 1951 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 2916 2991 gene locus_tag LOCUS_t00180 2916 2991 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3559 3053 gene locus_tag LOCUS_11820 3559 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 <4163 3561 gene locus_tag LOCUS_11830 <4163 3561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003111415.1:7-cyano-7-deazaguanine synthase QueC >Feature sequence196 267 3812 gene locus_tag LOCUS_11840 267 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence197 2256 1108 gene locus_tag LOCUS_11850 2256 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 3808 2591 gene locus_tag LOCUS_11860 3808 2591 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447207.1 protein_id gnl|my_center|LOCUS_11860 >Feature sequence198 1937 375 gene locus_tag LOCUS_11870 1937 375 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727481.1 protein_id gnl|my_center|LOCUS_11870 2561 2013 gene locus_tag LOCUS_11880 2561 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 2960 2841 gene locus_tag LOCUS_11890 2960 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 <4012 3105 gene locus_tag LOCUS_11900 <4012 3105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266601.1:class I adenylate-forming enzyme family protein >Feature sequence199 <1 1711 gene locus_tag LOCUS_11910 <1 1711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003084404.1:phosphoenolpyruvate--protein phosphotransferase 2405 1665 gene locus_tag LOCUS_11920 2405 1665 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_11920 2541 3314 gene locus_tag LOCUS_11930 gene lgt 2541 3314 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112963.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence200 <1 657 gene locus_tag LOCUS_11940 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051618882.1:serine hydrolase domain-containing protein 851 1909 gene locus_tag LOCUS_11950 851 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 4002 2041 gene locus_tag LOCUS_11960 4002 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence201 3031 2339 gene locus_tag LOCUS_11970 3031 2339 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406778.1 protein_id gnl|my_center|LOCUS_11970 3102 3749 gene locus_tag LOCUS_11980 3102 3749 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447512.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence202 <1 1144 gene locus_tag LOCUS_11990 <1 1144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994173.1:tRNA lysidine(34) synthetase TilS 1304 2950 gene locus_tag LOCUS_12000 1304 2950 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 protein_id gnl|my_center|LOCUS_12000 3002 3832 gene locus_tag LOCUS_12010 gene kdsA 3002 3832 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003041978.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence203 1397 306 gene locus_tag LOCUS_12020 gene prfA 1397 306 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103430.1 protein_id gnl|my_center|LOCUS_12020 2655 1378 gene locus_tag LOCUS_12030 gene hemA 2655 1378 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095001.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence204 3237 2587 gene locus_tag LOCUS_12040 gene rluA 3237 2587 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525162.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence205 506 431 gene locus_tag LOCUS_t00190 506 431 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 604 2634 gene locus_tag LOCUS_12050 gene uvrB 604 2634 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104590.1 protein_id gnl|my_center|LOCUS_12050 2735 2811 gene locus_tag LOCUS_t00200 2735 2811 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence206 531 1829 gene locus_tag LOCUS_12060 531 1829 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464216.1 protein_id gnl|my_center|LOCUS_12060 2962 2015 gene locus_tag LOCUS_12070 2962 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence207 433 1290 gene locus_tag LOCUS_12080 gene motD 433 1290 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083090.1 protein_id gnl|my_center|LOCUS_12080 1797 2492 gene locus_tag LOCUS_12090 1797 2492 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_12090 3846 2599 gene locus_tag LOCUS_12100 3846 2599 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172378.1 protein_id gnl|my_center|LOCUS_12100 >Feature sequence208 328 1512 gene locus_tag LOCUS_12110 328 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1554 2477 gene locus_tag LOCUS_12120 1554 2477 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971730.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence209 2123 33 gene locus_tag LOCUS_12130 2123 33 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_12130 2198 2899 gene locus_tag LOCUS_12140 2198 2899 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086937.1 protein_id gnl|my_center|LOCUS_12140 2930 3490 gene locus_tag LOCUS_12150 2930 3490 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence210 <1 503 gene locus_tag LOCUS_12160 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095330.1:Gfo/Idh/MocA family oxidoreductase 500 1576 gene locus_tag LOCUS_12170 500 1576 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 protein_id gnl|my_center|LOCUS_12170 <3930 2006 gene locus_tag LOCUS_12180 <3930 2006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071225.1:efflux RND transporter permease subunit >Feature sequence211 3559 1520 gene locus_tag LOCUS_12190 3559 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence212 130 1272 gene locus_tag LOCUS_12200 130 1272 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090103.1 protein_id gnl|my_center|LOCUS_12200 2168 1284 gene locus_tag LOCUS_12210 2168 1284 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_12210 2630 2253 gene locus_tag LOCUS_12220 2630 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 3352 2630 gene locus_tag LOCUS_12230 3352 2630 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038304.1 protein_id gnl|my_center|LOCUS_12230 3829 3539 gene locus_tag LOCUS_12240 3829 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12240 >Feature sequence213 744 424 gene locus_tag LOCUS_12250 744 424 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 protein_id gnl|my_center|LOCUS_12250 2064 853 gene locus_tag LOCUS_12260 2064 853 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921354.1 protein_id gnl|my_center|LOCUS_12260 2321 2611 gene locus_tag LOCUS_12270 2321 2611 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346198.1 protein_id gnl|my_center|LOCUS_12270 2623 3072 gene locus_tag LOCUS_12280 2623 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 <3906 3216 gene locus_tag LOCUS_12290 <3906 3216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203420.1:thymidylate synthase >Feature sequence214 1328 723 gene locus_tag LOCUS_12300 1328 723 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947139.1 protein_id gnl|my_center|LOCUS_12300 3370 1325 gene locus_tag LOCUS_12310 gene ligA 3370 1325 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478506.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence215 207 1391 gene locus_tag LOCUS_12320 207 1391 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922398.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence216 1804 1193 gene locus_tag LOCUS_12330 gene nqrE 1804 1193 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_12330 2472 1813 gene locus_tag LOCUS_12340 gene nqrD 2472 1813 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119802.1 protein_id gnl|my_center|LOCUS_12340 3301 2489 gene locus_tag LOCUS_12350 3301 2489 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 protein_id gnl|my_center|LOCUS_12350 <3857 3294 gene locus_tag LOCUS_12360 <3857 3294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003109478.1:NADH:ubiquinone reductase (Na(+)-transporting) subunit B >Feature sequence217 <1 1914 gene locus_tag LOCUS_12370 <1 1914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206764.1:TonB-dependent receptor 3415 2051 gene locus_tag LOCUS_12380 3415 2051 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224741.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence218 1308 532 gene locus_tag LOCUS_12390 gene fabG 1308 532 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_12390 2374 1343 gene locus_tag LOCUS_12400 2374 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 3718 2399 gene locus_tag LOCUS_12410 3718 2399 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence219 <1 799 gene locus_tag LOCUS_12420 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887868.1:glycosyltransferase family 4 protein 860 3361 gene locus_tag LOCUS_12430 860 3361 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387818.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence220 442 1761 gene locus_tag LOCUS_12440 442 1761 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707799.1 protein_id gnl|my_center|LOCUS_12440 1769 3073 gene locus_tag LOCUS_12450 1769 3073 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338191.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence221 2065 638 gene locus_tag LOCUS_12460 gene xdhA 2065 638 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 protein_id gnl|my_center|LOCUS_12460 2522 3148 gene locus_tag LOCUS_12470 2522 3148 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083903.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence222 1230 610 gene locus_tag LOCUS_12480 1230 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 2370 1252 gene locus_tag LOCUS_12490 2370 1252 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 protein_id gnl|my_center|LOCUS_12490 <3820 2408 gene locus_tag LOCUS_12500 <3820 2408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095699.1:efflux transporter outer membrane subunit OpmH >Feature sequence223 1779 757 gene locus_tag LOCUS_12510 gene pheS 1779 757 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367019.1 protein_id gnl|my_center|LOCUS_12510 2182 1820 gene locus_tag LOCUS_12520 gene rplT 2182 1820 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300683.1 protein_id gnl|my_center|LOCUS_12520 2435 2244 gene locus_tag LOCUS_12530 gene rpmI 2435 2244 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072303.1 protein_id gnl|my_center|LOCUS_12530 3080 2553 gene locus_tag LOCUS_12540 gene infC 3080 2553 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367017.1 protein_id gnl|my_center|LOCUS_12540 <3812 3181 gene locus_tag LOCUS_12550 <3812 3181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003090677.1:threonine--tRNA ligase >Feature sequence224 266 427 gene locus_tag LOCUS_12560 266 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 464 1450 gene locus_tag LOCUS_12570 464 1450 CDS product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782748.1 protein_id gnl|my_center|LOCUS_12570 2338 1559 gene locus_tag LOCUS_12580 2338 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 <3780 2584 gene locus_tag LOCUS_12590 <3780 2584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125657.1:GTP-binding protein >Feature sequence225 1145 306 gene locus_tag LOCUS_12600 1145 306 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530979.1 protein_id gnl|my_center|LOCUS_12600 1559 1278 gene locus_tag LOCUS_12610 1559 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1697 2137 gene locus_tag LOCUS_12620 1697 2137 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986776.1 protein_id gnl|my_center|LOCUS_12620 2247 3302 gene locus_tag LOCUS_12630 2247 3302 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921634.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence226 <1 885 gene locus_tag LOCUS_12640 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_036462348.1:acyl-CoA dehydrogenase family protein 1818 1012 gene locus_tag LOCUS_12650 1818 1012 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_12650 2730 2176 gene locus_tag LOCUS_12660 2730 2176 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767695.1 protein_id gnl|my_center|LOCUS_12660 2764 3486 gene locus_tag LOCUS_12670 2764 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 >Feature sequence227 1009 20 gene locus_tag LOCUS_12680 1009 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1322 2971 gene locus_tag LOCUS_12690 1322 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence228 1023 19 gene locus_tag LOCUS_12700 1023 19 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267273.1 protein_id gnl|my_center|LOCUS_12700 1434 2834 gene locus_tag LOCUS_12710 1434 2834 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_12710 2947 3441 gene locus_tag LOCUS_12720 2947 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence229 639 1067 gene locus_tag LOCUS_12730 639 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 1567 1064 gene locus_tag LOCUS_12740 gene gloA 1567 1064 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766190.1 protein_id gnl|my_center|LOCUS_12740 1824 1732 gene locus_tag LOCUS_t00210 1824 1732 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 <3693 2361 gene locus_tag LOCUS_12750 <3693 2361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_036891662.1:selenide, water dikinase SelD >Feature sequence230 332 1717 gene locus_tag LOCUS_12760 332 1717 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459963.1 protein_id gnl|my_center|LOCUS_12760 1714 3042 gene locus_tag LOCUS_12770 1714 3042 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707049.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence231 <1 1899 gene locus_tag LOCUS_12780 <1 1899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120560.1:glutamate synthase large subunit 1910 3349 gene locus_tag LOCUS_12790 1910 3349 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence232 2278 635 gene locus_tag LOCUS_12800 2278 635 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_12800 <3668 2283 gene locus_tag LOCUS_12810 <3668 2283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003107432.1:VWA domain-containing protein >Feature sequence233 155 80 gene locus_tag LOCUS_t00220 155 80 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 280 205 gene locus_tag LOCUS_t00230 280 205 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1480 371 gene locus_tag LOCUS_12820 1480 371 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096677.1 protein_id gnl|my_center|LOCUS_12820 3493 1508 gene locus_tag LOCUS_12830 gene pqqU 3493 1508 CDS product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706257.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence234 2106 406 gene locus_tag LOCUS_12840 2106 406 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_12840 2170 3378 gene locus_tag LOCUS_12850 2170 3378 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965460.1 protein_id gnl|my_center|LOCUS_12850 3638 3366 gene locus_tag LOCUS_12860 3638 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence235 <1 1941 gene locus_tag LOCUS_12870 <1 1941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813909.1:TonB-dependent siderophore receptor 2834 2031 gene locus_tag LOCUS_12880 2834 2031 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence236 647 1030 gene locus_tag LOCUS_12890 647 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 2274 1099 gene locus_tag LOCUS_12900 2274 1099 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140055.1 protein_id gnl|my_center|LOCUS_12900 2993 2271 gene locus_tag LOCUS_12910 2993 2271 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039041.1 protein_id gnl|my_center|LOCUS_12910 <3614 2986 gene locus_tag LOCUS_12920 <3614 2986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039042.1:alpha/beta hydrolase >Feature sequence237 <1 1772 gene locus_tag LOCUS_12930 <1 1772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930895.1:Fe/S-dependent 2-methylisocitrate dehydratase AcnD 1801 2973 gene locus_tag LOCUS_12940 gene prpF 1801 2973 CDS product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187247.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence238 1277 195 gene locus_tag LOCUS_12950 gene lptG 1277 195 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764084.1 protein_id gnl|my_center|LOCUS_12950 2338 1274 gene locus_tag LOCUS_12960 gene lptF 2338 1274 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence239 <1 1247 gene locus_tag LOCUS_12970 <1 1247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002118240.1:acyl-CoA dehydrogenase family protein 1506 3050 gene locus_tag LOCUS_12980 gene fadD13 1506 3050 CDS product long-chain-fatty-acid--CoA ligase FadD13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416081.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence240 831 904 gene locus_tag LOCUS_t00240 831 904 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1817 2596 gene locus_tag LOCUS_12990 1817 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence241 397 2403 gene locus_tag LOCUS_13000 397 2403 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence242 1539 556 gene locus_tag LOCUS_13010 1539 556 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707194.1 protein_id gnl|my_center|LOCUS_13010 3505 1544 gene locus_tag LOCUS_13020 3505 1544 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706661.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence243 1250 768 gene locus_tag LOCUS_13030 1250 768 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084400.1 protein_id gnl|my_center|LOCUS_13030 3262 1796 gene locus_tag LOCUS_13040 gene gcvPB 3262 1796 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945875.1 protein_id gnl|my_center|LOCUS_13040 >Feature sequence244 1430 225 gene locus_tag LOCUS_13050 1430 225 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_13050 2957 1434 gene locus_tag LOCUS_13060 gene purF 2957 1434 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091383.1 protein_id gnl|my_center|LOCUS_13060 <3557 2972 gene locus_tag LOCUS_13070 <3557 2972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072963.1:CvpA family protein >Feature sequence245 593 3019 gene locus_tag LOCUS_13080 593 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 >Feature sequence246 374 517 gene locus_tag LOCUS_13090 374 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 514 1587 gene locus_tag LOCUS_13100 gene recF 514 1587 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266123.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence247 3197 522 gene locus_tag LOCUS_13110 gene aceE 3197 522 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114556.1 protein_id gnl|my_center|LOCUS_13110 >Feature sequence248 303 1247 gene locus_tag LOCUS_13120 303 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1484 2359 gene locus_tag LOCUS_13130 1484 2359 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967074.1 protein_id gnl|my_center|LOCUS_13130 2367 2591 gene locus_tag LOCUS_13140 2367 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 3347 2484 gene locus_tag LOCUS_13150 3347 2484 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728081.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence249 2671 1331 gene locus_tag LOCUS_13160 2671 1331 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796577.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence250 1547 1044 gene locus_tag LOCUS_13170 1547 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 2102 1548 gene locus_tag LOCUS_13180 2102 1548 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267160.1 protein_id gnl|my_center|LOCUS_13180 3353 2112 gene locus_tag LOCUS_13190 gene folC 3353 2112 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043123896.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence251 2141 1473 gene locus_tag LOCUS_13200 2141 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence252 733 191 gene locus_tag LOCUS_13210 733 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1971 850 gene locus_tag LOCUS_13220 gene ribBA 1971 850 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707098.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence253 771 2087 gene locus_tag LOCUS_13230 771 2087 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085289.1 protein_id gnl|my_center|LOCUS_13230 2167 2463 gene locus_tag LOCUS_13240 2167 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence254 1291 734 gene locus_tag LOCUS_13250 1291 734 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626366.1 protein_id gnl|my_center|LOCUS_13250 2123 1482 gene locus_tag LOCUS_13260 2123 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 >Feature sequence255 2011 1241 gene locus_tag LOCUS_13270 2011 1241 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence256 772 1245 gene locus_tag LOCUS_13280 gene ybaK 772 1245 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405434.1 protein_id gnl|my_center|LOCUS_13280 1818 2396 gene locus_tag LOCUS_13290 1818 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 <3438 2397 gene locus_tag LOCUS_13300 <3438 2397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086713.1:TRAP transporter permease >Feature sequence257 630 1649 gene locus_tag LOCUS_13310 630 1649 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 protein_id gnl|my_center|LOCUS_13310 3010 1769 gene locus_tag LOCUS_13320 3010 1769 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640554.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence258 1 594 gene locus_tag LOCUS_13330 1 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1378 746 gene locus_tag LOCUS_13340 1378 746 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640531.1 protein_id gnl|my_center|LOCUS_13340 1801 1460 gene locus_tag LOCUS_13350 1801 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265866.1 protein_id gnl|my_center|LOCUS_13350 3265 2018 gene locus_tag LOCUS_13360 gene rhlE 3265 2018 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704814.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence259 1777 1902 gene locus_tag LOCUS_13370 1777 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence260 54 1691 gene locus_tag LOCUS_13380 54 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1827 2231 gene locus_tag LOCUS_13390 1827 2231 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083442.1 protein_id gnl|my_center|LOCUS_13390 3144 2245 gene locus_tag LOCUS_13400 3144 2245 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640156.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence261 287 1099 gene locus_tag LOCUS_13410 gene lpxA 287 1099 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016510.1 protein_id gnl|my_center|LOCUS_13410 1271 1912 gene locus_tag LOCUS_13420 1271 1912 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918133.1 protein_id gnl|my_center|LOCUS_13420 3286 2093 gene locus_tag LOCUS_13430 3286 2093 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286858.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence262 2237 597 gene locus_tag LOCUS_13440 2237 597 CDS product DNA alkylation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027581.1 protein_id gnl|my_center|LOCUS_13440 3049 2372 gene locus_tag LOCUS_13450 3049 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 >Feature sequence263 296 1489 gene locus_tag LOCUS_13460 296 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1521 2729 gene locus_tag LOCUS_13470 1521 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 >Feature sequence264 663 1997 gene locus_tag LOCUS_13480 663 1997 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_13480 2785 1985 gene locus_tag LOCUS_13490 2785 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 3270 2863 gene locus_tag LOCUS_13500 3270 2863 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087706.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence265 2229 823 gene locus_tag LOCUS_13510 2229 823 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088534.1 protein_id gnl|my_center|LOCUS_13510 2427 2561 gene locus_tag LOCUS_13520 2427 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 3284 2805 gene locus_tag LOCUS_13530 3284 2805 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477269.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence266 503 1156 gene locus_tag LOCUS_13540 503 1156 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_13540 1211 2233 gene locus_tag LOCUS_13550 1211 2233 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458995.1 protein_id gnl|my_center|LOCUS_13550 2233 3300 gene locus_tag LOCUS_13560 2233 3300 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707196.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence267 <1 763 gene locus_tag LOCUS_13570 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206559.1:tRNA epoxyqueuosine(34) reductase QueG 1364 819 gene locus_tag LOCUS_13580 gene orn 1364 819 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704162.1 protein_id gnl|my_center|LOCUS_13580 1624 1457 gene locus_tag LOCUS_13590 1624 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1773 2576 gene locus_tag LOCUS_13600 gene asd 1773 2576 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207963.1 protein_id gnl|my_center|LOCUS_13600 <3305 2577 gene locus_tag LOCUS_13610 <3305 2577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005175550.1:elongation factor P--(R)-beta-lysine ligase >Feature sequence268 394 47 gene locus_tag LOCUS_13620 394 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1158 394 gene locus_tag LOCUS_13630 1158 394 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_13630 2269 1355 gene locus_tag LOCUS_13640 2269 1355 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_13640 2981 2403 gene locus_tag LOCUS_13650 2981 2403 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339294.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence269 <1 697 gene locus_tag LOCUS_13660 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113457.1:tRNA (uridine(54)-C5)-methyltransferase TrmA 694 1020 gene locus_tag LOCUS_13670 694 1020 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201313.1 protein_id gnl|my_center|LOCUS_13670 1037 1558 gene locus_tag LOCUS_13680 1037 1558 CDS product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 protein_id gnl|my_center|LOCUS_13680 2477 1623 gene locus_tag LOCUS_13690 2477 1623 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923326.1 protein_id gnl|my_center|LOCUS_13690 3094 2474 gene locus_tag LOCUS_13700 gene dut 3094 2474 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence270 516 947 gene locus_tag LOCUS_13710 516 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 982 2124 gene locus_tag LOCUS_13720 982 2124 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 protein_id gnl|my_center|LOCUS_13720 2188 2673 gene locus_tag LOCUS_13730 2188 2673 CDS product MJ0936 family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870450.1 protein_id gnl|my_center|LOCUS_13730 2670 3263 gene locus_tag LOCUS_13740 2670 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence271 1320 2186 gene locus_tag LOCUS_13750 1320 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 2674 3180 gene locus_tag LOCUS_13760 2674 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence272 1 867 gene locus_tag LOCUS_13770 1 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 867 1730 gene locus_tag LOCUS_13780 867 1730 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_13780 2320 2832 gene locus_tag LOCUS_13790 2320 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence273 1275 355 gene locus_tag LOCUS_13800 1275 355 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_13800 1582 2652 gene locus_tag LOCUS_13810 1582 2652 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895326.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence274 3166 1298 gene locus_tag LOCUS_13820 3166 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence275 435 1514 gene locus_tag LOCUS_13830 435 1514 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920865.1 protein_id gnl|my_center|LOCUS_13830 1535 2143 gene locus_tag LOCUS_13840 1535 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 2242 2982 gene locus_tag LOCUS_13850 2242 2982 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917897.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence276 >Feature sequence277 1892 429 gene locus_tag LOCUS_13860 1892 429 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228965.1 protein_id gnl|my_center|LOCUS_13860 <3238 1883 gene locus_tag LOCUS_13870 <3238 1883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730162.1:fatty acid--CoA ligase family protein >Feature sequence278 412 1590 gene locus_tag LOCUS_13880 412 1590 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878493.1 protein_id gnl|my_center|LOCUS_13880 2352 1729 gene locus_tag LOCUS_13890 2352 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 2876 2382 gene locus_tag LOCUS_13900 2876 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 >Feature sequence279 427 1176 gene locus_tag LOCUS_13910 427 1176 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027763.1 protein_id gnl|my_center|LOCUS_13910 1339 1848 gene locus_tag LOCUS_13920 1339 1848 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707436.1 protein_id gnl|my_center|LOCUS_13920 2183 1845 gene locus_tag LOCUS_13930 2183 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 2234 2310 gene locus_tag LOCUS_t00250 2234 2310 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence280 726 100 gene locus_tag LOCUS_13940 726 100 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564165.1 protein_id gnl|my_center|LOCUS_13940 934 2631 gene locus_tag LOCUS_13950 934 2631 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence281 1710 1264 gene locus_tag LOCUS_13960 1710 1264 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090359.1 protein_id gnl|my_center|LOCUS_13960 >Feature sequence282 1993 689 gene locus_tag LOCUS_13970 1993 689 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_13970 2100 2657 gene locus_tag LOCUS_13980 2100 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 <3227 2667 gene locus_tag LOCUS_13990 <3227 2667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009564165.1:TetR family transcriptional regulator C-terminal domain-containing protein >Feature sequence283 1880 390 gene locus_tag LOCUS_14000 gene rhlB 1880 390 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119269.1 protein_id gnl|my_center|LOCUS_14000 <3218 1994 gene locus_tag LOCUS_14010 <3218 1994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224310.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence284 83 8 gene locus_tag LOCUS_t00260 83 8 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2016 292 gene locus_tag LOCUS_14020 2016 292 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111066.1 protein_id gnl|my_center|LOCUS_14020 <3207 2013 gene locus_tag LOCUS_14030 <3207 2013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023175504.1:amidohydrolase family protein >Feature sequence285 <1 1064 gene locus_tag LOCUS_14040 <1 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256085.1:2-methylfumaryl-CoA isomerase 1217 1876 gene locus_tag LOCUS_14050 1217 1876 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_14050 1889 2317 gene locus_tag LOCUS_14060 1889 2317 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902525.1 protein_id gnl|my_center|LOCUS_14060 >Feature sequence286 2322 844 gene locus_tag LOCUS_14070 2322 844 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878569.1 protein_id gnl|my_center|LOCUS_14070 <3185 2465 gene locus_tag LOCUS_14080 <3185 2465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528042.1:FAD-binding oxidoreductase >Feature sequence287 322 726 gene locus_tag LOCUS_14090 322 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1114 2571 gene locus_tag LOCUS_14100 1114 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919016.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence288 <1 1482 gene locus_tag LOCUS_14110 <1 1482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083814.1:AMP-binding protein 2551 1700 gene locus_tag LOCUS_14120 2551 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence289 2423 1236 gene locus_tag LOCUS_14130 2423 1236 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967232.1 protein_id gnl|my_center|LOCUS_14130 <3176 2499 gene locus_tag LOCUS_14140 <3176 2499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256492.1:amidase >Feature sequence290 1291 611 gene locus_tag LOCUS_14150 1291 611 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966804.1 protein_id gnl|my_center|LOCUS_14150 1671 2870 gene locus_tag LOCUS_14160 1671 2870 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_14160 >Feature sequence291 <1 509 gene locus_tag LOCUS_14170 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073927.1:S9 family peptidase >Feature sequence292 <1 1074 gene locus_tag LOCUS_14180 <1 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090524.1:acyl-CoA dehydrogenase 2757 1258 gene locus_tag LOCUS_14190 2757 1258 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_14190 >Feature sequence293 1 393 gene locus_tag LOCUS_14200 1 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 487 1851 gene locus_tag LOCUS_14210 gene pmpM 487 1851 CDS product proton-coupled multidrug efflux MATE transporter PmpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112388.1 protein_id gnl|my_center|LOCUS_14210 2714 1848 gene locus_tag LOCUS_14220 2714 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence294 <1 1451 gene locus_tag LOCUS_14230 <1 1451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704827.1:acetolactate synthase 3 large subunit 1448 1942 gene locus_tag LOCUS_14240 gene ilvN 1448 1942 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095069.1 protein_id gnl|my_center|LOCUS_14240 2118 2885 gene locus_tag LOCUS_14250 gene pssA 2118 2885 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence295 1720 716 gene locus_tag LOCUS_14260 1720 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 2811 1717 gene locus_tag LOCUS_14270 2811 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence296 <1 1414 gene locus_tag LOCUS_14280 <1 1414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265753.1:amidohydrolase 1411 2670 gene locus_tag LOCUS_14290 1411 2670 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919839.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence297 1117 1962 gene locus_tag LOCUS_14300 1117 1962 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813616.1 protein_id gnl|my_center|LOCUS_14300 2712 2074 gene locus_tag LOCUS_14310 2712 2074 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930283.1 protein_id gnl|my_center|LOCUS_14310 2666 2881 gene locus_tag LOCUS_14320 2666 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence298 2192 18 gene locus_tag LOCUS_14330 2192 18 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_14330 <3118 2546 gene locus_tag LOCUS_14340 <3118 2546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404763.1:S9 family peptidase >Feature sequence299 1024 2034 gene locus_tag LOCUS_14350 1024 2034 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922049.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence300 209 847 gene locus_tag LOCUS_14360 gene hisH 209 847 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937594.1 protein_id gnl|my_center|LOCUS_14360 837 1616 gene locus_tag LOCUS_14370 gene hisF 837 1616 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 protein_id gnl|my_center|LOCUS_14370 1632 1832 gene locus_tag LOCUS_14380 1632 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 2077 3045 gene locus_tag LOCUS_14390 2077 3045 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114796.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence301 316 391 gene locus_tag LOCUS_t00270 316 391 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 440 826 gene locus_tag LOCUS_14400 440 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 842 1429 gene locus_tag LOCUS_14410 gene hisB 842 1429 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_14410 1430 2167 gene locus_tag LOCUS_14420 gene hisA 1430 2167 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246848.1 protein_id gnl|my_center|LOCUS_14420 <3080 2388 gene locus_tag LOCUS_14430 <3080 2388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096067.1:proteolytic complex protein CptA >Feature sequence302 2 802 gene locus_tag LOCUS_14440 2 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 2067 799 gene locus_tag LOCUS_14450 2067 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 2613 2086 gene locus_tag LOCUS_14460 2613 2086 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence303 592 1059 gene locus_tag LOCUS_14470 gene rpsF 592 1059 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308887.1 protein_id gnl|my_center|LOCUS_14470 1063 1290 gene locus_tag LOCUS_14480 gene rpsR 1063 1290 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_14480 1305 2144 gene locus_tag LOCUS_14490 1305 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957858.1 protein_id gnl|my_center|LOCUS_14490 2156 2617 gene locus_tag LOCUS_14500 gene rplI 2156 2617 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317208.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence304 <1 1041 gene locus_tag LOCUS_14510 <1 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232789.1:monooxygenase YjiB 2684 1200 gene locus_tag LOCUS_14520 2684 1200 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence305 1507 503 gene locus_tag LOCUS_14530 1507 503 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_14530 2590 1544 gene locus_tag LOCUS_14540 2590 1544 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020487294.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence306 2 775 gene locus_tag LOCUS_14550 2 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 823 1188 gene locus_tag LOCUS_14560 823 1188 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095857.1 protein_id gnl|my_center|LOCUS_14560 1329 1469 gene locus_tag LOCUS_14570 1329 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1420 2217 gene locus_tag LOCUS_14580 gene ubiE 1420 2217 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103462.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence307 1416 1294 gene locus_tag LOCUS_14590 1416 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 2689 1433 gene locus_tag LOCUS_14600 2689 1433 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719549.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence308 <1 548 gene locus_tag LOCUS_14610 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265494.1:cytochrome P450 554 1603 gene locus_tag LOCUS_14620 554 1603 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813471.1 protein_id gnl|my_center|LOCUS_14620 1743 2345 gene locus_tag LOCUS_14630 1743 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 <3027 2379 gene locus_tag LOCUS_14640 <3027 2379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003098462.1:alpha/beta hydrolase >Feature sequence309 980 453 gene locus_tag LOCUS_14650 980 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 2101 1589 gene locus_tag LOCUS_14660 2101 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence310 216 1481 gene locus_tag LOCUS_14670 216 1481 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105195.1 protein_id gnl|my_center|LOCUS_14670 1478 2125 gene locus_tag LOCUS_14680 gene nadD 1478 2125 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838879.1 protein_id gnl|my_center|LOCUS_14680 2129 2485 gene locus_tag LOCUS_14690 gene rsfS 2129 2485 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037745.1 protein_id gnl|my_center|LOCUS_14690 2475 2942 gene locus_tag LOCUS_14700 gene rlmH 2475 2942 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701620.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence311 <1 1283 gene locus_tag LOCUS_14710 <1 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338014.1:Na+/H+ antiporter NhaC >Feature sequence312 1753 380 gene locus_tag LOCUS_14720 1753 380 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027026.1 protein_id gnl|my_center|LOCUS_14720 1995 2444 gene locus_tag LOCUS_14730 1995 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 2537 2710 gene locus_tag LOCUS_14740 2537 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 2920 2759 gene locus_tag LOCUS_14750 2920 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence313 1123 1323 gene locus_tag LOCUS_14760 1123 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 2527 1346 gene locus_tag LOCUS_14770 2527 1346 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118590.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence314 1009 50 gene locus_tag LOCUS_14780 gene lipA 1009 50 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119196.1 protein_id gnl|my_center|LOCUS_14780 1684 1025 gene locus_tag LOCUS_14790 gene lipB 1684 1025 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313884.1 protein_id gnl|my_center|LOCUS_14790 1950 1687 gene locus_tag LOCUS_14800 1950 1687 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763243.1 protein_id gnl|my_center|LOCUS_14800 <2962 1965 gene locus_tag LOCUS_14810 <2962 1965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093182.1:D-alanyl-D-alanine carboxypeptidase family protein >Feature sequence315 717 1007 gene locus_tag LOCUS_14820 717 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1029 1259 gene locus_tag LOCUS_14830 1029 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1313 2392 gene locus_tag LOCUS_14840 1313 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence316 672 136 gene locus_tag LOCUS_14850 672 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 1128 673 gene locus_tag LOCUS_14860 gene xcpT 1128 673 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_14860 2506 1286 gene locus_tag LOCUS_14870 gene xcpS 2506 1286 CDS product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence317 1713 1525 gene locus_tag LOCUS_14880 1713 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 2737 1883 gene locus_tag LOCUS_14890 2737 1883 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327314.1 protein_id gnl|my_center|LOCUS_14890 >Feature sequence318 331 1233 gene locus_tag LOCUS_14900 331 1233 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727159.1 protein_id gnl|my_center|LOCUS_14900 1394 2494 gene locus_tag LOCUS_14910 1394 2494 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence319 <1 2861 gene locus_tag LOCUS_14920 <1 2861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929325.1:tetratricopeptide repeat protein >Feature sequence320 2027 945 gene locus_tag LOCUS_14930 2027 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 <2938 2233 gene locus_tag LOCUS_14940 <2938 2233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267273.1:NADP-dependent oxidoreductase >Feature sequence321 904 35 gene locus_tag LOCUS_14950 904 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1538 1077 gene locus_tag LOCUS_14960 1538 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 2068 1571 gene locus_tag LOCUS_14970 2068 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 2899 2069 gene locus_tag LOCUS_14980 2899 2069 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003105.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence322 1268 312 gene locus_tag LOCUS_14990 1268 312 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114230.1 protein_id gnl|my_center|LOCUS_14990 2297 1338 gene locus_tag LOCUS_15000 2297 1338 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087749.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence323 1554 742 gene locus_tag LOCUS_15010 1554 742 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409413.1 protein_id gnl|my_center|LOCUS_15010 <2902 1723 gene locus_tag LOCUS_15020 <2902 1723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919912.1:acyl-CoA dehydrogenase family protein >Feature sequence324 880 83 gene locus_tag LOCUS_15030 880 83 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_15030 2028 877 gene locus_tag LOCUS_15040 2028 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 2121 2534 gene locus_tag LOCUS_15050 2121 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence325 509 1645 gene locus_tag LOCUS_15060 509 1645 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088879.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence326 102 449 gene locus_tag LOCUS_15070 102 449 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707590.1 protein_id gnl|my_center|LOCUS_15070 459 1031 gene locus_tag LOCUS_15080 459 1031 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418801.1 protein_id gnl|my_center|LOCUS_15080 1035 1622 gene locus_tag LOCUS_15090 1035 1622 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766550.1 protein_id gnl|my_center|LOCUS_15090 1989 1615 gene locus_tag LOCUS_15100 1989 1615 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377610.1 protein_id gnl|my_center|LOCUS_15100 2653 2006 gene locus_tag LOCUS_15110 2653 2006 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406040.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence327 1974 1489 gene locus_tag LOCUS_15120 1974 1489 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863309.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence328 >Feature sequence329 <1 883 gene locus_tag LOCUS_15130 <1 883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084309.1:TauD/TfdA family dioxygenase 1458 949 gene locus_tag LOCUS_15140 1458 949 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920716.1 protein_id gnl|my_center|LOCUS_15140 1942 2694 gene locus_tag LOCUS_15150 1942 2694 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312247.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence330 <1 870 gene locus_tag LOCUS_15160 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071057.1:FMN-binding glutamate synthase family protein 1142 867 gene locus_tag LOCUS_15170 1142 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 1343 2164 gene locus_tag LOCUS_15180 1343 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 <2871 2223 gene locus_tag LOCUS_15190 <2871 2223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967075.1:S8 family serine peptidase >Feature sequence331 82 924 gene locus_tag LOCUS_15200 82 924 CDS product 2OG-Fe(II) oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262215.1 protein_id gnl|my_center|LOCUS_15200 2283 1096 gene locus_tag LOCUS_15210 2283 1096 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037833.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence332 1534 515 gene locus_tag LOCUS_15220 gene prfA 1534 515 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019960.1 protein_id gnl|my_center|LOCUS_15220 <2868 1636 gene locus_tag LOCUS_15230 <2868 1636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095001.1:glutamyl-tRNA reductase >Feature sequence333 337 1299 gene locus_tag LOCUS_15240 gene fmt 337 1299 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768186.1 protein_id gnl|my_center|LOCUS_15240 1296 2594 gene locus_tag LOCUS_15250 gene rsmB 1296 2594 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266131.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence334 1704 598 gene locus_tag LOCUS_15260 1704 598 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920254.1 protein_id gnl|my_center|LOCUS_15260 <2866 1847 gene locus_tag LOCUS_15270 <2866 1847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943389.1:glycerol-3-phosphate dehydrogenase/oxidase >Feature sequence335 1079 216 gene locus_tag LOCUS_15280 1079 216 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112994.1 protein_id gnl|my_center|LOCUS_15280 1862 1461 gene locus_tag LOCUS_15290 1862 1461 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809511.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence336 2360 840 gene locus_tag LOCUS_15300 2360 840 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066658.1 protein_id gnl|my_center|LOCUS_15300 2772 2599 gene locus_tag LOCUS_15310 2772 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence337 <1 739 gene locus_tag LOCUS_15320 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965832.1:alkyl sulfatase dimerization domain-containing protein 763 891 gene locus_tag LOCUS_15330 763 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1855 926 gene locus_tag LOCUS_15340 1855 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 2285 1869 gene locus_tag LOCUS_15350 2285 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 >Feature sequence338 460 1515 gene locus_tag LOCUS_15360 460 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence339 <1 657 gene locus_tag LOCUS_15370 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809053.1:HlyD family type I secretion periplasmic adaptor subunit 657 1274 gene locus_tag LOCUS_15380 657 1274 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809051.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence340 1306 2301 gene locus_tag LOCUS_15390 1306 2301 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262762.1 protein_id gnl|my_center|LOCUS_15390 2789 2337 gene locus_tag LOCUS_15400 2789 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence341 61 1734 gene locus_tag LOCUS_15410 gene recD 61 1734 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932748.1 protein_id gnl|my_center|LOCUS_15410 1731 2591 gene locus_tag LOCUS_15420 1731 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence342 567 1499 gene locus_tag LOCUS_15430 gene rluD 567 1499 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417821.1 protein_id gnl|my_center|LOCUS_15430 1496 2218 gene locus_tag LOCUS_15440 gene pgeF 1496 2218 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602844.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence343 402 1637 gene locus_tag LOCUS_15450 402 1637 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089117.1 protein_id gnl|my_center|LOCUS_15450 2599 1760 gene locus_tag LOCUS_15460 2599 1760 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948031.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence344 <1 743 gene locus_tag LOCUS_15470 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728413.1:alpha/beta hydrolase 980 1819 gene locus_tag LOCUS_15480 980 1819 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_15480 2631 2023 gene locus_tag LOCUS_15490 2631 2023 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064232.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence345 407 1237 gene locus_tag LOCUS_15500 gene galU 407 1237 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467169.1 protein_id gnl|my_center|LOCUS_15500 2135 1257 gene locus_tag LOCUS_15510 2135 1257 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839117.1 protein_id gnl|my_center|LOCUS_15510 2487 2224 gene locus_tag LOCUS_15520 2487 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence346 1108 2550 gene locus_tag LOCUS_15530 1108 2550 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence347 <1 1528 gene locus_tag LOCUS_15540 <1 1528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940770.1:ABC transporter ATP-binding protein >Feature sequence348 989 132 gene locus_tag LOCUS_15550 989 132 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548604.1 protein_id gnl|my_center|LOCUS_15550 2165 993 gene locus_tag LOCUS_15560 2165 993 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 protein_id gnl|my_center|LOCUS_15560 <2781 2202 gene locus_tag LOCUS_15570 <2781 2202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337380.1:gamma-glutamylcyclotransferase >Feature sequence349 1 1038 gene locus_tag LOCUS_15580 1 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence350 <1 829 gene locus_tag LOCUS_15590 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003106427.1:FtsH protease activity modulator HflK 849 1721 gene locus_tag LOCUS_15600 gene hflC 849 1721 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366315.1 protein_id gnl|my_center|LOCUS_15600 1775 1966 gene locus_tag LOCUS_15610 1775 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence351 <1 1168 gene locus_tag LOCUS_15620 <1 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003083059.1:flagellar biosynthesis protein FlhA >Feature sequence352 1989 571 gene locus_tag LOCUS_15630 1989 571 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence353 1024 422 gene locus_tag LOCUS_15640 1024 422 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113746.1 protein_id gnl|my_center|LOCUS_15640 1186 1950 gene locus_tag LOCUS_15650 1186 1950 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804205.1 protein_id gnl|my_center|LOCUS_15650 1992 2447 gene locus_tag LOCUS_15660 1992 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence354 2375 810 gene locus_tag LOCUS_15670 gene murJ 2375 810 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001911253.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence355 1361 672 gene locus_tag LOCUS_15680 gene cmk 1361 672 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106707.1 protein_id gnl|my_center|LOCUS_15680 2343 1468 gene locus_tag LOCUS_15690 2343 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence356 1318 2655 gene locus_tag LOCUS_15700 gene pabB 1318 2655 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314634.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence357 971 1468 gene locus_tag LOCUS_15710 971 1468 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085194.1 protein_id gnl|my_center|LOCUS_15710 <2752 1478 gene locus_tag LOCUS_15720 <2752 1478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037392671.1:aromatic ring-hydroxylating dioxygenase subunit alpha >Feature sequence358 <1 930 gene locus_tag LOCUS_15730 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000445244.1:3-phosphoshikimate 1-carboxyvinyltransferase 1947 970 gene locus_tag LOCUS_15740 1947 970 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence359 2052 820 gene locus_tag LOCUS_15750 2052 820 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920352.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence360 <1 1012 gene locus_tag LOCUS_15760 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112397.1:bifunctional isocitrate dehydrogenase kinase/phosphatase 1012 1656 gene locus_tag LOCUS_15770 1012 1656 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070937794.1 protein_id gnl|my_center|LOCUS_15770 1653 2408 gene locus_tag LOCUS_15780 1653 2408 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229011.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence361 303 902 gene locus_tag LOCUS_15790 303 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15790 <2735 935 gene locus_tag LOCUS_15800 <2735 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001271572.1:polyphosphate kinase 1 >Feature sequence362 1790 1131 gene locus_tag LOCUS_15810 1790 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence363 <1 771 gene locus_tag LOCUS_15820 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115030.1:cytochrome c oxidase subunit 3 1289 1074 gene locus_tag LOCUS_15830 1289 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1373 2146 gene locus_tag LOCUS_15840 1373 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119510.1 protein_id gnl|my_center|LOCUS_15840 2118 2690 gene locus_tag LOCUS_15850 2118 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence364 2309 480 gene locus_tag LOCUS_15860 gene sppA 2309 480 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097047.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence365 1237 416 gene locus_tag LOCUS_15870 1237 416 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 protein_id gnl|my_center|LOCUS_15870 1550 2650 gene locus_tag LOCUS_15880 1550 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence366 2276 177 gene locus_tag LOCUS_15890 2276 177 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640693.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence367 1435 755 gene locus_tag LOCUS_15900 1435 755 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966058.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence368 784 83 gene locus_tag LOCUS_15910 784 83 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986243.1 protein_id gnl|my_center|LOCUS_15910 1313 2464 gene locus_tag LOCUS_15920 1313 2464 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731135.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence369 619 703 gene locus_tag LOCUS_t00280 619 703 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 780 2171 gene locus_tag LOCUS_15930 gene tig 780 2171 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087920.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence370 1106 414 gene locus_tag LOCUS_15940 1106 414 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_15940 2390 1173 gene locus_tag LOCUS_15950 gene fabB 2390 1173 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence371 3 1022 gene locus_tag LOCUS_15960 3 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 1159 1698 gene locus_tag LOCUS_15970 gene pgsA 1159 1698 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_15970 2000 1695 gene locus_tag LOCUS_15980 2000 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 2575 1997 gene locus_tag LOCUS_15990 2575 1997 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence372 <1 704 gene locus_tag LOCUS_16000 <1 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943409.1:efflux RND transporter permease subunit 787 862 gene locus_tag LOCUS_t00290 787 862 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1182 952 gene locus_tag LOCUS_16010 1182 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1440 1189 gene locus_tag LOCUS_16020 1440 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1773 2084 gene locus_tag LOCUS_16030 1773 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence373 2561 2076 gene locus_tag LOCUS_16040 2561 2076 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence374 <1 1092 gene locus_tag LOCUS_16050 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102294.1:selenocysteine-specific translation elongation factor 1233 2291 gene locus_tag LOCUS_16060 1233 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence375 1157 528 gene locus_tag LOCUS_16070 1157 528 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098558.1 protein_id gnl|my_center|LOCUS_16070 2121 1180 gene locus_tag LOCUS_16080 gene truD 2121 1180 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036881.1 protein_id gnl|my_center|LOCUS_16080 2594 2118 gene locus_tag LOCUS_16090 gene ispF 2594 2118 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115651.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence376 >Feature sequence377 >Feature sequence378 614 462 gene locus_tag LOCUS_16100 614 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 888 619 gene locus_tag LOCUS_16110 888 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 968 1663 gene locus_tag LOCUS_16120 968 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 2446 1733 gene locus_tag LOCUS_16130 2446 1733 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419060.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence379 479 727 gene locus_tag LOCUS_16140 479 727 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419207.1 protein_id gnl|my_center|LOCUS_16140 803 1642 gene locus_tag LOCUS_16150 803 1642 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_16150 1639 2616 gene locus_tag LOCUS_16160 1639 2616 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583317.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence380 579 292 gene locus_tag LOCUS_16170 579 292 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003650103.1 protein_id gnl|my_center|LOCUS_16170 763 1125 gene locus_tag LOCUS_16180 763 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 2422 1049 gene locus_tag LOCUS_16190 2422 1049 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence381 53 640 gene locus_tag LOCUS_16200 53 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 711 1796 gene locus_tag LOCUS_16210 711 1796 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_16210 1808 2527 gene locus_tag LOCUS_16220 1808 2527 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence382 <2618 1603 gene locus_tag LOCUS_16230 <2618 1603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256388.1:nucleoside hydrolase >Feature sequence383 937 1674 gene locus_tag LOCUS_16240 937 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1693 2046 gene locus_tag LOCUS_16250 1693 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 <2618 2085 gene locus_tag LOCUS_16260 <2618 2085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867337.1:MFS transporter >Feature sequence384 1384 206 gene locus_tag LOCUS_16270 1384 206 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_16270 1487 2533 gene locus_tag LOCUS_16280 gene oruR 1487 2533 CDS product ornithine utilization transcriptional regulator OruR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114220.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence385 >Feature sequence386 359 478 gene locus_tag LOCUS_16290 359 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence387 658 188 gene locus_tag LOCUS_16300 gene moaE 658 188 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490611.1 protein_id gnl|my_center|LOCUS_16300 914 660 gene locus_tag LOCUS_16310 gene moaD 914 660 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193789.1 protein_id gnl|my_center|LOCUS_16310 1393 911 gene locus_tag LOCUS_16320 gene moaC 1393 911 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986478.1 protein_id gnl|my_center|LOCUS_16320 1433 1876 gene locus_tag LOCUS_16330 1433 1876 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence388 <1 1636 gene locus_tag LOCUS_16340 <1 1636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640166.1:sulfatase-like hydrolase/transferase 1650 2354 gene locus_tag LOCUS_16350 1650 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence389 <1 623 gene locus_tag LOCUS_16360 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948060.1:radical SAM family heme chaperone HemW 1282 620 gene locus_tag LOCUS_16370 gene trmB 1282 620 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411920.1 protein_id gnl|my_center|LOCUS_16370 1682 1299 gene locus_tag LOCUS_16380 1682 1299 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261343.1 protein_id gnl|my_center|LOCUS_16380 2542 1679 gene locus_tag LOCUS_16390 gene rpoH 2542 1679 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084510.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence390 1107 580 gene locus_tag LOCUS_16400 1107 580 CDS product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104708.1 protein_id gnl|my_center|LOCUS_16400 2058 1117 gene locus_tag LOCUS_16410 2058 1117 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376303.1 protein_id gnl|my_center|LOCUS_16410 <2593 2066 gene locus_tag LOCUS_16420 <2593 2066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969434.1:AAA family ATPase >Feature sequence391 <1 2026 gene locus_tag LOCUS_16430 <1 2026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104597.1:transglycosylase SLT domain-containing protein >Feature sequence392 281 925 gene locus_tag LOCUS_16440 281 925 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479800.1 protein_id gnl|my_center|LOCUS_16440 2531 915 gene locus_tag LOCUS_16450 2531 915 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064742.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence393 <1 564 gene locus_tag LOCUS_16460 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003400979.1:SDR family oxidoreductase <2586 571 gene locus_tag LOCUS_16470 <2586 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204428.1:acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha >Feature sequence394 313 900 gene locus_tag LOCUS_16480 gene rpoE 313 900 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_16480 1415 2005 gene locus_tag LOCUS_16490 1415 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 >Feature sequence395 <1 814 gene locus_tag LOCUS_16500 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532911.1:aminomethyltransferase family protein 896 2170 gene locus_tag LOCUS_16510 896 2170 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528000.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence396 1 1413 gene locus_tag LOCUS_16520 gene oadA 1 1413 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_16520 1416 2555 gene locus_tag LOCUS_16530 1416 2555 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence397 1757 267 gene locus_tag LOCUS_16540 gene amiB 1757 267 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_16540 2486 2010 gene locus_tag LOCUS_16550 gene tsaE 2486 2010 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457080.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence398 >Feature sequence399 804 46 gene locus_tag LOCUS_16560 gene metF 804 46 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_16560 2040 886 gene locus_tag LOCUS_16570 gene metK 2040 886 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706910.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence400 1644 259 gene locus_tag LOCUS_16580 gene hemL 1644 259 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496557.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence401 257 2215 gene locus_tag LOCUS_16590 257 2215 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence402 >Feature sequence403 1092 250 gene locus_tag LOCUS_16600 1092 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 2108 1089 gene locus_tag LOCUS_16610 2108 1089 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223398.1 protein_id gnl|my_center|LOCUS_16610 2469 2119 gene locus_tag LOCUS_16620 2469 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence404 2210 1062 gene locus_tag LOCUS_16630 2210 1062 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence405 609 76 gene locus_tag LOCUS_16640 gene rimM 609 76 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071567.1 protein_id gnl|my_center|LOCUS_16640 901 626 gene locus_tag LOCUS_16650 gene rpsP 901 626 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092643.1 protein_id gnl|my_center|LOCUS_16650 <2526 1227 gene locus_tag LOCUS_16660 <2526 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004406399.1:signal recognition particle protein >Feature sequence406 1367 822 gene locus_tag LOCUS_16670 1367 822 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937593.1 protein_id gnl|my_center|LOCUS_16670 2155 1454 gene locus_tag LOCUS_16680 2155 1454 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125332.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence407 2002 1322 gene locus_tag LOCUS_16690 2002 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 2516 2220 gene locus_tag LOCUS_16700 2516 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence408 >Feature sequence409 1163 1972 gene locus_tag LOCUS_16710 1163 1972 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404449.1 protein_id gnl|my_center|LOCUS_16710 1962 2414 gene locus_tag LOCUS_16720 gene rnhA 1962 2414 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence410 890 243 gene locus_tag LOCUS_16730 890 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1612 1055 gene locus_tag LOCUS_16740 1612 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 <2512 1640 gene locus_tag LOCUS_16750 <2512 1640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728663.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence411 1660 587 gene locus_tag LOCUS_16760 1660 587 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919059.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence412 <1 1425 gene locus_tag LOCUS_16770 <1 1425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102062.1:DNA topoisomerase IV subunit B >Feature sequence413 2041 1013 gene locus_tag LOCUS_16780 2041 1013 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919916.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence414 <2503 494 gene locus_tag LOCUS_16790 <2503 494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918879.1:TonB-dependent receptor