>Feature sequence001 750 298 gene locus_tag LOCUS_00010 750 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1695 829 gene locus_tag LOCUS_00020 gene xerD 1695 829 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_00020 3860 1731 gene locus_tag LOCUS_00030 3860 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4740 3997 gene locus_tag LOCUS_00040 4740 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6400 4835 gene locus_tag LOCUS_00050 6400 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6672 6747 gene locus_tag LOCUS_t00010 6672 6747 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8087 6831 gene locus_tag LOCUS_00060 8087 6831 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_00060 8579 8109 gene locus_tag LOCUS_00070 8579 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8755 8994 gene locus_tag LOCUS_00080 8755 8994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9538 8984 gene locus_tag LOCUS_00090 9538 8984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9737 9904 gene locus_tag LOCUS_00100 9737 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9905 10189 gene locus_tag LOCUS_00110 9905 10189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10199 10576 gene locus_tag LOCUS_00120 10199 10576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10591 11463 gene locus_tag LOCUS_00130 10591 11463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11471 12259 gene locus_tag LOCUS_00140 11471 12259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 12261 12821 gene locus_tag LOCUS_00150 12261 12821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 12823 13059 gene locus_tag LOCUS_00160 12823 13059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 13059 13541 gene locus_tag LOCUS_00170 13059 13541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 13550 13825 gene locus_tag LOCUS_00180 13550 13825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 13809 14594 gene locus_tag LOCUS_00190 13809 14594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 14578 14877 gene locus_tag LOCUS_00200 14578 14877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 14879 15175 gene locus_tag LOCUS_00210 14879 15175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 15259 16146 gene locus_tag LOCUS_00220 15259 16146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 16163 16678 gene locus_tag LOCUS_00230 16163 16678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 16668 17219 gene locus_tag LOCUS_00240 16668 17219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 17234 17536 gene locus_tag LOCUS_00250 17234 17536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 17533 18639 gene locus_tag LOCUS_00260 17533 18639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 19213 19689 gene locus_tag LOCUS_00270 19213 19689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 19662 20369 gene locus_tag LOCUS_00280 19662 20369 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217650.1 protein_id gnl|my_center|LOCUS_00280 20428 21222 gene locus_tag LOCUS_00290 20428 21222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 21274 21828 gene locus_tag LOCUS_00300 21274 21828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 21828 23774 gene locus_tag LOCUS_00310 21828 23774 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272394.1 protein_id gnl|my_center|LOCUS_00310 23774 24022 gene locus_tag LOCUS_00320 23774 24022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 24023 25621 gene locus_tag LOCUS_00330 24023 25621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 25648 26112 gene locus_tag LOCUS_00340 25648 26112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 26116 26763 gene locus_tag LOCUS_00350 26116 26763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 26812 27207 gene locus_tag LOCUS_00360 26812 27207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 27396 27821 gene locus_tag LOCUS_00370 27396 27821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 27841 28905 gene locus_tag LOCUS_00380 27841 28905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 28905 29279 gene locus_tag LOCUS_00390 28905 29279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 29283 29966 gene locus_tag LOCUS_00400 29283 29966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 29971 31497 gene locus_tag LOCUS_00410 29971 31497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 31506 31883 gene locus_tag LOCUS_00420 31506 31883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 31897 32337 gene locus_tag LOCUS_00430 31897 32337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 32912 32469 gene locus_tag LOCUS_00440 32912 32469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 32942 34768 gene locus_tag LOCUS_00450 32942 34768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 34770 36074 gene locus_tag LOCUS_00460 34770 36074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 36262 37419 gene locus_tag LOCUS_00470 36262 37419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 37410 37856 gene locus_tag LOCUS_00480 37410 37856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 37856 38263 gene locus_tag LOCUS_00490 37856 38263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 38247 39455 gene locus_tag LOCUS_00500 38247 39455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 39455 40207 gene locus_tag LOCUS_00510 39455 40207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 40217 41065 gene locus_tag LOCUS_00520 40217 41065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 41078 41785 gene locus_tag LOCUS_00530 41078 41785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 41794 42186 gene locus_tag LOCUS_00540 41794 42186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 42196 42708 gene locus_tag LOCUS_00550 42196 42708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 42824 42970 gene locus_tag LOCUS_00560 42824 42970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 >Feature sequence002 1360 770 gene locus_tag LOCUS_00570 gene hisH 1360 770 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_00570 2597 1353 gene locus_tag LOCUS_00580 2597 1353 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_00580 3411 2617 gene locus_tag LOCUS_00590 gene folE2 3411 2617 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_00590 3745 3404 gene locus_tag LOCUS_00600 3745 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 4375 3755 gene locus_tag LOCUS_00610 gene tmk 4375 3755 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_00610 5642 4377 gene locus_tag LOCUS_00620 gene serS 5642 4377 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_00620 5736 6683 gene locus_tag LOCUS_00630 gene fmt 5736 6683 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_00630 6676 7506 gene locus_tag LOCUS_00640 6676 7506 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023463.1 protein_id gnl|my_center|LOCUS_00640 7959 7552 gene locus_tag LOCUS_00650 7959 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 8506 8003 gene locus_tag LOCUS_00660 gene ilvN 8506 8003 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_00660 10245 8509 gene locus_tag LOCUS_00670 gene ilvB 10245 8509 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545836.1 protein_id gnl|my_center|LOCUS_00670 10466 11464 gene locus_tag LOCUS_00680 gene ilvC 10466 11464 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081338.1 protein_id gnl|my_center|LOCUS_00680 12717 11533 gene locus_tag LOCUS_00690 12717 11533 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584117.1 protein_id gnl|my_center|LOCUS_00690 12900 12760 gene locus_tag LOCUS_00700 12900 12760 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_00700 13353 12964 gene locus_tag LOCUS_00710 13353 12964 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_00710 14044 13469 gene locus_tag LOCUS_00720 14044 13469 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938120.1 protein_id gnl|my_center|LOCUS_00720 14185 14958 gene locus_tag LOCUS_00730 14185 14958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 15019 15564 gene locus_tag LOCUS_00740 gene rfbC 15019 15564 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_00740 15566 16546 gene locus_tag LOCUS_00750 gene rfbB 15566 16546 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989656.1 protein_id gnl|my_center|LOCUS_00750 16548 17369 gene locus_tag LOCUS_00760 gene rfbD 16548 17369 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_00760 17366 18235 gene locus_tag LOCUS_00770 gene rfbA 17366 18235 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904719.1 protein_id gnl|my_center|LOCUS_00770 18780 18232 gene locus_tag LOCUS_00780 18780 18232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 18908 19156 gene locus_tag LOCUS_00790 18908 19156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 19486 19214 gene locus_tag LOCUS_00800 19486 19214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 20536 19688 gene locus_tag LOCUS_00810 gene folD 20536 19688 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545120.1 protein_id gnl|my_center|LOCUS_00810 21291 20533 gene locus_tag LOCUS_00820 21291 20533 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870334.1 protein_id gnl|my_center|LOCUS_00820 21514 22446 gene locus_tag LOCUS_00830 21514 22446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 24370 22706 gene locus_tag LOCUS_00840 gene ilvD 24370 22706 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546643.1 protein_id gnl|my_center|LOCUS_00840 25105 24440 gene locus_tag LOCUS_00850 25105 24440 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024082.1 protein_id gnl|my_center|LOCUS_00850 26132 25095 gene locus_tag LOCUS_00860 gene cbpA 26132 25095 CDS product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269037.1 protein_id gnl|my_center|LOCUS_00860 26266 27513 gene locus_tag LOCUS_00870 26266 27513 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965562.1 protein_id gnl|my_center|LOCUS_00870 27516 28571 gene locus_tag LOCUS_00880 27516 28571 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378318.1 protein_id gnl|my_center|LOCUS_00880 28571 29155 gene locus_tag LOCUS_00890 gene def 28571 29155 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965029.1 protein_id gnl|my_center|LOCUS_00890 29152 30093 gene locus_tag LOCUS_00900 gene fmt 29152 30093 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388615.1 protein_id gnl|my_center|LOCUS_00900 30095 30460 gene locus_tag LOCUS_00910 gene aroH 30095 30460 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460212.1 protein_id gnl|my_center|LOCUS_00910 30464 31618 gene locus_tag LOCUS_00920 30464 31618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 31615 31881 gene locus_tag LOCUS_00930 31615 31881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 31929 34577 gene locus_tag LOCUS_00940 gene infB 31929 34577 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541506.1 protein_id gnl|my_center|LOCUS_00940 34589 34939 gene locus_tag LOCUS_00950 gene rbfA 34589 34939 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 protein_id gnl|my_center|LOCUS_00950 34945 35802 gene locus_tag LOCUS_00960 gene truB 34945 35802 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_00960 35799 36650 gene locus_tag LOCUS_00970 35799 36650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 36652 37290 gene locus_tag LOCUS_00980 36652 37290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 37366 37596 gene locus_tag LOCUS_00990 37366 37596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 37656 39026 gene locus_tag LOCUS_01000 37656 39026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 38971 40830 gene locus_tag LOCUS_01010 38971 40830 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108288.1 protein_id gnl|my_center|LOCUS_01010 41411 40827 gene locus_tag LOCUS_01020 41411 40827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 >Feature sequence003 56 1039 gene locus_tag LOCUS_01030 56 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 1105 1881 gene locus_tag LOCUS_01040 gene tpiA 1105 1881 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700616.1 protein_id gnl|my_center|LOCUS_01040 3031 1955 gene locus_tag LOCUS_01050 3031 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 3332 3718 gene locus_tag LOCUS_01060 3332 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 3772 4530 gene locus_tag LOCUS_01070 gene pyrF 3772 4530 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942107.1 protein_id gnl|my_center|LOCUS_01070 4530 5651 gene locus_tag LOCUS_01080 gene ald 4530 5651 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459459.1 protein_id gnl|my_center|LOCUS_01080 6720 5638 gene locus_tag LOCUS_01090 6720 5638 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978063.1 protein_id gnl|my_center|LOCUS_01090 6862 7116 gene locus_tag LOCUS_01100 6862 7116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 7217 7789 gene locus_tag LOCUS_01110 7217 7789 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428485.1 protein_id gnl|my_center|LOCUS_01110 7834 8361 gene locus_tag LOCUS_01120 7834 8361 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058171.1 protein_id gnl|my_center|LOCUS_01120 8379 9452 gene locus_tag LOCUS_01130 gene flhB 8379 9452 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_01130 9478 10137 gene locus_tag LOCUS_01140 9478 10137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 11818 10151 gene locus_tag LOCUS_01150 11818 10151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 12006 12464 gene locus_tag LOCUS_01160 12006 12464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 12468 14306 gene locus_tag LOCUS_01170 12468 14306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 14357 15148 gene locus_tag LOCUS_01180 14357 15148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 15213 16310 gene locus_tag LOCUS_01190 gene ychF 15213 16310 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143223.1 protein_id gnl|my_center|LOCUS_01190 16547 17251 gene locus_tag LOCUS_01200 16547 17251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 17241 18773 gene locus_tag LOCUS_01210 17241 18773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 18783 19277 gene locus_tag LOCUS_01220 18783 19277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 19960 19271 gene locus_tag LOCUS_01230 19960 19271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 20047 20400 gene locus_tag LOCUS_01240 20047 20400 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392492.1 protein_id gnl|my_center|LOCUS_01240 20400 20954 gene locus_tag LOCUS_01250 20400 20954 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109092.1 protein_id gnl|my_center|LOCUS_01250 20958 21419 gene locus_tag LOCUS_01260 20958 21419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 21478 22518 gene locus_tag LOCUS_01270 gene nuoD 21478 22518 CDS product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 protein_id gnl|my_center|LOCUS_01270 22518 23603 gene locus_tag LOCUS_01280 gene nuoH 22518 23603 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886375.1 protein_id gnl|my_center|LOCUS_01280 23600 23965 gene locus_tag LOCUS_01290 23600 23965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 23965 24501 gene locus_tag LOCUS_01300 23965 24501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 24501 24815 gene locus_tag LOCUS_01310 gene nuoK 24501 24815 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886372.1 protein_id gnl|my_center|LOCUS_01310 24815 26641 gene locus_tag LOCUS_01320 gene nuoL 24815 26641 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568230.1 protein_id gnl|my_center|LOCUS_01320 26643 28148 gene locus_tag LOCUS_01330 26643 28148 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886373.1 protein_id gnl|my_center|LOCUS_01330 28317 28177 gene locus_tag LOCUS_01340 28317 28177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 28854 28600 gene locus_tag LOCUS_01350 28854 28600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 29147 29584 gene locus_tag LOCUS_01360 29147 29584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 29930 29628 gene locus_tag LOCUS_01370 29930 29628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 31044 29989 gene locus_tag LOCUS_01380 gene ispG 31044 29989 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_01380 31100 31852 gene locus_tag LOCUS_01390 31100 31852 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_01390 31947 34808 gene locus_tag LOCUS_01400 31947 34808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 34876 34948 gene locus_tag LOCUS_t00020 34876 34948 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence004 237 494 gene locus_tag LOCUS_01410 237 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01410 653 2059 gene locus_tag LOCUS_01420 gene atpD 653 2059 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142564.1 protein_id gnl|my_center|LOCUS_01420 2068 2475 gene locus_tag LOCUS_01430 2068 2475 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641444.1 protein_id gnl|my_center|LOCUS_01430 3062 2478 gene locus_tag LOCUS_01440 3062 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 3177 4028 gene locus_tag LOCUS_01450 3177 4028 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459554.1 protein_id gnl|my_center|LOCUS_01450 4100 5878 gene locus_tag LOCUS_01460 gene aspS 4100 5878 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830852.1 protein_id gnl|my_center|LOCUS_01460 5966 7378 gene locus_tag LOCUS_01470 gene dnaA 5966 7378 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_01470 7793 7425 gene locus_tag LOCUS_01480 7793 7425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 8430 7891 gene locus_tag LOCUS_01490 8430 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 8585 9973 gene locus_tag LOCUS_01500 8585 9973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 10047 10598 gene locus_tag LOCUS_01510 gene gmk 10047 10598 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_01510 11148 10603 gene locus_tag LOCUS_01520 11148 10603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 11340 12524 gene locus_tag LOCUS_01530 gene coaBC 11340 12524 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475839.1 protein_id gnl|my_center|LOCUS_01530 12508 13242 gene locus_tag LOCUS_01540 12508 13242 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_01540 13242 13772 gene locus_tag LOCUS_01550 13242 13772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 13772 14302 gene locus_tag LOCUS_01560 gene rsmD 13772 14302 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263796.1 protein_id gnl|my_center|LOCUS_01560 14984 14691 gene locus_tag LOCUS_01570 14984 14691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 15296 15604 gene locus_tag LOCUS_01580 15296 15604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 15673 16284 gene locus_tag LOCUS_01590 15673 16284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 16561 16331 gene locus_tag LOCUS_01600 16561 16331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 17150 17761 gene locus_tag LOCUS_01610 17150 17761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 17937 18530 gene locus_tag LOCUS_01620 17937 18530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 20133 18673 gene locus_tag LOCUS_01630 gene gatB 20133 18673 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058226.1 protein_id gnl|my_center|LOCUS_01630 20261 21394 gene locus_tag LOCUS_01640 20261 21394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 21396 22031 gene locus_tag LOCUS_01650 21396 22031 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_01650 23308 22043 gene locus_tag LOCUS_01660 gene obgE 23308 22043 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_01660 23837 23430 gene locus_tag LOCUS_01670 23837 23430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 23953 25197 gene locus_tag LOCUS_01680 23953 25197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 25396 25983 gene locus_tag LOCUS_01690 25396 25983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 26493 26002 gene locus_tag LOCUS_01700 26493 26002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 27111 26623 gene locus_tag LOCUS_01710 27111 26623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 27314 28612 gene locus_tag LOCUS_01720 gene tig 27314 28612 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_01720 28640 29248 gene locus_tag LOCUS_01730 gene clpP 28640 29248 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056360.1 protein_id gnl|my_center|LOCUS_01730 29252 30601 gene locus_tag LOCUS_01740 gene clpX 29252 30601 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144180.1 protein_id gnl|my_center|LOCUS_01740 30681 31259 gene locus_tag LOCUS_01750 30681 31259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 31314 33116 gene locus_tag LOCUS_01760 gene lepA 31314 33116 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056160.1 protein_id gnl|my_center|LOCUS_01760 >Feature sequence005 659 249 gene locus_tag LOCUS_01770 659 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 1068 676 gene locus_tag LOCUS_01780 gene rsfS 1068 676 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172029.1 protein_id gnl|my_center|LOCUS_01780 2110 1130 gene locus_tag LOCUS_01790 gene rpoD 2110 1130 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226225.1 protein_id gnl|my_center|LOCUS_01790 2882 2133 gene locus_tag LOCUS_01800 gene rlmB 2882 2133 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494715.1 protein_id gnl|my_center|LOCUS_01800 3046 4701 gene locus_tag LOCUS_01810 3046 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 4718 5317 gene locus_tag LOCUS_01820 4718 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 5782 5363 gene locus_tag LOCUS_01830 5782 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 6771 5782 gene locus_tag LOCUS_01840 gene secF 6771 5782 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144153.1 protein_id gnl|my_center|LOCUS_01840 8091 6790 gene locus_tag LOCUS_01850 gene secD 8091 6790 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144152.1 protein_id gnl|my_center|LOCUS_01850 8245 9273 gene locus_tag LOCUS_01860 gene recA 8245 9273 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_01860 10489 9347 gene locus_tag LOCUS_01870 10489 9347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 11287 10502 gene locus_tag LOCUS_01880 gene sigF 11287 10502 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860953.1 protein_id gnl|my_center|LOCUS_01880 11735 11340 gene locus_tag LOCUS_01890 11735 11340 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357963.1 protein_id gnl|my_center|LOCUS_01890 11925 13250 gene locus_tag LOCUS_01900 gene murA 11925 13250 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143118.1 protein_id gnl|my_center|LOCUS_01900 13234 13563 gene locus_tag LOCUS_01910 13234 13563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 14708 13560 gene locus_tag LOCUS_01920 14708 13560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 14843 15136 gene locus_tag LOCUS_01930 14843 15136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 15523 15173 gene locus_tag LOCUS_01940 15523 15173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 17398 15650 gene locus_tag LOCUS_01950 17398 15650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 17564 18853 gene locus_tag LOCUS_01960 17564 18853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 19860 18850 gene locus_tag LOCUS_01970 19860 18850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 21693 19966 gene locus_tag LOCUS_01980 21693 19966 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966455.1 protein_id gnl|my_center|LOCUS_01980 22813 21812 gene locus_tag LOCUS_01990 22813 21812 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_01990 24560 22806 gene locus_tag LOCUS_02000 24560 22806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 25210 24629 gene locus_tag LOCUS_02010 25210 24629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 27857 25245 gene locus_tag LOCUS_02020 27857 25245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 28029 30698 gene locus_tag LOCUS_02030 28029 30698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 31991 30708 gene locus_tag LOCUS_02040 31991 30708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 33130 32081 gene locus_tag LOCUS_02050 33130 32081 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814952.1 protein_id gnl|my_center|LOCUS_02050 >Feature sequence006 3996 895 gene locus_tag LOCUS_02060 3996 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 4564 4016 gene locus_tag LOCUS_02070 4564 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 4893 4564 gene locus_tag LOCUS_02080 4893 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044391358.1 protein_id gnl|my_center|LOCUS_02080 5469 4927 gene locus_tag LOCUS_02090 5469 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 6723 5974 gene locus_tag LOCUS_02100 6723 5974 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266512.1 protein_id gnl|my_center|LOCUS_02100 7443 6724 gene locus_tag LOCUS_02110 7443 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 8117 7443 gene locus_tag LOCUS_02120 8117 7443 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266514.1 protein_id gnl|my_center|LOCUS_02120 8724 8110 gene locus_tag LOCUS_02130 8724 8110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266513.1 protein_id gnl|my_center|LOCUS_02130 9331 8786 gene locus_tag LOCUS_02140 9331 8786 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775260.1 protein_id gnl|my_center|LOCUS_02140 10068 9553 gene locus_tag LOCUS_02150 10068 9553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 10166 10318 gene locus_tag LOCUS_02160 10166 10318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 10499 10879 gene locus_tag LOCUS_02170 10499 10879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 11307 12245 gene locus_tag LOCUS_02180 11307 12245 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_02180 12316 13785 gene locus_tag LOCUS_02190 12316 13785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 13819 14904 gene locus_tag LOCUS_02200 13819 14904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 14979 16478 gene locus_tag LOCUS_02210 14979 16478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 16912 16475 gene locus_tag LOCUS_02220 16912 16475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 17966 16902 gene locus_tag LOCUS_02230 17966 16902 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963737.1 protein_id gnl|my_center|LOCUS_02230 18946 18011 gene locus_tag LOCUS_02240 18946 18011 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_02240 20757 18943 gene locus_tag LOCUS_02250 gene msbA 20757 18943 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_02250 20849 21916 gene locus_tag LOCUS_02260 20849 21916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 22029 24701 gene locus_tag LOCUS_02270 22029 24701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 24740 26896 gene locus_tag LOCUS_02280 24740 26896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 26868 28886 gene locus_tag LOCUS_02290 26868 28886 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057111.1 protein_id gnl|my_center|LOCUS_02290 28883 30244 gene locus_tag LOCUS_02300 gene rlmD 28883 30244 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 protein_id gnl|my_center|LOCUS_02300 30491 30303 gene locus_tag LOCUS_02310 30491 30303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 33106 30611 gene locus_tag LOCUS_02320 gene pcrA 33106 30611 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989805.1 protein_id gnl|my_center|LOCUS_02320 >Feature sequence007 392 219 gene locus_tag LOCUS_02330 392 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 1994 507 gene locus_tag LOCUS_02340 1994 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 3413 2148 gene locus_tag LOCUS_02350 3413 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 3603 3677 gene locus_tag LOCUS_t00030 3603 3677 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3748 3831 gene locus_tag LOCUS_t00040 3748 3831 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5821 3971 gene locus_tag LOCUS_02360 5821 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 6135 7580 gene locus_tag LOCUS_02370 6135 7580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 7671 8906 gene locus_tag LOCUS_02380 7671 8906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 10977 8950 gene locus_tag LOCUS_02390 gene glyS 10977 8950 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861551.1 protein_id gnl|my_center|LOCUS_02390 11140 11217 gene locus_tag LOCUS_t00050 11140 11217 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 14194 11273 gene locus_tag LOCUS_02400 14194 11273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 14923 14282 gene locus_tag LOCUS_02410 14923 14282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 15562 14936 gene locus_tag LOCUS_02420 15562 14936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 16431 15586 gene locus_tag LOCUS_02430 16431 15586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 17319 16432 gene locus_tag LOCUS_02440 17319 16432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 17446 17946 gene locus_tag LOCUS_02450 17446 17946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 17943 18680 gene locus_tag LOCUS_02460 17943 18680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 18827 19030 gene locus_tag LOCUS_02470 18827 19030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 19437 19081 gene locus_tag LOCUS_02480 19437 19081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02480 19855 19325 gene locus_tag LOCUS_02490 19855 19325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02490 20758 19856 gene locus_tag LOCUS_02500 20758 19856 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 protein_id gnl|my_center|LOCUS_02500 21512 20769 gene locus_tag LOCUS_02510 21512 20769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 22189 21509 gene locus_tag LOCUS_02520 gene larB 22189 21509 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435015.1 protein_id gnl|my_center|LOCUS_02520 22916 22182 gene locus_tag LOCUS_02530 gene tatC 22916 22182 CDS product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260928.1 protein_id gnl|my_center|LOCUS_02530 23133 22918 gene locus_tag LOCUS_02540 23133 22918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 24429 23152 gene locus_tag LOCUS_02550 24429 23152 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765754.1 protein_id gnl|my_center|LOCUS_02550 25679 24429 gene locus_tag LOCUS_02560 25679 24429 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066524.1 protein_id gnl|my_center|LOCUS_02560 26211 25765 gene locus_tag LOCUS_02570 gene bcp 26211 25765 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880283.1 protein_id gnl|my_center|LOCUS_02570 26392 27621 gene locus_tag LOCUS_02580 26392 27621 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143095.1 protein_id gnl|my_center|LOCUS_02580 29076 27712 gene locus_tag LOCUS_02590 29076 27712 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439500.1 protein_id gnl|my_center|LOCUS_02590 29328 29089 gene locus_tag LOCUS_02600 29328 29089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 29792 29334 gene locus_tag LOCUS_02610 29792 29334 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083188.1 protein_id gnl|my_center|LOCUS_02610 30197 29895 gene locus_tag LOCUS_02620 30197 29895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 30532 30185 gene locus_tag LOCUS_02630 30532 30185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 >Feature sequence008 883 1128 gene locus_tag LOCUS_02640 883 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 1989 1207 gene locus_tag LOCUS_02650 gene fliR 1989 1207 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870059.1 protein_id gnl|my_center|LOCUS_02650 2363 1989 gene locus_tag LOCUS_02660 2363 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 2857 2360 gene locus_tag LOCUS_02670 2857 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 3508 2867 gene locus_tag LOCUS_02680 gene fliP 3508 2867 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852529.1 protein_id gnl|my_center|LOCUS_02680 3860 3510 gene locus_tag LOCUS_02690 3860 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 5164 3869 gene locus_tag LOCUS_02700 5164 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 5393 6268 gene locus_tag LOCUS_02710 5393 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 6249 6434 gene locus_tag LOCUS_02720 6249 6434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 7016 6435 gene locus_tag LOCUS_02730 7016 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 7760 7116 gene locus_tag LOCUS_02740 7760 7116 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140815.1 protein_id gnl|my_center|LOCUS_02740 9677 7773 gene locus_tag LOCUS_02750 9677 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 9745 10437 gene locus_tag LOCUS_02760 9745 10437 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_02760 10512 11048 gene locus_tag LOCUS_02770 10512 11048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 11026 11571 gene locus_tag LOCUS_02780 11026 11571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 13187 11583 gene locus_tag LOCUS_02790 13187 11583 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_02790 13292 13531 gene locus_tag LOCUS_02800 13292 13531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 14347 13664 gene locus_tag LOCUS_02810 14347 13664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 15432 14422 gene locus_tag LOCUS_02820 15432 14422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 17723 15435 gene locus_tag LOCUS_02830 17723 15435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 19321 17960 gene locus_tag LOCUS_02840 19321 17960 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772424.1 protein_id gnl|my_center|LOCUS_02840 19541 19918 gene locus_tag LOCUS_02850 19541 19918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 20900 20520 gene locus_tag LOCUS_02860 gene dagK 20900 20520 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365219.1 protein_id gnl|my_center|LOCUS_02860 21397 20897 gene locus_tag LOCUS_02870 21397 20897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 23501 21390 gene locus_tag LOCUS_02880 23501 21390 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047997.1 protein_id gnl|my_center|LOCUS_02880 23661 28181 gene locus_tag LOCUS_02890 23661 28181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 28903 28232 gene locus_tag LOCUS_02900 28903 28232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 29408 28917 gene locus_tag LOCUS_02910 29408 28917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 29777 29424 gene locus_tag LOCUS_02920 29777 29424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 >Feature sequence009 1035 673 gene locus_tag LOCUS_02930 1035 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 1280 3850 gene locus_tag LOCUS_02940 1280 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 3899 4486 gene locus_tag LOCUS_02950 3899 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 4495 7953 gene locus_tag LOCUS_02960 4495 7953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 8652 7954 gene locus_tag LOCUS_02970 8652 7954 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_02970 10766 8640 gene locus_tag LOCUS_02980 10766 8640 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_02980 13015 11027 gene locus_tag LOCUS_02990 13015 11027 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546396.1 protein_id gnl|my_center|LOCUS_02990 14504 13065 gene locus_tag LOCUS_03000 14504 13065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 15564 14467 gene locus_tag LOCUS_03010 15564 14467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 18078 15631 gene locus_tag LOCUS_03020 gene gyrB 18078 15631 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940681.1 protein_id gnl|my_center|LOCUS_03020 18227 18850 gene locus_tag LOCUS_03030 18227 18850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 18861 19352 gene locus_tag LOCUS_03040 18861 19352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 20129 19347 gene locus_tag LOCUS_03050 gene zupT 20129 19347 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861091.1 protein_id gnl|my_center|LOCUS_03050 20207 21400 gene locus_tag LOCUS_03060 20207 21400 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798964.1 protein_id gnl|my_center|LOCUS_03060 22497 21472 gene locus_tag LOCUS_03070 22497 21472 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016467.1 protein_id gnl|my_center|LOCUS_03070 23558 22494 gene locus_tag LOCUS_03080 gene lpxK 23558 22494 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626176.1 protein_id gnl|my_center|LOCUS_03080 24924 23566 gene locus_tag LOCUS_03090 24924 23566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 25690 24962 gene locus_tag LOCUS_03100 25690 24962 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920674.1 protein_id gnl|my_center|LOCUS_03100 26462 25704 gene locus_tag LOCUS_03110 26462 25704 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141808.1 protein_id gnl|my_center|LOCUS_03110 27535 26561 gene locus_tag LOCUS_03120 27535 26561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294513.1 protein_id gnl|my_center|LOCUS_03120 28597 27608 gene locus_tag LOCUS_03130 28597 27608 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964851.1 protein_id gnl|my_center|LOCUS_03130 <29359 28654 gene locus_tag LOCUS_03140 <29359 28654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963616.1:LD-carboxypeptidase >Feature sequence010 1128 472 gene locus_tag LOCUS_03150 gene cysE 1128 472 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285050.1 protein_id gnl|my_center|LOCUS_03150 2355 1129 gene locus_tag LOCUS_03160 gene tyrS 2355 1129 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081488.1 protein_id gnl|my_center|LOCUS_03160 2643 2446 gene locus_tag LOCUS_03170 2643 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 2736 3242 gene locus_tag LOCUS_03180 gene leuD 2736 3242 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583553.1 protein_id gnl|my_center|LOCUS_03180 3632 3270 gene locus_tag LOCUS_03190 3632 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 3831 5765 gene locus_tag LOCUS_03200 3831 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 5860 6849 gene locus_tag LOCUS_03210 5860 6849 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583478.1 protein_id gnl|my_center|LOCUS_03210 6895 6969 gene locus_tag LOCUS_t00060 6895 6969 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7689 7057 gene locus_tag LOCUS_03220 7689 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 9578 7779 gene locus_tag LOCUS_03230 9578 7779 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880932.1 protein_id gnl|my_center|LOCUS_03230 10994 9708 gene locus_tag LOCUS_03240 gene miaB 10994 9708 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_03240 11152 11436 gene locus_tag LOCUS_03250 11152 11436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 11436 13091 gene locus_tag LOCUS_03260 11436 13091 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951270.1 protein_id gnl|my_center|LOCUS_03260 13079 13822 gene locus_tag LOCUS_03270 13079 13822 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299518.1 protein_id gnl|my_center|LOCUS_03270 13950 14087 gene locus_tag LOCUS_03280 13950 14087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 14234 14377 gene locus_tag LOCUS_03290 14234 14377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 14454 16223 gene locus_tag LOCUS_03300 gene argS 14454 16223 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086459.1 protein_id gnl|my_center|LOCUS_03300 16338 17201 gene locus_tag LOCUS_03310 gene accD 16338 17201 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_03310 17211 18161 gene locus_tag LOCUS_03320 17211 18161 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124688.1 protein_id gnl|my_center|LOCUS_03320 18152 19075 gene locus_tag LOCUS_03330 18152 19075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 19077 19805 gene locus_tag LOCUS_03340 gene kdsB 19077 19805 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545187.1 protein_id gnl|my_center|LOCUS_03340 19807 20481 gene locus_tag LOCUS_03350 19807 20481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 20556 21002 gene locus_tag LOCUS_03360 20556 21002 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030904.1 protein_id gnl|my_center|LOCUS_03360 21019 21705 gene locus_tag LOCUS_03370 21019 21705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 21960 21706 gene locus_tag LOCUS_03380 21960 21706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 22250 22023 gene locus_tag LOCUS_03390 22250 22023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 22366 23163 gene locus_tag LOCUS_03400 gene dapB 22366 23163 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920961.1 protein_id gnl|my_center|LOCUS_03400 24320 23193 gene locus_tag LOCUS_03410 gene anmK 24320 23193 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439909.1 protein_id gnl|my_center|LOCUS_03410 24421 25866 gene locus_tag LOCUS_03420 24421 25866 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546227.1 protein_id gnl|my_center|LOCUS_03420 25853 27028 gene locus_tag LOCUS_03430 25853 27028 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_03430 27025 27459 gene locus_tag LOCUS_03440 gene aroQ 27025 27459 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964217.1 protein_id gnl|my_center|LOCUS_03440 >Feature sequence011 939 1289 gene locus_tag LOCUS_03450 939 1289 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 protein_id gnl|my_center|LOCUS_03450 1286 1591 gene locus_tag LOCUS_03460 1286 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 4299 1891 gene locus_tag LOCUS_03470 4299 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 4451 4993 gene locus_tag LOCUS_03480 4451 4993 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_03480 5275 5021 gene locus_tag LOCUS_03490 5275 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 7247 5376 gene locus_tag LOCUS_03500 7247 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 7698 9728 gene locus_tag LOCUS_03510 7698 9728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 9835 10347 gene locus_tag LOCUS_03520 9835 10347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 11135 10383 gene locus_tag LOCUS_03530 11135 10383 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_03530 11182 11955 gene locus_tag LOCUS_03540 11182 11955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 12034 12300 gene locus_tag LOCUS_03550 gene grxC 12034 12300 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200200.1 protein_id gnl|my_center|LOCUS_03550 12308 13909 gene locus_tag LOCUS_03560 gene hcp 12308 13909 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071571.1 protein_id gnl|my_center|LOCUS_03560 15239 13980 gene locus_tag LOCUS_03570 gene fabF 15239 13980 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331838.1 protein_id gnl|my_center|LOCUS_03570 15565 15332 gene locus_tag LOCUS_03580 15565 15332 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388176.1 protein_id gnl|my_center|LOCUS_03580 16384 15656 gene locus_tag LOCUS_03590 gene fabG 16384 15656 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_03590 17325 16384 gene locus_tag LOCUS_03600 gene fabD 17325 16384 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 protein_id gnl|my_center|LOCUS_03600 18323 17325 gene locus_tag LOCUS_03610 18323 17325 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_03610 19383 18325 gene locus_tag LOCUS_03620 gene plsX 19383 18325 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_03620 19618 19415 gene locus_tag LOCUS_03630 19618 19415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 20114 19623 gene locus_tag LOCUS_03640 20114 19623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 20542 20204 gene locus_tag LOCUS_03650 20542 20204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 20832 20548 gene locus_tag LOCUS_03660 20832 20548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 21929 21078 gene locus_tag LOCUS_03670 21929 21078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 23209 22007 gene locus_tag LOCUS_03680 23209 22007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 25427 23292 gene locus_tag LOCUS_03690 gene pnp 25427 23292 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_03690 25539 26546 gene locus_tag LOCUS_03700 gene rsgA 25539 26546 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_03700 >Feature sequence012 229 304 gene locus_tag LOCUS_t00070 229 304 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 351 812 gene locus_tag LOCUS_03710 351 812 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_03710 802 1524 gene locus_tag LOCUS_03720 gene mtnN 802 1524 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579275.1 protein_id gnl|my_center|LOCUS_03720 2463 1540 gene locus_tag LOCUS_03730 gene cysK 2463 1540 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_03730 3377 2466 gene locus_tag LOCUS_03740 3377 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 4480 3377 gene locus_tag LOCUS_03750 gene mnmA 4480 3377 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_03750 4601 5827 gene locus_tag LOCUS_03760 gene hisF 4601 5827 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592610.1 protein_id gnl|my_center|LOCUS_03760 5884 7134 gene locus_tag LOCUS_03770 gene hisD 5884 7134 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861261.1 protein_id gnl|my_center|LOCUS_03770 7258 8145 gene locus_tag LOCUS_03780 7258 8145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 8669 8205 gene locus_tag LOCUS_03790 8669 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 8879 9553 gene locus_tag LOCUS_03800 8879 9553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 10017 9592 gene locus_tag LOCUS_03810 10017 9592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 10295 11044 gene locus_tag LOCUS_03820 10295 11044 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263218.1 protein_id gnl|my_center|LOCUS_03820 11032 11946 gene locus_tag LOCUS_03830 11032 11946 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 protein_id gnl|my_center|LOCUS_03830 11946 12524 gene locus_tag LOCUS_03840 gene pyrE 11946 12524 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083096.1 protein_id gnl|my_center|LOCUS_03840 12524 13441 gene locus_tag LOCUS_03850 12524 13441 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_03850 13431 14705 gene locus_tag LOCUS_03860 13431 14705 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545202.1 protein_id gnl|my_center|LOCUS_03860 14712 15803 gene locus_tag LOCUS_03870 14712 15803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 15845 16546 gene locus_tag LOCUS_03880 15845 16546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03880 16595 19831 gene locus_tag LOCUS_03890 gene carB 16595 19831 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965932.1 protein_id gnl|my_center|LOCUS_03890 19841 19987 gene locus_tag LOCUS_03900 19841 19987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 20132 21988 gene locus_tag LOCUS_03910 20132 21988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 22126 24777 gene locus_tag LOCUS_03920 gene adhE 22126 24777 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056082.1 protein_id gnl|my_center|LOCUS_03920 24889 25518 gene locus_tag LOCUS_03930 24889 25518 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669725.1 protein_id gnl|my_center|LOCUS_03930 25518 25748 gene locus_tag LOCUS_03940 25518 25748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 >Feature sequence013 261 974 gene locus_tag LOCUS_03950 261 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 1185 985 gene locus_tag LOCUS_03960 1185 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 1400 1185 gene locus_tag LOCUS_03970 1400 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 1773 1549 gene locus_tag LOCUS_03980 1773 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 1861 2586 gene locus_tag LOCUS_03990 1861 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 2893 2600 gene locus_tag LOCUS_04000 2893 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 3000 5885 gene locus_tag LOCUS_04010 3000 5885 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286652.1 protein_id gnl|my_center|LOCUS_04010 5885 6733 gene locus_tag LOCUS_04020 gene dinD 5885 6733 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001377125.1 protein_id gnl|my_center|LOCUS_04020 6734 7723 gene locus_tag LOCUS_04030 6734 7723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 7737 9302 gene locus_tag LOCUS_04040 7737 9302 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105162.1 protein_id gnl|my_center|LOCUS_04040 9303 9971 gene locus_tag LOCUS_04050 9303 9971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 10072 10752 gene locus_tag LOCUS_04060 10072 10752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 10736 13447 gene locus_tag LOCUS_04070 10736 13447 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081335.1 protein_id gnl|my_center|LOCUS_04070 13431 13871 gene locus_tag LOCUS_04080 13431 13871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 14444 13905 gene locus_tag LOCUS_04090 14444 13905 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949169.1 protein_id gnl|my_center|LOCUS_04090 14693 14971 gene locus_tag LOCUS_04100 14693 14971 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894809.1 protein_id gnl|my_center|LOCUS_04100 14964 16070 gene locus_tag LOCUS_04110 14964 16070 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_04110 16875 16240 gene locus_tag LOCUS_04120 16875 16240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 17101 18075 gene locus_tag LOCUS_04130 17101 18075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 18644 18084 gene locus_tag LOCUS_04140 18644 18084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 19102 18728 gene locus_tag LOCUS_04150 19102 18728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 20263 19223 gene locus_tag LOCUS_04160 20263 19223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 20387 20989 gene locus_tag LOCUS_04170 20387 20989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 21218 23062 gene locus_tag LOCUS_04180 21218 23062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 <24526 23123 gene locus_tag LOCUS_04190 <24526 23123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015673.1:potassium/proton antiporter >Feature sequence014 <1 1979 gene locus_tag LOCUS_04200 <1 1979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392382.1:isoleucine--tRNA ligase 2686 2042 gene locus_tag LOCUS_04210 2686 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 3828 2743 gene locus_tag LOCUS_04220 3828 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 4815 3829 gene locus_tag LOCUS_04230 4815 3829 CDS product DUF3326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140560.1 protein_id gnl|my_center|LOCUS_04230 5479 4802 gene locus_tag LOCUS_04240 5479 4802 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173343.1 protein_id gnl|my_center|LOCUS_04240 5950 5570 gene locus_tag LOCUS_04250 5950 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 6279 5929 gene locus_tag LOCUS_04260 6279 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 10239 6421 gene locus_tag LOCUS_04270 10239 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 10528 11418 gene locus_tag LOCUS_04280 10528 11418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 11613 12671 gene locus_tag LOCUS_04290 11613 12671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 12661 13200 gene locus_tag LOCUS_04300 12661 13200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 13360 13899 gene locus_tag LOCUS_04310 13360 13899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 13990 15027 gene locus_tag LOCUS_04320 13990 15027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 15294 15028 gene locus_tag LOCUS_04330 15294 15028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 15482 16348 gene locus_tag LOCUS_04340 15482 16348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 16357 16956 gene locus_tag LOCUS_04350 16357 16956 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287632.1 protein_id gnl|my_center|LOCUS_04350 16940 17518 gene locus_tag LOCUS_04360 gene yqeK 16940 17518 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721995.1 protein_id gnl|my_center|LOCUS_04360 17520 18194 gene locus_tag LOCUS_04370 17520 18194 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760203.1 protein_id gnl|my_center|LOCUS_04370 18444 18196 gene locus_tag LOCUS_04380 18444 18196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 18871 18482 gene locus_tag LOCUS_04390 18871 18482 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 protein_id gnl|my_center|LOCUS_04390 19681 18932 gene locus_tag LOCUS_04400 gene pflA 19681 18932 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289264.1 protein_id gnl|my_center|LOCUS_04400 19851 21074 gene locus_tag LOCUS_04410 19851 21074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 21137 21826 gene locus_tag LOCUS_04420 21137 21826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 22134 21886 gene locus_tag LOCUS_04430 22134 21886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 24239 22158 gene locus_tag LOCUS_04440 gene pflB 24239 22158 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195472.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence015 410 2320 gene locus_tag LOCUS_04450 410 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 2304 2654 gene locus_tag LOCUS_04460 2304 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 2915 2658 gene locus_tag LOCUS_04470 2915 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 3090 3542 gene locus_tag LOCUS_04480 gene accB 3090 3542 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583401.1 protein_id gnl|my_center|LOCUS_04480 3556 4905 gene locus_tag LOCUS_04490 gene accC 3556 4905 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931851.1 protein_id gnl|my_center|LOCUS_04490 5507 4932 gene locus_tag LOCUS_04500 5507 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 6095 5511 gene locus_tag LOCUS_04510 6095 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 6210 7322 gene locus_tag LOCUS_04520 6210 7322 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070687.1 protein_id gnl|my_center|LOCUS_04520 8342 7359 gene locus_tag LOCUS_04530 gene galE 8342 7359 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583707.1 protein_id gnl|my_center|LOCUS_04530 9198 8347 gene locus_tag LOCUS_04540 9198 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 9855 9265 gene locus_tag LOCUS_04550 9855 9265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 10546 9848 gene locus_tag LOCUS_04560 10546 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 10993 10625 gene locus_tag LOCUS_04570 10993 10625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 11216 12610 gene locus_tag LOCUS_04580 11216 12610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 12641 14020 gene locus_tag LOCUS_04590 gene tilS 12641 14020 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966480.1 protein_id gnl|my_center|LOCUS_04590 13995 14540 gene locus_tag LOCUS_04600 gene hpt 13995 14540 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019306.1 protein_id gnl|my_center|LOCUS_04600 15651 14821 gene locus_tag LOCUS_04610 gene cruD 15651 14821 CDS product hydroxychlorobactene glucoside lauroyltransferase CruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932647.1 protein_id gnl|my_center|LOCUS_04610 16409 15696 gene locus_tag LOCUS_04620 16409 15696 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804184.1 protein_id gnl|my_center|LOCUS_04620 17510 16413 gene locus_tag LOCUS_04630 17510 16413 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082547.1 protein_id gnl|my_center|LOCUS_04630 18478 17510 gene locus_tag LOCUS_04640 18478 17510 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081376.1 protein_id gnl|my_center|LOCUS_04640 18759 18565 gene locus_tag LOCUS_04650 18759 18565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 19123 18752 gene locus_tag LOCUS_04660 19123 18752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04660 19011 19277 gene locus_tag LOCUS_04670 19011 19277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 19474 22500 gene locus_tag LOCUS_04680 19474 22500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 22524 23474 gene locus_tag LOCUS_04690 22524 23474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 23482 23811 gene locus_tag LOCUS_04700 23482 23811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 23982 >24326 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attataacatattttaaattaagagaaaatcaaaac >Feature sequence016 379 41 gene locus_tag LOCUS_04710 gene rplX 379 41 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966401.1 protein_id gnl|my_center|LOCUS_04710 758 390 gene locus_tag LOCUS_04720 gene rplN 758 390 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055946.1 protein_id gnl|my_center|LOCUS_04720 1054 809 gene locus_tag LOCUS_04730 gene rpsQ 1054 809 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143906.1 protein_id gnl|my_center|LOCUS_04730 1287 1075 gene locus_tag LOCUS_04740 gene rpmC 1287 1075 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869921.1 protein_id gnl|my_center|LOCUS_04740 1703 1290 gene locus_tag LOCUS_04750 gene rplP 1703 1290 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393930.1 protein_id gnl|my_center|LOCUS_04750 2497 1733 gene locus_tag LOCUS_04760 gene rpsC 2497 1733 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_04760 2848 2510 gene locus_tag LOCUS_04770 gene rplV 2848 2510 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638065.1 protein_id gnl|my_center|LOCUS_04770 3142 2852 gene locus_tag LOCUS_04780 gene rpsS 3142 2852 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140906.1 protein_id gnl|my_center|LOCUS_04780 3985 3158 gene locus_tag LOCUS_04790 gene rplB 3985 3158 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393934.1 protein_id gnl|my_center|LOCUS_04790 4298 3990 gene locus_tag LOCUS_04800 4298 3990 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055343.1 protein_id gnl|my_center|LOCUS_04800 4933 4298 gene locus_tag LOCUS_04810 gene rplD 4933 4298 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810159.1 protein_id gnl|my_center|LOCUS_04810 5600 4965 gene locus_tag LOCUS_04820 gene rplC 5600 4965 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140089.1 protein_id gnl|my_center|LOCUS_04820 6023 5706 gene locus_tag LOCUS_04830 gene rpsJ 6023 5706 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_04830 9340 6254 gene locus_tag LOCUS_04840 9340 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 10827 9445 gene locus_tag LOCUS_04850 10827 9445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 11196 10831 gene locus_tag LOCUS_04860 11196 10831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 13258 11174 gene locus_tag LOCUS_04870 13258 11174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 14048 13599 gene locus_tag LOCUS_04880 14048 13599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 14342 15448 gene locus_tag LOCUS_04890 14342 15448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 15672 16481 gene locus_tag LOCUS_04900 15672 16481 CDS product prephenate/arogenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125868.1 protein_id gnl|my_center|LOCUS_04900 16851 17534 gene locus_tag LOCUS_04910 gene tmk 16851 17534 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 protein_id gnl|my_center|LOCUS_04910 17535 18194 gene locus_tag LOCUS_04920 gene tmk 17535 18194 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 protein_id gnl|my_center|LOCUS_04920 18244 18579 gene locus_tag LOCUS_04930 18244 18579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 18576 20915 gene locus_tag LOCUS_04940 18576 20915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 21002 21247 gene locus_tag LOCUS_04950 21002 21247 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458940.1 protein_id gnl|my_center|LOCUS_04950 23099 21282 gene locus_tag LOCUS_04960 23099 21282 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957835.1 protein_id gnl|my_center|LOCUS_04960 23863 23150 gene locus_tag LOCUS_04970 23863 23150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 >Feature sequence017 1783 1616 gene locus_tag LOCUS_04980 1783 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 1975 2517 gene locus_tag LOCUS_04990 1975 2517 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949169.1 protein_id gnl|my_center|LOCUS_04990 2606 4633 gene locus_tag LOCUS_05000 2606 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 4630 5946 gene locus_tag LOCUS_05010 4630 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 5949 7142 gene locus_tag LOCUS_05020 5949 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 8440 7172 gene locus_tag LOCUS_05030 8440 7172 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208594.1 protein_id gnl|my_center|LOCUS_05030 9581 8415 gene locus_tag LOCUS_05040 9581 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 10739 9645 gene locus_tag LOCUS_05050 gene rfbG 10739 9645 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202465.1 protein_id gnl|my_center|LOCUS_05050 11648 10740 gene locus_tag LOCUS_05060 11648 10740 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987005.1 protein_id gnl|my_center|LOCUS_05060 12464 11649 gene locus_tag LOCUS_05070 gene rfbF 12464 11649 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257101.1 protein_id gnl|my_center|LOCUS_05070 13515 12466 gene locus_tag LOCUS_05080 13515 12466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 14637 13564 gene locus_tag LOCUS_05090 14637 13564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 16002 14878 gene locus_tag LOCUS_05100 gene glf 16002 14878 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875983.1 protein_id gnl|my_center|LOCUS_05100 16983 16051 gene locus_tag LOCUS_05110 16983 16051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 18822 17095 gene locus_tag LOCUS_05120 18822 17095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 18970 19455 gene locus_tag LOCUS_05130 18970 19455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 19531 20895 gene locus_tag LOCUS_05140 gene bioA 19531 20895 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964671.1 protein_id gnl|my_center|LOCUS_05140 20898 21560 gene locus_tag LOCUS_05150 gene bioD 20898 21560 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545503.1 protein_id gnl|my_center|LOCUS_05150 22245 21541 gene locus_tag LOCUS_05160 gene rsmG 22245 21541 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188793.1 protein_id gnl|my_center|LOCUS_05160 <24049 22245 gene locus_tag LOCUS_05170 <24049 22245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880520.1:tetratricopeptide repeat protein >Feature sequence018 89 943 gene locus_tag LOCUS_05180 gene uppP 89 943 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_05180 946 1746 gene locus_tag LOCUS_05190 946 1746 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986426.1 protein_id gnl|my_center|LOCUS_05190 2514 1750 gene locus_tag LOCUS_05200 2514 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 3380 2514 gene locus_tag LOCUS_05210 gene hisG 3380 2514 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870716.1 protein_id gnl|my_center|LOCUS_05210 4729 3401 gene locus_tag LOCUS_05220 4729 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 4851 6077 gene locus_tag LOCUS_05230 4851 6077 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143008.1 protein_id gnl|my_center|LOCUS_05230 6622 6086 gene locus_tag LOCUS_05240 6622 6086 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869337.1 protein_id gnl|my_center|LOCUS_05240 7377 6622 gene locus_tag LOCUS_05250 7377 6622 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942505.1 protein_id gnl|my_center|LOCUS_05250 8455 7358 gene locus_tag LOCUS_05260 8455 7358 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082297.1 protein_id gnl|my_center|LOCUS_05260 8658 8452 gene locus_tag LOCUS_05270 8658 8452 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_05270 8806 9738 gene locus_tag LOCUS_05280 8806 9738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 9742 10569 gene locus_tag LOCUS_05290 9742 10569 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_05290 10652 11770 gene locus_tag LOCUS_05300 10652 11770 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_05300 13199 11832 gene locus_tag LOCUS_05310 gene radA 13199 11832 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_05310 14181 13180 gene locus_tag LOCUS_05320 14181 13180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 14684 14262 gene locus_tag LOCUS_05330 14684 14262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 19898 14685 gene locus_tag LOCUS_05340 19898 14685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 20106 20387 gene locus_tag LOCUS_05350 20106 20387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 23035 20429 gene locus_tag LOCUS_05360 gene clpB 23035 20429 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546043.1 protein_id gnl|my_center|LOCUS_05360 >Feature sequence019 1613 1200 gene locus_tag LOCUS_05370 1613 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 1720 5178 gene locus_tag LOCUS_05380 gene mfd 1720 5178 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048383.1 protein_id gnl|my_center|LOCUS_05380 5199 6341 gene locus_tag LOCUS_05390 5199 6341 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_05390 6404 6865 gene locus_tag LOCUS_05400 gene rfaE2 6404 6865 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896999.1 protein_id gnl|my_center|LOCUS_05400 6927 8015 gene locus_tag LOCUS_05410 gene lpxD 6927 8015 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387804.1 protein_id gnl|my_center|LOCUS_05410 8019 8825 gene locus_tag LOCUS_05420 gene lpxC 8019 8825 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447207.1 protein_id gnl|my_center|LOCUS_05420 8825 9295 gene locus_tag LOCUS_05430 gene fabZ 8825 9295 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391761.1 protein_id gnl|my_center|LOCUS_05430 9314 10117 gene locus_tag LOCUS_05440 gene lpxA 9314 10117 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016510.1 protein_id gnl|my_center|LOCUS_05440 10120 11223 gene locus_tag LOCUS_05450 10120 11223 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_05450 11679 11260 gene locus_tag LOCUS_05460 11679 11260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 11800 13764 gene locus_tag LOCUS_05470 11800 13764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 13811 15367 gene locus_tag LOCUS_05480 13811 15367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 16230 15424 gene locus_tag LOCUS_05490 16230 15424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 17257 16289 gene locus_tag LOCUS_05500 17257 16289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 18396 17503 gene locus_tag LOCUS_05510 18396 17503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 19369 18383 gene locus_tag LOCUS_05520 19369 18383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 20850 19555 gene locus_tag LOCUS_05530 20850 19555 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_05530 20985 22646 gene locus_tag LOCUS_05540 20985 22646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 22822 22897 gene locus_tag LOCUS_t00080 22822 22897 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 23842 23315 gene locus_tag LOCUS_05550 23842 23315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 >Feature sequence020 568 128 gene locus_tag LOCUS_05560 gene rplM 568 128 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933443.1 protein_id gnl|my_center|LOCUS_05560 1344 565 gene locus_tag LOCUS_05570 gene truA 1344 565 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_05570 1772 1344 gene locus_tag LOCUS_05580 gene rplQ 1772 1344 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_05580 2765 1791 gene locus_tag LOCUS_05590 2765 1791 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_05590 3387 2785 gene locus_tag LOCUS_05600 gene rpsD 3387 2785 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143561.1 protein_id gnl|my_center|LOCUS_05600 3797 3411 gene locus_tag LOCUS_05610 gene rpsK 3797 3411 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545788.1 protein_id gnl|my_center|LOCUS_05610 4183 3818 gene locus_tag LOCUS_05620 gene rpsM 4183 3818 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936622.1 protein_id gnl|my_center|LOCUS_05620 4665 4450 gene locus_tag LOCUS_05630 gene infA 4665 4450 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118443.1 protein_id gnl|my_center|LOCUS_05630 4998 5951 gene locus_tag LOCUS_05640 4998 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 5944 6912 gene locus_tag LOCUS_05650 5944 6912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 6937 7740 gene locus_tag LOCUS_05660 6937 7740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 7744 8328 gene locus_tag LOCUS_05670 7744 8328 CDS product 4Fe-4S single cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948683.1 protein_id gnl|my_center|LOCUS_05670 8388 10010 gene locus_tag LOCUS_05680 8388 10010 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948684.1 protein_id gnl|my_center|LOCUS_05680 10019 10486 gene locus_tag LOCUS_05690 10019 10486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 10489 10701 gene locus_tag LOCUS_05700 10489 10701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 10714 11712 gene locus_tag LOCUS_05710 10714 11712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 13001 11709 gene locus_tag LOCUS_05720 gene purB 13001 11709 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545083.1 protein_id gnl|my_center|LOCUS_05720 13060 14583 gene locus_tag LOCUS_05730 13060 14583 CDS product LeuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806758.1 protein_id gnl|my_center|LOCUS_05730 14608 16647 gene locus_tag LOCUS_05740 14608 16647 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021647.1 protein_id gnl|my_center|LOCUS_05740 18549 16711 gene locus_tag LOCUS_05750 gene dnaK 18549 16711 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_05750 18719 19396 gene locus_tag LOCUS_05760 18719 19396 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430452.1 protein_id gnl|my_center|LOCUS_05760 19398 20312 gene locus_tag LOCUS_05770 19398 20312 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583478.1 protein_id gnl|my_center|LOCUS_05770 20368 20772 gene locus_tag LOCUS_05780 20368 20772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 20860 21573 gene locus_tag LOCUS_05790 20860 21573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 22382 21624 gene locus_tag LOCUS_05800 22382 21624 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546049.1 protein_id gnl|my_center|LOCUS_05800 22813 22382 gene locus_tag LOCUS_05810 gene tadA 22813 22382 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931378.1 protein_id gnl|my_center|LOCUS_05810 23804 22803 gene locus_tag LOCUS_05820 23804 22803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence021 192 569 gene locus_tag LOCUS_05830 192 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 1370 564 gene locus_tag LOCUS_05840 1370 564 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173484.1 protein_id gnl|my_center|LOCUS_05840 1633 2166 gene locus_tag LOCUS_05850 1633 2166 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015988.1 protein_id gnl|my_center|LOCUS_05850 2178 3410 gene locus_tag LOCUS_05860 2178 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 3514 4251 gene locus_tag LOCUS_05870 3514 4251 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683251.1 protein_id gnl|my_center|LOCUS_05870 4317 4709 gene locus_tag LOCUS_05880 4317 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 4702 5370 gene locus_tag LOCUS_05890 4702 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 5684 5394 gene locus_tag LOCUS_05900 5684 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 5566 7407 gene locus_tag LOCUS_05910 gene hyfB 5566 7407 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393678.1 protein_id gnl|my_center|LOCUS_05910 7404 8327 gene locus_tag LOCUS_05920 7404 8327 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941400.1 protein_id gnl|my_center|LOCUS_05920 8331 8981 gene locus_tag LOCUS_05930 8331 8981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 9271 10392 gene locus_tag LOCUS_05940 9271 10392 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941402.1 protein_id gnl|my_center|LOCUS_05940 10401 11852 gene locus_tag LOCUS_05950 10401 11852 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941403.1 protein_id gnl|my_center|LOCUS_05950 11863 12597 gene locus_tag LOCUS_05960 11863 12597 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_05960 13585 12599 gene locus_tag LOCUS_05970 gene ftsY 13585 12599 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249530.1 protein_id gnl|my_center|LOCUS_05970 14257 13601 gene locus_tag LOCUS_05980 gene nusB 14257 13601 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141336.1 protein_id gnl|my_center|LOCUS_05980 14400 14474 gene locus_tag LOCUS_t00090 14400 14474 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 14952 14521 gene locus_tag LOCUS_05990 14952 14521 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185796.1 protein_id gnl|my_center|LOCUS_05990 15265 15101 gene locus_tag LOCUS_06000 15265 15101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 16469 15351 gene locus_tag LOCUS_06010 16469 15351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 16829 16608 gene locus_tag LOCUS_06020 16829 16608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 17394 18614 gene locus_tag LOCUS_06030 17394 18614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 18807 19037 gene locus_tag LOCUS_06040 18807 19037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 19184 19110 gene locus_tag LOCUS_t00100 19184 19110 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 21061 19271 gene locus_tag LOCUS_06050 21061 19271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 21318 21605 gene locus_tag LOCUS_06060 21318 21605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 21894 22205 gene locus_tag LOCUS_06070 21894 22205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 22290 22748 gene locus_tag LOCUS_06080 22290 22748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 22745 22939 gene locus_tag LOCUS_06090 22745 22939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 >Feature sequence022 200 272 gene locus_tag LOCUS_t00110 200 272 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 292 498 gene locus_tag LOCUS_06100 292 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 549 1208 gene locus_tag LOCUS_06110 gene nusG 549 1208 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_06110 1271 1696 gene locus_tag LOCUS_06120 gene rplK 1271 1696 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870243.1 protein_id gnl|my_center|LOCUS_06120 1766 2494 gene locus_tag LOCUS_06130 gene rplA 1766 2494 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_06130 2566 3228 gene locus_tag LOCUS_06140 2566 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 4037 3288 gene locus_tag LOCUS_06150 4037 3288 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929702.1 protein_id gnl|my_center|LOCUS_06150 4241 5206 gene locus_tag LOCUS_06160 4241 5206 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940340.1 protein_id gnl|my_center|LOCUS_06160 5258 6307 gene locus_tag LOCUS_06170 5258 6307 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768231.1 protein_id gnl|my_center|LOCUS_06170 6878 6390 gene locus_tag LOCUS_06180 6878 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 7556 6897 gene locus_tag LOCUS_06190 7556 6897 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546351.1 protein_id gnl|my_center|LOCUS_06190 7792 8700 gene locus_tag LOCUS_06200 gene xerD 7792 8700 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_06200 8739 9788 gene locus_tag LOCUS_06210 8739 9788 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020716.1 protein_id gnl|my_center|LOCUS_06210 11378 9840 gene locus_tag LOCUS_06220 11378 9840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 12183 11512 gene locus_tag LOCUS_06230 12183 11512 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288638.1 protein_id gnl|my_center|LOCUS_06230 13238 12267 gene locus_tag LOCUS_06240 13238 12267 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080738.1 protein_id gnl|my_center|LOCUS_06240 13679 13251 gene locus_tag LOCUS_06250 13679 13251 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437174.1 protein_id gnl|my_center|LOCUS_06250 17689 13793 gene locus_tag LOCUS_06260 17689 13793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 18991 17828 gene locus_tag LOCUS_06270 18991 17828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 19226 20023 gene locus_tag LOCUS_06280 gene rpsB 19226 20023 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080936.1 protein_id gnl|my_center|LOCUS_06280 20114 20977 gene locus_tag LOCUS_06290 gene tsf 20114 20977 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231929.1 protein_id gnl|my_center|LOCUS_06290 21047 22039 gene locus_tag LOCUS_06300 21047 22039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 22967 22041 gene locus_tag LOCUS_06310 22967 22041 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_06310 >Feature sequence023 911 1432 gene locus_tag LOCUS_06320 911 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 2418 1429 gene locus_tag LOCUS_06330 2418 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 3428 2427 gene locus_tag LOCUS_06340 3428 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 3515 4951 gene locus_tag LOCUS_06350 3515 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 5985 4957 gene locus_tag LOCUS_06360 5985 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 6078 7085 gene locus_tag LOCUS_06370 6078 7085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 7117 8100 gene locus_tag LOCUS_06380 7117 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 8100 9143 gene locus_tag LOCUS_06390 8100 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 10069 9140 gene locus_tag LOCUS_06400 10069 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 11066 10077 gene locus_tag LOCUS_06410 11066 10077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 11184 12149 gene locus_tag LOCUS_06420 11184 12149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 12187 13206 gene locus_tag LOCUS_06430 12187 13206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 14184 13192 gene locus_tag LOCUS_06440 14184 13192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 14240 15274 gene locus_tag LOCUS_06450 14240 15274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 16552 15233 gene locus_tag LOCUS_06460 16552 15233 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_06460 16703 17134 gene locus_tag LOCUS_06470 16703 17134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 17127 18251 gene locus_tag LOCUS_06480 gene rfbE 17127 18251 CDS product GDP-perosamine synthase RfbE/PerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875215.1 protein_id gnl|my_center|LOCUS_06480 18941 18240 gene locus_tag LOCUS_06490 18941 18240 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962342.1 protein_id gnl|my_center|LOCUS_06490 19427 19017 gene locus_tag LOCUS_06500 19427 19017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 19528 20253 gene locus_tag LOCUS_06510 19528 20253 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202283.1 protein_id gnl|my_center|LOCUS_06510 20272 21105 gene locus_tag LOCUS_06520 20272 21105 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_06520 21545 21102 gene locus_tag LOCUS_06530 gene bcp 21545 21102 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880283.1 protein_id gnl|my_center|LOCUS_06530 >Feature sequence024 901 1935 gene locus_tag LOCUS_06540 901 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 2481 1939 gene locus_tag LOCUS_06550 2481 1939 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390527.1 protein_id gnl|my_center|LOCUS_06550 2946 2500 gene locus_tag LOCUS_06560 2946 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 3142 5013 gene locus_tag LOCUS_06570 gene mnmG 3142 5013 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056385.1 protein_id gnl|my_center|LOCUS_06570 5879 5016 gene locus_tag LOCUS_06580 5879 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 6767 5931 gene locus_tag LOCUS_06590 6767 5931 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106196.1 protein_id gnl|my_center|LOCUS_06590 6809 7174 gene locus_tag LOCUS_06600 6809 7174 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 protein_id gnl|my_center|LOCUS_06600 7962 7171 gene locus_tag LOCUS_06610 gene surE 7962 7171 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057623.1 protein_id gnl|my_center|LOCUS_06610 9099 8014 gene locus_tag LOCUS_06620 gene aroB 9099 8014 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021364.1 protein_id gnl|my_center|LOCUS_06620 9592 9080 gene locus_tag LOCUS_06630 9592 9080 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903422.1 protein_id gnl|my_center|LOCUS_06630 10774 9596 gene locus_tag LOCUS_06640 gene aroC 10774 9596 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_06640 11302 12477 gene locus_tag LOCUS_06650 11302 12477 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583824.1 protein_id gnl|my_center|LOCUS_06650 12465 13109 gene locus_tag LOCUS_06660 12465 13109 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968046.1 protein_id gnl|my_center|LOCUS_06660 13158 14075 gene locus_tag LOCUS_06670 gene nadA 13158 14075 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870480.1 protein_id gnl|my_center|LOCUS_06670 14161 14337 gene locus_tag LOCUS_06680 14161 14337 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393332.1 protein_id gnl|my_center|LOCUS_06680 14761 14426 gene locus_tag LOCUS_06690 14761 14426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 14819 15031 gene locus_tag LOCUS_06700 14819 15031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 15841 15068 gene locus_tag LOCUS_06710 15841 15068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 16324 16235 gene locus_tag LOCUS_t00120 16324 16235 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17257 16370 gene locus_tag LOCUS_06720 17257 16370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 18047 17364 gene locus_tag LOCUS_06730 18047 17364 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 protein_id gnl|my_center|LOCUS_06730 18735 18253 gene locus_tag LOCUS_06740 18735 18253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 19565 18753 gene locus_tag LOCUS_06750 19565 18753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 19701 20147 gene locus_tag LOCUS_06760 gene rpiB 19701 20147 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_06760 21024 20125 gene locus_tag LOCUS_06770 21024 20125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 21222 22418 gene locus_tag LOCUS_06780 21222 22418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 >Feature sequence025 1717 2712 gene locus_tag LOCUS_06790 1717 2712 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392883.1 protein_id gnl|my_center|LOCUS_06790 2816 3715 gene locus_tag LOCUS_06800 2816 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 3914 6175 gene locus_tag LOCUS_06810 3914 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 7327 6230 gene locus_tag LOCUS_06820 7327 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 7600 8232 gene locus_tag LOCUS_06830 7600 8232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 8275 8919 gene locus_tag LOCUS_06840 8275 8919 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816806.1 protein_id gnl|my_center|LOCUS_06840 8932 9942 gene locus_tag LOCUS_06850 8932 9942 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816804.1 protein_id gnl|my_center|LOCUS_06850 9957 10235 gene locus_tag LOCUS_06860 9957 10235 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 protein_id gnl|my_center|LOCUS_06860 10289 11104 gene locus_tag LOCUS_06870 gene lpxI 10289 11104 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_06870 11101 12228 gene locus_tag LOCUS_06880 gene lpxB 11101 12228 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_06880 12359 14221 gene locus_tag LOCUS_06890 12359 14221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 15014 14211 gene locus_tag LOCUS_06900 15014 14211 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_06900 15164 16288 gene locus_tag LOCUS_06910 15164 16288 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_06910 19715 16272 gene locus_tag LOCUS_06920 19715 16272 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_06920 21088 19793 gene locus_tag LOCUS_06930 gene mtaB 21088 19793 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_06930 >Feature sequence026 313 1491 gene locus_tag LOCUS_06940 313 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 2107 1565 gene locus_tag LOCUS_06950 2107 1565 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020471.1 protein_id gnl|my_center|LOCUS_06950 3157 2126 gene locus_tag LOCUS_06960 3157 2126 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_06960 4097 3150 gene locus_tag LOCUS_06970 4097 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 4670 4101 gene locus_tag LOCUS_06980 4670 4101 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818015.1 protein_id gnl|my_center|LOCUS_06980 5920 4679 gene locus_tag LOCUS_06990 5920 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 6034 6930 gene locus_tag LOCUS_07000 6034 6930 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_07000 6970 7917 gene locus_tag LOCUS_07010 6970 7917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 7892 8605 gene locus_tag LOCUS_07020 7892 8605 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058255.1 protein_id gnl|my_center|LOCUS_07020 8653 9024 gene locus_tag LOCUS_07030 8653 9024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 9121 11541 gene locus_tag LOCUS_07040 9121 11541 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_07040 12116 11601 gene locus_tag LOCUS_07050 12116 11601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 12309 13112 gene locus_tag LOCUS_07060 12309 13112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 13349 13158 gene locus_tag LOCUS_07070 gene rpmB 13349 13158 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775872.1 protein_id gnl|my_center|LOCUS_07070 13565 14557 gene locus_tag LOCUS_07080 13565 14557 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_07080 14561 16444 gene locus_tag LOCUS_07090 gene dnaG 14561 16444 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357766.1 protein_id gnl|my_center|LOCUS_07090 16450 17559 gene locus_tag LOCUS_07100 gene rpoD 16450 17559 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_07100 17723 20272 gene locus_tag LOCUS_07110 17723 20272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 21134 20265 gene locus_tag LOCUS_07120 21134 20265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 >Feature sequence027 2171 690 gene locus_tag LOCUS_07130 2171 690 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546649.1 protein_id gnl|my_center|LOCUS_07130 3026 2184 gene locus_tag LOCUS_07140 3026 2184 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862498.1 protein_id gnl|my_center|LOCUS_07140 4339 3023 gene locus_tag LOCUS_07150 4339 3023 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810342.1 protein_id gnl|my_center|LOCUS_07150 4958 4332 gene locus_tag LOCUS_07160 4958 4332 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962669.1 protein_id gnl|my_center|LOCUS_07160 5108 6514 gene locus_tag LOCUS_07170 5108 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 6604 6732 gene locus_tag LOCUS_07180 6604 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 7084 6848 gene locus_tag LOCUS_07190 7084 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 8115 7132 gene locus_tag LOCUS_07200 8115 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 8251 9768 gene locus_tag LOCUS_07210 gene gpmI 8251 9768 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964031.1 protein_id gnl|my_center|LOCUS_07210 10756 9815 gene locus_tag LOCUS_07220 10756 9815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 10907 13555 gene locus_tag LOCUS_07230 gene valS 10907 13555 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398606.1 protein_id gnl|my_center|LOCUS_07230 13734 14684 gene locus_tag LOCUS_07240 13734 14684 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_07240 15115 14738 gene locus_tag LOCUS_07250 15115 14738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 15155 15847 gene locus_tag LOCUS_07260 15155 15847 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948716.1 protein_id gnl|my_center|LOCUS_07260 19028 15852 gene locus_tag LOCUS_07270 19028 15852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 19255 21420 gene locus_tag LOCUS_07280 19255 21420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 21537 21612 gene locus_tag LOCUS_t00130 21537 21612 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence028 <1 947 gene locus_tag LOCUS_07290 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460838.1:glycine--tRNA ligase subunit alpha 1016 2569 gene locus_tag LOCUS_07300 1016 2569 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809373.1 protein_id gnl|my_center|LOCUS_07300 4401 2629 gene locus_tag LOCUS_07310 4401 2629 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392090.1 protein_id gnl|my_center|LOCUS_07310 4642 5991 gene locus_tag LOCUS_07320 gene glnA 4642 5991 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393265.1 protein_id gnl|my_center|LOCUS_07320 7634 6087 gene locus_tag LOCUS_07330 7634 6087 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143918059.1 protein_id gnl|my_center|LOCUS_07330 6100 6175 gene locus_tag LOCUS_t00140 6100 6175 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 7773 7636 gene locus_tag LOCUS_07340 7773 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 8824 7874 gene locus_tag LOCUS_07350 8824 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 9435 8899 gene locus_tag LOCUS_07360 9435 8899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 10474 9488 gene locus_tag LOCUS_07370 10474 9488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 10632 10952 gene locus_tag LOCUS_07380 10632 10952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 11962 10961 gene locus_tag LOCUS_07390 11962 10961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 12627 12037 gene locus_tag LOCUS_07400 12627 12037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 13815 12895 gene locus_tag LOCUS_07410 13815 12895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 15824 13815 gene locus_tag LOCUS_07420 15824 13815 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942936.1 protein_id gnl|my_center|LOCUS_07420 17200 16292 gene locus_tag LOCUS_07430 17200 16292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 17336 17656 gene locus_tag LOCUS_07440 17336 17656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 18650 17679 gene locus_tag LOCUS_07450 18650 17679 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943586.1 protein_id gnl|my_center|LOCUS_07450 18726 18986 gene locus_tag LOCUS_07460 18726 18986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 19130 19510 gene locus_tag LOCUS_07470 19130 19510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 20447 19557 gene locus_tag LOCUS_07480 20447 19557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 20628 21506 gene locus_tag LOCUS_07490 20628 21506 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393185.1 protein_id gnl|my_center|LOCUS_07490 21562 21648 gene locus_tag LOCUS_t00150 21562 21648 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence029 940 818 gene locus_tag LOCUS_07500 940 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 2215 1217 gene locus_tag LOCUS_07510 2215 1217 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_07510 2947 2255 gene locus_tag LOCUS_07520 2947 2255 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_07520 5403 3160 gene locus_tag LOCUS_07530 5403 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 5587 6528 gene locus_tag LOCUS_07540 5587 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 9533 6531 gene locus_tag LOCUS_07550 9533 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 9681 10631 gene locus_tag LOCUS_07560 9681 10631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 10663 11676 gene locus_tag LOCUS_07570 10663 11676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 13173 11671 gene locus_tag LOCUS_07580 13173 11671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 13308 13589 gene locus_tag LOCUS_07590 gene gatC 13308 13589 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_07590 13635 15269 gene locus_tag LOCUS_07600 gene pyrG 13635 15269 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227612.1 protein_id gnl|my_center|LOCUS_07600 16201 15314 gene locus_tag LOCUS_07610 gene era 16201 15314 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359745.1 protein_id gnl|my_center|LOCUS_07610 18041 16188 gene locus_tag LOCUS_07620 18041 16188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 18362 18437 gene locus_tag LOCUS_t00160 18362 18437 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 19866 18544 gene locus_tag LOCUS_07630 19866 18544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 20134 20206 gene locus_tag LOCUS_t00170 20134 20206 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 20573 20232 gene locus_tag LOCUS_07640 20573 20232 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096609.1 protein_id gnl|my_center|LOCUS_07640 <21611 20638 gene locus_tag LOCUS_07650 <21611 20638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932198.1:deoxyribodipyrimidine photo-lyase >Feature sequence030 243 2108 gene locus_tag LOCUS_07660 243 2108 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367282.1 protein_id gnl|my_center|LOCUS_07660 2108 2590 gene locus_tag LOCUS_07670 gene tsaE 2108 2590 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722335.1 protein_id gnl|my_center|LOCUS_07670 2571 3245 gene locus_tag LOCUS_07680 gene tsaB 2571 3245 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860649.1 protein_id gnl|my_center|LOCUS_07680 3238 3522 gene locus_tag LOCUS_07690 3238 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 3855 3583 gene locus_tag LOCUS_07700 3855 3583 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043904.1 protein_id gnl|my_center|LOCUS_07700 5500 3959 gene locus_tag LOCUS_07710 5500 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 5608 6642 gene locus_tag LOCUS_07720 gene pheS 5608 6642 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436795.1 protein_id gnl|my_center|LOCUS_07720 6646 7404 gene locus_tag LOCUS_07730 gene hisF 6646 7404 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080486.1 protein_id gnl|my_center|LOCUS_07730 7404 7994 gene locus_tag LOCUS_07740 7404 7994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 8053 9027 gene locus_tag LOCUS_07750 8053 9027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 9020 9712 gene locus_tag LOCUS_07760 gene queC 9020 9712 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496801.1 protein_id gnl|my_center|LOCUS_07760 9715 10278 gene locus_tag LOCUS_07770 9715 10278 CDS product DUF366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251187.1 protein_id gnl|my_center|LOCUS_07770 10278 10943 gene locus_tag LOCUS_07780 10278 10943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 11527 11009 gene locus_tag LOCUS_07790 11527 11009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 12897 11782 gene locus_tag LOCUS_07800 12897 11782 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140933.1 protein_id gnl|my_center|LOCUS_07800 14132 12933 gene locus_tag LOCUS_07810 14132 12933 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920974.1 protein_id gnl|my_center|LOCUS_07810 14190 15419 gene locus_tag LOCUS_07820 14190 15419 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_07820 15483 15992 gene locus_tag LOCUS_07830 15483 15992 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878337.1 protein_id gnl|my_center|LOCUS_07830 16053 16553 gene locus_tag LOCUS_07840 16053 16553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 16671 17183 gene locus_tag LOCUS_07850 16671 17183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 18837 17245 gene locus_tag LOCUS_07860 gene serA 18837 17245 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056180.1 protein_id gnl|my_center|LOCUS_07860 19997 18846 gene locus_tag LOCUS_07870 19997 18846 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147561507.1 protein_id gnl|my_center|LOCUS_07870 20225 20752 gene locus_tag LOCUS_07880 20225 20752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 >Feature sequence031 290 1618 gene locus_tag LOCUS_07890 290 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 1667 1951 gene locus_tag LOCUS_07900 1667 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 2022 3671 gene locus_tag LOCUS_07910 2022 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 3777 4724 gene locus_tag LOCUS_07920 3777 4724 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810938.1 protein_id gnl|my_center|LOCUS_07920 4746 6014 gene locus_tag LOCUS_07930 4746 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 6018 6806 gene locus_tag LOCUS_07940 6018 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 7864 6803 gene locus_tag LOCUS_07950 7864 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 8538 7864 gene locus_tag LOCUS_07960 8538 7864 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695801.1 protein_id gnl|my_center|LOCUS_07960 10070 8526 gene locus_tag LOCUS_07970 10070 8526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 12050 10131 gene locus_tag LOCUS_07980 12050 10131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 13404 12196 gene locus_tag LOCUS_07990 gene tuf 13404 12196 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057587.1 protein_id gnl|my_center|LOCUS_07990 13540 13469 gene locus_tag LOCUS_t00180 13540 13469 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 13738 13654 gene locus_tag LOCUS_t00190 13738 13654 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 13840 13769 gene locus_tag LOCUS_t00200 13840 13769 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14023 14346 gene locus_tag LOCUS_08000 gene trxA 14023 14346 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125291.1 protein_id gnl|my_center|LOCUS_08000 14358 14816 gene locus_tag LOCUS_08010 14358 14816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 14875 15363 gene locus_tag LOCUS_08020 14875 15363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 15470 16363 gene locus_tag LOCUS_08030 15470 16363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 16445 17755 gene locus_tag LOCUS_08040 16445 17755 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545541.1 protein_id gnl|my_center|LOCUS_08040 17767 19020 gene locus_tag LOCUS_08050 17767 19020 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083007.1 protein_id gnl|my_center|LOCUS_08050 19020 19520 gene locus_tag LOCUS_08060 19020 19520 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879257.1 protein_id gnl|my_center|LOCUS_08060 19531 20526 gene locus_tag LOCUS_08070 19531 20526 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127350626.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence032 2230 146 gene locus_tag LOCUS_08080 gene fusA 2230 146 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057586.1 protein_id gnl|my_center|LOCUS_08080 2451 2681 gene locus_tag LOCUS_08090 2451 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 2756 4042 gene locus_tag LOCUS_08100 gene asnS 2756 4042 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583296.1 protein_id gnl|my_center|LOCUS_08100 4138 4611 gene locus_tag LOCUS_08110 gene ruvC 4138 4611 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902123.1 protein_id gnl|my_center|LOCUS_08110 5083 4574 gene locus_tag LOCUS_08120 5083 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 5068 6123 gene locus_tag LOCUS_08130 gene mtnA 5068 6123 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080652.1 protein_id gnl|my_center|LOCUS_08130 6189 6656 gene locus_tag LOCUS_08140 6189 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 6790 7782 gene locus_tag LOCUS_08150 gene gshB 6790 7782 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482451.1 protein_id gnl|my_center|LOCUS_08150 7766 9055 gene locus_tag LOCUS_08160 7766 9055 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401210.1 protein_id gnl|my_center|LOCUS_08160 10371 9067 gene locus_tag LOCUS_08170 10371 9067 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583823.1 protein_id gnl|my_center|LOCUS_08170 10914 10462 gene locus_tag LOCUS_08180 10914 10462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 11046 12059 gene locus_tag LOCUS_08190 gene aroF 11046 12059 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083125.1 protein_id gnl|my_center|LOCUS_08190 13345 12116 gene locus_tag LOCUS_08200 13345 12116 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_08200 14064 13348 gene locus_tag LOCUS_08210 14064 13348 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546598.1 protein_id gnl|my_center|LOCUS_08210 15205 14066 gene locus_tag LOCUS_08220 15205 14066 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_08220 16617 15205 gene locus_tag LOCUS_08230 16617 15205 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545697.1 protein_id gnl|my_center|LOCUS_08230 17379 16768 gene locus_tag LOCUS_08240 17379 16768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 18020 17442 gene locus_tag LOCUS_08250 18020 17442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 18141 20057 gene locus_tag LOCUS_08260 gene malQ 18141 20057 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016706.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence033 840 1343 gene locus_tag LOCUS_08270 840 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 1411 2214 gene locus_tag LOCUS_08280 1411 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 2283 3449 gene locus_tag LOCUS_08290 2283 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 3481 4116 gene locus_tag LOCUS_08300 3481 4116 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141141.1 protein_id gnl|my_center|LOCUS_08300 4126 4641 gene locus_tag LOCUS_08310 4126 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 4653 5042 gene locus_tag LOCUS_08320 4653 5042 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141140.1 protein_id gnl|my_center|LOCUS_08320 5526 5050 gene locus_tag LOCUS_08330 gene ispF 5526 5050 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015827.1 protein_id gnl|my_center|LOCUS_08330 6322 5519 gene locus_tag LOCUS_08340 6322 5519 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454798.1 protein_id gnl|my_center|LOCUS_08340 6849 6319 gene locus_tag LOCUS_08350 6849 6319 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986429.1 protein_id gnl|my_center|LOCUS_08350 6943 7668 gene locus_tag LOCUS_08360 6943 7668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 7665 8369 gene locus_tag LOCUS_08370 7665 8369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 8419 8871 gene locus_tag LOCUS_08380 8419 8871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 11512 8897 gene locus_tag LOCUS_08390 gene alaS 11512 8897 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016588.1 protein_id gnl|my_center|LOCUS_08390 11867 11679 gene locus_tag LOCUS_08400 11867 11679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 12702 12001 gene locus_tag LOCUS_08410 12702 12001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 12981 14093 gene locus_tag LOCUS_08420 12981 14093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 14106 14924 gene locus_tag LOCUS_08430 gene minD 14106 14924 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816779.1 protein_id gnl|my_center|LOCUS_08430 14928 15401 gene locus_tag LOCUS_08440 14928 15401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 15636 15433 gene locus_tag LOCUS_08450 15636 15433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 15828 15904 gene locus_tag LOCUS_t00210 15828 15904 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 16394 17239 gene locus_tag LOCUS_08460 16394 17239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 17256 17708 gene locus_tag LOCUS_08470 17256 17708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 <19552 17933 gene locus_tag LOCUS_08480 <19552 17933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860904.1:glycosylating toxin TcdA >Feature sequence034 289 1053 gene locus_tag LOCUS_08490 289 1053 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519040.1 protein_id gnl|my_center|LOCUS_08490 1580 1080 gene locus_tag LOCUS_08500 1580 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 2578 1580 gene locus_tag LOCUS_08510 2578 1580 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946576.1 protein_id gnl|my_center|LOCUS_08510 2673 4487 gene locus_tag LOCUS_08520 2673 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 4557 6290 gene locus_tag LOCUS_08530 4557 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 6379 6621 gene locus_tag LOCUS_08540 6379 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 6671 7768 gene locus_tag LOCUS_08550 gene dprA 6671 7768 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546585.1 protein_id gnl|my_center|LOCUS_08550 7775 10054 gene locus_tag LOCUS_08560 gene topA 7775 10054 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_08560 10057 10908 gene locus_tag LOCUS_08570 gene aroE 10057 10908 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812076.1 protein_id gnl|my_center|LOCUS_08570 12261 10912 gene locus_tag LOCUS_08580 gene fliI 12261 10912 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082899.1 protein_id gnl|my_center|LOCUS_08580 14368 12266 gene locus_tag LOCUS_08590 gene flhA 14368 12266 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870057.1 protein_id gnl|my_center|LOCUS_08590 15178 14375 gene locus_tag LOCUS_08600 15178 14375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 16166 15168 gene locus_tag LOCUS_08610 16166 15168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 17832 16183 gene locus_tag LOCUS_08620 17832 16183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 18271 17930 gene locus_tag LOCUS_08630 18271 17930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 18997 18287 gene locus_tag LOCUS_08640 18997 18287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 19463 19020 gene locus_tag LOCUS_08650 gene flgC 19463 19020 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence035 2964 316 gene locus_tag LOCUS_08660 gene ppdK 2964 316 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 protein_id gnl|my_center|LOCUS_08660 3692 3057 gene locus_tag LOCUS_08670 3692 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 4534 3692 gene locus_tag LOCUS_08680 4534 3692 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_08680 5365 4553 gene locus_tag LOCUS_08690 5365 4553 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904102.1 protein_id gnl|my_center|LOCUS_08690 6929 5469 gene locus_tag LOCUS_08700 gene rny 6929 5469 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_08700 7230 7315 gene locus_tag LOCUS_t00220 7230 7315 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9426 7420 gene locus_tag LOCUS_08710 9426 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 10029 9532 gene locus_tag LOCUS_08720 10029 9532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 10756 10052 gene locus_tag LOCUS_08730 gene pnuC 10756 10052 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003026840.1 protein_id gnl|my_center|LOCUS_08730 10830 11918 gene locus_tag LOCUS_08740 10830 11918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 12235 11921 gene locus_tag LOCUS_08750 12235 11921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 13811 12261 gene locus_tag LOCUS_08760 13811 12261 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_08760 14917 13808 gene locus_tag LOCUS_08770 14917 13808 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545031.1 protein_id gnl|my_center|LOCUS_08770 14994 16382 gene locus_tag LOCUS_08780 14994 16382 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188537.1 protein_id gnl|my_center|LOCUS_08780 17121 16456 gene locus_tag LOCUS_08790 17121 16456 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994186.1 protein_id gnl|my_center|LOCUS_08790 17234 17794 gene locus_tag LOCUS_08800 17234 17794 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203642.1 protein_id gnl|my_center|LOCUS_08800 18790 17810 gene locus_tag LOCUS_08810 18790 17810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 <19420 18815 gene locus_tag LOCUS_08820 <19420 18815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544988.1:M48 family metalloprotease >Feature sequence036 499 1938 gene locus_tag LOCUS_08830 gene pyk 499 1938 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_08830 2398 1994 gene locus_tag LOCUS_08840 2398 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 5265 2398 gene locus_tag LOCUS_08850 gene polA 5265 2398 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140638.1 protein_id gnl|my_center|LOCUS_08850 6828 5521 gene locus_tag LOCUS_08860 6828 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 8187 7027 gene locus_tag LOCUS_08870 8187 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 9048 8515 gene locus_tag LOCUS_08880 9048 8515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 9206 9481 gene locus_tag LOCUS_08890 9206 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 10230 9610 gene locus_tag LOCUS_08900 10230 9610 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355669.1 protein_id gnl|my_center|LOCUS_08900 10348 11094 gene locus_tag LOCUS_08910 10348 11094 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583818.1 protein_id gnl|my_center|LOCUS_08910 11151 11498 gene locus_tag LOCUS_08920 gene panD 11151 11498 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142250.1 protein_id gnl|my_center|LOCUS_08920 11959 11495 gene locus_tag LOCUS_08930 11959 11495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 15883 12032 gene locus_tag LOCUS_08940 15883 12032 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144262.1 protein_id gnl|my_center|LOCUS_08940 17623 15908 gene locus_tag LOCUS_08950 gene rpoC1 17623 15908 CDS product DNA-directed RNA polymerase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144261.1 protein_id gnl|my_center|LOCUS_08950 <19121 17693 gene locus_tag LOCUS_08960 <19121 17693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056489.1:DNA-directed RNA polymerase subunit beta >Feature sequence037 459 1295 gene locus_tag LOCUS_08970 459 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 2912 1371 gene locus_tag LOCUS_08980 2912 1371 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_08980 3117 2983 gene locus_tag LOCUS_08990 3117 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 3401 4069 gene locus_tag LOCUS_09000 gene sdaAB 3401 4069 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922792.1 protein_id gnl|my_center|LOCUS_09000 4071 4970 gene locus_tag LOCUS_09010 gene sdaAA 4071 4970 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356262.1 protein_id gnl|my_center|LOCUS_09010 4972 5295 gene locus_tag LOCUS_09020 4972 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 6502 5324 gene locus_tag LOCUS_09030 6502 5324 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461084.1 protein_id gnl|my_center|LOCUS_09030 6641 8014 gene locus_tag LOCUS_09040 gene gltA 6641 8014 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_09040 8353 8069 gene locus_tag LOCUS_09050 8353 8069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 8619 8443 gene locus_tag LOCUS_09060 8619 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 8585 8860 gene locus_tag LOCUS_09070 8585 8860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 8921 9466 gene locus_tag LOCUS_09080 8921 9466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 10161 9475 gene locus_tag LOCUS_09090 10161 9475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 10365 10607 gene locus_tag LOCUS_09100 10365 10607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 10962 10690 gene locus_tag LOCUS_09110 gene rpsT 10962 10690 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902954.1 protein_id gnl|my_center|LOCUS_09110 11162 12739 gene locus_tag LOCUS_09120 11162 12739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 13438 12857 gene locus_tag LOCUS_09130 13438 12857 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830169.1 protein_id gnl|my_center|LOCUS_09130 14185 13442 gene locus_tag LOCUS_09140 14185 13442 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424529.1 protein_id gnl|my_center|LOCUS_09140 14432 16975 gene locus_tag LOCUS_09150 gene gyrA 14432 16975 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143075.1 protein_id gnl|my_center|LOCUS_09150 16968 17342 gene locus_tag LOCUS_09160 16968 17342 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385301.1 protein_id gnl|my_center|LOCUS_09160 17342 17791 gene locus_tag LOCUS_09170 gene dtd 17342 17791 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence038 1276 977 gene locus_tag LOCUS_09180 1276 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 1568 1290 gene locus_tag LOCUS_09190 1568 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1840 2916 gene locus_tag LOCUS_09200 1840 2916 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107732.1 protein_id gnl|my_center|LOCUS_09200 3645 2917 gene locus_tag LOCUS_09210 3645 2917 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258445.1 protein_id gnl|my_center|LOCUS_09210 3958 3635 gene locus_tag LOCUS_09220 3958 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 4297 3962 gene locus_tag LOCUS_09230 4297 3962 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546430.1 protein_id gnl|my_center|LOCUS_09230 5123 4362 gene locus_tag LOCUS_09240 5123 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 5191 6528 gene locus_tag LOCUS_09250 gene mnmE 5191 6528 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359423.1 protein_id gnl|my_center|LOCUS_09250 6641 7711 gene locus_tag LOCUS_09260 6641 7711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 9207 7708 gene locus_tag LOCUS_09270 9207 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 9818 9207 gene locus_tag LOCUS_09280 gene plsY 9818 9207 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531489.1 protein_id gnl|my_center|LOCUS_09280 11143 9815 gene locus_tag LOCUS_09290 gene der 11143 9815 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727996.1 protein_id gnl|my_center|LOCUS_09290 11260 12744 gene locus_tag LOCUS_09300 11260 12744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 13608 12727 gene locus_tag LOCUS_09310 13608 12727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 13679 15175 gene locus_tag LOCUS_09320 gene lysS 13679 15175 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056067.1 protein_id gnl|my_center|LOCUS_09320 15277 15570 gene locus_tag LOCUS_09330 15277 15570 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_09330 15644 18013 gene locus_tag LOCUS_09340 15644 18013 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_09340 18631 18086 gene locus_tag LOCUS_09350 18631 18086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence039 <1 500 gene locus_tag LOCUS_09360 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002856815.1:S41 family peptidase 1038 3293 gene locus_tag LOCUS_09370 1038 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 3510 4094 gene locus_tag LOCUS_09380 3510 4094 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057791.1 protein_id gnl|my_center|LOCUS_09380 4256 6664 gene locus_tag LOCUS_09390 4256 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 9489 6661 gene locus_tag LOCUS_09400 9489 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 10446 9553 gene locus_tag LOCUS_09410 gene murQ 10446 9553 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948949.1 protein_id gnl|my_center|LOCUS_09410 11296 10439 gene locus_tag LOCUS_09420 gene ispE 11296 10439 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772104.1 protein_id gnl|my_center|LOCUS_09420 12129 11293 gene locus_tag LOCUS_09430 gene rsmA 12129 11293 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986025.1 protein_id gnl|my_center|LOCUS_09430 12168 12626 gene locus_tag LOCUS_09440 12168 12626 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208442.1 protein_id gnl|my_center|LOCUS_09440 13137 12676 gene locus_tag LOCUS_09450 gene accB 13137 12676 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921156.1 protein_id gnl|my_center|LOCUS_09450 13706 13149 gene locus_tag LOCUS_09460 gene efp 13706 13149 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_09460 14545 13802 gene locus_tag LOCUS_09470 14545 13802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 15207 14563 gene locus_tag LOCUS_09480 15207 14563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 15620 15207 gene locus_tag LOCUS_09490 15620 15207 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870191.1 protein_id gnl|my_center|LOCUS_09490 17180 15711 gene locus_tag LOCUS_09500 17180 15711 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930810.1 protein_id gnl|my_center|LOCUS_09500 18504 17191 gene locus_tag LOCUS_09510 18504 17191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence040 1592 1517 gene locus_tag LOCUS_t00230 1592 1517 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1731 2612 gene locus_tag LOCUS_09520 1731 2612 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932822.1 protein_id gnl|my_center|LOCUS_09520 2653 3135 gene locus_tag LOCUS_09530 2653 3135 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_09530 3132 4304 gene locus_tag LOCUS_09540 3132 4304 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_09540 4696 4301 gene locus_tag LOCUS_09550 gene crcB 4696 4301 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871047.1 protein_id gnl|my_center|LOCUS_09550 5518 4706 gene locus_tag LOCUS_09560 5518 4706 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_09560 5605 7038 gene locus_tag LOCUS_09570 5605 7038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 7654 7028 gene locus_tag LOCUS_09580 gene metW 7654 7028 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188046.1 protein_id gnl|my_center|LOCUS_09580 8792 7647 gene locus_tag LOCUS_09590 8792 7647 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990604.1 protein_id gnl|my_center|LOCUS_09590 10068 8803 gene locus_tag LOCUS_09600 10068 8803 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 protein_id gnl|my_center|LOCUS_09600 11572 10166 gene locus_tag LOCUS_09610 11572 10166 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038455.1 protein_id gnl|my_center|LOCUS_09610 12575 11565 gene locus_tag LOCUS_09620 12575 11565 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428573.1 protein_id gnl|my_center|LOCUS_09620 13363 12575 gene locus_tag LOCUS_09630 13363 12575 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_09630 14267 13425 gene locus_tag LOCUS_09640 gene nadC 14267 13425 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_09640 15884 14274 gene locus_tag LOCUS_09650 gene nadB 15884 14274 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583120.1 protein_id gnl|my_center|LOCUS_09650 17517 15979 gene locus_tag LOCUS_09660 17517 15979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 <18505 17574 gene locus_tag LOCUS_09670 <18505 17574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000690025.1:N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA >Feature sequence041 238 678 gene locus_tag LOCUS_09680 238 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 718 1968 gene locus_tag LOCUS_09690 718 1968 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627649.1 protein_id gnl|my_center|LOCUS_09690 1965 2444 gene locus_tag LOCUS_09700 1965 2444 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831044.1 protein_id gnl|my_center|LOCUS_09700 2579 2884 gene locus_tag LOCUS_09710 gene trxA 2579 2884 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254147.1 protein_id gnl|my_center|LOCUS_09710 3990 2935 gene locus_tag LOCUS_09720 3990 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 4414 3983 gene locus_tag LOCUS_09730 4414 3983 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044348005.1 protein_id gnl|my_center|LOCUS_09730 4531 5124 gene locus_tag LOCUS_09740 gene coaE 4531 5124 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926374.1 protein_id gnl|my_center|LOCUS_09740 7636 5114 gene locus_tag LOCUS_09750 7636 5114 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257049.1 protein_id gnl|my_center|LOCUS_09750 8148 7660 gene locus_tag LOCUS_09760 8148 7660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 9509 8427 gene locus_tag LOCUS_09770 gene leuB 9509 8427 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812648.1 protein_id gnl|my_center|LOCUS_09770 10356 9523 gene locus_tag LOCUS_09780 10356 9523 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202149.1 protein_id gnl|my_center|LOCUS_09780 10811 10443 gene locus_tag LOCUS_09790 10811 10443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 11297 10842 gene locus_tag LOCUS_09800 11297 10842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 11545 11676 gene locus_tag LOCUS_09810 11545 11676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 12326 11700 gene locus_tag LOCUS_09820 12326 11700 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_09820 12395 13276 gene locus_tag LOCUS_09830 gene rnhC 12395 13276 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883701.1 protein_id gnl|my_center|LOCUS_09830 14342 13278 gene locus_tag LOCUS_09840 gene dnaJ 14342 13278 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119021.1 protein_id gnl|my_center|LOCUS_09840 14521 16503 gene locus_tag LOCUS_09850 14521 16503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 16490 17335 gene locus_tag LOCUS_09860 gene dapF 16490 17335 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546632.1 protein_id gnl|my_center|LOCUS_09860 >Feature sequence042 337 498 gene locus_tag LOCUS_09870 337 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 1272 499 gene locus_tag LOCUS_09880 gene glnH 1272 499 CDS product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245954.1 protein_id gnl|my_center|LOCUS_09880 2180 1341 gene locus_tag LOCUS_09890 2180 1341 CDS product YhjD/YihY/BrkB family envelope integrity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963807.1 protein_id gnl|my_center|LOCUS_09890 3148 2177 gene locus_tag LOCUS_09900 3148 2177 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583572.1 protein_id gnl|my_center|LOCUS_09900 3334 3771 gene locus_tag LOCUS_09910 3334 3771 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461316.1 protein_id gnl|my_center|LOCUS_09910 3833 4630 gene locus_tag LOCUS_09920 3833 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 5697 4660 gene locus_tag LOCUS_09930 5697 4660 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140373.1 protein_id gnl|my_center|LOCUS_09930 6704 5694 gene locus_tag LOCUS_09940 6704 5694 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980425.1 protein_id gnl|my_center|LOCUS_09940 7486 6752 gene locus_tag LOCUS_09950 gene trmD 7486 6752 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384686.1 protein_id gnl|my_center|LOCUS_09950 7998 7483 gene locus_tag LOCUS_09960 gene rimM 7998 7483 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261987.1 protein_id gnl|my_center|LOCUS_09960 8873 8001 gene locus_tag LOCUS_09970 8873 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 10117 9086 gene locus_tag LOCUS_09980 gene rlmN 10117 9086 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082231.1 protein_id gnl|my_center|LOCUS_09980 10241 10537 gene locus_tag LOCUS_09990 gene rpsF 10241 10537 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420522.1 protein_id gnl|my_center|LOCUS_09990 10552 10959 gene locus_tag LOCUS_10000 gene ssb 10552 10959 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583716.1 protein_id gnl|my_center|LOCUS_10000 10986 11219 gene locus_tag LOCUS_10010 gene rpsR 10986 11219 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_10010 11972 11271 gene locus_tag LOCUS_10020 11972 11271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 12658 12047 gene locus_tag LOCUS_10030 12658 12047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 12756 16241 gene locus_tag LOCUS_10040 12756 16241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence043 2182 4635 gene locus_tag LOCUS_10050 gene pheT 2182 4635 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498186.1 protein_id gnl|my_center|LOCUS_10050 4882 5100 gene locus_tag LOCUS_10060 4882 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 6492 5161 gene locus_tag LOCUS_10070 6492 5161 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_10070 6645 7310 gene locus_tag LOCUS_10080 6645 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 7360 8769 gene locus_tag LOCUS_10090 gene murC 7360 8769 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583606.1 protein_id gnl|my_center|LOCUS_10090 8770 9690 gene locus_tag LOCUS_10100 gene murB 8770 9690 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_10100 9648 10601 gene locus_tag LOCUS_10110 9648 10601 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_10110 10601 11440 gene locus_tag LOCUS_10120 10601 11440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 11607 12146 gene locus_tag LOCUS_10130 gene rpsE 11607 12146 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055952.1 protein_id gnl|my_center|LOCUS_10130 12160 12342 gene locus_tag LOCUS_10140 gene rpmD 12160 12342 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690310.1 protein_id gnl|my_center|LOCUS_10140 12360 12812 gene locus_tag LOCUS_10150 gene rplO 12360 12812 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143897.1 protein_id gnl|my_center|LOCUS_10150 12812 14155 gene locus_tag LOCUS_10160 gene secY 12812 14155 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055954.1 protein_id gnl|my_center|LOCUS_10160 14264 14920 gene locus_tag LOCUS_10170 14264 14920 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_10170 14922 15674 gene locus_tag LOCUS_10180 gene map 14922 15674 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_10180 15685 16194 gene locus_tag LOCUS_10190 15685 16194 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920972.1 protein_id gnl|my_center|LOCUS_10190 16345 16166 gene locus_tag LOCUS_10200 16345 16166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 16421 16621 gene locus_tag LOCUS_10210 16421 16621 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007190.1 protein_id gnl|my_center|LOCUS_10210 16740 17234 gene locus_tag LOCUS_10220 gene rplI 16740 17234 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429267.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence044 2314 1784 gene locus_tag LOCUS_10230 2314 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 2731 2318 gene locus_tag LOCUS_10240 2731 2318 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074029.1 protein_id gnl|my_center|LOCUS_10240 4305 2758 gene locus_tag LOCUS_10250 4305 2758 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208349.1 protein_id gnl|my_center|LOCUS_10250 4703 4302 gene locus_tag LOCUS_10260 4703 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 4954 4700 gene locus_tag LOCUS_10270 4954 4700 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074023.1 protein_id gnl|my_center|LOCUS_10270 5204 4947 gene locus_tag LOCUS_10280 5204 4947 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074022.1 protein_id gnl|my_center|LOCUS_10280 6485 5262 gene locus_tag LOCUS_10290 6485 5262 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261528.1 protein_id gnl|my_center|LOCUS_10290 7210 6482 gene locus_tag LOCUS_10300 gene fabG 7210 6482 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266390.1 protein_id gnl|my_center|LOCUS_10300 7665 7216 gene locus_tag LOCUS_10310 7665 7216 CDS product hotdog family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460561.1 protein_id gnl|my_center|LOCUS_10310 8741 7668 gene locus_tag LOCUS_10320 8741 7668 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074034.1 protein_id gnl|my_center|LOCUS_10320 8783 9391 gene locus_tag LOCUS_10330 8783 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 9393 10127 gene locus_tag LOCUS_10340 9393 10127 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222117.1 protein_id gnl|my_center|LOCUS_10340 10851 10153 gene locus_tag LOCUS_10350 10851 10153 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016732.1 protein_id gnl|my_center|LOCUS_10350 11070 10994 gene locus_tag LOCUS_t00240 11070 10994 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 11416 11123 gene locus_tag LOCUS_10360 11416 11123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 12636 11434 gene locus_tag LOCUS_10370 12636 11434 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583240.1 protein_id gnl|my_center|LOCUS_10370 14777 12651 gene locus_tag LOCUS_10380 gene pilB 14777 12651 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546013.1 protein_id gnl|my_center|LOCUS_10380 16570 14789 gene locus_tag LOCUS_10390 16570 14789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 17601 16594 gene locus_tag LOCUS_10400 17601 16594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 >Feature sequence045 364 155 gene locus_tag LOCUS_10410 gene yidD 364 155 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718107.1 protein_id gnl|my_center|LOCUS_10410 2099 366 gene locus_tag LOCUS_10420 2099 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 3419 2121 gene locus_tag LOCUS_10430 gene gcvPA 3419 2121 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583867.1 protein_id gnl|my_center|LOCUS_10430 3801 3421 gene locus_tag LOCUS_10440 gene gcvH 3801 3421 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723327.1 protein_id gnl|my_center|LOCUS_10440 4921 3818 gene locus_tag LOCUS_10450 4921 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 6310 4937 gene locus_tag LOCUS_10460 6310 4937 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_10460 6434 6904 gene locus_tag LOCUS_10470 gene rlmH 6434 6904 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048404.1 protein_id gnl|my_center|LOCUS_10470 7053 7511 gene locus_tag LOCUS_10480 7053 7511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 7522 8847 gene locus_tag LOCUS_10490 7522 8847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 8844 9116 gene locus_tag LOCUS_10500 8844 9116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 9100 9411 gene locus_tag LOCUS_10510 9100 9411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 9395 9706 gene locus_tag LOCUS_10520 9395 9706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 9928 10224 gene locus_tag LOCUS_10530 9928 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 10217 11527 gene locus_tag LOCUS_10540 10217 11527 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996384.1 protein_id gnl|my_center|LOCUS_10540 11544 12026 gene locus_tag LOCUS_10550 11544 12026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 12124 12324 gene locus_tag LOCUS_10560 12124 12324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 12326 13981 gene locus_tag LOCUS_10570 12326 13981 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852428.1 protein_id gnl|my_center|LOCUS_10570 13994 14596 gene locus_tag LOCUS_10580 13994 14596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 14621 15616 gene locus_tag LOCUS_10590 14621 15616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123829849.1 protein_id gnl|my_center|LOCUS_10590 15631 16029 gene locus_tag LOCUS_10600 15631 16029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 16113 16703 gene locus_tag LOCUS_10610 16113 16703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179259.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence046 272 1570 gene locus_tag LOCUS_10620 272 1570 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936956.1 protein_id gnl|my_center|LOCUS_10620 1555 1842 gene locus_tag LOCUS_10630 1555 1842 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811676.1 protein_id gnl|my_center|LOCUS_10630 1858 2286 gene locus_tag LOCUS_10640 1858 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 2301 4703 gene locus_tag LOCUS_10650 gene recJ 2301 4703 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476160.1 protein_id gnl|my_center|LOCUS_10650 4697 5701 gene locus_tag LOCUS_10660 4697 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 5758 6108 gene locus_tag LOCUS_10670 5758 6108 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141555.1 protein_id gnl|my_center|LOCUS_10670 8641 6155 gene locus_tag LOCUS_10680 gene leuS 8641 6155 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_10680 8810 9118 gene locus_tag LOCUS_10690 8810 9118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 10020 9115 gene locus_tag LOCUS_10700 10020 9115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 11006 10017 gene locus_tag LOCUS_10710 11006 10017 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143105.1 protein_id gnl|my_center|LOCUS_10710 11355 11008 gene locus_tag LOCUS_10720 11355 11008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 11495 12163 gene locus_tag LOCUS_10730 11495 12163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 13360 12170 gene locus_tag LOCUS_10740 13360 12170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 13538 14242 gene locus_tag LOCUS_10750 13538 14242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 14549 14992 gene locus_tag LOCUS_10760 14549 14992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 15689 15156 gene locus_tag LOCUS_10770 15689 15156 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694080.1 protein_id gnl|my_center|LOCUS_10770 15812 16165 gene locus_tag LOCUS_10780 15812 16165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 16234 16887 gene locus_tag LOCUS_10790 16234 16887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10790 >Feature sequence047 2680 1028 gene locus_tag LOCUS_10800 gene recN 2680 1028 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 protein_id gnl|my_center|LOCUS_10800 3533 2682 gene locus_tag LOCUS_10810 3533 2682 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_10810 4096 3542 gene locus_tag LOCUS_10820 4096 3542 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380327.1 protein_id gnl|my_center|LOCUS_10820 5735 4086 gene locus_tag LOCUS_10830 5735 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 6867 5746 gene locus_tag LOCUS_10840 gene dnaJ 6867 5746 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124172.1 protein_id gnl|my_center|LOCUS_10840 7539 6892 gene locus_tag LOCUS_10850 7539 6892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 7686 8681 gene locus_tag LOCUS_10860 7686 8681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 9664 8678 gene locus_tag LOCUS_10870 9664 8678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 10646 9672 gene locus_tag LOCUS_10880 10646 9672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 11527 10649 gene locus_tag LOCUS_10890 11527 10649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 11666 12820 gene locus_tag LOCUS_10900 11666 12820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 12946 14292 gene locus_tag LOCUS_10910 12946 14292 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713291.1 protein_id gnl|my_center|LOCUS_10910 15796 14300 gene locus_tag LOCUS_10920 15796 14300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence048 910 164 gene locus_tag LOCUS_10930 910 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1454 924 gene locus_tag LOCUS_10940 1454 924 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583029.1 protein_id gnl|my_center|LOCUS_10940 1632 3692 gene locus_tag LOCUS_10950 1632 3692 CDS product DUF262 and DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203121.1 protein_id gnl|my_center|LOCUS_10950 4247 3798 gene locus_tag LOCUS_10960 4247 3798 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986313.1 protein_id gnl|my_center|LOCUS_10960 4775 4296 gene locus_tag LOCUS_10970 4775 4296 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986313.1 protein_id gnl|my_center|LOCUS_10970 5271 5441 gene locus_tag LOCUS_10980 5271 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 6346 5366 gene locus_tag LOCUS_10990 6346 5366 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801979.1 protein_id gnl|my_center|LOCUS_10990 7112 8230 gene locus_tag LOCUS_11000 7112 8230 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964085.1 protein_id gnl|my_center|LOCUS_11000 8260 8946 gene locus_tag LOCUS_11010 8260 8946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 9095 9976 gene locus_tag LOCUS_11020 gene ylqF 9095 9976 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967235.1 protein_id gnl|my_center|LOCUS_11020 10115 11929 gene locus_tag LOCUS_11030 gene typA 10115 11929 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183842.1 protein_id gnl|my_center|LOCUS_11030 12163 12666 gene locus_tag LOCUS_11040 12163 12666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 15622 12731 gene locus_tag LOCUS_11050 15622 12731 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948376.1 protein_id gnl|my_center|LOCUS_11050 >Feature sequence049 899 2626 gene locus_tag LOCUS_11060 899 2626 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170127867.1 protein_id gnl|my_center|LOCUS_11060 3012 3146 gene locus_tag LOCUS_11070 3012 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 3115 3378 gene locus_tag LOCUS_11080 3115 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 3375 3833 gene locus_tag LOCUS_11090 3375 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 3826 4146 gene locus_tag LOCUS_11100 3826 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 4159 4407 gene locus_tag LOCUS_11110 4159 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 4466 4858 gene locus_tag LOCUS_11120 4466 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 4868 5161 gene locus_tag LOCUS_11130 4868 5161 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965349.1 protein_id gnl|my_center|LOCUS_11130 5155 5895 gene locus_tag LOCUS_11140 5155 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 5852 6487 gene locus_tag LOCUS_11150 5852 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 6531 6704 gene locus_tag LOCUS_11160 6531 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 6664 7158 gene locus_tag LOCUS_11170 6664 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11170 7151 7399 gene locus_tag LOCUS_11180 7151 7399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 7449 7673 gene locus_tag LOCUS_11190 7449 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 7725 7895 gene locus_tag LOCUS_11200 7725 7895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 7855 9207 gene locus_tag LOCUS_11210 7855 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 9191 10099 gene locus_tag LOCUS_11220 9191 10099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 10214 10405 gene locus_tag LOCUS_11230 10214 10405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11230 10421 10795 gene locus_tag LOCUS_11240 10421 10795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 10837 11460 gene locus_tag LOCUS_11250 10837 11460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 11527 12240 gene locus_tag LOCUS_11260 11527 12240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 12312 14885 gene locus_tag LOCUS_11270 12312 14885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 14949 15221 gene locus_tag LOCUS_11280 14949 15221 CDS product septation protein SpoVG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879274.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence050 1430 561 gene locus_tag LOCUS_11290 gene sucD 1430 561 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881050.1 protein_id gnl|my_center|LOCUS_11290 2560 1430 gene locus_tag LOCUS_11300 gene sucC 2560 1430 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690686.1 protein_id gnl|my_center|LOCUS_11300 3928 2561 gene locus_tag LOCUS_11310 3928 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 4443 3928 gene locus_tag LOCUS_11320 4443 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 5486 4452 gene locus_tag LOCUS_11330 gene rfaE1 5486 4452 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_11330 5566 6198 gene locus_tag LOCUS_11340 5566 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 7941 6262 gene locus_tag LOCUS_11350 7941 6262 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760603.1 protein_id gnl|my_center|LOCUS_11350 8076 8426 gene locus_tag LOCUS_11360 8076 8426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 9411 8419 gene locus_tag LOCUS_11370 9411 8419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 10880 9414 gene locus_tag LOCUS_11380 gene gltX 10880 9414 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399675.1 protein_id gnl|my_center|LOCUS_11380 11025 12110 gene locus_tag LOCUS_11390 11025 12110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 12114 12920 gene locus_tag LOCUS_11400 12114 12920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 12938 13888 gene locus_tag LOCUS_11410 12938 13888 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932202.1 protein_id gnl|my_center|LOCUS_11410 13891 14553 gene locus_tag LOCUS_11420 13891 14553 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209768.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence051 1877 2191 gene locus_tag LOCUS_11430 1877 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 3251 2196 gene locus_tag LOCUS_11440 gene tsaD 3251 2196 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_11440 3322 4587 gene locus_tag LOCUS_11450 gene leuC 3322 4587 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545762.1 protein_id gnl|my_center|LOCUS_11450 4601 6079 gene locus_tag LOCUS_11460 4601 6079 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_11460 6081 6665 gene locus_tag LOCUS_11470 6081 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 6655 7815 gene locus_tag LOCUS_11480 6655 7815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 7854 9320 gene locus_tag LOCUS_11490 7854 9320 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016217.1 protein_id gnl|my_center|LOCUS_11490 9322 11658 gene locus_tag LOCUS_11500 9322 11658 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027389.1 protein_id gnl|my_center|LOCUS_11500 12295 11666 gene locus_tag LOCUS_11510 12295 11666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 12444 13394 gene locus_tag LOCUS_11520 12444 13394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 13436 14266 gene locus_tag LOCUS_11530 13436 14266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 14278 14982 gene locus_tag LOCUS_11540 14278 14982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence052 55 714 gene locus_tag LOCUS_11550 55 714 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721391.1 protein_id gnl|my_center|LOCUS_11550 732 1181 gene locus_tag LOCUS_11560 732 1181 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_11560 1191 1688 gene locus_tag LOCUS_11570 1191 1688 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578443.1 protein_id gnl|my_center|LOCUS_11570 1685 2773 gene locus_tag LOCUS_11580 1685 2773 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476426.1 protein_id gnl|my_center|LOCUS_11580 2792 3910 gene locus_tag LOCUS_11590 2792 3910 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476426.1 protein_id gnl|my_center|LOCUS_11590 3932 4891 gene locus_tag LOCUS_11600 3932 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 4905 5942 gene locus_tag LOCUS_11610 4905 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 5943 7061 gene locus_tag LOCUS_11620 gene glf 5943 7061 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057797519.1 protein_id gnl|my_center|LOCUS_11620 7067 8500 gene locus_tag LOCUS_11630 7067 8500 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549892.1 protein_id gnl|my_center|LOCUS_11630 8504 9664 gene locus_tag LOCUS_11640 8504 9664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 9672 10331 gene locus_tag LOCUS_11650 9672 10331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 10349 11344 gene locus_tag LOCUS_11660 10349 11344 CDS product stealth family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225420236.1 protein_id gnl|my_center|LOCUS_11660 11473 14715 gene locus_tag LOCUS_11670 11473 14715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence053 252 1358 gene locus_tag LOCUS_11680 252 1358 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368910.1 protein_id gnl|my_center|LOCUS_11680 1688 1560 gene locus_tag LOCUS_11690 1688 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 2160 1759 gene locus_tag LOCUS_11700 2160 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 3389 2244 gene locus_tag LOCUS_11710 3389 2244 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138985883.1 protein_id gnl|my_center|LOCUS_11710 4846 3389 gene locus_tag LOCUS_11720 4846 3389 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_11720 5980 5003 gene locus_tag LOCUS_11730 5980 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 7120 6110 gene locus_tag LOCUS_11740 7120 6110 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524103.1 protein_id gnl|my_center|LOCUS_11740 8433 7120 gene locus_tag LOCUS_11750 gene glmU 8433 7120 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015965.1 protein_id gnl|my_center|LOCUS_11750 8621 9016 gene locus_tag LOCUS_11760 8621 9016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 9059 10336 gene locus_tag LOCUS_11770 gene aroA 9059 10336 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545275.1 protein_id gnl|my_center|LOCUS_11770 11063 10326 gene locus_tag LOCUS_11780 11063 10326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 12754 11081 gene locus_tag LOCUS_11790 12754 11081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 13432 12764 gene locus_tag LOCUS_11800 13432 12764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 14963 13470 gene locus_tag LOCUS_11810 14963 13470 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_11810 15134 14964 gene locus_tag LOCUS_11820 15134 14964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 >Feature sequence054 1998 463 gene locus_tag LOCUS_11830 1998 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 2531 2013 gene locus_tag LOCUS_11840 gene scpB 2531 2013 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879077.1 protein_id gnl|my_center|LOCUS_11840 3416 2541 gene locus_tag LOCUS_11850 3416 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 6918 3421 gene locus_tag LOCUS_11860 gene smc 6918 3421 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024214.1 protein_id gnl|my_center|LOCUS_11860 7084 8175 gene locus_tag LOCUS_11870 7084 8175 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861983.1 protein_id gnl|my_center|LOCUS_11870 8182 8946 gene locus_tag LOCUS_11880 gene recO 8182 8946 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861552.1 protein_id gnl|my_center|LOCUS_11880 8948 9592 gene locus_tag LOCUS_11890 gene deoC 8948 9592 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448021.1 protein_id gnl|my_center|LOCUS_11890 9905 9579 gene locus_tag LOCUS_11900 9905 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 11667 9907 gene locus_tag LOCUS_11910 11667 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 13996 11660 gene locus_tag LOCUS_11920 13996 11660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 >Feature sequence055 1218 283 gene locus_tag LOCUS_11930 1218 283 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125980453.1 protein_id gnl|my_center|LOCUS_11930 2766 1219 gene locus_tag LOCUS_11940 2766 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674710.1 protein_id gnl|my_center|LOCUS_11940 4148 2763 gene locus_tag LOCUS_11950 4148 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 5715 4588 gene locus_tag LOCUS_11960 5715 4588 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643284.1 protein_id gnl|my_center|LOCUS_11960 6731 5721 gene locus_tag LOCUS_11970 6731 5721 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908873.1 protein_id gnl|my_center|LOCUS_11970 8157 6715 gene locus_tag LOCUS_11980 8157 6715 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549892.1 protein_id gnl|my_center|LOCUS_11980 9404 8286 gene locus_tag LOCUS_11990 gene glf 9404 8286 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057797519.1 protein_id gnl|my_center|LOCUS_11990 10482 9409 gene locus_tag LOCUS_12000 gene waaB 10482 9409 CDS product lipopolysaccharide 1,6-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704702.1 protein_id gnl|my_center|LOCUS_12000 11516 10494 gene locus_tag LOCUS_12010 11516 10494 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475868.1 protein_id gnl|my_center|LOCUS_12010 12072 11533 gene locus_tag LOCUS_12020 12072 11533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 13346 12150 gene locus_tag LOCUS_12030 13346 12150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476397.1 protein_id gnl|my_center|LOCUS_12030 14013 13366 gene locus_tag LOCUS_12040 14013 13366 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966340.1 protein_id gnl|my_center|LOCUS_12040 <14882 14025 gene locus_tag LOCUS_12050 <14882 14025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547856.1:glycosyltransferase family 2 protein >Feature sequence056 491 2281 gene locus_tag LOCUS_12060 491 2281 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256840.1 protein_id gnl|my_center|LOCUS_12060 2296 3141 gene locus_tag LOCUS_12070 2296 3141 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256841.1 protein_id gnl|my_center|LOCUS_12070 3151 4344 gene locus_tag LOCUS_12080 3151 4344 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071432.1 protein_id gnl|my_center|LOCUS_12080 4337 4876 gene locus_tag LOCUS_12090 4337 4876 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_12090 5126 4860 gene locus_tag LOCUS_12100 5126 4860 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422778.1 protein_id gnl|my_center|LOCUS_12100 6102 5119 gene locus_tag LOCUS_12110 gene dusB 6102 5119 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_12110 8213 6102 gene locus_tag LOCUS_12120 8213 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 8383 9555 gene locus_tag LOCUS_12130 8383 9555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 9809 10303 gene locus_tag LOCUS_12140 gene nuoE 9809 10303 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081672.1 protein_id gnl|my_center|LOCUS_12140 10303 12165 gene locus_tag LOCUS_12150 gene nuoF 10303 12165 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393387.1 protein_id gnl|my_center|LOCUS_12150 12184 13935 gene locus_tag LOCUS_12160 12184 13935 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence057 14 1216 gene locus_tag LOCUS_12170 14 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1223 3235 gene locus_tag LOCUS_12180 1223 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 3238 4431 gene locus_tag LOCUS_12190 3238 4431 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475870.1 protein_id gnl|my_center|LOCUS_12190 4435 5643 gene locus_tag LOCUS_12200 4435 5643 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475870.1 protein_id gnl|my_center|LOCUS_12200 5636 7102 gene locus_tag LOCUS_12210 5636 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 7111 8640 gene locus_tag LOCUS_12220 7111 8640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 8710 9249 gene locus_tag LOCUS_12230 8710 9249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 9408 10568 gene locus_tag LOCUS_12240 gene ftsZ 9408 10568 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171980.1 protein_id gnl|my_center|LOCUS_12240 13469 10626 gene locus_tag LOCUS_12250 13469 10626 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence058 141 980 gene locus_tag LOCUS_12260 141 980 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837306.1 protein_id gnl|my_center|LOCUS_12260 982 1548 gene locus_tag LOCUS_12270 982 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1563 2420 gene locus_tag LOCUS_12280 1563 2420 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870104.1 protein_id gnl|my_center|LOCUS_12280 2433 3224 gene locus_tag LOCUS_12290 2433 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 3205 4020 gene locus_tag LOCUS_12300 3205 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 5054 4017 gene locus_tag LOCUS_12310 5054 4017 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202723.1 protein_id gnl|my_center|LOCUS_12310 5141 5374 gene locus_tag LOCUS_12320 5141 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 5600 5815 gene locus_tag LOCUS_12330 5600 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 5815 6015 gene locus_tag LOCUS_12340 5815 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 5999 6232 gene locus_tag LOCUS_12350 5999 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 6650 6237 gene locus_tag LOCUS_12360 6650 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 8606 6660 gene locus_tag LOCUS_12370 8606 6660 CDS product transposase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115265087.1 protein_id gnl|my_center|LOCUS_12370 10379 9651 gene locus_tag LOCUS_12380 10379 9651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 12361 10382 gene locus_tag LOCUS_12390 12361 10382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 12848 12516 gene locus_tag LOCUS_12400 12848 12516 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459853.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence059 999 1985 gene locus_tag LOCUS_12410 999 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1989 2966 gene locus_tag LOCUS_12420 1989 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 4038 2998 gene locus_tag LOCUS_12430 4038 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 4266 5261 gene locus_tag LOCUS_12440 4266 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 6275 5262 gene locus_tag LOCUS_12450 6275 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 6374 7357 gene locus_tag LOCUS_12460 6374 7357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 8765 7362 gene locus_tag LOCUS_12470 8765 7362 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899369.1 protein_id gnl|my_center|LOCUS_12470 9021 9233 gene locus_tag LOCUS_12480 9021 9233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 10015 9323 gene locus_tag LOCUS_12490 10015 9323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 10682 10113 gene locus_tag LOCUS_12500 10682 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 <12833 10706 gene locus_tag LOCUS_12510 <12833 10706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948003.1:CoA-disulfide reductase >Feature sequence060 740 2122 gene locus_tag LOCUS_12520 740 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 2137 3177 gene locus_tag LOCUS_12530 2137 3177 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109299.1 protein_id gnl|my_center|LOCUS_12530 3665 3174 gene locus_tag LOCUS_12540 3665 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 4445 3744 gene locus_tag LOCUS_12550 gene rph 4445 3744 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545252.1 protein_id gnl|my_center|LOCUS_12550 4518 6089 gene locus_tag LOCUS_12560 gene metG 4518 6089 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_12560 6093 7202 gene locus_tag LOCUS_12570 gene prfB 6093 7202 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126988096.1 protein_id gnl|my_center|LOCUS_12570 7292 8617 gene locus_tag LOCUS_12580 7292 8617 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545236.1 protein_id gnl|my_center|LOCUS_12580 9632 8682 gene locus_tag LOCUS_12590 9632 8682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 10221 9646 gene locus_tag LOCUS_12600 10221 9646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 10298 11344 gene locus_tag LOCUS_12610 10298 11344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 11434 11509 gene locus_tag LOCUS_t00250 11434 11509 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 12229 12675 gene locus_tag LOCUS_12620 12229 12675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence061 820 173 gene locus_tag LOCUS_12630 820 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 1029 2486 gene locus_tag LOCUS_12640 1029 2486 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_12640 3769 2522 gene locus_tag LOCUS_12650 gene fabF 3769 2522 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_12650 6203 3879 gene locus_tag LOCUS_12660 gene mngB 6203 3879 CDS product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861603.1 protein_id gnl|my_center|LOCUS_12660 7079 6243 gene locus_tag LOCUS_12670 7079 6243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 7454 7140 gene locus_tag LOCUS_12680 gene cutA 7454 7140 CDS product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883400.1 protein_id gnl|my_center|LOCUS_12680 8855 7455 gene locus_tag LOCUS_12690 8855 7455 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545342.1 protein_id gnl|my_center|LOCUS_12690 9082 9705 gene locus_tag LOCUS_12700 9082 9705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 9898 9719 gene locus_tag LOCUS_12710 9898 9719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 10759 9911 gene locus_tag LOCUS_12720 10759 9911 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932161.1 protein_id gnl|my_center|LOCUS_12720 11287 10913 gene locus_tag LOCUS_12730 11287 10913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 <12665 11416 gene locus_tag LOCUS_12740 <12665 11416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010990137.1:DNA internalization-related competence protein ComEC/Rec2 >Feature sequence062 871 1464 gene locus_tag LOCUS_12750 871 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1468 2097 gene locus_tag LOCUS_12760 gene ruvA 1468 2097 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426582.1 protein_id gnl|my_center|LOCUS_12760 2110 3558 gene locus_tag LOCUS_12770 gene glgA 2110 3558 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042515450.1 protein_id gnl|my_center|LOCUS_12770 4417 3560 gene locus_tag LOCUS_12780 4417 3560 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529142.1 protein_id gnl|my_center|LOCUS_12780 5084 4500 gene locus_tag LOCUS_12790 5084 4500 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057791.1 protein_id gnl|my_center|LOCUS_12790 5182 5514 gene locus_tag LOCUS_12800 5182 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 5515 8019 gene locus_tag LOCUS_12810 5515 8019 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545608.1 protein_id gnl|my_center|LOCUS_12810 8047 9858 gene locus_tag LOCUS_12820 8047 9858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 9869 10261 gene locus_tag LOCUS_12830 9869 10261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 10839 10258 gene locus_tag LOCUS_12840 gene yihA 10839 10258 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965924.1 protein_id gnl|my_center|LOCUS_12840 11053 10808 gene locus_tag LOCUS_12850 11053 10808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 <12611 11115 gene locus_tag LOCUS_12860 <12611 11115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880520.1:tetratricopeptide repeat protein >Feature sequence063 554 108 gene locus_tag LOCUS_12870 554 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1506 571 gene locus_tag LOCUS_12880 gene rsmH 1506 571 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_12880 1671 2369 gene locus_tag LOCUS_12890 1671 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 3465 2383 gene locus_tag LOCUS_12900 gene prfA 3465 2383 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056003.1 protein_id gnl|my_center|LOCUS_12900 4169 3471 gene locus_tag LOCUS_12910 gene thyX 4169 3471 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459086.1 protein_id gnl|my_center|LOCUS_12910 4453 4253 gene locus_tag LOCUS_12920 gene rpmE 4453 4253 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_12920 4702 5292 gene locus_tag LOCUS_12930 4702 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 5406 6215 gene locus_tag LOCUS_12940 5406 6215 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867247.1 protein_id gnl|my_center|LOCUS_12940 6227 6493 gene locus_tag LOCUS_12950 6227 6493 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929315.1 protein_id gnl|my_center|LOCUS_12950 7134 6496 gene locus_tag LOCUS_12960 7134 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 7651 7124 gene locus_tag LOCUS_12970 gene rimI 7651 7124 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243019.1 protein_id gnl|my_center|LOCUS_12970 7780 8286 gene locus_tag LOCUS_12980 7780 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 8341 9429 gene locus_tag LOCUS_12990 gene hemW 8341 9429 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836907.1 protein_id gnl|my_center|LOCUS_12990 10136 9435 gene locus_tag LOCUS_13000 10136 9435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 10276 11031 gene locus_tag LOCUS_13010 10276 11031 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_13010 11033 11839 gene locus_tag LOCUS_13020 11033 11839 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965376.1 protein_id gnl|my_center|LOCUS_13020 12071 11841 gene locus_tag LOCUS_13030 12071 11841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence064 534 887 gene locus_tag LOCUS_13040 534 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1107 2096 gene locus_tag LOCUS_13050 1107 2096 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_13050 2086 2253 gene locus_tag LOCUS_13060 2086 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 2274 3620 gene locus_tag LOCUS_13070 2274 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 6138 3925 gene locus_tag LOCUS_13080 6138 3925 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929091.1 protein_id gnl|my_center|LOCUS_13080 6233 6559 gene locus_tag LOCUS_13090 6233 6559 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870123.1 protein_id gnl|my_center|LOCUS_13090 6570 6794 gene locus_tag LOCUS_13100 6570 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 7278 6844 gene locus_tag LOCUS_13110 gene dut 7278 6844 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016845.1 protein_id gnl|my_center|LOCUS_13110 8261 7281 gene locus_tag LOCUS_13120 8261 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 9125 8262 gene locus_tag LOCUS_13130 gene panC 9125 8262 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966198.1 protein_id gnl|my_center|LOCUS_13130 9963 9103 gene locus_tag LOCUS_13140 gene panB 9963 9103 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439367.1 protein_id gnl|my_center|LOCUS_13140 11291 9963 gene locus_tag LOCUS_13150 11291 9963 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144150.1 protein_id gnl|my_center|LOCUS_13150 12074 11304 gene locus_tag LOCUS_13160 12074 11304 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868110.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence065 140 1762 gene locus_tag LOCUS_13170 140 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 1780 3003 gene locus_tag LOCUS_13180 1780 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 4319 3048 gene locus_tag LOCUS_13190 gene metK 4319 3048 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142571.1 protein_id gnl|my_center|LOCUS_13190 4721 4446 gene locus_tag LOCUS_13200 gene rpsO 4721 4446 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005890045.1 protein_id gnl|my_center|LOCUS_13200 5059 4844 gene locus_tag LOCUS_13210 5059 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 6326 5094 gene locus_tag LOCUS_13220 6326 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 6415 6603 gene locus_tag LOCUS_13230 6415 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 6734 7327 gene locus_tag LOCUS_13240 6734 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 7341 8021 gene locus_tag LOCUS_13250 7341 8021 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_13250 8272 8853 gene locus_tag LOCUS_13260 8272 8853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 8853 9989 gene locus_tag LOCUS_13270 8853 9989 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460229.1 protein_id gnl|my_center|LOCUS_13270 10082 11683 gene locus_tag LOCUS_13280 10082 11683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 12061 11684 gene locus_tag LOCUS_13290 12061 11684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence066 <1 852 gene locus_tag LOCUS_13300 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009903674.1:folylpolyglutamate synthase/dihydrofolate synthase family protein 2218 854 gene locus_tag LOCUS_13310 gene dnaB 2218 854 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_13310 2837 2262 gene locus_tag LOCUS_13320 2837 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 3324 2842 gene locus_tag LOCUS_13330 gene coaD 3324 2842 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459625.1 protein_id gnl|my_center|LOCUS_13330 5036 3429 gene locus_tag LOCUS_13340 5036 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 5383 5066 gene locus_tag LOCUS_13350 5383 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 6500 5403 gene locus_tag LOCUS_13360 gene ribD 6500 5403 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896839.1 protein_id gnl|my_center|LOCUS_13360 7108 6500 gene locus_tag LOCUS_13370 7108 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 7175 9748 gene locus_tag LOCUS_13380 gene mutS 7175 9748 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047675.1 protein_id gnl|my_center|LOCUS_13380 9760 11283 gene locus_tag LOCUS_13390 9760 11283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence067 123 461 gene locus_tag LOCUS_13400 123 461 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940772.1 protein_id gnl|my_center|LOCUS_13400 464 1063 gene locus_tag LOCUS_13410 gene recR 464 1063 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722062.1 protein_id gnl|my_center|LOCUS_13410 1074 1250 gene locus_tag LOCUS_13420 1074 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 2313 1255 gene locus_tag LOCUS_13430 gene ugpC 2313 1255 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_13430 3467 2316 gene locus_tag LOCUS_13440 3467 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 4504 3572 gene locus_tag LOCUS_13450 gene rpoD 4504 3572 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_13450 5144 4572 gene locus_tag LOCUS_13460 5144 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 5822 5154 gene locus_tag LOCUS_13470 5822 5154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 5939 7258 gene locus_tag LOCUS_13480 5939 7258 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965427.1 protein_id gnl|my_center|LOCUS_13480 7261 8235 gene locus_tag LOCUS_13490 gene mraY 7261 8235 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358738.1 protein_id gnl|my_center|LOCUS_13490 8229 9593 gene locus_tag LOCUS_13500 gene murD 8229 9593 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286638.1 protein_id gnl|my_center|LOCUS_13500 9574 10710 gene locus_tag LOCUS_13510 gene ftsW 9574 10710 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_13510 10700 11824 gene locus_tag LOCUS_13520 gene murG 10700 11824 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232184.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence068 920 9 gene locus_tag LOCUS_13530 920 9 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201896.1 protein_id gnl|my_center|LOCUS_13530 1098 1751 gene locus_tag LOCUS_13540 1098 1751 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902988.1 protein_id gnl|my_center|LOCUS_13540 1751 2431 gene locus_tag LOCUS_13550 1751 2431 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897858.1 protein_id gnl|my_center|LOCUS_13550 2602 2474 gene locus_tag LOCUS_13560 2602 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 3938 2613 gene locus_tag LOCUS_13570 3938 2613 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545236.1 protein_id gnl|my_center|LOCUS_13570 4195 3938 gene locus_tag LOCUS_13580 4195 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 4691 4275 gene locus_tag LOCUS_13590 4691 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 5135 4779 gene locus_tag LOCUS_13600 5135 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 6346 5717 gene locus_tag LOCUS_13610 6346 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 6993 6346 gene locus_tag LOCUS_13620 gene ktrA 6993 6346 CDS product potassium uptake protein KtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243377.1 protein_id gnl|my_center|LOCUS_13620 8348 7005 gene locus_tag LOCUS_13630 8348 7005 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015791.1 protein_id gnl|my_center|LOCUS_13630 8797 8441 gene locus_tag LOCUS_13640 8797 8441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 9041 9361 gene locus_tag LOCUS_13650 gene sugE 9041 9361 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705814.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence069 1591 1409 gene locus_tag LOCUS_13660 1591 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 3439 1592 gene locus_tag LOCUS_13670 gene glmS 3439 1592 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142212.1 protein_id gnl|my_center|LOCUS_13670 3704 4426 gene locus_tag LOCUS_13680 3704 4426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 4512 4585 gene locus_tag LOCUS_t00260 4512 4585 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6427 4844 gene locus_tag LOCUS_13690 6427 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 7167 6703 gene locus_tag LOCUS_13700 7167 6703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 9084 7264 gene locus_tag LOCUS_13710 9084 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 9229 10434 gene locus_tag LOCUS_13720 gene ilvA 9229 10434 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_13720 <11953 10435 gene locus_tag LOCUS_13730 <11953 10435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403289.1:ATP-dependent helicase >Feature sequence070 310 2874 gene locus_tag LOCUS_13740 310 2874 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963004.1 protein_id gnl|my_center|LOCUS_13740 2846 4849 gene locus_tag LOCUS_13750 2846 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 6077 4860 gene locus_tag LOCUS_13760 6077 4860 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_13760 8524 6629 gene locus_tag LOCUS_13770 8524 6629 CDS product DUF3732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466016.1 protein_id gnl|my_center|LOCUS_13770 9000 8524 gene locus_tag LOCUS_13780 9000 8524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 10141 8990 gene locus_tag LOCUS_13790 10141 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654528.1 protein_id gnl|my_center|LOCUS_13790 10850 10641 gene locus_tag LOCUS_13800 10850 10641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence071 1193 360 gene locus_tag LOCUS_13810 1193 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 2554 1205 gene locus_tag LOCUS_13820 2554 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 3897 2554 gene locus_tag LOCUS_13830 3897 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 4414 4196 gene locus_tag LOCUS_13840 4414 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 4553 4395 gene locus_tag LOCUS_13850 4553 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 4876 4550 gene locus_tag LOCUS_13860 4876 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 5111 4899 gene locus_tag LOCUS_13870 5111 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 5279 5902 gene locus_tag LOCUS_13880 5279 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 5916 6386 gene locus_tag LOCUS_13890 5916 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 6410 6820 gene locus_tag LOCUS_13900 6410 6820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 6835 8487 gene locus_tag LOCUS_13910 6835 8487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 8789 8496 gene locus_tag LOCUS_13920 8789 8496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 9189 8773 gene locus_tag LOCUS_13930 9189 8773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 9843 9193 gene locus_tag LOCUS_13940 9843 9193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 10019 9840 gene locus_tag LOCUS_13950 10019 9840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 10611 9967 gene locus_tag LOCUS_13960 10611 9967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 10819 10604 gene locus_tag LOCUS_13970 10819 10604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 11398 10823 gene locus_tag LOCUS_13980 11398 10823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence072 3 1973 gene locus_tag LOCUS_13990 3 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 2800 1970 gene locus_tag LOCUS_14000 gene hpnK 2800 1970 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941812.1 protein_id gnl|my_center|LOCUS_14000 2862 3818 gene locus_tag LOCUS_14010 2862 3818 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245533.1 protein_id gnl|my_center|LOCUS_14010 3967 3815 gene locus_tag LOCUS_14020 3967 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 4078 4494 gene locus_tag LOCUS_14030 4078 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 4566 5297 gene locus_tag LOCUS_14040 4566 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 5291 5509 gene locus_tag LOCUS_14050 5291 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 5541 7349 gene locus_tag LOCUS_14060 5541 7349 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 protein_id gnl|my_center|LOCUS_14060 7360 8547 gene locus_tag LOCUS_14070 7360 8547 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 protein_id gnl|my_center|LOCUS_14070 8640 10301 gene locus_tag LOCUS_14080 8640 10301 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262712.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence073 94 1461 gene locus_tag LOCUS_14090 94 1461 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965635.1 protein_id gnl|my_center|LOCUS_14090 1471 2460 gene locus_tag LOCUS_14100 1471 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 2728 2576 gene locus_tag LOCUS_14110 2728 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 2685 3326 gene locus_tag LOCUS_14120 2685 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 3420 5234 gene locus_tag LOCUS_14130 3420 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 5665 6639 gene locus_tag LOCUS_14140 5665 6639 CDS product LdpA C-terminal domain-containing domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866389.1 protein_id gnl|my_center|LOCUS_14140 6632 7387 gene locus_tag LOCUS_14150 6632 7387 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416645.1 protein_id gnl|my_center|LOCUS_14150 7624 8859 gene locus_tag LOCUS_14160 7624 8859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 8938 10251 gene locus_tag LOCUS_14170 8938 10251 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964731.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence074 39 2156 gene locus_tag LOCUS_14180 39 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 3414 2161 gene locus_tag LOCUS_14190 gene waaA 3414 2161 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444132.1 protein_id gnl|my_center|LOCUS_14190 6112 3416 gene locus_tag LOCUS_14200 gene secA 6112 3416 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_14200 6301 6720 gene locus_tag LOCUS_14210 6301 6720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 6948 7568 gene locus_tag LOCUS_14220 6948 7568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 7717 8331 gene locus_tag LOCUS_14230 7717 8331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 8489 8899 gene locus_tag LOCUS_14240 8489 8899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 8884 9549 gene locus_tag LOCUS_14250 8884 9549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 <10489 9700 gene locus_tag LOCUS_14260 <10489 9700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009994423.1:PIF1 family DEAD/DEAH box helicase >Feature sequence075 948 316 gene locus_tag LOCUS_14270 948 316 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459715.1 protein_id gnl|my_center|LOCUS_14270 1331 951 gene locus_tag LOCUS_14280 1331 951 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104373.1 protein_id gnl|my_center|LOCUS_14280 1433 1777 gene locus_tag LOCUS_14290 1433 1777 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420359.1 protein_id gnl|my_center|LOCUS_14290 2570 2181 gene locus_tag LOCUS_tm00010 2570 2181 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 3618 2635 gene locus_tag LOCUS_14300 3618 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 3779 5500 gene locus_tag LOCUS_14310 3779 5500 CDS product 1,4-alpha-glucan branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867884.1 protein_id gnl|my_center|LOCUS_14310 6286 5546 gene locus_tag LOCUS_14320 6286 5546 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227700.1 protein_id gnl|my_center|LOCUS_14320 7237 6383 gene locus_tag LOCUS_14330 7237 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 8030 7275 gene locus_tag LOCUS_14340 8030 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 8284 8117 gene locus_tag LOCUS_14350 8284 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 9607 8468 gene locus_tag LOCUS_14360 9607 8468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 10377 9709 gene locus_tag LOCUS_14370 10377 9709 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694643.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence076 <1 1551 gene locus_tag LOCUS_14380 <1 1551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048366.1:ATP-dependent Clp protease ATP-binding subunit 1741 1968 gene locus_tag LOCUS_14390 1741 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 2813 1965 gene locus_tag LOCUS_14400 gene lipA 2813 1965 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_14400 3214 2819 gene locus_tag LOCUS_14410 gene gloA 3214 2819 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017084654.1 protein_id gnl|my_center|LOCUS_14410 3937 3257 gene locus_tag LOCUS_14420 3937 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 4559 3951 gene locus_tag LOCUS_14430 4559 3951 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057943.1 protein_id gnl|my_center|LOCUS_14430 4675 5145 gene locus_tag LOCUS_14440 4675 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 5210 5285 gene locus_tag LOCUS_t00270 5210 5285 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6107 5325 gene locus_tag LOCUS_14450 6107 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 6789 6244 gene locus_tag LOCUS_14460 6789 6244 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_14460 7731 6880 gene locus_tag LOCUS_14470 7731 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 7921 7748 gene locus_tag LOCUS_14480 7921 7748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 8434 7964 gene locus_tag LOCUS_14490 gene mscL 8434 7964 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932912.1 protein_id gnl|my_center|LOCUS_14490 8786 8439 gene locus_tag LOCUS_14500 8786 8439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 9542 9024 gene locus_tag LOCUS_14510 9542 9024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 10231 9926 gene locus_tag LOCUS_14520 10231 9926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence077 <1 833 gene locus_tag LOCUS_14530 <1 833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393817.1:DUF4127 family protein 870 2651 gene locus_tag LOCUS_14540 gene thrS 870 2651 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_14540 3728 2694 gene locus_tag LOCUS_14550 3728 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 3825 4862 gene locus_tag LOCUS_14560 3825 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 4874 7537 gene locus_tag LOCUS_14570 4874 7537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 8243 7545 gene locus_tag LOCUS_14580 8243 7545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 8912 8259 gene locus_tag LOCUS_14590 8912 8259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 9092 10096 gene locus_tag LOCUS_14600 gene gap 9092 10096 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360478.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence078 109 570 gene locus_tag LOCUS_14610 109 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 560 1573 gene locus_tag LOCUS_14620 gene hydE 560 1573 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964939.1 protein_id gnl|my_center|LOCUS_14620 1745 4573 gene locus_tag LOCUS_14630 gene uvrA 1745 4573 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 protein_id gnl|my_center|LOCUS_14630 5014 4628 gene locus_tag LOCUS_14640 5014 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 6230 5151 gene locus_tag LOCUS_14650 gene rpsA 6230 5151 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360341.1 protein_id gnl|my_center|LOCUS_14650 7095 6247 gene locus_tag LOCUS_14660 gene ispH 7095 6247 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544912.1 protein_id gnl|my_center|LOCUS_14660 8693 7230 gene locus_tag LOCUS_14670 8693 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 8847 9674 gene locus_tag LOCUS_14680 8847 9674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence079 1800 1709 gene locus_tag LOCUS_t00280 1800 1709 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1928 3367 gene locus_tag LOCUS_14690 1928 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 4296 3388 gene locus_tag LOCUS_14700 4296 3388 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228418.1 protein_id gnl|my_center|LOCUS_14700 4963 4289 gene locus_tag LOCUS_14710 gene ftsE 4963 4289 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263537.1 protein_id gnl|my_center|LOCUS_14710 5895 4960 gene locus_tag LOCUS_14720 5895 4960 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545386.1 protein_id gnl|my_center|LOCUS_14720 6743 5907 gene locus_tag LOCUS_14730 6743 5907 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870186.1 protein_id gnl|my_center|LOCUS_14730 7505 6765 gene locus_tag LOCUS_14740 7505 6765 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920693.1 protein_id gnl|my_center|LOCUS_14740 8943 7546 gene locus_tag LOCUS_14750 8943 7546 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_14750 9083 10033 gene locus_tag LOCUS_14760 gene thiL 9083 10033 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234080.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence080 <1 638 gene locus_tag LOCUS_14770 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202723.1:DUF2971 domain-containing protein 740 2497 gene locus_tag LOCUS_14780 740 2497 CDS product Mu transposase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938439.1 protein_id gnl|my_center|LOCUS_14780 2566 3246 gene locus_tag LOCUS_14790 2566 3246 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938438.1 protein_id gnl|my_center|LOCUS_14790 3243 3803 gene locus_tag LOCUS_14800 3243 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 3803 4201 gene locus_tag LOCUS_14810 3803 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 4246 6771 gene locus_tag LOCUS_14820 4246 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 6771 8027 gene locus_tag LOCUS_14830 6771 8027 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861451.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence081 1410 175 gene locus_tag LOCUS_14840 1410 175 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965968.1 protein_id gnl|my_center|LOCUS_14840 1804 1538 gene locus_tag LOCUS_14850 1804 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 2165 1791 gene locus_tag LOCUS_14860 2165 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 2486 2175 gene locus_tag LOCUS_14870 2486 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 2718 3677 gene locus_tag LOCUS_14880 gene fba 2718 3677 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_14880 3772 4833 gene locus_tag LOCUS_14890 3772 4833 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061326.1 protein_id gnl|my_center|LOCUS_14890 4931 5728 gene locus_tag LOCUS_14900 gene fabI 4931 5728 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383908.1 protein_id gnl|my_center|LOCUS_14900 6916 5804 gene locus_tag LOCUS_14910 gene tgt 6916 5804 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229725.1 protein_id gnl|my_center|LOCUS_14910 7367 6906 gene locus_tag LOCUS_14920 gene ndk 7367 6906 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886554.1 protein_id gnl|my_center|LOCUS_14920 7494 9266 gene locus_tag LOCUS_14930 7494 9266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 9427 9804 gene locus_tag LOCUS_14940 9427 9804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence082 <1 845 gene locus_tag LOCUS_14950 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000610574.1:multidrug efflux transporter outer membrane subunit MdtP 1183 1096 gene locus_tag LOCUS_t00290 1183 1096 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1926 1207 gene locus_tag LOCUS_14960 1926 1207 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_14960 1965 1894 gene locus_tag LOCUS_t00300 1965 1894 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2065 3612 gene locus_tag LOCUS_14970 2065 3612 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114139.1 protein_id gnl|my_center|LOCUS_14970 3676 5442 gene locus_tag LOCUS_14980 gene mutL 3676 5442 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965141.1 protein_id gnl|my_center|LOCUS_14980 5494 6228 gene locus_tag LOCUS_14990 5494 6228 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942545.1 protein_id gnl|my_center|LOCUS_14990 7305 6229 gene locus_tag LOCUS_15000 7305 6229 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055976.1 protein_id gnl|my_center|LOCUS_15000 8738 7356 gene locus_tag LOCUS_15010 8738 7356 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_15010 <9979 8728 gene locus_tag LOCUS_15020 <9979 8728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_189099273.1:alanine/glycine:cation symporter family protein >Feature sequence083 <1 711 gene locus_tag LOCUS_15030 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038419670.1:ATP-grasp fold amidoligase family protein 713 886 gene locus_tag LOCUS_15040 713 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 906 2282 gene locus_tag LOCUS_15050 906 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 2643 2732 gene locus_tag LOCUS_t00310 2643 2732 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4005 3169 gene locus_tag LOCUS_15060 4005 3169 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_15060 4672 4007 gene locus_tag LOCUS_15070 4672 4007 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021861.1 protein_id gnl|my_center|LOCUS_15070 5684 4662 gene locus_tag LOCUS_15080 5684 4662 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202737.1 protein_id gnl|my_center|LOCUS_15080 6291 5698 gene locus_tag LOCUS_15090 6291 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 8330 6549 gene locus_tag LOCUS_15100 8330 6549 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence084 413 1054 gene locus_tag LOCUS_15110 413 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1054 1890 gene locus_tag LOCUS_15120 1054 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1894 2727 gene locus_tag LOCUS_15130 1894 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 3380 2724 gene locus_tag LOCUS_15140 3380 2724 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861240.1 protein_id gnl|my_center|LOCUS_15140 3541 4143 gene locus_tag LOCUS_15150 3541 4143 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206063.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence085 231 82 gene locus_tag LOCUS_15160 231 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 272 943 gene locus_tag LOCUS_15170 272 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 940 1785 gene locus_tag LOCUS_15180 940 1785 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057222.1 protein_id gnl|my_center|LOCUS_15180 2225 1842 gene locus_tag LOCUS_15190 2225 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 3584 2385 gene locus_tag LOCUS_15200 gene hydF 3584 2385 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_15200 3698 5335 gene locus_tag LOCUS_15210 3698 5335 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583956.1 protein_id gnl|my_center|LOCUS_15210 5328 6905 gene locus_tag LOCUS_15220 gene murJ 5328 6905 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058183.1 protein_id gnl|my_center|LOCUS_15220 6862 7485 gene locus_tag LOCUS_15230 6862 7485 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015966.1 protein_id gnl|my_center|LOCUS_15230 8287 7457 gene locus_tag LOCUS_15240 8287 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence086 773 531 gene locus_tag LOCUS_15250 773 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 3056 786 gene locus_tag LOCUS_15260 3056 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 3869 3135 gene locus_tag LOCUS_15270 gene bioC 3869 3135 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693577.1 protein_id gnl|my_center|LOCUS_15270 4492 3866 gene locus_tag LOCUS_15280 4492 3866 CDS product DUF452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689360.1 protein_id gnl|my_center|LOCUS_15280 5637 4492 gene locus_tag LOCUS_15290 gene bioF 5637 4492 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951279.1 protein_id gnl|my_center|LOCUS_15290 8388 5668 gene locus_tag LOCUS_15300 8388 5668 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456350.1 protein_id gnl|my_center|LOCUS_15300 <9279 8392 gene locus_tag LOCUS_15310 <9279 8392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065381.1:exonuclease SbcCD subunit D >Feature sequence087 95 310 gene locus_tag LOCUS_15320 95 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 470 760 gene locus_tag LOCUS_15330 470 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 794 1150 gene locus_tag LOCUS_15340 794 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1239 1724 gene locus_tag LOCUS_15350 1239 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 2342 1812 gene locus_tag LOCUS_15360 2342 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 2542 2895 gene locus_tag LOCUS_15370 gene rplS 2542 2895 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583883.1 protein_id gnl|my_center|LOCUS_15370 2989 3828 gene locus_tag LOCUS_15380 gene ylqF 2989 3828 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460442.1 protein_id gnl|my_center|LOCUS_15380 3821 4459 gene locus_tag LOCUS_15390 3821 4459 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626801.1 protein_id gnl|my_center|LOCUS_15390 5749 4463 gene locus_tag LOCUS_15400 5749 4463 CDS product TIGR03279 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124272.1 protein_id gnl|my_center|LOCUS_15400 6257 5739 gene locus_tag LOCUS_15410 6257 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 6370 6993 gene locus_tag LOCUS_15420 6370 6993 CDS product TatD family nuclease-associated radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583586.1 protein_id gnl|my_center|LOCUS_15420 7027 9186 gene locus_tag LOCUS_15430 7027 9186 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence088 315 1661 gene locus_tag LOCUS_15440 315 1661 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231218.1 protein_id gnl|my_center|LOCUS_15440 1748 2473 gene locus_tag LOCUS_15450 gene pyrH 1748 2473 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703168.1 protein_id gnl|my_center|LOCUS_15450 2475 3035 gene locus_tag LOCUS_15460 gene frr 2475 3035 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_15460 3035 3931 gene locus_tag LOCUS_15470 3035 3931 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141396.1 protein_id gnl|my_center|LOCUS_15470 3915 4643 gene locus_tag LOCUS_15480 gene rnc 3915 4643 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557292.1 protein_id gnl|my_center|LOCUS_15480 4636 5274 gene locus_tag LOCUS_15490 gene rpe 4636 5274 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_15490 5277 6206 gene locus_tag LOCUS_15500 gene nagA 5277 6206 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582637.1 protein_id gnl|my_center|LOCUS_15500 6736 6203 gene locus_tag LOCUS_15510 6736 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 6912 8297 gene locus_tag LOCUS_15520 6912 8297 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125914.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence089 1219 1136 gene locus_tag LOCUS_t00320 1219 1136 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1415 2023 gene locus_tag LOCUS_15530 1415 2023 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213184.1 protein_id gnl|my_center|LOCUS_15530 2013 2552 gene locus_tag LOCUS_15540 gene spmB 2013 2552 CDS product spore maturation protein SpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029511.1 protein_id gnl|my_center|LOCUS_15540 4002 2560 gene locus_tag LOCUS_15550 4002 2560 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678778.1 protein_id gnl|my_center|LOCUS_15550 4132 5343 gene locus_tag LOCUS_15560 4132 5343 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949022.1 protein_id gnl|my_center|LOCUS_15560 5457 5540 gene locus_tag LOCUS_t00330 5457 5540 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8965 5600 gene locus_tag LOCUS_15570 8965 5600 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence090 109 735 gene locus_tag LOCUS_15580 109 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 2491 773 gene locus_tag LOCUS_15590 gene ade 2491 773 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964205.1 protein_id gnl|my_center|LOCUS_15590 2690 2923 gene locus_tag LOCUS_15600 2690 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 4397 2931 gene locus_tag LOCUS_15610 4397 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 5001 4459 gene locus_tag LOCUS_15620 5001 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 5090 5680 gene locus_tag LOCUS_15630 gene clpP 5090 5680 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056360.1 protein_id gnl|my_center|LOCUS_15630 5778 6731 gene locus_tag LOCUS_15640 gene glcK 5778 6731 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_15640 6737 7705 gene locus_tag LOCUS_15650 6737 7705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 7707 8651 gene locus_tag LOCUS_15660 7707 8651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 8707 8955 gene locus_tag LOCUS_15670 8707 8955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 >Feature sequence091 2503 761 gene locus_tag LOCUS_15680 2503 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 5727 2518 gene locus_tag LOCUS_15690 5727 2518 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976147.1 protein_id gnl|my_center|LOCUS_15690 6918 5743 gene locus_tag LOCUS_15700 6918 5743 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090064.1 protein_id gnl|my_center|LOCUS_15700 7380 6943 gene locus_tag LOCUS_15710 7380 6943 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053228394.1 protein_id gnl|my_center|LOCUS_15710 7940 7461 gene locus_tag LOCUS_15720 7940 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 <8791 7937 gene locus_tag LOCUS_15730 <8791 7937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227648.1:glucose-1-phosphate adenylyltransferase >Feature sequence092 <1 969 gene locus_tag LOCUS_15740 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942126.1:MDR family MFS transporter 1246 977 gene locus_tag LOCUS_15750 1246 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1388 2359 gene locus_tag LOCUS_15760 1388 2359 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_15760 4181 2418 gene locus_tag LOCUS_15770 4181 2418 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107752.1 protein_id gnl|my_center|LOCUS_15770 4294 5238 gene locus_tag LOCUS_15780 4294 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 5235 6293 gene locus_tag LOCUS_15790 5235 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 6290 7396 gene locus_tag LOCUS_15800 6290 7396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence093 <1 687 gene locus_tag LOCUS_15810 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003643249.1:dTDP-glucose 4,6-dehydratase 763 1845 gene locus_tag LOCUS_15820 763 1845 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824469.1 protein_id gnl|my_center|LOCUS_15820 1848 2843 gene locus_tag LOCUS_15830 1848 2843 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549884.1 protein_id gnl|my_center|LOCUS_15830 2833 3825 gene locus_tag LOCUS_15840 2833 3825 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101287.1 protein_id gnl|my_center|LOCUS_15840 3844 5124 gene locus_tag LOCUS_15850 3844 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 5142 6533 gene locus_tag LOCUS_15860 5142 6533 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108298.1 protein_id gnl|my_center|LOCUS_15860 6536 7654 gene locus_tag LOCUS_15870 gene glf 6536 7654 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057797519.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence094 361 288 gene locus_tag LOCUS_t00340 361 288 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 509 838 gene locus_tag LOCUS_15880 509 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 876 1115 gene locus_tag LOCUS_15890 876 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1075 1932 gene locus_tag LOCUS_15900 1075 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 2508 1933 gene locus_tag LOCUS_15910 2508 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2609 3175 gene locus_tag LOCUS_15920 gene pth 2609 3175 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240196.1 protein_id gnl|my_center|LOCUS_15920 3544 3828 gene locus_tag LOCUS_15930 3544 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 4573 3830 gene locus_tag LOCUS_15940 4573 3830 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_15940 4796 6283 gene locus_tag LOCUS_15950 4796 6283 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582491.1 protein_id gnl|my_center|LOCUS_15950 6283 7290 gene locus_tag LOCUS_15960 gene sppA 6283 7290 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_15960 7281 7859 gene locus_tag LOCUS_15970 7281 7859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 >Feature sequence095 2189 24 gene locus_tag LOCUS_15980 2189 24 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583490.1 protein_id gnl|my_center|LOCUS_15980 2269 2658 gene locus_tag LOCUS_15990 2269 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 4231 2642 gene locus_tag LOCUS_16000 4231 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 5257 4256 gene locus_tag LOCUS_16010 5257 4256 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724031.1 protein_id gnl|my_center|LOCUS_16010 6763 5306 gene locus_tag LOCUS_16020 6763 5306 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_16020 <8482 6779 gene locus_tag LOCUS_16030 <8482 6779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010427469.1:penicillin-binding protein 2 >Feature sequence096 1497 2711 gene locus_tag LOCUS_16040 1497 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 3701 2763 gene locus_tag LOCUS_16050 gene pdxA 3701 2763 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124183.1 protein_id gnl|my_center|LOCUS_16050 5014 3707 gene locus_tag LOCUS_16060 5014 3707 CDS product D-threonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783298.1 protein_id gnl|my_center|LOCUS_16060 5346 5023 gene locus_tag LOCUS_16070 5346 5023 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142936.1 protein_id gnl|my_center|LOCUS_16070 6865 5459 gene locus_tag LOCUS_16080 6865 5459 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583871.1 protein_id gnl|my_center|LOCUS_16080 7589 6858 gene locus_tag LOCUS_16090 7589 6858 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048001.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence097 142 1740 gene locus_tag LOCUS_16100 142 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 1754 2164 gene locus_tag LOCUS_16110 1754 2164 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099162.1 protein_id gnl|my_center|LOCUS_16110 2269 3030 gene locus_tag LOCUS_16120 2269 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 3091 4038 gene locus_tag LOCUS_16130 3091 4038 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094977.1 protein_id gnl|my_center|LOCUS_16130 4088 5053 gene locus_tag LOCUS_16140 gene csaB 4088 5053 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241591.1 protein_id gnl|my_center|LOCUS_16140 5873 5055 gene locus_tag LOCUS_16150 gene whiG 5873 5055 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667112.1 protein_id gnl|my_center|LOCUS_16150 6544 5975 gene locus_tag LOCUS_16160 6544 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 7757 6729 gene locus_tag LOCUS_16170 7757 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 8086 7832 gene locus_tag LOCUS_16180 gene rpmA 8086 7832 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943850.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence098 1134 1421 gene locus_tag LOCUS_16190 1134 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1468 2949 gene locus_tag LOCUS_16200 1468 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 3783 2950 gene locus_tag LOCUS_16210 3783 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 5312 3834 gene locus_tag LOCUS_16220 gene gatA 5312 3834 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141527.1 protein_id gnl|my_center|LOCUS_16220 5429 6487 gene locus_tag LOCUS_16230 gene ruvB 5429 6487 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058086.1 protein_id gnl|my_center|LOCUS_16230 6850 7455 gene locus_tag LOCUS_16240 6850 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 7745 7461 gene locus_tag LOCUS_16250 7745 7461 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081429.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence099 953 1810 gene locus_tag LOCUS_16260 953 1810 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928880.1 protein_id gnl|my_center|LOCUS_16260 1817 2755 gene locus_tag LOCUS_16270 1817 2755 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_16270 2746 3297 gene locus_tag LOCUS_16280 2746 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 3933 3292 gene locus_tag LOCUS_16290 3933 3292 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920655.1 protein_id gnl|my_center|LOCUS_16290 3995 4951 gene locus_tag LOCUS_16300 3995 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 4961 5176 gene locus_tag LOCUS_16310 4961 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 5287 6351 gene locus_tag LOCUS_16320 5287 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 6556 6482 gene locus_tag LOCUS_t00350 6556 6482 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6828 6631 gene locus_tag LOCUS_16330 6828 6631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 7226 6858 gene locus_tag LOCUS_16340 7226 6858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence100 1555 446 gene locus_tag LOCUS_16350 gene wecB 1555 446 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767232.1 protein_id gnl|my_center|LOCUS_16350 2579 1566 gene locus_tag LOCUS_16360 gene trpS 2579 1566 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583821.1 protein_id gnl|my_center|LOCUS_16360 2790 3659 gene locus_tag LOCUS_16370 2790 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 5174 5509 gene locus_tag LOCUS_16380 5174 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 6841 5591 gene locus_tag LOCUS_16390 6841 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 7270 6920 gene locus_tag LOCUS_16400 7270 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 <8005 7270 gene locus_tag LOCUS_16410 <8005 7270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_108105469.1:AAA domain-containing protein >Feature sequence101 278 1066 gene locus_tag LOCUS_16420 gene lgt 278 1066 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057991.1 protein_id gnl|my_center|LOCUS_16420 1086 1802 gene locus_tag LOCUS_16430 1086 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 1795 2457 gene locus_tag LOCUS_16440 gene upp 1795 2457 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723470.1 protein_id gnl|my_center|LOCUS_16440 2457 3194 gene locus_tag LOCUS_16450 gene pgeF 2457 3194 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986855.1 protein_id gnl|my_center|LOCUS_16450 3196 4500 gene locus_tag LOCUS_16460 3196 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 4586 5572 gene locus_tag LOCUS_16470 4586 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 6211 5573 gene locus_tag LOCUS_16480 6211 5573 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942096.1 protein_id gnl|my_center|LOCUS_16480 6287 7165 gene locus_tag LOCUS_16490 6287 7165 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693993.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence102 95 622 gene locus_tag LOCUS_16500 95 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 1694 1110 gene locus_tag LOCUS_16510 1694 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 4158 2380 gene locus_tag LOCUS_16520 gene msbA 4158 2380 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_16520 5240 4170 gene locus_tag LOCUS_16530 5240 4170 CDS product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986978.1 protein_id gnl|my_center|LOCUS_16530 6382 5252 gene locus_tag LOCUS_16540 6382 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 7487 6492 gene locus_tag LOCUS_16550 7487 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 >Feature sequence103 761 1282 gene locus_tag LOCUS_16560 gene rplJ 761 1282 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393947.1 protein_id gnl|my_center|LOCUS_16560 1339 1710 gene locus_tag LOCUS_16570 gene rplL 1339 1710 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931848.1 protein_id gnl|my_center|LOCUS_16570 1886 2413 gene locus_tag LOCUS_16580 1886 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2553 3122 gene locus_tag LOCUS_16590 2553 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 3174 5273 gene locus_tag LOCUS_16600 3174 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 5279 6073 gene locus_tag LOCUS_16610 gene murI 5279 6073 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_16610 6180 6677 gene locus_tag LOCUS_16620 6180 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence104 141 2105 gene locus_tag LOCUS_16630 141 2105 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013008044.1 protein_id gnl|my_center|LOCUS_16630 2105 4522 gene locus_tag LOCUS_16640 gene recG 2105 4522 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141278.1 protein_id gnl|my_center|LOCUS_16640 5619 4528 gene locus_tag LOCUS_16650 5619 4528 CDS product WavE lipopolysaccharide synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895771.1 protein_id gnl|my_center|LOCUS_16650 6652 5612 gene locus_tag LOCUS_16660 6652 5612 CDS product WavE lipopolysaccharide synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590014.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence105 354 776 gene locus_tag LOCUS_16670 354 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 3073 779 gene locus_tag LOCUS_16680 3073 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 4123 3077 gene locus_tag LOCUS_16690 gene aroF 4123 3077 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_16690 5152 4136 gene locus_tag LOCUS_16700 5152 4136 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143077.1 protein_id gnl|my_center|LOCUS_16700 6535 5174 gene locus_tag LOCUS_16710 gene ffh 6535 5174 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767918.1 protein_id gnl|my_center|LOCUS_16710 7343 6639 gene locus_tag LOCUS_16720 7343 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence106 2493 1147 gene locus_tag LOCUS_16730 2493 1147 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_16730 2626 3033 gene locus_tag LOCUS_16740 2626 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 3700 3017 gene locus_tag LOCUS_16750 3700 3017 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830993.1 protein_id gnl|my_center|LOCUS_16750 3759 4340 gene locus_tag LOCUS_16760 gene rubY 3759 4340 CDS product rubrerythrin RubY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965865.1 protein_id gnl|my_center|LOCUS_16760 4841 4380 gene locus_tag LOCUS_16770 4841 4380 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879260.1 protein_id gnl|my_center|LOCUS_16770 5033 5884 gene locus_tag LOCUS_16780 5033 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 5881 6798 gene locus_tag LOCUS_16790 5881 6798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence107 1545 754 gene locus_tag LOCUS_16800 1545 754 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234254.1 protein_id gnl|my_center|LOCUS_16800 1653 2012 gene locus_tag LOCUS_16810 1653 2012 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964792.1 protein_id gnl|my_center|LOCUS_16810 2269 2607 gene locus_tag LOCUS_16820 2269 2607 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057416.1 protein_id gnl|my_center|LOCUS_16820 3201 4736 gene locus_tag LOCUS_16830 gene hcp 3201 4736 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_16830 5106 6020 gene locus_tag LOCUS_16840 5106 6020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 <7283 6062 gene locus_tag LOCUS_16850 <7283 6062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963528.1:radical SAM protein >Feature sequence108 1253 162 gene locus_tag LOCUS_16860 gene nirJ1 1253 162 CDS product putative heme d1 biosynthesis radical SAM protein NirJ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966081.1 protein_id gnl|my_center|LOCUS_16860 3124 1277 gene locus_tag LOCUS_16870 gene uvrC 3124 1277 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143581.1 protein_id gnl|my_center|LOCUS_16870 3170 3583 gene locus_tag LOCUS_16880 3170 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 4749 3580 gene locus_tag LOCUS_16890 gene folP 4749 3580 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948526.1 protein_id gnl|my_center|LOCUS_16890 6667 5186 gene locus_tag LOCUS_16900 6667 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence109 75 239 gene locus_tag LOCUS_16910 75 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 239 1168 gene locus_tag LOCUS_16920 239 1168 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461526.1 protein_id gnl|my_center|LOCUS_16920 1802 1179 gene locus_tag LOCUS_16930 gene fucA 1802 1179 CDS product L-fuculose phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870936.1 protein_id gnl|my_center|LOCUS_16930 3462 1831 gene locus_tag LOCUS_16940 3462 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 3555 4688 gene locus_tag LOCUS_16950 gene recF 3555 4688 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470745.1 protein_id gnl|my_center|LOCUS_16950 5105 4737 gene locus_tag LOCUS_16960 gene rplR 5105 4737 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 protein_id gnl|my_center|LOCUS_16960 5716 5177 gene locus_tag LOCUS_16970 gene rplF 5716 5177 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892857.1 protein_id gnl|my_center|LOCUS_16970 6154 5753 gene locus_tag LOCUS_16980 gene rpsH 6154 5753 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371522.1 protein_id gnl|my_center|LOCUS_16980 6489 6283 gene locus_tag LOCUS_16990 6489 6283 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143902.1 protein_id gnl|my_center|LOCUS_16990 <7108 6507 gene locus_tag LOCUS_17000 <7108 6507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003225809.1:50S ribosomal protein L5 >Feature sequence110 656 156 gene locus_tag LOCUS_17010 656 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 700 864 gene locus_tag LOCUS_17020 700 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 1336 1103 gene locus_tag LOCUS_17030 1336 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17030 1517 1957 gene locus_tag LOCUS_17040 1517 1957 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546951.1 protein_id gnl|my_center|LOCUS_17040 3640 2063 gene locus_tag LOCUS_17050 3640 2063 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254534.1 protein_id gnl|my_center|LOCUS_17050 3886 4140 gene locus_tag LOCUS_17060 3886 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 4666 4361 gene locus_tag LOCUS_17070 4666 4361 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916506.1 protein_id gnl|my_center|LOCUS_17070 4986 4666 gene locus_tag LOCUS_17080 4986 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 5670 5125 gene locus_tag LOCUS_17090 5670 5125 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639830.1 protein_id gnl|my_center|LOCUS_17090 6112 5654 gene locus_tag LOCUS_17100 6112 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547345.1 protein_id gnl|my_center|LOCUS_17100 6632 6165 gene locus_tag LOCUS_17110 6632 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547345.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence111 2481 1054 gene locus_tag LOCUS_17120 2481 1054 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101282.1 protein_id gnl|my_center|LOCUS_17120 3738 2620 gene locus_tag LOCUS_17130 gene glf 3738 2620 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057797519.1 protein_id gnl|my_center|LOCUS_17130 4374 3757 gene locus_tag LOCUS_17140 4374 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 5567 4371 gene locus_tag LOCUS_17150 5567 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476397.1 protein_id gnl|my_center|LOCUS_17150 6242 5595 gene locus_tag LOCUS_17160 6242 5595 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966340.1 protein_id gnl|my_center|LOCUS_17160 <7019 6254 gene locus_tag LOCUS_17170 <7019 6254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547856.1:glycosyltransferase family 2 protein >Feature sequence112 <1 1483 gene locus_tag LOCUS_17180 <1 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122985.1:carbamoyltransferase 1689 1480 gene locus_tag LOCUS_17190 1689 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 1816 2157 gene locus_tag LOCUS_17200 1816 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 2487 2765 gene locus_tag LOCUS_17210 2487 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 4554 2785 gene locus_tag LOCUS_17220 4554 2785 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530082.1 protein_id gnl|my_center|LOCUS_17220 >Feature sequence113 138 587 gene locus_tag LOCUS_17230 138 587 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921062.1 protein_id gnl|my_center|LOCUS_17230 594 2270 gene locus_tag LOCUS_17240 594 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 3178 2267 gene locus_tag LOCUS_17250 3178 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 3272 4492 gene locus_tag LOCUS_17260 gene hisS 3272 4492 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422928.1 protein_id gnl|my_center|LOCUS_17260 4722 4498 gene locus_tag LOCUS_17270 4722 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence114 2809 1889 gene locus_tag LOCUS_17280 2809 1889 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056240.1 protein_id gnl|my_center|LOCUS_17280 4334 2817 gene locus_tag LOCUS_17290 gene atpA 4334 2817 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056290.1 protein_id gnl|my_center|LOCUS_17290 4893 4321 gene locus_tag LOCUS_17300 gene atpH 4893 4321 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475836.1 protein_id gnl|my_center|LOCUS_17300 5390 4890 gene locus_tag LOCUS_17310 5390 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 5859 5392 gene locus_tag LOCUS_17320 5859 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 6107 5868 gene locus_tag LOCUS_17330 6107 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 6797 6123 gene locus_tag LOCUS_17340 gene atpB 6797 6123 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142904.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence115 249 410 gene locus_tag LOCUS_17350 249 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 498 653 gene locus_tag LOCUS_17360 498 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 1273 2409 gene locus_tag LOCUS_17370 gene alr 1273 2409 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182683.1 protein_id gnl|my_center|LOCUS_17370 3723 2413 gene locus_tag LOCUS_17380 3723 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 3990 4400 gene locus_tag LOCUS_17390 3990 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 5115 4405 gene locus_tag LOCUS_17400 5115 4405 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405201.1 protein_id gnl|my_center|LOCUS_17400 5500 5108 gene locus_tag LOCUS_17410 5500 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 5752 5579 gene locus_tag LOCUS_17420 5752 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 5929 6783 gene locus_tag LOCUS_17430 5929 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence116 1843 749 gene locus_tag LOCUS_17440 1843 749 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475860.1 protein_id gnl|my_center|LOCUS_17440 3366 1930 gene locus_tag LOCUS_17450 3366 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 5072 3456 gene locus_tag LOCUS_17460 5072 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 6586 5087 gene locus_tag LOCUS_17470 6586 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674710.1 protein_id gnl|my_center|LOCUS_17470 6787 6599 gene locus_tag LOCUS_17480 6787 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence117 1752 3191 gene locus_tag LOCUS_17490 gene cysS 1752 3191 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015680.1 protein_id gnl|my_center|LOCUS_17490 3528 3860 gene locus_tag LOCUS_17500 3528 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 4737 3865 gene locus_tag LOCUS_17510 4737 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 4917 5606 gene locus_tag LOCUS_17520 gene flgF 4917 5606 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529801.1 protein_id gnl|my_center|LOCUS_17520 5621 6334 gene locus_tag LOCUS_17530 gene flgG 5621 6334 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081929.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence118 285 1583 gene locus_tag LOCUS_17540 285 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 2116 1823 gene locus_tag LOCUS_17550 2116 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 2643 3893 gene locus_tag LOCUS_17560 2643 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 3890 4948 gene locus_tag LOCUS_17570 3890 4948 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202469.1 protein_id gnl|my_center|LOCUS_17570 4936 6045 gene locus_tag LOCUS_17580 4936 6045 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039964.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence119 347 2416 gene locus_tag LOCUS_17590 347 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 2565 3935 gene locus_tag LOCUS_17600 2565 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 4341 3940 gene locus_tag LOCUS_17610 4341 3940 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878336.1 protein_id gnl|my_center|LOCUS_17610 5775 4411 gene locus_tag LOCUS_17620 gene dacB 5775 4411 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957323.1 protein_id gnl|my_center|LOCUS_17620 6584 5775 gene locus_tag LOCUS_17630 6584 5775 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940707.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence120 1436 300 gene locus_tag LOCUS_17640 1436 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 1810 3399 gene locus_tag LOCUS_17650 1810 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 3517 4191 gene locus_tag LOCUS_17660 3517 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 4194 4382 gene locus_tag LOCUS_17670 4194 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 4391 4582 gene locus_tag LOCUS_17680 4391 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 5382 4762 gene locus_tag LOCUS_17690 5382 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 5664 6329 gene locus_tag LOCUS_17700 5664 6329 CDS product master DNA invertase Mpi family serine-type recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818830.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence121 2424 979 gene locus_tag LOCUS_17710 2424 979 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187233.1 protein_id gnl|my_center|LOCUS_17710 3896 2418 gene locus_tag LOCUS_17720 3896 2418 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775649.1 protein_id gnl|my_center|LOCUS_17720 6287 3918 gene locus_tag LOCUS_17730 6287 3918 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027389.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence122 72 1061 gene locus_tag LOCUS_17740 72 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 1063 1293 gene locus_tag LOCUS_17750 1063 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 1784 1287 gene locus_tag LOCUS_17760 1784 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 1934 3259 gene locus_tag LOCUS_17770 gene lysA 1934 3259 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398851.1 protein_id gnl|my_center|LOCUS_17770 3265 4161 gene locus_tag LOCUS_17780 gene cdaA 3265 4161 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_17780 4140 4781 gene locus_tag LOCUS_17790 4140 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 4798 6228 gene locus_tag LOCUS_17800 gene gcvPB 4798 6228 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468434.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence123 475 1455 gene locus_tag LOCUS_17810 475 1455 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965979.1 protein_id gnl|my_center|LOCUS_17810 2243 1506 gene locus_tag LOCUS_17820 2243 1506 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_17820 2323 3570 gene locus_tag LOCUS_17830 gene eno 2323 3570 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880276.1 protein_id gnl|my_center|LOCUS_17830 4821 3895 gene locus_tag LOCUS_17840 4821 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 5699 4830 gene locus_tag LOCUS_17850 5699 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 6150 5692 gene locus_tag LOCUS_17860 gene trmL 6150 5692 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence124 1484 420 gene locus_tag LOCUS_17870 1484 420 CDS product protein rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222005.1 protein_id gnl|my_center|LOCUS_17870 3500 2109 gene locus_tag LOCUS_17880 gene mobV 3500 2109 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119405.1 protein_id gnl|my_center|LOCUS_17880 4454 3966 gene locus_tag LOCUS_17890 4454 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 4704 4495 gene locus_tag LOCUS_17900 4704 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 5314 5066 gene locus_tag LOCUS_17910 5314 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 5587 5826 gene locus_tag LOCUS_17920 5587 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 >Feature sequence125 1589 999 gene locus_tag LOCUS_17930 1589 999 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775494.1 protein_id gnl|my_center|LOCUS_17930 1688 2506 gene locus_tag LOCUS_17940 1688 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 3895 2654 gene locus_tag LOCUS_17950 gene creD 3895 2654 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113266.1 protein_id gnl|my_center|LOCUS_17950 4656 3919 gene locus_tag LOCUS_17960 4656 3919 CDS product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787146.1 protein_id gnl|my_center|LOCUS_17960 5105 4656 gene locus_tag LOCUS_17970 5105 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 5577 5116 gene locus_tag LOCUS_17980 5577 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 >Feature sequence126 1789 692 gene locus_tag LOCUS_17990 1789 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 3164 1806 gene locus_tag LOCUS_18000 3164 1806 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125968.1 protein_id gnl|my_center|LOCUS_18000 3449 4153 gene locus_tag LOCUS_18010 3449 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 4098 5000 gene locus_tag LOCUS_18020 gene miaA 4098 5000 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989726.1 protein_id gnl|my_center|LOCUS_18020 5081 5380 gene locus_tag LOCUS_18030 5081 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 <6259 5487 gene locus_tag LOCUS_18040 <6259 5487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000648617.1:uridine kinase >Feature sequence127 <1 1879 gene locus_tag LOCUS_18050 <1 1879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002361258.1:NAD-dependent DNA ligase LigA 1872 2333 gene locus_tag LOCUS_18060 1872 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 2338 3087 gene locus_tag LOCUS_18070 2338 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 3097 4836 gene locus_tag LOCUS_18080 3097 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 4820 5404 gene locus_tag LOCUS_18090 gene hisB 4820 5404 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537957.1 protein_id gnl|my_center|LOCUS_18090 6065 5409 gene locus_tag LOCUS_18100 6065 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence128 1682 288 gene locus_tag LOCUS_18110 1682 288 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091276.1 protein_id gnl|my_center|LOCUS_18110 2763 1675 gene locus_tag LOCUS_18120 2763 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 3763 2774 gene locus_tag LOCUS_18130 3763 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 4464 3736 gene locus_tag LOCUS_18140 4464 3736 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612460.1 protein_id gnl|my_center|LOCUS_18140 5339 4461 gene locus_tag LOCUS_18150 5339 4461 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_18150 6030 5332 gene locus_tag LOCUS_18160 6030 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence129 1697 2179 gene locus_tag LOCUS_18170 1697 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 2182 2685 gene locus_tag LOCUS_18180 2182 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 2697 4082 gene locus_tag LOCUS_18190 2697 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 4093 5844 gene locus_tag LOCUS_18200 4093 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 >Feature sequence130 6 1818 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attataacatattttaaattaagagaaaatcaaaac 2051 1833 gene locus_tag LOCUS_18210 2051 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 2336 4570 gene locus_tag LOCUS_18220 gene nrdD 2336 4570 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_18220 4573 5088 gene locus_tag LOCUS_18230 gene nrdG 4573 5088 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_18230 5641 5072 gene locus_tag LOCUS_18240 5641 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence131 1992 289 gene locus_tag LOCUS_18250 1992 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476454.1 protein_id gnl|my_center|LOCUS_18250 3067 1979 gene locus_tag LOCUS_18260 3067 1979 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475860.1 protein_id gnl|my_center|LOCUS_18260 4546 3128 gene locus_tag LOCUS_18270 4546 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 5567 4620 gene locus_tag LOCUS_18280 5567 4620 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125980453.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence132 134 1876 gene locus_tag LOCUS_18290 134 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 1857 3728 gene locus_tag LOCUS_18300 1857 3728 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254337.1 protein_id gnl|my_center|LOCUS_18300 3732 4229 gene locus_tag LOCUS_18310 3732 4229 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548936.1 protein_id gnl|my_center|LOCUS_18310 4680 4267 gene locus_tag LOCUS_18320 4680 4267 CDS product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549798.1 protein_id gnl|my_center|LOCUS_18320 5119 4682 gene locus_tag LOCUS_18330 5119 4682 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549799.1 protein_id gnl|my_center|LOCUS_18330 5223 5573 gene locus_tag LOCUS_18340 5223 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence133 1061 258 gene locus_tag LOCUS_18350 1061 258 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794285.1 protein_id gnl|my_center|LOCUS_18350 1158 1682 gene locus_tag LOCUS_18360 1158 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 1675 2967 gene locus_tag LOCUS_18370 1675 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 2992 4566 gene locus_tag LOCUS_18380 2992 4566 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861369.1 protein_id gnl|my_center|LOCUS_18380 4551 5651 gene locus_tag LOCUS_18390 4551 5651 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889821.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence134 1 387 gene locus_tag LOCUS_18400 1 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18400 424 810 gene locus_tag LOCUS_18410 424 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 1272 850 gene locus_tag LOCUS_18420 1272 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 1797 2981 gene locus_tag LOCUS_18430 gene trpB 1797 2981 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562635.1 protein_id gnl|my_center|LOCUS_18430 2974 3750 gene locus_tag LOCUS_18440 gene trpA 2974 3750 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence135 2359 1202 gene locus_tag LOCUS_18450 2359 1202 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808460.1 protein_id gnl|my_center|LOCUS_18450 3896 2361 gene locus_tag LOCUS_18460 gene purH 3896 2361 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545749.1 protein_id gnl|my_center|LOCUS_18460 4702 3899 gene locus_tag LOCUS_18470 gene proC 4702 3899 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931771.1 protein_id gnl|my_center|LOCUS_18470 4796 4948 gene locus_tag LOCUS_18480 gene rpmH 4796 4948 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141474.1 protein_id gnl|my_center|LOCUS_18480 5042 5398 gene locus_tag LOCUS_18490 5042 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence136 40 243 gene locus_tag LOCUS_18500 40 243 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140407.1 protein_id gnl|my_center|LOCUS_18500 357 836 gene locus_tag LOCUS_18510 357 836 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_18510 1161 1237 gene locus_tag LOCUS_t00360 1161 1237 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1429 3120 gene locus_tag LOCUS_18520 1429 3120 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470631.1 protein_id gnl|my_center|LOCUS_18520 3721 3149 gene locus_tag LOCUS_18530 3721 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 4133 4600 gene locus_tag LOCUS_18540 4133 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 4621 4986 gene locus_tag LOCUS_18550 4621 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 5204 5019 gene locus_tag LOCUS_18560 5204 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence137 38 610 gene locus_tag LOCUS_18570 38 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 715 1296 gene locus_tag LOCUS_18580 715 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 1297 2853 gene locus_tag LOCUS_18590 1297 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 4313 2850 gene locus_tag LOCUS_18600 4313 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 <5465 4442 gene locus_tag LOCUS_18610 <5465 4442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546258.1:FAD-dependent oxidoreductase >Feature sequence138 1388 72 gene locus_tag LOCUS_18620 gene purA 1388 72 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243325.1 protein_id gnl|my_center|LOCUS_18620 3370 1814 gene locus_tag LOCUS_18630 3370 1814 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057717.1 protein_id gnl|my_center|LOCUS_18630 4419 3370 gene locus_tag LOCUS_18640 4419 3370 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435455.1 protein_id gnl|my_center|LOCUS_18640 >Feature sequence139 <1 1392 gene locus_tag LOCUS_18650 <1 1392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003132130.1:radical SAM protein 1442 3427 gene locus_tag LOCUS_18660 gene uvrB 1442 3427 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141853.1 protein_id gnl|my_center|LOCUS_18660 4144 3407 gene locus_tag LOCUS_18670 4144 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 <5331 4179 gene locus_tag LOCUS_18680 <5331 4179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966478.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence140 <1 1351 gene locus_tag LOCUS_18690 <1 1351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256684.1:phospholipase D-like domain-containing protein 3399 1348 gene locus_tag LOCUS_18700 3399 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 4679 3552 gene locus_tag LOCUS_18710 4679 3552 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928605.1 protein_id gnl|my_center|LOCUS_18710 >Feature sequence141 1711 497 gene locus_tag LOCUS_18720 1711 497 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880177.1 protein_id gnl|my_center|LOCUS_18720 2353 1712 gene locus_tag LOCUS_18730 gene ribE 2353 1712 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015638.1 protein_id gnl|my_center|LOCUS_18730 2509 3015 gene locus_tag LOCUS_18740 gene folK 2509 3015 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582990.1 protein_id gnl|my_center|LOCUS_18740 2978 4195 gene locus_tag LOCUS_18750 2978 4195 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_18750 5040 4231 gene locus_tag LOCUS_18760 5040 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 >Feature sequence142 1601 1113 gene locus_tag LOCUS_18770 1601 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 2959 1670 gene locus_tag LOCUS_18780 2959 1670 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023992.1 protein_id gnl|my_center|LOCUS_18780 4090 2969 gene locus_tag LOCUS_18790 gene proB 4090 2969 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023993.1 protein_id gnl|my_center|LOCUS_18790 <5168 4155 gene locus_tag LOCUS_18800 <5168 4155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460075.1:ATP-binding protein >Feature sequence143 158 1006 gene locus_tag LOCUS_18810 158 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 1108 1830 gene locus_tag LOCUS_18820 gene lptB 1108 1830 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_18820 1830 2933 gene locus_tag LOCUS_18830 1830 2933 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140933.1 protein_id gnl|my_center|LOCUS_18830 2933 3742 gene locus_tag LOCUS_18840 2933 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 4101 3778 gene locus_tag LOCUS_18850 4101 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 >Feature sequence144 <1 889 gene locus_tag LOCUS_18860 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003242748.1:glycosyltransferase family 8 protein 1006 1998 gene locus_tag LOCUS_18870 gene galE 1006 1998 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293897.1 protein_id gnl|my_center|LOCUS_18870 1998 2774 gene locus_tag LOCUS_18880 1998 2774 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_18880 2767 3486 gene locus_tag LOCUS_18890 2767 3486 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902370.1 protein_id gnl|my_center|LOCUS_18890 3525 4397 gene locus_tag LOCUS_18900 3525 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 <5086 4502 gene locus_tag LOCUS_18910 <5086 4502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002670719.1:chaperonin GroEL >Feature sequence145 2145 2215 gene locus_tag LOCUS_t00370 2145 2215 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2238 2441 gene locus_tag LOCUS_18920 2238 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 3549 2473 gene locus_tag LOCUS_18930 3549 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 4021 3557 gene locus_tag LOCUS_18940 gene ribE 4021 3557 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905674.1 protein_id gnl|my_center|LOCUS_18940 5053 4106 gene locus_tag LOCUS_18950 5053 4106 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965112.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence146 1164 136 gene locus_tag LOCUS_18960 1164 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 1788 1264 gene locus_tag LOCUS_18970 1788 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 2578 1862 gene locus_tag LOCUS_18980 gene pdxJ 2578 1862 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296302.1 protein_id gnl|my_center|LOCUS_18980 2717 2790 gene locus_tag LOCUS_t00380 2717 2790 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2829 3089 gene locus_tag LOCUS_18990 2829 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 3129 4526 gene locus_tag LOCUS_19000 3129 4526 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_19000 4572 4646 gene locus_tag LOCUS_t00390 4572 4646 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence147 507 1622 gene locus_tag LOCUS_19010 gene dnaN 507 1622 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058182.1 protein_id gnl|my_center|LOCUS_19010 1633 2559 gene locus_tag LOCUS_19020 gene thrB 1633 2559 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986279.1 protein_id gnl|my_center|LOCUS_19020 2574 3770 gene locus_tag LOCUS_19030 2574 3770 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036339.1 protein_id gnl|my_center|LOCUS_19030 4907 3843 gene locus_tag LOCUS_19040 4907 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence148 388 597 gene locus_tag LOCUS_19050 388 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 1564 695 gene locus_tag LOCUS_19060 1564 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 2403 1561 gene locus_tag LOCUS_19070 2403 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 3715 2498 gene locus_tag LOCUS_19080 3715 2498 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962560.1 protein_id gnl|my_center|LOCUS_19080 4374 3799 gene locus_tag LOCUS_19090 gene lexA 4374 3799 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140711.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence149 675 2273 gene locus_tag LOCUS_19100 675 2273 CDS product R3H domain-containing nucleic acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041244518.1 protein_id gnl|my_center|LOCUS_19100 3396 2329 gene locus_tag LOCUS_19110 gene thrC 3396 2329 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880238.1 protein_id gnl|my_center|LOCUS_19110 <4563 3406 gene locus_tag LOCUS_19120 <4563 3406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964316.1:homoserine dehydrogenase >Feature sequence150 <1 1367 gene locus_tag LOCUS_19130 <1 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010871189.1:PFL family protein 1379 2026 gene locus_tag LOCUS_19140 1379 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 2518 2030 gene locus_tag LOCUS_19150 2518 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 3447 2554 gene locus_tag LOCUS_19160 3447 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 4517 3444 gene locus_tag LOCUS_19170 4517 3444 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273200.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence151 80 832 gene locus_tag LOCUS_19180 80 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027861.1 protein_id gnl|my_center|LOCUS_19180 2495 912 gene locus_tag LOCUS_19190 2495 912 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254025.1 protein_id gnl|my_center|LOCUS_19190 2854 2498 gene locus_tag LOCUS_19200 2854 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19200 4088 2871 gene locus_tag LOCUS_19210 4088 2871 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548575.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19210 >Feature sequence152 289 107 gene locus_tag LOCUS_19220 289 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2939 264 gene locus_tag LOCUS_19230 2939 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 3163 3020 gene locus_tag LOCUS_19240 3163 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 4253 3441 gene locus_tag LOCUS_19250 4253 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 >Feature sequence153 797 1075 gene locus_tag LOCUS_19260 797 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 1083 1892 gene locus_tag LOCUS_19270 gene rsmI 1083 1892 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947928.1 protein_id gnl|my_center|LOCUS_19270 >Feature sequence154 <1 1269 gene locus_tag LOCUS_19280 <1 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679357.1:leucine-rich repeat domain-containing protein 1281 1808 gene locus_tag LOCUS_19290 1281 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 1867 2358 gene locus_tag LOCUS_19300 1867 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 2362 3183 gene locus_tag LOCUS_19310 2362 3183 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099498.1 protein_id gnl|my_center|LOCUS_19310 3180 3410 gene locus_tag LOCUS_19320 3180 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 >Feature sequence155 <1 1719 gene locus_tag LOCUS_19330 <1 1719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583749.1:3'-5' exonuclease >Feature sequence156 316 684 gene locus_tag LOCUS_19340 316 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 753 1775 gene locus_tag LOCUS_19350 753 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 1847 3478 gene locus_tag LOCUS_19360 1847 3478 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence157 534 2363 gene locus_tag LOCUS_19370 534 2363 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057141.1 protein_id gnl|my_center|LOCUS_19370 2369 4222 gene locus_tag LOCUS_19380 2369 4222 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963172.1 protein_id gnl|my_center|LOCUS_19380 >Feature sequence158 2193 3299 gene locus_tag LOCUS_19390 2193 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545929.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence159 <1 1666 gene locus_tag LOCUS_19400 <1 1666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003396717.1:[Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein 1666 2823 gene locus_tag LOCUS_19410 1666 2823 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_19410 2869 3132 gene locus_tag LOCUS_19420 2869 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 >Feature sequence160 2474 405 gene locus_tag LOCUS_19430 2474 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 <4149 2601 gene locus_tag LOCUS_19440 <4149 2601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_069635112.1:6-pyruvoyl-tetrahydropterin synthase-related protein >Feature sequence161 193 1209 gene locus_tag LOCUS_19450 193 1209 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392580.1 protein_id gnl|my_center|LOCUS_19450 1237 2121 gene locus_tag LOCUS_19460 gene dapA 1237 2121 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141020.1 protein_id gnl|my_center|LOCUS_19460 2149 2895 gene locus_tag LOCUS_19470 2149 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 3722 2901 gene locus_tag LOCUS_19480 gene kdsA 3722 2901 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545456.1 protein_id gnl|my_center|LOCUS_19480 4127 4053 gene locus_tag LOCUS_t00400 4127 4053 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence162 <1 1921 gene locus_tag LOCUS_19490 <1 1921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391612.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 2672 2001 gene locus_tag LOCUS_19500 gene menG 2672 2001 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726790.1 protein_id gnl|my_center|LOCUS_19500 3122 2679 gene locus_tag LOCUS_19510 3122 2679 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964154.1 protein_id gnl|my_center|LOCUS_19510 3268 3471 gene locus_tag LOCUS_19520 3268 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 >Feature sequence163 94 1152 gene locus_tag LOCUS_19530 94 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 1264 1632 gene locus_tag LOCUS_19540 1264 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 1625 1819 gene locus_tag LOCUS_19550 1625 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 1825 3447 gene locus_tag LOCUS_19560 1825 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 3477 3632 gene locus_tag LOCUS_19570 3477 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 3753 3893 gene locus_tag LOCUS_19580 3753 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence164 1102 107 gene locus_tag LOCUS_19590 1102 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 1294 2667 gene locus_tag LOCUS_19600 1294 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 >Feature sequence165 109 894 gene locus_tag LOCUS_19610 109 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000385029.1 protein_id gnl|my_center|LOCUS_19610 1453 1644 gene locus_tag LOCUS_19620 1453 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 1953 3110 gene locus_tag LOCUS_19630 1953 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 3276 3593 gene locus_tag LOCUS_19640 3276 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence166 <1 579 gene locus_tag LOCUS_19650 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015826.1:tetratricopeptide repeat protein 576 980 gene locus_tag LOCUS_19660 576 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 981 1397 gene locus_tag LOCUS_19670 981 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2709 1390 gene locus_tag LOCUS_19680 gene trmFO 2709 1390 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244725.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence167 42 1469 gene locus_tag LOCUS_19690 42 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 1603 1980 gene locus_tag LOCUS_19700 gene rpsL 1603 1980 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143913.1 protein_id gnl|my_center|LOCUS_19700 1996 2466 gene locus_tag LOCUS_19710 gene rpsG 1996 2466 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057585.1 protein_id gnl|my_center|LOCUS_19710 3019 2534 gene locus_tag LOCUS_19720 3019 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 3575 3075 gene locus_tag LOCUS_19730 3575 3075 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124633.1 protein_id gnl|my_center|LOCUS_19730 >Feature sequence168 1676 462 gene locus_tag LOCUS_19740 1676 462 CDS product reverse transcriptase/maturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459234.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19740 3071 2769 gene locus_tag LOCUS_19750 3071 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 >Feature sequence169 792 400 gene locus_tag LOCUS_19760 792 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 999 1631 gene locus_tag LOCUS_19770 999 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1774 2283 gene locus_tag LOCUS_19780 1774 2283 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263276.1 protein_id gnl|my_center|LOCUS_19780 <3599 2717 gene locus_tag LOCUS_19790 <3599 2717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548923.1:helix-turn-helix transcriptional regulator >Feature sequence170 <1 886 gene locus_tag LOCUS_19800 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000110082.1:restriction endonuclease subunit S 1000 1629 gene locus_tag LOCUS_19810 1000 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 1623 2081 gene locus_tag LOCUS_19820 1623 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 2086 2907 gene locus_tag LOCUS_19830 2086 2907 CDS product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679305.1 protein_id gnl|my_center|LOCUS_19830 >Feature sequence171 390 1502 gene locus_tag LOCUS_19840 390 1502 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946398.1 protein_id gnl|my_center|LOCUS_19840 3109 1688 gene locus_tag LOCUS_19850 3109 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence172 708 457 gene locus_tag LOCUS_19860 708 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 1329 1631 gene locus_tag LOCUS_19870 1329 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19870 3318 1921 gene locus_tag LOCUS_19880 3318 1921 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548236.1 protein_id gnl|my_center|LOCUS_19880 >Feature sequence173 1486 2046 gene locus_tag LOCUS_19890 1486 2046 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920769.1 protein_id gnl|my_center|LOCUS_19890 3352 2093 gene locus_tag LOCUS_19900 3352 2093 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376442.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence174 490 1320 gene locus_tag LOCUS_19910 490 1320 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767556.1 protein_id gnl|my_center|LOCUS_19910 1317 1439 gene locus_tag LOCUS_19920 1317 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2243 1443 gene locus_tag LOCUS_19930 2243 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19930 2674 2279 gene locus_tag LOCUS_19940 2674 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence175 249 40 gene locus_tag LOCUS_19950 249 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 1783 188 gene locus_tag LOCUS_19960 1783 188 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860806.1 protein_id gnl|my_center|LOCUS_19960 2088 1921 gene locus_tag LOCUS_19970 2088 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 2729 2145 gene locus_tag LOCUS_19980 2729 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 3077 2910 gene locus_tag LOCUS_19990 3077 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 >Feature sequence176 369 1043 gene locus_tag LOCUS_20000 369 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 1046 2239 gene locus_tag LOCUS_20010 1046 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 >Feature sequence177 675 121 gene locus_tag LOCUS_20020 675 121 CDS product putative colanic acid biosynthesis acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331372.1 protein_id gnl|my_center|LOCUS_20020 1493 672 gene locus_tag LOCUS_20030 1493 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 2874 1774 gene locus_tag LOCUS_20040 2874 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 <3373 2859 gene locus_tag LOCUS_20050 <3373 2859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476426.1:glycosyltransferase family 1 protein >Feature sequence178 2803 1097 gene locus_tag LOCUS_20060 2803 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 3282 2800 gene locus_tag LOCUS_20070 3282 2800 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016229.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence179 631 1437 gene locus_tag LOCUS_20080 631 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 1539 3107 gene locus_tag LOCUS_20090 1539 3107 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254623.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence180 241 924 gene locus_tag LOCUS_20100 241 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 2090 933 gene locus_tag LOCUS_20110 2090 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence181 81 974 gene locus_tag LOCUS_20120 81 974 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254560.1 protein_id gnl|my_center|LOCUS_20120 967 2172 gene locus_tag LOCUS_20130 967 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 2309 2875 gene locus_tag LOCUS_20140 2309 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 >Feature sequence182 167 12 gene locus_tag LOCUS_20150 167 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 491 213 gene locus_tag LOCUS_20160 491 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 922 1347 gene locus_tag LOCUS_20170 922 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 2553 1351 gene locus_tag LOCUS_20180 2553 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 >Feature sequence183 <1 1448 gene locus_tag LOCUS_20190 <1 1448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529729.1:bifunctional UDP-sugar hydrolase/5'-nucleotidase 1556 2554 gene locus_tag LOCUS_20200 1556 2554 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582950.1 protein_id gnl|my_center|LOCUS_20200 >Feature sequence184 1986 301 gene locus_tag LOCUS_20210 1986 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 2439 2363 gene locus_tag LOCUS_t00410 2439 2363 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence185 2007 1228 gene locus_tag LOCUS_20220 2007 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2328 2008 gene locus_tag LOCUS_20230 2328 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 >Feature sequence186 109 1095 gene locus_tag LOCUS_20240 109 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 1073 1567 gene locus_tag LOCUS_20250 gene lspA 1073 1567 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295859.1 protein_id gnl|my_center|LOCUS_20250 1577 2503 gene locus_tag LOCUS_20260 1577 2503 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130995.1 protein_id gnl|my_center|LOCUS_20260 2500 2859 gene locus_tag LOCUS_20270 2500 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 >Feature sequence187 <1 1855 gene locus_tag LOCUS_20280 <1 1855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547921.1:primosomal protein N' 2663 1857 gene locus_tag LOCUS_20290 2663 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence188 1197 268 gene locus_tag LOCUS_20300 1197 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 2225 1197 gene locus_tag LOCUS_20310 2225 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 2720 2325 gene locus_tag LOCUS_20320 2720 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 >Feature sequence189 267 2090 gene locus_tag LOCUS_20330 267 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2553 2098 gene locus_tag LOCUS_20340 gene smpB 2553 2098 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 protein_id gnl|my_center|LOCUS_20340 2890 2561 gene locus_tag LOCUS_20350 2890 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 >Feature sequence190 541 1734 gene locus_tag LOCUS_20360 541 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 2356 1901 gene locus_tag LOCUS_20370 2356 1901 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546682.1 protein_id gnl|my_center|LOCUS_20370 >Feature sequence191 1402 890 gene locus_tag LOCUS_20380 1402 890 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125831.1 protein_id gnl|my_center|LOCUS_20380 1497 2048 gene locus_tag LOCUS_20390 1497 2048 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_20390 2041 2601 gene locus_tag LOCUS_20400 2041 2601 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence192 2260 134 gene locus_tag LOCUS_20410 2260 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 2447 2800 gene locus_tag LOCUS_20420 2447 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 >Feature sequence193 254 508 gene locus_tag LOCUS_20430 254 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 1871 492 gene locus_tag LOCUS_20440 1871 492 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391765.1 protein_id gnl|my_center|LOCUS_20440 1952 2806 gene locus_tag LOCUS_20450 gene pheA 1952 2806 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546845.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence194 451 1425 gene locus_tag LOCUS_20460 451 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 1425 2414 gene locus_tag LOCUS_20470 1425 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence195 809 1525 gene locus_tag LOCUS_20480 809 1525 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263036.1 protein_id gnl|my_center|LOCUS_20480 1533 2792 gene locus_tag LOCUS_20490 1533 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence196 583 311 gene locus_tag LOCUS_20500 583 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 1023 703 gene locus_tag LOCUS_20510 1023 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 1165 1037 gene locus_tag LOCUS_20520 1165 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 1494 1225 gene locus_tag LOCUS_20530 1494 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 1637 2302 gene locus_tag LOCUS_20540 1637 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence197 1464 88 gene locus_tag LOCUS_20550 gene gdhA 1464 88 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721354.1 protein_id gnl|my_center|LOCUS_20550 <2690 1514 gene locus_tag LOCUS_20560 <2690 1514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048120.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence198 1594 599 gene locus_tag LOCUS_20570 1594 599 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931799.1 protein_id gnl|my_center|LOCUS_20570 2074 1616 gene locus_tag LOCUS_20580 2074 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 >Feature sequence199 182 928 gene locus_tag LOCUS_20590 182 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 925 2004 gene locus_tag LOCUS_20600 925 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 2042 2117 gene locus_tag LOCUS_t00420 2042 2117 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2419 2640 gene locus_tag LOCUS_20610 2419 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 >Feature sequence200 682 266 gene locus_tag LOCUS_20620 gene ruvX 682 266 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428279.1 protein_id gnl|my_center|LOCUS_20620 2312 675 gene locus_tag LOCUS_20630 2312 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 2584 2312 gene locus_tag LOCUS_20640 2584 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 >Feature sequence201 835 2019 gene locus_tag LOCUS_20650 835 2019 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010680900.1 protein_id gnl|my_center|LOCUS_20650 >Feature sequence202 1826 138 gene locus_tag LOCUS_20660 gene glgP 1826 138 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 protein_id gnl|my_center|LOCUS_20660 >Feature sequence203 1513 665 gene locus_tag LOCUS_20670 1513 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20670 2221 2084 gene locus_tag LOCUS_20680 2221 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 >Feature sequence204 46 1059 gene locus_tag LOCUS_20690 46 1059 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475868.1 protein_id gnl|my_center|LOCUS_20690 1059 2087 gene locus_tag LOCUS_20700 1059 2087 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475868.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence205 1573 1286 gene locus_tag LOCUS_20710 1573 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20710 >Feature sequence206 1426 692 gene locus_tag LOCUS_20720 1426 692 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436406.1 protein_id gnl|my_center|LOCUS_20720 2463 1423 gene locus_tag LOCUS_20730 gene vanG 2463 1423 CDS product D-alanine--D-serine ligase VanG-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861276.1 protein_id gnl|my_center|LOCUS_20730 >Feature sequence207 292 14 gene locus_tag LOCUS_20740 292 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 1789 353 gene locus_tag LOCUS_20750 gene hydG 1789 353 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_20750 1892 2353 gene locus_tag LOCUS_20760 1892 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760