>Feature sequence01 2453 558 gene locus_tag LOCUS_00010 2453 558 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876827.1 protein_id gnl|my_center|LOCUS_00010 3153 2515 gene locus_tag LOCUS_00020 gene psmB 3153 2515 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094873.1 protein_id gnl|my_center|LOCUS_00020 4295 3234 gene locus_tag LOCUS_00030 4295 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5159 4353 gene locus_tag LOCUS_00040 5159 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6849 5101 gene locus_tag LOCUS_00050 6849 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6893 7417 gene locus_tag LOCUS_00060 6893 7417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7970 7404 gene locus_tag LOCUS_00070 7970 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8314 7976 gene locus_tag LOCUS_00080 8314 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 12312 8356 gene locus_tag LOCUS_00090 12312 8356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13457 12408 gene locus_tag LOCUS_00100 13457 12408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14544 13483 gene locus_tag LOCUS_00110 14544 13483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 15545 14544 gene locus_tag LOCUS_00120 15545 14544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 17662 15545 gene locus_tag LOCUS_00130 17662 15545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 18657 17659 gene locus_tag LOCUS_00140 18657 17659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 19856 18657 gene locus_tag LOCUS_00150 19856 18657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 20083 23460 gene locus_tag LOCUS_00160 20083 23460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 23535 23864 gene locus_tag LOCUS_00170 23535 23864 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250445.1 protein_id gnl|my_center|LOCUS_00170 23906 24454 gene locus_tag LOCUS_00180 23906 24454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 24451 24906 gene locus_tag LOCUS_00190 gene scpB 24451 24906 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867410.1 protein_id gnl|my_center|LOCUS_00190 26133 25609 gene locus_tag LOCUS_00200 26133 25609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 26488 26883 gene locus_tag LOCUS_00210 26488 26883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 26924 28189 gene locus_tag LOCUS_00220 26924 28189 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_00220 28306 29871 gene locus_tag LOCUS_00230 28306 29871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 29925 30533 gene locus_tag LOCUS_00240 29925 30533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 31674 30697 gene locus_tag LOCUS_00250 31674 30697 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868629.1 protein_id gnl|my_center|LOCUS_00250 32011 31664 gene locus_tag LOCUS_00260 32011 31664 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878647.1 protein_id gnl|my_center|LOCUS_00260 32231 32013 gene locus_tag LOCUS_00270 32231 32013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32604 32329 gene locus_tag LOCUS_00280 32604 32329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 32815 32546 gene locus_tag LOCUS_00290 32815 32546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 33285 33049 gene locus_tag LOCUS_00300 33285 33049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 34087 33287 gene locus_tag LOCUS_00310 gene rrp42 34087 33287 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250584.1 protein_id gnl|my_center|LOCUS_00310 34836 34093 gene locus_tag LOCUS_00320 gene rrp41 34836 34093 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876322.1 protein_id gnl|my_center|LOCUS_00320 35449 34838 gene locus_tag LOCUS_00330 gene rrp4 35449 34838 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250586.1 protein_id gnl|my_center|LOCUS_00330 36345 35650 gene locus_tag LOCUS_00340 36345 35650 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496552.1 protein_id gnl|my_center|LOCUS_00340 36498 37427 gene locus_tag LOCUS_00350 36498 37427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 38346 37504 gene locus_tag LOCUS_00360 38346 37504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 38949 38407 gene locus_tag LOCUS_00370 gene thpR 38949 38407 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250689.1 protein_id gnl|my_center|LOCUS_00370 39028 40224 gene locus_tag LOCUS_00380 39028 40224 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876694.1 protein_id gnl|my_center|LOCUS_00380 40221 41162 gene locus_tag LOCUS_00390 40221 41162 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867902.1 protein_id gnl|my_center|LOCUS_00390 41155 41931 gene locus_tag LOCUS_00400 41155 41931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 41938 42375 gene locus_tag LOCUS_00410 41938 42375 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674599.1 protein_id gnl|my_center|LOCUS_00410 43393 42380 gene locus_tag LOCUS_00420 43393 42380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 43498 44259 gene locus_tag LOCUS_00430 43498 44259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 44376 45629 gene locus_tag LOCUS_00440 44376 45629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 45683 47656 gene locus_tag LOCUS_00450 gene lonB 45683 47656 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877871.1 protein_id gnl|my_center|LOCUS_00450 47725 49725 gene locus_tag LOCUS_00460 47725 49725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 51299 50061 gene locus_tag LOCUS_00470 51299 50061 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066217.1 protein_id gnl|my_center|LOCUS_00470 51409 51966 gene locus_tag LOCUS_00480 51409 51966 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250120.1 protein_id gnl|my_center|LOCUS_00480 51982 52257 gene locus_tag LOCUS_00490 51982 52257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 52271 53299 gene locus_tag LOCUS_00500 52271 53299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 53865 53431 gene locus_tag LOCUS_00510 53865 53431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 54685 53930 gene locus_tag LOCUS_00520 54685 53930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 54877 55428 gene locus_tag LOCUS_00530 54877 55428 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868811.1 protein_id gnl|my_center|LOCUS_00530 55449 55904 gene locus_tag LOCUS_00540 55449 55904 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250202.1 protein_id gnl|my_center|LOCUS_00540 56041 56511 gene locus_tag LOCUS_00550 56041 56511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 56517 56852 gene locus_tag LOCUS_00560 56517 56852 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877726.1 protein_id gnl|my_center|LOCUS_00560 56877 57458 gene locus_tag LOCUS_00570 56877 57458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 >Feature sequence02 1781 1161 gene locus_tag LOCUS_00580 1781 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 2259 1801 gene locus_tag LOCUS_00590 2259 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 2804 3280 gene locus_tag LOCUS_00600 2804 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 3894 3238 gene locus_tag LOCUS_00610 3894 3238 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250624.1 protein_id gnl|my_center|LOCUS_00610 4842 3898 gene locus_tag LOCUS_00620 4842 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 4925 5692 gene locus_tag LOCUS_00630 4925 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 5838 8738 gene locus_tag LOCUS_00640 5838 8738 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942279.1 protein_id gnl|my_center|LOCUS_00640 8857 10665 gene locus_tag LOCUS_00650 8857 10665 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250186.1 protein_id gnl|my_center|LOCUS_00650 12629 10926 gene locus_tag LOCUS_00660 gene ade 12629 10926 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964205.1 protein_id gnl|my_center|LOCUS_00660 13360 12626 gene locus_tag LOCUS_00670 gene rio1 13360 12626 CDS product RIO-type serine/threonine-protein kinase Rio1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879299.1 protein_id gnl|my_center|LOCUS_00670 14064 13441 gene locus_tag LOCUS_00680 14064 13441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 14516 14160 gene locus_tag LOCUS_00690 gene eif1A 14516 14160 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869944.1 protein_id gnl|my_center|LOCUS_00690 14931 14521 gene locus_tag LOCUS_00700 14931 14521 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877371.1 protein_id gnl|my_center|LOCUS_00700 15044 15703 gene locus_tag LOCUS_00710 15044 15703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 15794 17275 gene locus_tag LOCUS_00720 15794 17275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 18545 17292 gene locus_tag LOCUS_00730 gene ahcY 18545 17292 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870905.1 protein_id gnl|my_center|LOCUS_00730 18730 19083 gene locus_tag LOCUS_00740 18730 19083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 19088 19774 gene locus_tag LOCUS_00750 19088 19774 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187151961.1 protein_id gnl|my_center|LOCUS_00750 19758 21305 gene locus_tag LOCUS_00760 19758 21305 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903076.1 protein_id gnl|my_center|LOCUS_00760 21368 22579 gene locus_tag LOCUS_00770 21368 22579 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023110.1 protein_id gnl|my_center|LOCUS_00770 22579 23802 gene locus_tag LOCUS_00780 22579 23802 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496851.1 protein_id gnl|my_center|LOCUS_00780 23884 25041 gene locus_tag LOCUS_00790 23884 25041 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_00790 25466 29515 gene locus_tag LOCUS_00800 25466 29515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 30980 29541 gene locus_tag LOCUS_00810 30980 29541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 31179 32501 gene locus_tag LOCUS_00820 31179 32501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 33964 32522 gene locus_tag LOCUS_00830 gene aspA 33964 32522 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460903.1 protein_id gnl|my_center|LOCUS_00830 34322 34074 gene locus_tag LOCUS_00840 34322 34074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 34484 34347 gene locus_tag LOCUS_00850 34484 34347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 35034 34447 gene locus_tag LOCUS_00860 35034 34447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 35266 37305 gene locus_tag LOCUS_00870 gene topA 35266 37305 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496891.1 protein_id gnl|my_center|LOCUS_00870 37289 38527 gene locus_tag LOCUS_00880 37289 38527 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496567.1 protein_id gnl|my_center|LOCUS_00880 38633 39745 gene locus_tag LOCUS_00890 38633 39745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 39764 41032 gene locus_tag LOCUS_00900 39764 41032 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250842.1 protein_id gnl|my_center|LOCUS_00900 42085 41048 gene locus_tag LOCUS_00910 42085 41048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 42207 43121 gene locus_tag LOCUS_00920 42207 43121 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_00920 44699 43143 gene locus_tag LOCUS_00930 44699 43143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 46106 46603 gene locus_tag LOCUS_00940 46106 46603 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211757.1 protein_id gnl|my_center|LOCUS_00940 47629 46625 gene locus_tag LOCUS_00950 47629 46625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 47869 52548 gene locus_tag LOCUS_00960 47869 52548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 52827 55283 gene locus_tag LOCUS_00970 52827 55283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 >Feature sequence03 221 976 gene locus_tag LOCUS_00980 gene rsmA 221 976 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870542.1 protein_id gnl|my_center|LOCUS_00980 1002 1415 gene locus_tag LOCUS_00990 1002 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 1482 2657 gene locus_tag LOCUS_01000 1482 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 3533 2721 gene locus_tag LOCUS_01010 3533 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 4791 3673 gene locus_tag LOCUS_01020 gene dnaJ 4791 3673 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021493.1 protein_id gnl|my_center|LOCUS_01020 5227 4937 gene locus_tag LOCUS_01030 5227 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 7268 5385 gene locus_tag LOCUS_01040 gene dnaK 7268 5385 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_01040 7783 7265 gene locus_tag LOCUS_01050 7783 7265 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800555.1 protein_id gnl|my_center|LOCUS_01050 7993 8349 gene locus_tag LOCUS_01060 7993 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 9291 8386 gene locus_tag LOCUS_01070 9291 8386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 9648 9358 gene locus_tag LOCUS_01080 9648 9358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 10086 10949 gene locus_tag LOCUS_01090 10086 10949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 11052 11948 gene locus_tag LOCUS_01100 11052 11948 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_01100 12010 13566 gene locus_tag LOCUS_01110 gene purH 12010 13566 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_01110 13580 13987 gene locus_tag LOCUS_01120 13580 13987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 14993 14004 gene locus_tag LOCUS_01130 14993 14004 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880139.1 protein_id gnl|my_center|LOCUS_01130 15465 14962 gene locus_tag LOCUS_01140 15465 14962 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903443.1 protein_id gnl|my_center|LOCUS_01140 15965 16957 gene locus_tag LOCUS_01150 15965 16957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 17957 16959 gene locus_tag LOCUS_01160 17957 16959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 18078 18650 gene locus_tag LOCUS_01170 18078 18650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 18981 19670 gene locus_tag LOCUS_01180 18981 19670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 20967 19711 gene locus_tag LOCUS_01190 20967 19711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 22364 21045 gene locus_tag LOCUS_01200 22364 21045 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064974.1 protein_id gnl|my_center|LOCUS_01200 22573 23037 gene locus_tag LOCUS_01210 22573 23037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 23653 23012 gene locus_tag LOCUS_01220 23653 23012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 23928 25370 gene locus_tag LOCUS_01230 gene proS 23928 25370 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868093.1 protein_id gnl|my_center|LOCUS_01230 25494 26399 gene locus_tag LOCUS_01240 25494 26399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 27450 28370 gene locus_tag LOCUS_01250 27450 28370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 29076 28447 gene locus_tag LOCUS_01260 29076 28447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 30292 29183 gene locus_tag LOCUS_01270 30292 29183 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839956.1 protein_id gnl|my_center|LOCUS_01270 30352 30966 gene locus_tag LOCUS_01280 30352 30966 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870952.1 protein_id gnl|my_center|LOCUS_01280 33353 30963 gene locus_tag LOCUS_01290 33353 30963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 34462 33365 gene locus_tag LOCUS_01300 34462 33365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 35360 34539 gene locus_tag LOCUS_01310 35360 34539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 35628 36491 gene locus_tag LOCUS_01320 gene rnz 35628 36491 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878439.1 protein_id gnl|my_center|LOCUS_01320 36782 39727 gene locus_tag LOCUS_01330 36782 39727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 40711 39884 gene locus_tag LOCUS_01340 40711 39884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 40871 42319 gene locus_tag LOCUS_01350 40871 42319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 42479 43138 gene locus_tag LOCUS_01360 42479 43138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 43204 43716 gene locus_tag LOCUS_01370 43204 43716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 43727 44008 gene locus_tag LOCUS_01380 43727 44008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 44028 44189 gene locus_tag LOCUS_01390 44028 44189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 44186 44944 gene locus_tag LOCUS_01400 44186 44944 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496399.1 protein_id gnl|my_center|LOCUS_01400 45134 45901 gene locus_tag LOCUS_01410 45134 45901 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020689.1 protein_id gnl|my_center|LOCUS_01410 47065 47451 gene locus_tag LOCUS_01420 47065 47451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 47762 47478 gene locus_tag LOCUS_01430 47762 47478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 48164 49090 gene locus_tag LOCUS_01440 48164 49090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 49151 50212 gene locus_tag LOCUS_01450 49151 50212 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249523.1 protein_id gnl|my_center|LOCUS_01450 51029 50220 gene locus_tag LOCUS_01460 51029 50220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 51786 51067 gene locus_tag LOCUS_01470 gene mtnP 51786 51067 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392226.1 protein_id gnl|my_center|LOCUS_01470 >Feature sequence04 1967 1515 gene locus_tag LOCUS_01480 1967 1515 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867126.1 protein_id gnl|my_center|LOCUS_01480 2136 1972 gene locus_tag LOCUS_01490 2136 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 3299 2145 gene locus_tag LOCUS_01500 gene ftsZ 3299 2145 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869869.1 protein_id gnl|my_center|LOCUS_01500 3443 3943 gene locus_tag LOCUS_01510 3443 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 4634 4032 gene locus_tag LOCUS_01520 4634 4032 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990667.1 protein_id gnl|my_center|LOCUS_01520 5480 4656 gene locus_tag LOCUS_01530 5480 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 6580 5480 gene locus_tag LOCUS_01540 6580 5480 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876814.1 protein_id gnl|my_center|LOCUS_01540 6645 7565 gene locus_tag LOCUS_01550 6645 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 9147 7606 gene locus_tag LOCUS_01560 9147 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 10552 9332 gene locus_tag LOCUS_01570 gene truD 10552 9332 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_01570 11099 10554 gene locus_tag LOCUS_01580 11099 10554 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021817.1 protein_id gnl|my_center|LOCUS_01580 11223 11429 gene locus_tag LOCUS_01590 11223 11429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 11549 13774 gene locus_tag LOCUS_01600 gene metG 11549 13774 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889772.1 protein_id gnl|my_center|LOCUS_01600 13811 14443 gene locus_tag LOCUS_01610 13811 14443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 14876 14493 gene locus_tag LOCUS_01620 14876 14493 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868249.1 protein_id gnl|my_center|LOCUS_01620 14962 15357 gene locus_tag LOCUS_01630 14962 15357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 17002 15374 gene locus_tag LOCUS_01640 17002 15374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 17090 18790 gene locus_tag LOCUS_01650 17090 18790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 18893 20470 gene locus_tag LOCUS_01660 18893 20470 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750460.1 protein_id gnl|my_center|LOCUS_01660 20484 22139 gene locus_tag LOCUS_01670 20484 22139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 22141 23037 gene locus_tag LOCUS_01680 22141 23037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 23049 24116 gene locus_tag LOCUS_01690 23049 24116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 24139 24711 gene locus_tag LOCUS_01700 24139 24711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 25412 24852 gene locus_tag LOCUS_01710 25412 24852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 26672 25485 gene locus_tag LOCUS_01720 26672 25485 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871137.1 protein_id gnl|my_center|LOCUS_01720 26816 28852 gene locus_tag LOCUS_01730 26816 28852 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877372.1 protein_id gnl|my_center|LOCUS_01730 28918 29757 gene locus_tag LOCUS_01740 28918 29757 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065870.1 protein_id gnl|my_center|LOCUS_01740 30798 29776 gene locus_tag LOCUS_01750 gene trm5b 30798 29776 CDS product tRNA (guanine(37)-N1)-methyltransferase Trm5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867861.1 protein_id gnl|my_center|LOCUS_01750 33674 30900 gene locus_tag LOCUS_01760 gene leuS 33674 30900 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496564.1 protein_id gnl|my_center|LOCUS_01760 35131 33749 gene locus_tag LOCUS_01770 35131 33749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 35305 35469 gene locus_tag LOCUS_01780 35305 35469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 35484 35885 gene locus_tag LOCUS_01790 35484 35885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 36129 36494 gene locus_tag LOCUS_01800 36129 36494 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867598.1 protein_id gnl|my_center|LOCUS_01800 36553 37905 gene locus_tag LOCUS_01810 gene dnaG 36553 37905 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250361.1 protein_id gnl|my_center|LOCUS_01810 38772 37990 gene locus_tag LOCUS_01820 38772 37990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 39332 38847 gene locus_tag LOCUS_01830 39332 38847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 39841 39335 gene locus_tag LOCUS_01840 39841 39335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 40278 39838 gene locus_tag LOCUS_01850 40278 39838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 41855 40278 gene locus_tag LOCUS_01860 41855 40278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 42484 41864 gene locus_tag LOCUS_01870 42484 41864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 43027 42536 gene locus_tag LOCUS_01880 43027 42536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 43294 43049 gene locus_tag LOCUS_01890 43294 43049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 44268 43462 gene locus_tag LOCUS_01900 44268 43462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 44261 44425 gene locus_tag LOCUS_01910 44261 44425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 44457 44984 gene locus_tag LOCUS_01920 44457 44984 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871125.1 protein_id gnl|my_center|LOCUS_01920 45082 45657 gene locus_tag LOCUS_01930 45082 45657 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146546.1 protein_id gnl|my_center|LOCUS_01930 46345 45623 gene locus_tag LOCUS_01940 46345 45623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 48857 46968 gene locus_tag LOCUS_01950 48857 46968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 49530 48943 gene locus_tag LOCUS_01960 49530 48943 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989890.1 protein_id gnl|my_center|LOCUS_01960 50240 49536 gene locus_tag LOCUS_01970 50240 49536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 >Feature sequence05 719 210 gene locus_tag LOCUS_01980 719 210 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 protein_id gnl|my_center|LOCUS_01980 969 871 gene locus_tag LOCUS_r00010 969 871 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1026 1898 gene locus_tag LOCUS_01990 1026 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 1910 2992 gene locus_tag LOCUS_02000 1910 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 2996 4522 gene locus_tag LOCUS_02010 gene lysS 2996 4522 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061081.1 protein_id gnl|my_center|LOCUS_02010 4519 5139 gene locus_tag LOCUS_02020 4519 5139 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869554.1 protein_id gnl|my_center|LOCUS_02020 5333 7021 gene locus_tag LOCUS_02030 5333 7021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 7449 7066 gene locus_tag LOCUS_02040 7449 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 7643 7434 gene locus_tag LOCUS_02050 7643 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 8730 7693 gene locus_tag LOCUS_02060 gene fen 8730 7693 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250232.1 protein_id gnl|my_center|LOCUS_02060 9174 8731 gene locus_tag LOCUS_02070 9174 8731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 9297 10481 gene locus_tag LOCUS_02080 9297 10481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 12484 10556 gene locus_tag LOCUS_02090 12484 10556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 14865 12535 gene locus_tag LOCUS_02100 14865 12535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 19305 15118 gene locus_tag LOCUS_02110 19305 15118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 19943 19443 gene locus_tag LOCUS_02120 19943 19443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 20475 19993 gene locus_tag LOCUS_02130 20475 19993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 20547 21563 gene locus_tag LOCUS_02140 gene purM 20547 21563 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869698.1 protein_id gnl|my_center|LOCUS_02140 22233 21595 gene locus_tag LOCUS_02150 22233 21595 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251230.1 protein_id gnl|my_center|LOCUS_02150 22277 23050 gene locus_tag LOCUS_02160 22277 23050 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868725.1 protein_id gnl|my_center|LOCUS_02160 23347 23054 gene locus_tag LOCUS_02170 23347 23054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 23925 23374 gene locus_tag LOCUS_02180 23925 23374 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941797.1 protein_id gnl|my_center|LOCUS_02180 24759 23938 gene locus_tag LOCUS_02190 24759 23938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 24910 25581 gene locus_tag LOCUS_02200 24910 25581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 25535 25951 gene locus_tag LOCUS_02210 25535 25951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 26178 27260 gene locus_tag LOCUS_02220 26178 27260 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496792.1 protein_id gnl|my_center|LOCUS_02220 27291 27521 gene locus_tag LOCUS_02230 27291 27521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 27637 27897 gene locus_tag LOCUS_02240 27637 27897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 28482 30140 gene locus_tag LOCUS_02250 28482 30140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 30643 30155 gene locus_tag LOCUS_02260 30643 30155 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878520.1 protein_id gnl|my_center|LOCUS_02260 30717 32045 gene locus_tag LOCUS_02270 gene trpE 30717 32045 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 protein_id gnl|my_center|LOCUS_02270 32042 32617 gene locus_tag LOCUS_02280 32042 32617 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877264.1 protein_id gnl|my_center|LOCUS_02280 32620 33618 gene locus_tag LOCUS_02290 gene trpD 32620 33618 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869732.1 protein_id gnl|my_center|LOCUS_02290 33623 34402 gene locus_tag LOCUS_02300 gene trpC 33623 34402 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536690.1 protein_id gnl|my_center|LOCUS_02300 34399 35580 gene locus_tag LOCUS_02310 gene trpB 34399 35580 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880421.1 protein_id gnl|my_center|LOCUS_02310 35577 36341 gene locus_tag LOCUS_02320 gene trpA 35577 36341 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496709.1 protein_id gnl|my_center|LOCUS_02320 36559 37380 gene locus_tag LOCUS_02330 gene aroF 36559 37380 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460211.1 protein_id gnl|my_center|LOCUS_02330 37370 38374 gene locus_tag LOCUS_02340 gene aroB 37370 38374 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964212.1 protein_id gnl|my_center|LOCUS_02340 38361 39005 gene locus_tag LOCUS_02350 gene aroD 38361 39005 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870974.1 protein_id gnl|my_center|LOCUS_02350 38998 40284 gene locus_tag LOCUS_02360 38998 40284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 40271 41536 gene locus_tag LOCUS_02370 gene aroA 40271 41536 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_02370 41533 42540 gene locus_tag LOCUS_02380 gene aroC 41533 42540 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867581.1 protein_id gnl|my_center|LOCUS_02380 42537 43592 gene locus_tag LOCUS_02390 gene pheA 42537 43592 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583989.1 protein_id gnl|my_center|LOCUS_02390 43589 44365 gene locus_tag LOCUS_02400 43589 44365 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791104.1 protein_id gnl|my_center|LOCUS_02400 45891 44437 gene locus_tag LOCUS_02410 45891 44437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 47657 45891 gene locus_tag LOCUS_02420 47657 45891 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870401.1 protein_id gnl|my_center|LOCUS_02420 47893 48942 gene locus_tag LOCUS_02430 47893 48942 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249215.1 protein_id gnl|my_center|LOCUS_02430 49518 49165 gene locus_tag LOCUS_02440 49518 49165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020567.1 protein_id gnl|my_center|LOCUS_02440 49787 49515 gene locus_tag LOCUS_02450 49787 49515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020566.1 protein_id gnl|my_center|LOCUS_02450 50632 50000 gene locus_tag LOCUS_02460 50632 50000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 50827 50633 gene locus_tag LOCUS_02470 50827 50633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 >Feature sequence06 1249 2382 gene locus_tag LOCUS_02480 1249 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 2854 2384 gene locus_tag LOCUS_02490 2854 2384 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867323.1 protein_id gnl|my_center|LOCUS_02490 3862 2990 gene locus_tag LOCUS_02500 3862 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 5719 3974 gene locus_tag LOCUS_02510 5719 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 6019 7392 gene locus_tag LOCUS_02520 6019 7392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 8074 7427 gene locus_tag LOCUS_02530 8074 7427 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870120.1 protein_id gnl|my_center|LOCUS_02530 9455 8079 gene locus_tag LOCUS_02540 9455 8079 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296141.1 protein_id gnl|my_center|LOCUS_02540 11210 9465 gene locus_tag LOCUS_02550 11210 9465 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 protein_id gnl|my_center|LOCUS_02550 11603 11280 gene locus_tag LOCUS_02560 11603 11280 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250552.1 protein_id gnl|my_center|LOCUS_02560 12772 11657 gene locus_tag LOCUS_02570 12772 11657 CDS product V-type ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480006.1 protein_id gnl|my_center|LOCUS_02570 13341 12772 gene locus_tag LOCUS_02580 13341 12772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 13598 13344 gene locus_tag LOCUS_02590 13598 13344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 15505 13610 gene locus_tag LOCUS_02600 15505 13610 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869718.1 protein_id gnl|my_center|LOCUS_02600 15861 15517 gene locus_tag LOCUS_02610 15861 15517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 16075 16758 gene locus_tag LOCUS_02620 16075 16758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 16780 17232 gene locus_tag LOCUS_02630 16780 17232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 17341 17691 gene locus_tag LOCUS_02640 17341 17691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 18591 17692 gene locus_tag LOCUS_02650 18591 17692 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_02650 19557 18649 gene locus_tag LOCUS_02660 gene dph2 19557 18649 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250878.1 protein_id gnl|my_center|LOCUS_02660 19698 20540 gene locus_tag LOCUS_02670 19698 20540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 20733 21344 gene locus_tag LOCUS_02680 20733 21344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 21531 22331 gene locus_tag LOCUS_02690 21531 22331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 22875 22408 gene locus_tag LOCUS_02700 22875 22408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 23831 22872 gene locus_tag LOCUS_02710 23831 22872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 24277 24561 gene locus_tag LOCUS_02720 24277 24561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 24563 25597 gene locus_tag LOCUS_02730 24563 25597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 25599 25847 gene locus_tag LOCUS_02740 25599 25847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 26518 26766 gene locus_tag LOCUS_02750 26518 26766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 26769 27002 gene locus_tag LOCUS_02760 26769 27002 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_02760 27022 28008 gene locus_tag LOCUS_02770 27022 28008 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943586.1 protein_id gnl|my_center|LOCUS_02770 28025 28513 gene locus_tag LOCUS_02780 28025 28513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 28514 29230 gene locus_tag LOCUS_02790 28514 29230 CDS product aromatic aminobenezylarsenical efflux permease ArsG family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107126.1 protein_id gnl|my_center|LOCUS_02790 30010 29462 gene locus_tag LOCUS_02800 30010 29462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 31641 30103 gene locus_tag LOCUS_02810 31641 30103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 33364 31628 gene locus_tag LOCUS_02820 33364 31628 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966914.1 protein_id gnl|my_center|LOCUS_02820 33849 33442 gene locus_tag LOCUS_02830 33849 33442 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964388.1 protein_id gnl|my_center|LOCUS_02830 33933 34994 gene locus_tag LOCUS_02840 33933 34994 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080828.1 protein_id gnl|my_center|LOCUS_02840 35438 35004 gene locus_tag LOCUS_02850 35438 35004 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206190.1 protein_id gnl|my_center|LOCUS_02850 35616 35431 gene locus_tag LOCUS_02860 35616 35431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 36277 38634 gene locus_tag LOCUS_02870 36277 38634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 39266 38622 gene locus_tag LOCUS_02880 39266 38622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 39328 41553 gene locus_tag LOCUS_02890 39328 41553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 41699 42865 gene locus_tag LOCUS_02900 41699 42865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 44155 43022 gene locus_tag LOCUS_02910 44155 43022 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135390550.1 protein_id gnl|my_center|LOCUS_02910 44382 45095 gene locus_tag LOCUS_02920 44382 45095 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905221.1 protein_id gnl|my_center|LOCUS_02920 46110 45448 gene locus_tag LOCUS_02930 46110 45448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 46634 46107 gene locus_tag LOCUS_02940 46634 46107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 47243 46647 gene locus_tag LOCUS_02950 47243 46647 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250456.1 protein_id gnl|my_center|LOCUS_02950 47759 47253 gene locus_tag LOCUS_02960 47759 47253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 48174 47917 gene locus_tag LOCUS_02970 48174 47917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 >Feature sequence07 <1 507 gene locus_tag LOCUS_02980 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_143274369.1:UbiA family prenyltransferase 553 1671 gene locus_tag LOCUS_02990 553 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 1683 4055 gene locus_tag LOCUS_03000 1683 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 4135 4506 gene locus_tag LOCUS_03010 4135 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 4801 5151 gene locus_tag LOCUS_03020 4801 5151 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869688.1 protein_id gnl|my_center|LOCUS_03020 5157 5573 gene locus_tag LOCUS_03030 gene rplM 5157 5573 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867656.1 protein_id gnl|my_center|LOCUS_03030 5578 6075 gene locus_tag LOCUS_03040 5578 6075 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061175.1 protein_id gnl|my_center|LOCUS_03040 6087 6275 gene locus_tag LOCUS_03050 6087 6275 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878626.1 protein_id gnl|my_center|LOCUS_03050 7956 6820 gene locus_tag LOCUS_03060 7956 6820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 9047 8553 gene locus_tag LOCUS_03070 9047 8553 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531233.1 protein_id gnl|my_center|LOCUS_03070 9278 9967 gene locus_tag LOCUS_03080 9278 9967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 10101 10340 gene locus_tag LOCUS_03090 10101 10340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 10631 10308 gene locus_tag LOCUS_03100 10631 10308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 11287 12078 gene locus_tag LOCUS_03110 11287 12078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 13316 12075 gene locus_tag LOCUS_03120 13316 12075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 14503 13586 gene locus_tag LOCUS_03130 14503 13586 CDS product asparagine synthetase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250501.1 protein_id gnl|my_center|LOCUS_03130 14630 15076 gene locus_tag LOCUS_03140 gene lysM 14630 15076 CDS product HTH-type transcriptional regulator LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978132.1 protein_id gnl|my_center|LOCUS_03140 15198 16469 gene locus_tag LOCUS_03150 gene tuf 15198 16469 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869821.1 protein_id gnl|my_center|LOCUS_03150 16589 17887 gene locus_tag LOCUS_03160 gene asnS 16589 17887 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762130.1 protein_id gnl|my_center|LOCUS_03160 18503 17928 gene locus_tag LOCUS_03170 18503 17928 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545352.1 protein_id gnl|my_center|LOCUS_03170 19438 18590 gene locus_tag LOCUS_03180 19438 18590 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869948.1 protein_id gnl|my_center|LOCUS_03180 19955 19497 gene locus_tag LOCUS_03190 gene ndk 19955 19497 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770040.1 protein_id gnl|my_center|LOCUS_03190 20235 19975 gene locus_tag LOCUS_03200 20235 19975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 20447 20241 gene locus_tag LOCUS_03210 20447 20241 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867791.1 protein_id gnl|my_center|LOCUS_03210 20827 20453 gene locus_tag LOCUS_03220 gene rpl7ae 20827 20453 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979469.1 protein_id gnl|my_center|LOCUS_03220 21349 20969 gene locus_tag LOCUS_03230 21349 20969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 21473 22210 gene locus_tag LOCUS_03240 21473 22210 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 protein_id gnl|my_center|LOCUS_03240 23186 22230 gene locus_tag LOCUS_03250 23186 22230 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880897.1 protein_id gnl|my_center|LOCUS_03250 23311 23183 gene locus_tag LOCUS_03260 23311 23183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 23585 23334 gene locus_tag LOCUS_03270 23585 23334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 24262 23753 gene locus_tag LOCUS_03280 24262 23753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 25170 24262 gene locus_tag LOCUS_03290 25170 24262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 25299 26030 gene locus_tag LOCUS_03300 25299 26030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 26145 26924 gene locus_tag LOCUS_03310 26145 26924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 26905 27693 gene locus_tag LOCUS_03320 26905 27693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 27694 29265 gene locus_tag LOCUS_03330 27694 29265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 29329 30801 gene locus_tag LOCUS_03340 29329 30801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 32747 30927 gene locus_tag LOCUS_03350 32747 30927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 32894 34552 gene locus_tag LOCUS_03360 32894 34552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 34549 36006 gene locus_tag LOCUS_03370 34549 36006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 36978 36007 gene locus_tag LOCUS_03380 36978 36007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 37073 37417 gene locus_tag LOCUS_03390 37073 37417 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355771.1 protein_id gnl|my_center|LOCUS_03390 39278 37452 gene locus_tag LOCUS_03400 39278 37452 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932766.1 protein_id gnl|my_center|LOCUS_03400 40578 39280 gene locus_tag LOCUS_03410 40578 39280 CDS product ATP citrate lyase citrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932767.1 protein_id gnl|my_center|LOCUS_03410 41849 40623 gene locus_tag LOCUS_03420 gene icd 41849 40623 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868777.1 protein_id gnl|my_center|LOCUS_03420 43830 41899 gene locus_tag LOCUS_03430 43830 41899 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_03430 47020 44165 gene locus_tag LOCUS_03440 47020 44165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 >Feature sequence08 1475 267 gene locus_tag LOCUS_03450 gene prf1 1475 267 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 protein_id gnl|my_center|LOCUS_03450 2077 1505 gene locus_tag LOCUS_03460 2077 1505 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942088.1 protein_id gnl|my_center|LOCUS_03460 2337 3539 gene locus_tag LOCUS_03470 2337 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 5697 3901 gene locus_tag LOCUS_03480 5697 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 5992 7731 gene locus_tag LOCUS_03490 5992 7731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 7848 9587 gene locus_tag LOCUS_03500 gene glmS 7848 9587 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249760.1 protein_id gnl|my_center|LOCUS_03500 11271 9574 gene locus_tag LOCUS_03510 11271 9574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 11746 11276 gene locus_tag LOCUS_03520 11746 11276 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867125.1 protein_id gnl|my_center|LOCUS_03520 11783 12061 gene locus_tag LOCUS_03530 11783 12061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 12845 12129 gene locus_tag LOCUS_03540 12845 12129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 12900 13637 gene locus_tag LOCUS_03550 12900 13637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 13644 14627 gene locus_tag LOCUS_03560 gene fni 13644 14627 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875688.1 protein_id gnl|my_center|LOCUS_03560 15119 14658 gene locus_tag LOCUS_03570 15119 14658 CDS product HTH-type transcriptional regulator Ptr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869646.1 protein_id gnl|my_center|LOCUS_03570 15514 15266 gene locus_tag LOCUS_03580 15514 15266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 16458 15511 gene locus_tag LOCUS_03590 16458 15511 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113846.1 protein_id gnl|my_center|LOCUS_03590 16814 18112 gene locus_tag LOCUS_03600 16814 18112 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222086.1 protein_id gnl|my_center|LOCUS_03600 18754 19911 gene locus_tag LOCUS_03610 18754 19911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 19964 20230 gene locus_tag LOCUS_03620 19964 20230 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869817.1 protein_id gnl|my_center|LOCUS_03620 20231 20818 gene locus_tag LOCUS_03630 20231 20818 CDS product TIGR00267 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870150.1 protein_id gnl|my_center|LOCUS_03630 22379 21672 gene locus_tag LOCUS_03640 22379 21672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 22956 22714 gene locus_tag LOCUS_03650 22956 22714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 23246 22953 gene locus_tag LOCUS_03660 23246 22953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 23451 23248 gene locus_tag LOCUS_03670 23451 23248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 23442 23852 gene locus_tag LOCUS_03680 23442 23852 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881317.1 protein_id gnl|my_center|LOCUS_03680 24630 23839 gene locus_tag LOCUS_03690 24630 23839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 24701 24907 gene locus_tag LOCUS_03700 24701 24907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 25621 24908 gene locus_tag LOCUS_03710 25621 24908 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_03710 25708 26109 gene locus_tag LOCUS_03720 25708 26109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 26114 27187 gene locus_tag LOCUS_03730 26114 27187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 29002 27191 gene locus_tag LOCUS_03740 29002 27191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 29895 29056 gene locus_tag LOCUS_03750 29895 29056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 30529 29933 gene locus_tag LOCUS_03760 30529 29933 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868412.1 protein_id gnl|my_center|LOCUS_03760 32436 30529 gene locus_tag LOCUS_03770 gene iorA 32436 30529 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249091.1 protein_id gnl|my_center|LOCUS_03770 32711 32493 gene locus_tag LOCUS_03780 32711 32493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 33074 33415 gene locus_tag LOCUS_03790 33074 33415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 33677 33441 gene locus_tag LOCUS_03800 33677 33441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 35624 34185 gene locus_tag LOCUS_03810 35624 34185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 36548 35664 gene locus_tag LOCUS_03820 36548 35664 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_03820 36742 37185 gene locus_tag LOCUS_03830 36742 37185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 38942 37194 gene locus_tag LOCUS_03840 38942 37194 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496592.1 protein_id gnl|my_center|LOCUS_03840 40232 38976 gene locus_tag LOCUS_03850 40232 38976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 40368 40601 gene locus_tag LOCUS_03860 40368 40601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 40913 40620 gene locus_tag LOCUS_03870 40913 40620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 40965 41579 gene locus_tag LOCUS_03880 40965 41579 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227146.1 protein_id gnl|my_center|LOCUS_03880 41703 42788 gene locus_tag LOCUS_03890 41703 42788 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870788.1 protein_id gnl|my_center|LOCUS_03890 43663 42767 gene locus_tag LOCUS_03900 43663 42767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 44505 43669 gene locus_tag LOCUS_03910 44505 43669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 >Feature sequence09 298 1638 gene locus_tag LOCUS_03920 298 1638 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_03920 1710 2948 gene locus_tag LOCUS_03930 1710 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 3035 3769 gene locus_tag LOCUS_03940 3035 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 3967 6354 gene locus_tag LOCUS_03950 3967 6354 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868838.1 protein_id gnl|my_center|LOCUS_03950 6398 6706 gene locus_tag LOCUS_03960 6398 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 6706 7050 gene locus_tag LOCUS_03970 6706 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 7076 8242 gene locus_tag LOCUS_03980 7076 8242 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021461.1 protein_id gnl|my_center|LOCUS_03980 8251 8874 gene locus_tag LOCUS_03990 8251 8874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 9698 8922 gene locus_tag LOCUS_04000 9698 8922 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249977.1 protein_id gnl|my_center|LOCUS_04000 9902 10321 gene locus_tag LOCUS_04010 9902 10321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 10373 10567 gene locus_tag LOCUS_04020 10373 10567 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879124.1 protein_id gnl|my_center|LOCUS_04020 11787 10573 gene locus_tag LOCUS_04030 11787 10573 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771113.1 protein_id gnl|my_center|LOCUS_04030 12394 11828 gene locus_tag LOCUS_04040 12394 11828 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765028.1 protein_id gnl|my_center|LOCUS_04040 13537 12452 gene locus_tag LOCUS_04050 13537 12452 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876364.1 protein_id gnl|my_center|LOCUS_04050 13985 13593 gene locus_tag LOCUS_04060 13985 13593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 14857 13952 gene locus_tag LOCUS_04070 14857 13952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 16155 14854 gene locus_tag LOCUS_04080 gene purD 16155 14854 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061056.1 protein_id gnl|my_center|LOCUS_04080 16370 16161 gene locus_tag LOCUS_04090 16370 16161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 17083 16379 gene locus_tag LOCUS_04100 17083 16379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 18641 17076 gene locus_tag LOCUS_04110 18641 17076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 18890 19867 gene locus_tag LOCUS_04120 18890 19867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 19812 20063 gene locus_tag LOCUS_04130 19812 20063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 20070 21863 gene locus_tag LOCUS_04140 20070 21863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 22864 22082 gene locus_tag LOCUS_04150 22864 22082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 23964 22924 gene locus_tag LOCUS_04160 23964 22924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 25353 24103 gene locus_tag LOCUS_04170 25353 24103 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023091.1 protein_id gnl|my_center|LOCUS_04170 25730 27307 gene locus_tag LOCUS_04180 25730 27307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 28191 27457 gene locus_tag LOCUS_04190 28191 27457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 28541 28188 gene locus_tag LOCUS_04200 28541 28188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 29218 28538 gene locus_tag LOCUS_04210 29218 28538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 29618 29235 gene locus_tag LOCUS_04220 29618 29235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 29759 31015 gene locus_tag LOCUS_04230 29759 31015 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869538.1 protein_id gnl|my_center|LOCUS_04230 32301 31024 gene locus_tag LOCUS_04240 gene cca 32301 31024 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870623.1 protein_id gnl|my_center|LOCUS_04240 32522 34684 gene locus_tag LOCUS_04250 32522 34684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 35464 34676 gene locus_tag LOCUS_04260 35464 34676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 35692 37581 gene locus_tag LOCUS_04270 gene gyrB 35692 37581 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021594.1 protein_id gnl|my_center|LOCUS_04270 37692 40214 gene locus_tag LOCUS_04280 gene gyrA 37692 40214 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_04280 >Feature sequence10 235 987 gene locus_tag LOCUS_04290 235 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 2202 1048 gene locus_tag LOCUS_04300 2202 1048 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250045.1 protein_id gnl|my_center|LOCUS_04300 2686 2321 gene locus_tag LOCUS_04310 2686 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 3212 2688 gene locus_tag LOCUS_04320 3212 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 3540 3199 gene locus_tag LOCUS_04330 3540 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 4109 3537 gene locus_tag LOCUS_04340 4109 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 4362 4180 gene locus_tag LOCUS_04350 4362 4180 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869895.1 protein_id gnl|my_center|LOCUS_04350 4952 4359 gene locus_tag LOCUS_04360 4952 4359 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868803.1 protein_id gnl|my_center|LOCUS_04360 6545 5217 gene locus_tag LOCUS_04370 6545 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 6728 7810 gene locus_tag LOCUS_04380 6728 7810 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545936.1 protein_id gnl|my_center|LOCUS_04380 8629 7811 gene locus_tag LOCUS_04390 8629 7811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 8985 10793 gene locus_tag LOCUS_04400 8985 10793 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870139.1 protein_id gnl|my_center|LOCUS_04400 11596 10871 gene locus_tag LOCUS_04410 11596 10871 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023449.1 protein_id gnl|my_center|LOCUS_04410 12088 11684 gene locus_tag LOCUS_04420 12088 11684 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172718.1 protein_id gnl|my_center|LOCUS_04420 12419 12078 gene locus_tag LOCUS_04430 12419 12078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 12471 14198 gene locus_tag LOCUS_04440 12471 14198 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583146.1 protein_id gnl|my_center|LOCUS_04440 15258 14293 gene locus_tag LOCUS_04450 15258 14293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 15383 15904 gene locus_tag LOCUS_04460 15383 15904 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_04460 16101 17555 gene locus_tag LOCUS_04470 16101 17555 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_04470 19703 18057 gene locus_tag LOCUS_04480 gene thsB 19703 18057 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867141.1 protein_id gnl|my_center|LOCUS_04480 19923 20846 gene locus_tag LOCUS_04490 19923 20846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 20927 21952 gene locus_tag LOCUS_04500 20927 21952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 21991 23313 gene locus_tag LOCUS_04510 gene srp54 21991 23313 CDS product signal recognition particle protein SRP54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878126.1 protein_id gnl|my_center|LOCUS_04510 23377 23586 gene locus_tag LOCUS_04520 23377 23586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 25232 24300 gene locus_tag LOCUS_04530 25232 24300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 25286 25801 gene locus_tag LOCUS_04540 gene dcd 25286 25801 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902137.1 protein_id gnl|my_center|LOCUS_04540 25810 26445 gene locus_tag LOCUS_04550 25810 26445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 26642 26475 gene locus_tag LOCUS_04560 26642 26475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 27896 26703 gene locus_tag LOCUS_04570 27896 26703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 29001 27937 gene locus_tag LOCUS_04580 29001 27937 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065228.1 protein_id gnl|my_center|LOCUS_04580 29070 29372 gene locus_tag LOCUS_04590 29070 29372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 29433 29705 gene locus_tag LOCUS_04600 29433 29705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 30518 29718 gene locus_tag LOCUS_04610 gene serK 30518 29718 CDS product L-serine kinase SerK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868633.1 protein_id gnl|my_center|LOCUS_04610 31512 30568 gene locus_tag LOCUS_04620 31512 30568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 31595 31864 gene locus_tag LOCUS_04630 31595 31864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023563.1 protein_id gnl|my_center|LOCUS_04630 32356 32667 gene locus_tag LOCUS_04640 32356 32667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 32809 33063 gene locus_tag LOCUS_04650 32809 33063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 33065 33637 gene locus_tag LOCUS_04660 33065 33637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 34336 34034 gene locus_tag LOCUS_04670 34336 34034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 34363 35517 gene locus_tag LOCUS_04680 34363 35517 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061240.1 protein_id gnl|my_center|LOCUS_04680 35616 37064 gene locus_tag LOCUS_04690 35616 37064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 37857 37114 gene locus_tag LOCUS_04700 37857 37114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 >Feature sequence11 2 2131 gene locus_tag LOCUS_04710 2 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 3652 2429 gene locus_tag LOCUS_04720 3652 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 5061 4174 gene locus_tag LOCUS_04730 5061 4174 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527947.1 protein_id gnl|my_center|LOCUS_04730 5788 5099 gene locus_tag LOCUS_04740 5788 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 6471 5788 gene locus_tag LOCUS_04750 6471 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 6967 6509 gene locus_tag LOCUS_04760 6967 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 7166 7603 gene locus_tag LOCUS_04770 7166 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 7875 8333 gene locus_tag LOCUS_04780 gene hycI 7875 8333 CDS product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867982.1 protein_id gnl|my_center|LOCUS_04780 8616 8413 gene locus_tag LOCUS_04790 8616 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 8929 8630 gene locus_tag LOCUS_04800 8929 8630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 9123 9827 gene locus_tag LOCUS_04810 9123 9827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 9824 9943 gene locus_tag LOCUS_04820 9824 9943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 9940 10350 gene locus_tag LOCUS_04830 9940 10350 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937739.1 protein_id gnl|my_center|LOCUS_04830 10331 10654 gene locus_tag LOCUS_04840 10331 10654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 10630 11790 gene locus_tag LOCUS_04850 10630 11790 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937737.1 protein_id gnl|my_center|LOCUS_04850 11783 12622 gene locus_tag LOCUS_04860 11783 12622 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389175.1 protein_id gnl|my_center|LOCUS_04860 12627 12989 gene locus_tag LOCUS_04870 12627 12989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 13121 14557 gene locus_tag LOCUS_04880 13121 14557 CDS product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876525.1 protein_id gnl|my_center|LOCUS_04880 14955 14596 gene locus_tag LOCUS_04890 14955 14596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 14988 15161 gene locus_tag LOCUS_04900 14988 15161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 15154 15282 gene locus_tag LOCUS_04910 15154 15282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 15741 15550 gene locus_tag LOCUS_04920 15741 15550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 17038 15647 gene locus_tag LOCUS_04930 17038 15647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 17839 17303 gene locus_tag LOCUS_04940 17839 17303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 18419 17829 gene locus_tag LOCUS_04950 18419 17829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 18621 18836 gene locus_tag LOCUS_04960 18621 18836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 19962 19018 gene locus_tag LOCUS_04970 19962 19018 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023359.1 protein_id gnl|my_center|LOCUS_04970 20183 21397 gene locus_tag LOCUS_04980 20183 21397 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023694.1 protein_id gnl|my_center|LOCUS_04980 21604 21942 gene locus_tag LOCUS_04990 21604 21942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 22601 21939 gene locus_tag LOCUS_05000 22601 21939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 22676 23035 gene locus_tag LOCUS_05010 22676 23035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 23475 23041 gene locus_tag LOCUS_05020 gene lrpC 23475 23041 CDS product transcriptional regulator LrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246585.1 protein_id gnl|my_center|LOCUS_05020 23596 24666 gene locus_tag LOCUS_05030 23596 24666 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146489.1 protein_id gnl|my_center|LOCUS_05030 24668 24847 gene locus_tag LOCUS_05040 24668 24847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 24944 25567 gene locus_tag LOCUS_05050 24944 25567 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963951.1 protein_id gnl|my_center|LOCUS_05050 25568 26200 gene locus_tag LOCUS_05060 25568 26200 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941145.1 protein_id gnl|my_center|LOCUS_05060 26255 27604 gene locus_tag LOCUS_05070 gene purD 26255 27604 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061056.1 protein_id gnl|my_center|LOCUS_05070 27606 29747 gene locus_tag LOCUS_05080 27606 29747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 29754 30581 gene locus_tag LOCUS_05090 29754 30581 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876504.1 protein_id gnl|my_center|LOCUS_05090 31925 30591 gene locus_tag LOCUS_05100 gene purF 31925 30591 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869699.1 protein_id gnl|my_center|LOCUS_05100 35244 32197 gene locus_tag LOCUS_05110 35244 32197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 >Feature sequence12 95 505 gene locus_tag LOCUS_05120 95 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 502 1785 gene locus_tag LOCUS_05130 gene hisD 502 1785 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880475.1 protein_id gnl|my_center|LOCUS_05130 1782 3485 gene locus_tag LOCUS_05140 1782 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 3482 4066 gene locus_tag LOCUS_05150 3482 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 4077 4934 gene locus_tag LOCUS_05160 gene hisG 4077 4934 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870716.1 protein_id gnl|my_center|LOCUS_05160 4931 5533 gene locus_tag LOCUS_05170 gene hisH 4931 5533 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_05170 5530 6234 gene locus_tag LOCUS_05180 gene hisA 5530 6234 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402280.1 protein_id gnl|my_center|LOCUS_05180 6236 6994 gene locus_tag LOCUS_05190 gene hisF 6236 6994 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_05190 6984 7586 gene locus_tag LOCUS_05200 gene hisIE 6984 7586 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243045.1 protein_id gnl|my_center|LOCUS_05200 7602 8849 gene locus_tag LOCUS_05210 gene hisS 7602 8849 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_05210 9115 8861 gene locus_tag LOCUS_05220 9115 8861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 9404 9871 gene locus_tag LOCUS_05230 9404 9871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 10869 10024 gene locus_tag LOCUS_05240 10869 10024 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146498.1 protein_id gnl|my_center|LOCUS_05240 11369 10872 gene locus_tag LOCUS_05250 11369 10872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 11666 11824 gene locus_tag LOCUS_05260 11666 11824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 11821 12603 gene locus_tag LOCUS_05270 11821 12603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 12600 13256 gene locus_tag LOCUS_05280 12600 13256 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021463.1 protein_id gnl|my_center|LOCUS_05280 13253 13642 gene locus_tag LOCUS_05290 13253 13642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 14246 15430 gene locus_tag LOCUS_05300 14246 15430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 16718 16068 gene locus_tag LOCUS_05310 gene tpiA 16718 16068 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871052.1 protein_id gnl|my_center|LOCUS_05310 17624 17061 gene locus_tag LOCUS_05320 17624 17061 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496635.1 protein_id gnl|my_center|LOCUS_05320 18475 17651 gene locus_tag LOCUS_05330 gene amrB 18475 17651 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_05330 19524 18472 gene locus_tag LOCUS_05340 gene amrS 19524 18472 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_05340 20219 19563 gene locus_tag LOCUS_05350 20219 19563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 20437 20952 gene locus_tag LOCUS_05360 gene rplJ 20437 20952 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878836.1 protein_id gnl|my_center|LOCUS_05360 21053 23449 gene locus_tag LOCUS_05370 21053 23449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 23974 23468 gene locus_tag LOCUS_05380 23974 23468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 25860 24244 gene locus_tag LOCUS_05390 25860 24244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 26252 25944 gene locus_tag LOCUS_05400 26252 25944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 27050 26253 gene locus_tag LOCUS_05410 27050 26253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 27340 28788 gene locus_tag LOCUS_05420 gene ppcA 27340 28788 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060929.1 protein_id gnl|my_center|LOCUS_05420 28844 29518 gene locus_tag LOCUS_05430 28844 29518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 30169 29534 gene locus_tag LOCUS_05440 30169 29534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 30842 30171 gene locus_tag LOCUS_05450 30842 30171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 31824 30847 gene locus_tag LOCUS_05460 31824 30847 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978451.1 protein_id gnl|my_center|LOCUS_05460 32074 32760 gene locus_tag LOCUS_05470 32074 32760 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868075.1 protein_id gnl|my_center|LOCUS_05470 32793 33218 gene locus_tag LOCUS_05480 32793 33218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 34254 33244 gene locus_tag LOCUS_05490 34254 33244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 >Feature sequence13 <1 502 gene locus_tag LOCUS_05500 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022096.1:ABC transporter permease 1256 492 gene locus_tag LOCUS_05510 gene sfsA 1256 492 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113458.1 protein_id gnl|my_center|LOCUS_05510 1369 2313 gene locus_tag LOCUS_05520 1369 2313 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888855.1 protein_id gnl|my_center|LOCUS_05520 2370 4010 gene locus_tag LOCUS_05530 2370 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 4049 4687 gene locus_tag LOCUS_05540 4049 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 4724 5869 gene locus_tag LOCUS_05550 4724 5869 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_05550 5888 6184 gene locus_tag LOCUS_05560 5888 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 6201 6608 gene locus_tag LOCUS_05570 6201 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 7369 6611 gene locus_tag LOCUS_05580 7369 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 7470 8471 gene locus_tag LOCUS_05590 7470 8471 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964709.1 protein_id gnl|my_center|LOCUS_05590 8478 9194 gene locus_tag LOCUS_05600 8478 9194 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_05600 9167 9934 gene locus_tag LOCUS_05610 9167 9934 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529864.1 protein_id gnl|my_center|LOCUS_05610 10929 9937 gene locus_tag LOCUS_05620 10929 9937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 10981 11943 gene locus_tag LOCUS_05630 10981 11943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 11947 14094 gene locus_tag LOCUS_05640 11947 14094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 14099 14479 gene locus_tag LOCUS_05650 14099 14479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 14480 15205 gene locus_tag LOCUS_05660 14480 15205 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061267.1 protein_id gnl|my_center|LOCUS_05660 15210 15773 gene locus_tag LOCUS_05670 15210 15773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 15802 16026 gene locus_tag LOCUS_05680 15802 16026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 16080 16412 gene locus_tag LOCUS_05690 16080 16412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 17275 16523 gene locus_tag LOCUS_05700 17275 16523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 18035 17268 gene locus_tag LOCUS_05710 18035 17268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 18799 18095 gene locus_tag LOCUS_05720 18799 18095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 19102 19803 gene locus_tag LOCUS_05730 19102 19803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 19803 20585 gene locus_tag LOCUS_05740 19803 20585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 21873 21301 gene locus_tag LOCUS_05750 gene tmk 21873 21301 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080341.1 protein_id gnl|my_center|LOCUS_05750 21958 22848 gene locus_tag LOCUS_05760 gene pyrB 21958 22848 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064165.1 protein_id gnl|my_center|LOCUS_05760 22854 23294 gene locus_tag LOCUS_05770 gene pyrI 22854 23294 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868441.1 protein_id gnl|my_center|LOCUS_05770 23389 24153 gene locus_tag LOCUS_05780 23389 24153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 24890 24171 gene locus_tag LOCUS_05790 24890 24171 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867184.1 protein_id gnl|my_center|LOCUS_05790 24880 25284 gene locus_tag LOCUS_05800 24880 25284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 25391 25798 gene locus_tag LOCUS_05810 25391 25798 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870197.1 protein_id gnl|my_center|LOCUS_05810 25800 26087 gene locus_tag LOCUS_05820 25800 26087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 26097 26258 gene locus_tag LOCUS_05830 26097 26258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 26263 26763 gene locus_tag LOCUS_05840 26263 26763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 26760 27422 gene locus_tag LOCUS_05850 26760 27422 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877219.1 protein_id gnl|my_center|LOCUS_05850 27500 27682 gene locus_tag LOCUS_05860 27500 27682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 27685 28137 gene locus_tag LOCUS_05870 27685 28137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 28262 30130 gene locus_tag LOCUS_05880 28262 30130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 30368 34279 gene locus_tag LOCUS_05890 30368 34279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 >Feature sequence14 1375 392 gene locus_tag LOCUS_05900 1375 392 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867784.1 protein_id gnl|my_center|LOCUS_05900 1430 2893 gene locus_tag LOCUS_05910 1430 2893 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_05910 3671 2958 gene locus_tag LOCUS_05920 3671 2958 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262121.1 protein_id gnl|my_center|LOCUS_05920 3767 4216 gene locus_tag LOCUS_05930 3767 4216 CDS product HTH-type transcriptional regulator Ptr1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496594.1 protein_id gnl|my_center|LOCUS_05930 4662 4240 gene locus_tag LOCUS_05940 4662 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 4880 4659 gene locus_tag LOCUS_05950 4880 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 5509 5252 gene locus_tag LOCUS_05960 5509 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 5736 5464 gene locus_tag LOCUS_05970 5736 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 6291 5755 gene locus_tag LOCUS_05980 6291 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 7238 6270 gene locus_tag LOCUS_05990 gene mtnA 7238 6270 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869953.1 protein_id gnl|my_center|LOCUS_05990 7826 7251 gene locus_tag LOCUS_06000 7826 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 8313 7876 gene locus_tag LOCUS_06010 gene purE 8313 7876 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870121.1 protein_id gnl|my_center|LOCUS_06010 8976 8566 gene locus_tag LOCUS_06020 8976 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 9357 9001 gene locus_tag LOCUS_06030 9357 9001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 10737 9361 gene locus_tag LOCUS_06040 10737 9361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 11933 10746 gene locus_tag LOCUS_06050 11933 10746 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496963.1 protein_id gnl|my_center|LOCUS_06050 13135 11942 gene locus_tag LOCUS_06060 13135 11942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 13407 14840 gene locus_tag LOCUS_06070 13407 14840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 15601 14849 gene locus_tag LOCUS_06080 15601 14849 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969534.1 protein_id gnl|my_center|LOCUS_06080 16776 15598 gene locus_tag LOCUS_06090 16776 15598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 17210 16812 gene locus_tag LOCUS_06100 17210 16812 CDS product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546858.1 protein_id gnl|my_center|LOCUS_06100 17298 17756 gene locus_tag LOCUS_06110 17298 17756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 17753 18283 gene locus_tag LOCUS_06120 17753 18283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 18298 19866 gene locus_tag LOCUS_06130 18298 19866 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878560.1 protein_id gnl|my_center|LOCUS_06130 19937 21304 gene locus_tag LOCUS_06140 19937 21304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 23521 21356 gene locus_tag LOCUS_06150 23521 21356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 26255 23559 gene locus_tag LOCUS_06160 26255 23559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 26433 26266 gene locus_tag LOCUS_06170 26433 26266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 27461 26664 gene locus_tag LOCUS_06180 27461 26664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 31665 27553 gene locus_tag LOCUS_06190 31665 27553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 32561 31983 gene locus_tag LOCUS_06200 32561 31983 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583840.1 protein_id gnl|my_center|LOCUS_06200 33038 33214 gene locus_tag LOCUS_06210 33038 33214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 >Feature sequence15 242 394 gene locus_tag LOCUS_06220 242 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 1464 667 gene locus_tag LOCUS_06230 1464 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 2718 2933 gene locus_tag LOCUS_06240 2718 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 3051 3761 gene locus_tag LOCUS_06250 3051 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 3758 4081 gene locus_tag LOCUS_06260 3758 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 4157 4807 gene locus_tag LOCUS_06270 4157 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 4804 5301 gene locus_tag LOCUS_06280 4804 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 5400 6719 gene locus_tag LOCUS_06290 5400 6719 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876489.1 protein_id gnl|my_center|LOCUS_06290 6852 8006 gene locus_tag LOCUS_06300 6852 8006 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879532.1 protein_id gnl|my_center|LOCUS_06300 8181 8396 gene locus_tag LOCUS_06310 8181 8396 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048036534.1 protein_id gnl|my_center|LOCUS_06310 8393 8623 gene locus_tag LOCUS_06320 8393 8623 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048105191.1 protein_id gnl|my_center|LOCUS_06320 11981 8718 gene locus_tag LOCUS_06330 gene carB 11981 8718 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_06330 13060 11978 gene locus_tag LOCUS_06340 gene carA 13060 11978 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878768.1 protein_id gnl|my_center|LOCUS_06340 13131 14024 gene locus_tag LOCUS_06350 13131 14024 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832962.1 protein_id gnl|my_center|LOCUS_06350 14038 14724 gene locus_tag LOCUS_06360 14038 14724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 14764 15540 gene locus_tag LOCUS_06370 14764 15540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 15605 16294 gene locus_tag LOCUS_06380 15605 16294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 17242 16343 gene locus_tag LOCUS_06390 gene argF 17242 16343 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_06390 17535 17840 gene locus_tag LOCUS_06400 gene rpsJ 17535 17840 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876685.1 protein_id gnl|my_center|LOCUS_06400 18336 18043 gene locus_tag LOCUS_06410 18336 18043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 19020 18340 gene locus_tag LOCUS_06420 19020 18340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 19461 20096 gene locus_tag LOCUS_06430 19461 20096 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496520.1 protein_id gnl|my_center|LOCUS_06430 20101 20985 gene locus_tag LOCUS_06440 20101 20985 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902794.1 protein_id gnl|my_center|LOCUS_06440 21007 21312 gene locus_tag LOCUS_06450 gene rpl12p 21007 21312 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870009.1 protein_id gnl|my_center|LOCUS_06450 21482 21784 gene locus_tag LOCUS_06460 21482 21784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 21830 22759 gene locus_tag LOCUS_06470 21830 22759 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146505.1 protein_id gnl|my_center|LOCUS_06470 22797 24359 gene locus_tag LOCUS_06480 22797 24359 CDS product AMP phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146577.1 protein_id gnl|my_center|LOCUS_06480 24812 24402 gene locus_tag LOCUS_06490 24812 24402 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438075.1 protein_id gnl|my_center|LOCUS_06490 25163 26257 gene locus_tag LOCUS_06500 25163 26257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 26262 27401 gene locus_tag LOCUS_06510 26262 27401 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251116.1 protein_id gnl|my_center|LOCUS_06510 28325 27393 gene locus_tag LOCUS_06520 28325 27393 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546236.1 protein_id gnl|my_center|LOCUS_06520 29115 28540 gene locus_tag LOCUS_06530 29115 28540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 29659 30630 gene locus_tag LOCUS_06540 gene rtcA 29659 30630 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878932.1 protein_id gnl|my_center|LOCUS_06540 31858 30644 gene locus_tag LOCUS_06550 31858 30644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence16 836 752 gene locus_tag LOCUS_t00010 836 752 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2158 968 gene locus_tag LOCUS_06560 2158 968 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496772.1 protein_id gnl|my_center|LOCUS_06560 2550 2158 gene locus_tag LOCUS_06570 2550 2158 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870773.1 protein_id gnl|my_center|LOCUS_06570 2865 2635 gene locus_tag LOCUS_06580 2865 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 3030 3341 gene locus_tag LOCUS_06590 3030 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 3810 3361 gene locus_tag LOCUS_06600 3810 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 3936 5153 gene locus_tag LOCUS_06610 3936 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 5181 6359 gene locus_tag LOCUS_06620 5181 6359 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080975.1 protein_id gnl|my_center|LOCUS_06620 6470 6901 gene locus_tag LOCUS_06630 6470 6901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 7059 20582 gene locus_tag LOCUS_06640 7059 20582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 20599 21138 gene locus_tag LOCUS_06650 20599 21138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 22846 21218 gene locus_tag LOCUS_06660 22846 21218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 24309 22906 gene locus_tag LOCUS_06670 gene hydG 24309 22906 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393235.1 protein_id gnl|my_center|LOCUS_06670 24411 24725 gene locus_tag LOCUS_06680 24411 24725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 26036 24741 gene locus_tag LOCUS_06690 gene hydE 26036 24741 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079975.1 protein_id gnl|my_center|LOCUS_06690 27277 26075 gene locus_tag LOCUS_06700 27277 26075 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958343.1 protein_id gnl|my_center|LOCUS_06700 29584 27587 gene locus_tag LOCUS_06710 29584 27587 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023776.1 protein_id gnl|my_center|LOCUS_06710 29794 30177 gene locus_tag LOCUS_06720 29794 30177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 30903 30190 gene locus_tag LOCUS_06730 30903 30190 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867480.1 protein_id gnl|my_center|LOCUS_06730 31075 32181 gene locus_tag LOCUS_06740 31075 32181 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980390.1 protein_id gnl|my_center|LOCUS_06740 32178 32624 gene locus_tag LOCUS_06750 32178 32624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 >Feature sequence17 1239 229 gene locus_tag LOCUS_06760 1239 229 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067595.1 protein_id gnl|my_center|LOCUS_06760 1888 1250 gene locus_tag LOCUS_06770 1888 1250 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_06770 3888 2497 gene locus_tag LOCUS_06780 3888 2497 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867476.1 protein_id gnl|my_center|LOCUS_06780 4517 3894 gene locus_tag LOCUS_06790 4517 3894 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762240.1 protein_id gnl|my_center|LOCUS_06790 4633 5166 gene locus_tag LOCUS_06800 4633 5166 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791480.1 protein_id gnl|my_center|LOCUS_06800 5492 6016 gene locus_tag LOCUS_06810 5492 6016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 6039 6518 gene locus_tag LOCUS_06820 6039 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 6695 6558 gene locus_tag LOCUS_06830 6695 6558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 6688 9120 gene locus_tag LOCUS_06840 6688 9120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 10223 9117 gene locus_tag LOCUS_06850 10223 9117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 10322 10987 gene locus_tag LOCUS_06860 10322 10987 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860219.1 protein_id gnl|my_center|LOCUS_06860 11058 12092 gene locus_tag LOCUS_06870 11058 12092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 12137 13339 gene locus_tag LOCUS_06880 12137 13339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 13500 13904 gene locus_tag LOCUS_06890 13500 13904 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023551.1 protein_id gnl|my_center|LOCUS_06890 14030 14194 gene locus_tag LOCUS_06900 14030 14194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 14874 14308 gene locus_tag LOCUS_06910 14874 14308 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765028.1 protein_id gnl|my_center|LOCUS_06910 15948 14974 gene locus_tag LOCUS_06920 15948 14974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 16535 16194 gene locus_tag LOCUS_06930 16535 16194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 16853 16581 gene locus_tag LOCUS_06940 16853 16581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 18059 17037 gene locus_tag LOCUS_06950 18059 17037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 19411 18428 gene locus_tag LOCUS_06960 19411 18428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 20970 19465 gene locus_tag LOCUS_06970 gene pckA 20970 19465 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262836.1 protein_id gnl|my_center|LOCUS_06970 21126 21641 gene locus_tag LOCUS_06980 21126 21641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06980 21759 23339 gene locus_tag LOCUS_06990 21759 23339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 24041 23370 gene locus_tag LOCUS_07000 24041 23370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 24131 24622 gene locus_tag LOCUS_07010 24131 24622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 24764 26008 gene locus_tag LOCUS_07020 24764 26008 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_07020 27001 26045 gene locus_tag LOCUS_07030 gene radA 27001 26045 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 protein_id gnl|my_center|LOCUS_07030 27434 27129 gene locus_tag LOCUS_07040 27434 27129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 27836 27582 gene locus_tag LOCUS_07050 27836 27582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 28916 27915 gene locus_tag LOCUS_07060 gene gap 28916 27915 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081074.1 protein_id gnl|my_center|LOCUS_07060 30700 28979 gene locus_tag LOCUS_07070 30700 28979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 <31580 30800 gene locus_tag LOCUS_07080 <31580 30800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249110.1:DHH family phosphoesterase >Feature sequence18 1077 823 gene locus_tag LOCUS_07090 1077 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 1635 1081 gene locus_tag LOCUS_07100 1635 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 1714 3081 gene locus_tag LOCUS_07110 1714 3081 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942327.1 protein_id gnl|my_center|LOCUS_07110 3044 3172 gene locus_tag LOCUS_07120 3044 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07120 3233 3685 gene locus_tag LOCUS_07130 3233 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 4634 3705 gene locus_tag LOCUS_07140 gene arcC 4634 3705 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251108.1 protein_id gnl|my_center|LOCUS_07140 4700 6010 gene locus_tag LOCUS_07150 4700 6010 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_07150 6064 6462 gene locus_tag LOCUS_07160 6064 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 7043 6474 gene locus_tag LOCUS_07170 gene pdxT 7043 6474 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391559.1 protein_id gnl|my_center|LOCUS_07170 7939 7046 gene locus_tag LOCUS_07180 gene pdxS 7939 7046 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876304.1 protein_id gnl|my_center|LOCUS_07180 8440 7955 gene locus_tag LOCUS_07190 8440 7955 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020492.1 protein_id gnl|my_center|LOCUS_07190 8531 9970 gene locus_tag LOCUS_07200 8531 9970 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065546.1 protein_id gnl|my_center|LOCUS_07200 9991 11280 gene locus_tag LOCUS_07210 9991 11280 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022811.1 protein_id gnl|my_center|LOCUS_07210 11447 11980 gene locus_tag LOCUS_07220 11447 11980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 12076 12465 gene locus_tag LOCUS_07230 12076 12465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 13411 14787 gene locus_tag LOCUS_07240 13411 14787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 15447 14779 gene locus_tag LOCUS_07250 15447 14779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 15621 15773 gene locus_tag LOCUS_07260 15621 15773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 17998 16727 gene locus_tag LOCUS_07270 17998 16727 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173522.1 protein_id gnl|my_center|LOCUS_07270 18232 19239 gene locus_tag LOCUS_07280 18232 19239 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256218.1 protein_id gnl|my_center|LOCUS_07280 20790 19324 gene locus_tag LOCUS_07290 20790 19324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 22781 20877 gene locus_tag LOCUS_07300 gene feoB 22781 20877 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065727.1 protein_id gnl|my_center|LOCUS_07300 23156 22920 gene locus_tag LOCUS_07310 23156 22920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 23262 23699 gene locus_tag LOCUS_07320 23262 23699 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879882.1 protein_id gnl|my_center|LOCUS_07320 23853 24032 gene locus_tag LOCUS_07330 23853 24032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 24037 24315 gene locus_tag LOCUS_07340 24037 24315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 24353 24922 gene locus_tag LOCUS_07350 24353 24922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 25690 24911 gene locus_tag LOCUS_07360 25690 24911 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979881.1 protein_id gnl|my_center|LOCUS_07360 25886 26440 gene locus_tag LOCUS_07370 25886 26440 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 protein_id gnl|my_center|LOCUS_07370 26510 27313 gene locus_tag LOCUS_07380 26510 27313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 27300 27842 gene locus_tag LOCUS_07390 27300 27842 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496497.1 protein_id gnl|my_center|LOCUS_07390 27983 29680 gene locus_tag LOCUS_07400 gene top6B 27983 29680 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867718.1 protein_id gnl|my_center|LOCUS_07400 29673 30773 gene locus_tag LOCUS_07410 29673 30773 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762613.1 protein_id gnl|my_center|LOCUS_07410 >Feature sequence19 230 784 gene locus_tag LOCUS_07420 230 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 794 11650 gene locus_tag LOCUS_07430 794 11650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 11655 14153 gene locus_tag LOCUS_07440 11655 14153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 14467 14730 gene locus_tag LOCUS_07450 14467 14730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 14715 15056 gene locus_tag LOCUS_07460 14715 15056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 15168 24371 gene locus_tag LOCUS_07470 15168 24371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 24511 25527 gene locus_tag LOCUS_07480 gene twy1 24511 25527 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193384983.1 protein_id gnl|my_center|LOCUS_07480 25552 25893 gene locus_tag LOCUS_07490 25552 25893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 26468 25965 gene locus_tag LOCUS_07500 26468 25965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 27085 26540 gene locus_tag LOCUS_07510 27085 26540 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053622.1 protein_id gnl|my_center|LOCUS_07510 27139 28542 gene locus_tag LOCUS_07520 gene glmM 27139 28542 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877192.1 protein_id gnl|my_center|LOCUS_07520 28600 29553 gene locus_tag LOCUS_07530 28600 29553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 30454 29606 gene locus_tag LOCUS_07540 30454 29606 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868818.1 protein_id gnl|my_center|LOCUS_07540 >Feature sequence20 1877 792 gene locus_tag LOCUS_07550 gene ftsZ 1877 792 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496560.1 protein_id gnl|my_center|LOCUS_07550 2122 2340 gene locus_tag LOCUS_07560 2122 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 2345 2719 gene locus_tag LOCUS_07570 2345 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 2777 3550 gene locus_tag LOCUS_07580 gene purQ 2777 3550 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256638.1 protein_id gnl|my_center|LOCUS_07580 3875 3624 gene locus_tag LOCUS_07590 3875 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 4255 4025 gene locus_tag LOCUS_07600 4255 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 4780 4313 gene locus_tag LOCUS_07610 4780 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 5321 4848 gene locus_tag LOCUS_07620 5321 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 5422 7119 gene locus_tag LOCUS_07630 5422 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 7269 7412 gene locus_tag LOCUS_07640 7269 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 7409 8104 gene locus_tag LOCUS_07650 7409 8104 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250639.1 protein_id gnl|my_center|LOCUS_07650 8529 8107 gene locus_tag LOCUS_07660 8529 8107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 8747 8508 gene locus_tag LOCUS_07670 8747 8508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 8855 10426 gene locus_tag LOCUS_07680 gene pyrG 8855 10426 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867477.1 protein_id gnl|my_center|LOCUS_07680 11287 10466 gene locus_tag LOCUS_07690 11287 10466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 11893 11345 gene locus_tag LOCUS_07700 11893 11345 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_07700 12987 12742 gene locus_tag LOCUS_07710 12987 12742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 14621 13062 gene locus_tag LOCUS_07720 14621 13062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 14746 16497 gene locus_tag LOCUS_07730 gene infB 14746 16497 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875898.1 protein_id gnl|my_center|LOCUS_07730 17267 16494 gene locus_tag LOCUS_07740 17267 16494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 17878 18885 gene locus_tag LOCUS_07750 17878 18885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 18894 19193 gene locus_tag LOCUS_07760 18894 19193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 19958 19203 gene locus_tag LOCUS_07770 19958 19203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 20288 21031 gene locus_tag LOCUS_07780 20288 21031 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869745.1 protein_id gnl|my_center|LOCUS_07780 21142 22023 gene locus_tag LOCUS_07790 21142 22023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 26019 22198 gene locus_tag LOCUS_07800 26019 22198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 26165 26830 gene locus_tag LOCUS_07810 26165 26830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 27314 26811 gene locus_tag LOCUS_07820 27314 26811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 27514 28545 gene locus_tag LOCUS_07830 27514 28545 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249915.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence21 655 1878 gene locus_tag LOCUS_07840 gene gdhA 655 1878 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_07840 1950 2144 gene locus_tag LOCUS_07850 1950 2144 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546429.1 protein_id gnl|my_center|LOCUS_07850 2258 2680 gene locus_tag LOCUS_07860 2258 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 2704 3108 gene locus_tag LOCUS_07870 2704 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 3171 3473 gene locus_tag LOCUS_07880 3171 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 3899 4669 gene locus_tag LOCUS_07890 3899 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 4858 5187 gene locus_tag LOCUS_07900 4858 5187 CDS product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065892.1 protein_id gnl|my_center|LOCUS_07900 5720 5977 gene locus_tag LOCUS_07910 5720 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 5978 6358 gene locus_tag LOCUS_07920 5978 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 6403 6672 gene locus_tag LOCUS_07930 6403 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 6774 7046 gene locus_tag LOCUS_07940 6774 7046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 7043 7378 gene locus_tag LOCUS_07950 7043 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 7495 7704 gene locus_tag LOCUS_07960 7495 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 7697 8110 gene locus_tag LOCUS_07970 7697 8110 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391721.1 protein_id gnl|my_center|LOCUS_07970 8216 8452 gene locus_tag LOCUS_07980 8216 8452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 8436 8831 gene locus_tag LOCUS_07990 8436 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 8863 9465 gene locus_tag LOCUS_08000 8863 9465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 9507 10058 gene locus_tag LOCUS_08010 9507 10058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 10521 10351 gene locus_tag LOCUS_08020 10521 10351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 10916 11347 gene locus_tag LOCUS_08030 10916 11347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 11704 11378 gene locus_tag LOCUS_08040 11704 11378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 13636 11765 gene locus_tag LOCUS_08050 13636 11765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 14330 13812 gene locus_tag LOCUS_08060 14330 13812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 14552 14382 gene locus_tag LOCUS_08070 14552 14382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 14617 14922 gene locus_tag LOCUS_08080 14617 14922 CDS product MscL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022264.1 protein_id gnl|my_center|LOCUS_08080 15937 14924 gene locus_tag LOCUS_08090 15937 14924 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957761.1 protein_id gnl|my_center|LOCUS_08090 16407 15958 gene locus_tag LOCUS_08100 16407 15958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 16871 16437 gene locus_tag LOCUS_08110 16871 16437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 17785 16868 gene locus_tag LOCUS_08120 17785 16868 CDS product tRNA (cytosine(49)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867747.1 protein_id gnl|my_center|LOCUS_08120 18332 17790 gene locus_tag LOCUS_08130 18332 17790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 19053 18319 gene locus_tag LOCUS_08140 19053 18319 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202330.1 protein_id gnl|my_center|LOCUS_08140 19066 20145 gene locus_tag LOCUS_08150 gene dinB 19066 20145 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066563.1 protein_id gnl|my_center|LOCUS_08150 21029 20298 gene locus_tag LOCUS_08160 gene dph5 21029 20298 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870787.1 protein_id gnl|my_center|LOCUS_08160 21822 21421 gene locus_tag LOCUS_08170 21822 21421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 22932 21823 gene locus_tag LOCUS_08180 gene fbp 22932 21823 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251114.1 protein_id gnl|my_center|LOCUS_08180 23693 23211 gene locus_tag LOCUS_08190 23693 23211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 25992 23878 gene locus_tag LOCUS_08200 25992 23878 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879160.1 protein_id gnl|my_center|LOCUS_08200 26597 27289 gene locus_tag LOCUS_08210 26597 27289 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243553.1 protein_id gnl|my_center|LOCUS_08210 27389 27832 gene locus_tag LOCUS_08220 27389 27832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 >Feature sequence22 34 1251 gene locus_tag LOCUS_08230 34 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 1607 2344 gene locus_tag LOCUS_08240 1607 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 4101 2527 gene locus_tag LOCUS_08250 4101 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 5514 4162 gene locus_tag LOCUS_08260 5514 4162 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750460.1 protein_id gnl|my_center|LOCUS_08260 5613 6476 gene locus_tag LOCUS_08270 5613 6476 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986782.1 protein_id gnl|my_center|LOCUS_08270 6564 7637 gene locus_tag LOCUS_08280 6564 7637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 7642 8715 gene locus_tag LOCUS_08290 7642 8715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 9735 8845 gene locus_tag LOCUS_08300 9735 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 10445 9792 gene locus_tag LOCUS_08310 10445 9792 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979262.1 protein_id gnl|my_center|LOCUS_08310 12457 10442 gene locus_tag LOCUS_08320 12457 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 12535 13536 gene locus_tag LOCUS_08330 12535 13536 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582746.1 protein_id gnl|my_center|LOCUS_08330 14527 13556 gene locus_tag LOCUS_08340 14527 13556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 15232 14528 gene locus_tag LOCUS_08350 15232 14528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 15896 15237 gene locus_tag LOCUS_08360 15896 15237 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937645.1 protein_id gnl|my_center|LOCUS_08360 16822 15896 gene locus_tag LOCUS_08370 16822 15896 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937649.1 protein_id gnl|my_center|LOCUS_08370 17764 16844 gene locus_tag LOCUS_08380 17764 16844 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937646.1 protein_id gnl|my_center|LOCUS_08380 19619 17820 gene locus_tag LOCUS_08390 19619 17820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 20393 19653 gene locus_tag LOCUS_08400 gene kdsB 20393 19653 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_08400 21142 20390 gene locus_tag LOCUS_08410 21142 20390 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527996.1 protein_id gnl|my_center|LOCUS_08410 22202 21135 gene locus_tag LOCUS_08420 22202 21135 CDS product LdpA C-terminal domain-containing domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866389.1 protein_id gnl|my_center|LOCUS_08420 22999 22226 gene locus_tag LOCUS_08430 22999 22226 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814132.1 protein_id gnl|my_center|LOCUS_08430 24726 22996 gene locus_tag LOCUS_08440 24726 22996 CDS product aldolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461003.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence23 83 892 gene locus_tag LOCUS_08450 83 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 895 2487 gene locus_tag LOCUS_08460 895 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 2491 2991 gene locus_tag LOCUS_08470 2491 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 2991 3779 gene locus_tag LOCUS_08480 2991 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 3787 6357 gene locus_tag LOCUS_08490 3787 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 6431 7021 gene locus_tag LOCUS_08500 6431 7021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 7410 7030 gene locus_tag LOCUS_08510 7410 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 8163 7411 gene locus_tag LOCUS_08520 8163 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 11026 8369 gene locus_tag LOCUS_08530 11026 8369 CDS product calcium-transporting P-type ATPase, PMR1-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272458.1 protein_id gnl|my_center|LOCUS_08530 11964 11107 gene locus_tag LOCUS_08540 11964 11107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 12548 13936 gene locus_tag LOCUS_08550 12548 13936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 13993 14868 gene locus_tag LOCUS_08560 13993 14868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 16427 14865 gene locus_tag LOCUS_08570 16427 14865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 16479 17312 gene locus_tag LOCUS_08580 16479 17312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 17386 17571 gene locus_tag LOCUS_08590 17386 17571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 17581 18507 gene locus_tag LOCUS_08600 17581 18507 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903042.1 protein_id gnl|my_center|LOCUS_08600 18510 19004 gene locus_tag LOCUS_08610 18510 19004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 19196 20131 gene locus_tag LOCUS_08620 19196 20131 CDS product DNA primase large subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762604.1 protein_id gnl|my_center|LOCUS_08620 20128 21246 gene locus_tag LOCUS_08630 gene priS 20128 21246 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870353.1 protein_id gnl|my_center|LOCUS_08630 21713 21324 gene locus_tag LOCUS_08640 21713 21324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 21927 23120 gene locus_tag LOCUS_08650 21927 23120 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877755.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence24 398 820 gene locus_tag LOCUS_08660 398 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 841 1257 gene locus_tag LOCUS_08670 841 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 2253 1639 gene locus_tag LOCUS_08680 2253 1639 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583271.1 protein_id gnl|my_center|LOCUS_08680 3039 2254 gene locus_tag LOCUS_08690 3039 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 3114 5480 gene locus_tag LOCUS_08700 gene ppsA 3114 5480 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878213.1 protein_id gnl|my_center|LOCUS_08700 5617 5985 gene locus_tag LOCUS_08710 5617 5985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 6080 9064 gene locus_tag LOCUS_08720 6080 9064 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942279.1 protein_id gnl|my_center|LOCUS_08720 9066 9863 gene locus_tag LOCUS_08730 9066 9863 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938913.1 protein_id gnl|my_center|LOCUS_08730 9949 10284 gene locus_tag LOCUS_08740 9949 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 11724 10819 gene locus_tag LOCUS_08750 gene dusB 11724 10819 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966475.1 protein_id gnl|my_center|LOCUS_08750 13776 11944 gene locus_tag LOCUS_08760 13776 11944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 14168 13959 gene locus_tag LOCUS_08770 14168 13959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 14467 14805 gene locus_tag LOCUS_08780 gene albA 14467 14805 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249515.1 protein_id gnl|my_center|LOCUS_08780 14815 15432 gene locus_tag LOCUS_08790 14815 15432 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320022.1 protein_id gnl|my_center|LOCUS_08790 15470 16171 gene locus_tag LOCUS_08800 15470 16171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 16183 17070 gene locus_tag LOCUS_08810 16183 17070 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249955.1 protein_id gnl|my_center|LOCUS_08810 18476 17067 gene locus_tag LOCUS_08820 18476 17067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 19521 18568 gene locus_tag LOCUS_08830 19521 18568 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060851.1 protein_id gnl|my_center|LOCUS_08830 20775 19534 gene locus_tag LOCUS_08840 20775 19534 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 protein_id gnl|my_center|LOCUS_08840 21282 20827 gene locus_tag LOCUS_08850 21282 20827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 21444 21815 gene locus_tag LOCUS_08860 21444 21815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 >Feature sequence25 161 643 gene locus_tag LOCUS_08870 161 643 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762453.1 protein_id gnl|my_center|LOCUS_08870 1926 730 gene locus_tag LOCUS_08880 1926 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 2688 1966 gene locus_tag LOCUS_08890 gene surE 2688 1966 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250088.1 protein_id gnl|my_center|LOCUS_08890 4092 2764 gene locus_tag LOCUS_08900 gene aspS 4092 2764 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496866.1 protein_id gnl|my_center|LOCUS_08900 4237 5493 gene locus_tag LOCUS_08910 4237 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 5496 7061 gene locus_tag LOCUS_08920 5496 7061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 7063 8484 gene locus_tag LOCUS_08930 7063 8484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 8486 9766 gene locus_tag LOCUS_08940 8486 9766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 9933 11057 gene locus_tag LOCUS_08950 9933 11057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 11057 12175 gene locus_tag LOCUS_08960 11057 12175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 12209 12427 gene locus_tag LOCUS_08970 12209 12427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 12775 13386 gene locus_tag LOCUS_08980 12775 13386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 13404 14213 gene locus_tag LOCUS_08990 13404 14213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 14226 15542 gene locus_tag LOCUS_09000 14226 15542 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065307.1 protein_id gnl|my_center|LOCUS_09000 15539 17476 gene locus_tag LOCUS_09010 15539 17476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 17482 18735 gene locus_tag LOCUS_09020 17482 18735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 18876 19595 gene locus_tag LOCUS_09030 18876 19595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 >Feature sequence26 1424 129 gene locus_tag LOCUS_09040 gene rbcL 1424 129 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146906.1 protein_id gnl|my_center|LOCUS_09040 1717 1466 gene locus_tag LOCUS_09050 1717 1466 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020108.1 protein_id gnl|my_center|LOCUS_09050 1961 1719 gene locus_tag LOCUS_09060 1961 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 2404 2027 gene locus_tag LOCUS_09070 2404 2027 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_09070 2771 2409 gene locus_tag LOCUS_09080 2771 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 3984 2764 gene locus_tag LOCUS_09090 3984 2764 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989988.1 protein_id gnl|my_center|LOCUS_09090 4767 4021 gene locus_tag LOCUS_09100 gene sufC 4767 4021 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_09100 4888 6267 gene locus_tag LOCUS_09110 gene sufB 4888 6267 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356769.1 protein_id gnl|my_center|LOCUS_09110 6264 7289 gene locus_tag LOCUS_09120 6264 7289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 8707 7328 gene locus_tag LOCUS_09130 8707 7328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 8889 10691 gene locus_tag LOCUS_09140 8889 10691 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717997.1 protein_id gnl|my_center|LOCUS_09140 10694 11191 gene locus_tag LOCUS_09150 10694 11191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 11267 11938 gene locus_tag LOCUS_09160 11267 11938 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249637.1 protein_id gnl|my_center|LOCUS_09160 11940 13319 gene locus_tag LOCUS_09170 11940 13319 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060924.1 protein_id gnl|my_center|LOCUS_09170 14803 13316 gene locus_tag LOCUS_09180 14803 13316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 15099 14932 gene locus_tag LOCUS_09190 15099 14932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 15242 16168 gene locus_tag LOCUS_09200 15242 16168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 16412 16173 gene locus_tag LOCUS_09210 16412 16173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09210 17747 16449 gene locus_tag LOCUS_09220 17747 16449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 18316 17819 gene locus_tag LOCUS_09230 18316 17819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 18734 21289 gene locus_tag LOCUS_r00020 18734 21289 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 79 percent of the 23S ribosomal RNA >Feature sequence27 182 1264 gene locus_tag LOCUS_09240 182 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 2497 1316 gene locus_tag LOCUS_09250 2497 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 4036 2927 gene locus_tag LOCUS_09260 4036 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 5008 4100 gene locus_tag LOCUS_09270 5008 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 5552 6634 gene locus_tag LOCUS_09280 5552 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 6728 9919 gene locus_tag LOCUS_09290 6728 9919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 10768 9926 gene locus_tag LOCUS_09300 10768 9926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 10907 11956 gene locus_tag LOCUS_09310 10907 11956 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978258.1 protein_id gnl|my_center|LOCUS_09310 12595 12017 gene locus_tag LOCUS_09320 12595 12017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 12675 14456 gene locus_tag LOCUS_09330 12675 14456 CDS product DUF2070 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877505.1 protein_id gnl|my_center|LOCUS_09330 15307 14459 gene locus_tag LOCUS_09340 15307 14459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 15866 15363 gene locus_tag LOCUS_09350 15866 15363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 16696 15863 gene locus_tag LOCUS_09360 16696 15863 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066525.1 protein_id gnl|my_center|LOCUS_09360 16709 17008 gene locus_tag LOCUS_09370 16709 17008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 17094 18080 gene locus_tag LOCUS_09380 gene idsA 17094 18080 CDS product short chain isoprenyl diphosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875690.1 protein_id gnl|my_center|LOCUS_09380 18190 20250 gene locus_tag LOCUS_09390 18190 20250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 20255 20998 gene locus_tag LOCUS_09400 20255 20998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence28 784 1041 gene locus_tag LOCUS_09410 784 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1046 1672 gene locus_tag LOCUS_09420 1046 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 2337 1738 gene locus_tag LOCUS_09430 2337 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 2841 2527 gene locus_tag LOCUS_09440 2841 2527 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875653.1 protein_id gnl|my_center|LOCUS_09440 3215 2913 gene locus_tag LOCUS_09450 gene yciH 3215 2913 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496503.1 protein_id gnl|my_center|LOCUS_09450 3426 3208 gene locus_tag LOCUS_09460 3426 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 4217 3426 gene locus_tag LOCUS_09470 4217 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 4893 4228 gene locus_tag LOCUS_09480 4893 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 5294 4899 gene locus_tag LOCUS_09490 gene rpsS 5294 4899 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869675.1 protein_id gnl|my_center|LOCUS_09490 6077 5307 gene locus_tag LOCUS_09500 6077 5307 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867461.1 protein_id gnl|my_center|LOCUS_09500 6338 6087 gene locus_tag LOCUS_09510 gene rplW 6338 6087 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102087.1 protein_id gnl|my_center|LOCUS_09510 7084 6335 gene locus_tag LOCUS_09520 gene rpl4p 7084 6335 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869672.1 protein_id gnl|my_center|LOCUS_09520 8025 7093 gene locus_tag LOCUS_09530 8025 7093 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250493.1 protein_id gnl|my_center|LOCUS_09530 8359 10059 gene locus_tag LOCUS_09540 8359 10059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 10643 10101 gene locus_tag LOCUS_09550 10643 10101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 11330 10776 gene locus_tag LOCUS_09560 11330 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 11423 12202 gene locus_tag LOCUS_09570 11423 12202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 12199 12732 gene locus_tag LOCUS_09580 12199 12732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 12710 12880 gene locus_tag LOCUS_09590 12710 12880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 12912 13766 gene locus_tag LOCUS_09600 12912 13766 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877749.1 protein_id gnl|my_center|LOCUS_09600 14902 13772 gene locus_tag LOCUS_09610 14902 13772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 15012 15980 gene locus_tag LOCUS_09620 15012 15980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 15985 16467 gene locus_tag LOCUS_09630 15985 16467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 16505 16924 gene locus_tag LOCUS_09640 16505 16924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 18086 16959 gene locus_tag LOCUS_09650 gene thiI 18086 16959 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_09650 19031 18429 gene locus_tag LOCUS_09660 19031 18429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 19653 20885 gene locus_tag LOCUS_09670 19653 20885 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965562.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence29 769 98 gene locus_tag LOCUS_09680 769 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 2468 774 gene locus_tag LOCUS_09690 2468 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 3380 2520 gene locus_tag LOCUS_09700 3380 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 3458 4294 gene locus_tag LOCUS_09710 3458 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 4387 5967 gene locus_tag LOCUS_09720 4387 5967 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978681.1 protein_id gnl|my_center|LOCUS_09720 6047 6499 gene locus_tag LOCUS_09730 6047 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 7169 6570 gene locus_tag LOCUS_09740 7169 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 7339 8622 gene locus_tag LOCUS_09750 7339 8622 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082326.1 protein_id gnl|my_center|LOCUS_09750 8622 9812 gene locus_tag LOCUS_09760 gene argH 8622 9812 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082327.1 protein_id gnl|my_center|LOCUS_09760 10897 9809 gene locus_tag LOCUS_09770 10897 9809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 11516 10890 gene locus_tag LOCUS_09780 11516 10890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 11416 11661 gene locus_tag LOCUS_09790 11416 11661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 12827 11652 gene locus_tag LOCUS_09800 12827 11652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 13553 12906 gene locus_tag LOCUS_09810 13553 12906 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963951.1 protein_id gnl|my_center|LOCUS_09810 13607 14218 gene locus_tag LOCUS_09820 13607 14218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 14277 15005 gene locus_tag LOCUS_09830 14277 15005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 15375 15043 gene locus_tag LOCUS_09840 15375 15043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 16002 15478 gene locus_tag LOCUS_09850 gene rnhB 16002 15478 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878125.1 protein_id gnl|my_center|LOCUS_09850 16670 16413 gene locus_tag LOCUS_09860 16670 16413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 18230 16797 gene locus_tag LOCUS_09870 18230 16797 CDS product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870207.1 protein_id gnl|my_center|LOCUS_09870 18533 18273 gene locus_tag LOCUS_09880 18533 18273 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061044.1 protein_id gnl|my_center|LOCUS_09880 19628 20287 gene locus_tag LOCUS_09890 19628 20287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence30 2424 1204 gene locus_tag LOCUS_09900 2424 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 2674 3303 gene locus_tag LOCUS_09910 2674 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 3305 4783 gene locus_tag LOCUS_09920 3305 4783 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061013.1 protein_id gnl|my_center|LOCUS_09920 4785 5396 gene locus_tag LOCUS_09930 4785 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 5562 5629 gene locus_tag LOCUS_t00020 5562 5629 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5972 6382 gene locus_tag LOCUS_09940 5972 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 6363 7085 gene locus_tag LOCUS_09950 6363 7085 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878991.1 protein_id gnl|my_center|LOCUS_09950 7130 7954 gene locus_tag LOCUS_09960 7130 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 10800 7960 gene locus_tag LOCUS_09970 gene alaS 10800 7960 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870068.1 protein_id gnl|my_center|LOCUS_09970 11322 10897 gene locus_tag LOCUS_09980 11322 10897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 11376 12968 gene locus_tag LOCUS_09990 gene glyS 11376 12968 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869726.1 protein_id gnl|my_center|LOCUS_09990 12965 14023 gene locus_tag LOCUS_10000 12965 14023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 14678 16108 gene locus_tag LOCUS_10010 14678 16108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 18996 16426 gene locus_tag LOCUS_10020 18996 16426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 >Feature sequence31 419 1105 gene locus_tag LOCUS_10030 gene pyrH 419 1105 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249260.1 protein_id gnl|my_center|LOCUS_10030 1144 1968 gene locus_tag LOCUS_10040 1144 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 2154 4163 gene locus_tag LOCUS_10050 2154 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 4923 4210 gene locus_tag LOCUS_10060 gene psmA 4923 4210 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870095.1 protein_id gnl|my_center|LOCUS_10060 6002 5109 gene locus_tag LOCUS_10070 gene htpX 6002 5109 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583272.1 protein_id gnl|my_center|LOCUS_10070 6591 6022 gene locus_tag LOCUS_10080 6591 6022 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583271.1 protein_id gnl|my_center|LOCUS_10080 6693 7481 gene locus_tag LOCUS_10090 6693 7481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 7701 7453 gene locus_tag LOCUS_10100 7701 7453 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060863.1 protein_id gnl|my_center|LOCUS_10100 8404 7745 gene locus_tag LOCUS_10110 8404 7745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 9662 8472 gene locus_tag LOCUS_10120 9662 8472 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065409.1 protein_id gnl|my_center|LOCUS_10120 10534 9686 gene locus_tag LOCUS_10130 10534 9686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 10616 11296 gene locus_tag LOCUS_10140 10616 11296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 12433 11297 gene locus_tag LOCUS_10150 12433 11297 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942161.1 protein_id gnl|my_center|LOCUS_10150 12911 12435 gene locus_tag LOCUS_10160 gene rfaE2 12911 12435 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896999.1 protein_id gnl|my_center|LOCUS_10160 13488 12916 gene locus_tag LOCUS_10170 gene gmhB 13488 12916 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_10170 13551 14627 gene locus_tag LOCUS_10180 13551 14627 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986202.1 protein_id gnl|my_center|LOCUS_10180 15590 14655 gene locus_tag LOCUS_10190 15590 14655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 16167 15607 gene locus_tag LOCUS_10200 gene gmhA 16167 15607 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858021.1 protein_id gnl|my_center|LOCUS_10200 17834 16203 gene locus_tag LOCUS_10210 17834 16203 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048165814.1 protein_id gnl|my_center|LOCUS_10210 18664 17888 gene locus_tag LOCUS_10220 gene hisF 18664 17888 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391341.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence32 260 730 gene locus_tag LOCUS_10230 260 730 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036317.1 protein_id gnl|my_center|LOCUS_10230 723 1280 gene locus_tag LOCUS_10240 723 1280 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930731.1 protein_id gnl|my_center|LOCUS_10240 1310 2161 gene locus_tag LOCUS_10250 1310 2161 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250373.1 protein_id gnl|my_center|LOCUS_10250 2449 2835 gene locus_tag LOCUS_10260 2449 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 3134 4189 gene locus_tag LOCUS_10270 3134 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 5457 4219 gene locus_tag LOCUS_10280 5457 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 7361 5454 gene locus_tag LOCUS_10290 7361 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 8779 7358 gene locus_tag LOCUS_10300 8779 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 9618 8779 gene locus_tag LOCUS_10310 9618 8779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 9731 10828 gene locus_tag LOCUS_10320 9731 10828 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249158.1 protein_id gnl|my_center|LOCUS_10320 11434 10838 gene locus_tag LOCUS_10330 11434 10838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 11848 11441 gene locus_tag LOCUS_10340 11848 11441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 12159 11866 gene locus_tag LOCUS_10350 12159 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 12345 13286 gene locus_tag LOCUS_10360 12345 13286 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081620.1 protein_id gnl|my_center|LOCUS_10360 13672 13313 gene locus_tag LOCUS_10370 13672 13313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 14354 13641 gene locus_tag LOCUS_10380 14354 13641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 >Feature sequence33 3346 173 gene locus_tag LOCUS_10390 3346 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 4396 3347 gene locus_tag LOCUS_10400 gene ftsZ 4396 3347 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496560.1 protein_id gnl|my_center|LOCUS_10400 5386 4709 gene locus_tag LOCUS_10410 5386 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 5511 6440 gene locus_tag LOCUS_10420 5511 6440 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146595.1 protein_id gnl|my_center|LOCUS_10420 6492 7436 gene locus_tag LOCUS_10430 6492 7436 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870966.1 protein_id gnl|my_center|LOCUS_10430 7532 8230 gene locus_tag LOCUS_10440 gene ribB 7532 8230 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869547.1 protein_id gnl|my_center|LOCUS_10440 8230 8808 gene locus_tag LOCUS_10450 8230 8808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 9033 9215 gene locus_tag LOCUS_10460 9033 9215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 9212 9490 gene locus_tag LOCUS_10470 9212 9490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 9500 10378 gene locus_tag LOCUS_10480 9500 10378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 10375 10995 gene locus_tag LOCUS_10490 10375 10995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 11916 10996 gene locus_tag LOCUS_10500 11916 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 13184 12051 gene locus_tag LOCUS_10510 13184 12051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 14477 13317 gene locus_tag LOCUS_10520 gene metK 14477 13317 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082170.1 protein_id gnl|my_center|LOCUS_10520 15855 14635 gene locus_tag LOCUS_10530 15855 14635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 15911 17032 gene locus_tag LOCUS_10540 gene ribD 15911 17032 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987156.1 protein_id gnl|my_center|LOCUS_10540 17122 17700 gene locus_tag LOCUS_10550 17122 17700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 18055 17807 gene locus_tag LOCUS_10560 18055 17807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 >Feature sequence34 816 253 gene locus_tag LOCUS_10570 816 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 3016 848 gene locus_tag LOCUS_10580 3016 848 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_10580 3792 3085 gene locus_tag LOCUS_10590 3792 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 5245 3824 gene locus_tag LOCUS_10600 5245 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 5466 5242 gene locus_tag LOCUS_10610 5466 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 5653 6156 gene locus_tag LOCUS_10620 5653 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 6198 10379 gene locus_tag LOCUS_10630 6198 10379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 10511 11524 gene locus_tag LOCUS_10640 10511 11524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 12837 11536 gene locus_tag LOCUS_10650 12837 11536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 13136 12834 gene locus_tag LOCUS_10660 13136 12834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 13191 13580 gene locus_tag LOCUS_10670 13191 13580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 15177 13735 gene locus_tag LOCUS_10680 15177 13735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 15386 15775 gene locus_tag LOCUS_10690 15386 15775 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147239.1 protein_id gnl|my_center|LOCUS_10690 15772 16086 gene locus_tag LOCUS_10700 15772 16086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 16915 16037 gene locus_tag LOCUS_10710 16915 16037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 17018 17962 gene locus_tag LOCUS_10720 17018 17962 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979428.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence35 632 2050 gene locus_tag LOCUS_10730 632 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3509 2613 gene locus_tag LOCUS_10740 gene map 3509 2613 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870846.1 protein_id gnl|my_center|LOCUS_10740 3683 3904 gene locus_tag LOCUS_10750 3683 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 4051 6630 gene locus_tag LOCUS_10760 4051 6630 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762372.1 protein_id gnl|my_center|LOCUS_10760 7126 6665 gene locus_tag LOCUS_10770 7126 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 7227 8864 gene locus_tag LOCUS_10780 7227 8864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 8913 9263 gene locus_tag LOCUS_10790 gene pth2 8913 9263 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320039.1 protein_id gnl|my_center|LOCUS_10790 9292 9849 gene locus_tag LOCUS_10800 9292 9849 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234219.1 protein_id gnl|my_center|LOCUS_10800 10706 9846 gene locus_tag LOCUS_10810 10706 9846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 11962 11426 gene locus_tag LOCUS_10820 11962 11426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10820 13222 12167 gene locus_tag LOCUS_10830 13222 12167 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064840.1 protein_id gnl|my_center|LOCUS_10830 13261 14487 gene locus_tag LOCUS_10840 gene glmU 13261 14487 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870613.1 protein_id gnl|my_center|LOCUS_10840 14546 14631 gene locus_tag LOCUS_t00030 14546 14631 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14720 15937 gene locus_tag LOCUS_10850 14720 15937 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135390550.1 protein_id gnl|my_center|LOCUS_10850 15966 16475 gene locus_tag LOCUS_10860 15966 16475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 16708 16968 gene locus_tag LOCUS_10870 16708 16968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 17475 17041 gene locus_tag LOCUS_10880 gene lrpC 17475 17041 CDS product transcriptional regulator LrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246585.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence36 174 1481 gene locus_tag LOCUS_10890 gene gatD 174 1481 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867819.1 protein_id gnl|my_center|LOCUS_10890 1499 1741 gene locus_tag LOCUS_10900 1499 1741 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272468.1 protein_id gnl|my_center|LOCUS_10900 1747 3543 gene locus_tag LOCUS_10910 gene gatE 1747 3543 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022814.1 protein_id gnl|my_center|LOCUS_10910 3579 4067 gene locus_tag LOCUS_10920 3579 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 6791 4407 gene locus_tag LOCUS_10930 6791 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 8485 6788 gene locus_tag LOCUS_10940 8485 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 9698 8532 gene locus_tag LOCUS_10950 9698 8532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150048584.1 protein_id gnl|my_center|LOCUS_10950 10653 9913 gene locus_tag LOCUS_10960 10653 9913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 11286 10678 gene locus_tag LOCUS_10970 11286 10678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 11554 11375 gene locus_tag LOCUS_10980 11554 11375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10980 13330 11579 gene locus_tag LOCUS_10990 13330 11579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 13713 14807 gene locus_tag LOCUS_11000 13713 14807 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249453.1 protein_id gnl|my_center|LOCUS_11000 14876 15145 gene locus_tag LOCUS_11010 14876 15145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020566.1 protein_id gnl|my_center|LOCUS_11010 15189 15464 gene locus_tag LOCUS_11020 15189 15464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 16339 15488 gene locus_tag LOCUS_11030 16339 15488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence37 1252 323 gene locus_tag LOCUS_11040 gene speB 1252 323 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_11040 2334 1519 gene locus_tag LOCUS_11050 2334 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 2349 3437 gene locus_tag LOCUS_11060 2349 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 3936 3409 gene locus_tag LOCUS_11070 3936 3409 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846254.1 protein_id gnl|my_center|LOCUS_11070 7365 3982 gene locus_tag LOCUS_11080 gene smc 7365 3982 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867481.1 protein_id gnl|my_center|LOCUS_11080 8103 7879 gene locus_tag LOCUS_11090 8103 7879 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878376.1 protein_id gnl|my_center|LOCUS_11090 8631 8161 gene locus_tag LOCUS_11100 8631 8161 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064326.1 protein_id gnl|my_center|LOCUS_11100 9403 8675 gene locus_tag LOCUS_11110 9403 8675 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_11110 9605 9997 gene locus_tag LOCUS_11120 gene eif5A 9605 9997 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878148.1 protein_id gnl|my_center|LOCUS_11120 9994 10323 gene locus_tag LOCUS_11130 9994 10323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 10329 10505 gene locus_tag LOCUS_11140 10329 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 10568 11140 gene locus_tag LOCUS_11150 10568 11140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 11137 12111 gene locus_tag LOCUS_11160 gene kae1 11137 12111 CDS product KEOPS complex N(6)-L-threonylcarbamoyladenine synthase Kae1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868890.1 protein_id gnl|my_center|LOCUS_11160 13216 12233 gene locus_tag LOCUS_11170 13216 12233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 14205 13303 gene locus_tag LOCUS_11180 14205 13303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 14637 14416 gene locus_tag LOCUS_11190 14637 14416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 14856 14650 gene locus_tag LOCUS_11200 14856 14650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 15383 14856 gene locus_tag LOCUS_11210 15383 14856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 15840 15487 gene locus_tag LOCUS_11220 15840 15487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 16483 16103 gene locus_tag LOCUS_11230 16483 16103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence38 1816 491 gene locus_tag LOCUS_11240 1816 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1979 2788 gene locus_tag LOCUS_11250 1979 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 2820 3725 gene locus_tag LOCUS_11260 2820 3725 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867665.1 protein_id gnl|my_center|LOCUS_11260 3786 4271 gene locus_tag LOCUS_11270 3786 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 4925 4266 gene locus_tag LOCUS_11280 4925 4266 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880134.1 protein_id gnl|my_center|LOCUS_11280 5482 4937 gene locus_tag LOCUS_11290 5482 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 5658 6884 gene locus_tag LOCUS_11300 5658 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 7651 6881 gene locus_tag LOCUS_11310 7651 6881 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020652.1 protein_id gnl|my_center|LOCUS_11310 7787 8350 gene locus_tag LOCUS_11320 7787 8350 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868085.1 protein_id gnl|my_center|LOCUS_11320 8396 9691 gene locus_tag LOCUS_11330 8396 9691 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249880.1 protein_id gnl|my_center|LOCUS_11330 9708 10883 gene locus_tag LOCUS_11340 9708 10883 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877033.1 protein_id gnl|my_center|LOCUS_11340 10889 11302 gene locus_tag LOCUS_11350 10889 11302 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020302.1 protein_id gnl|my_center|LOCUS_11350 11815 11315 gene locus_tag LOCUS_11360 11815 11315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 12708 11908 gene locus_tag LOCUS_11370 12708 11908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 12910 13821 gene locus_tag LOCUS_11380 12910 13821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 14571 13834 gene locus_tag LOCUS_11390 14571 13834 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020864.1 protein_id gnl|my_center|LOCUS_11390 14657 15376 gene locus_tag LOCUS_11400 14657 15376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 15396 15887 gene locus_tag LOCUS_11410 15396 15887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence39 671 1237 gene locus_tag LOCUS_11420 671 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1303 1830 gene locus_tag LOCUS_11430 1303 1830 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259510.1 protein_id gnl|my_center|LOCUS_11430 1978 1902 gene locus_tag LOCUS_t00040 1978 1902 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2444 2055 gene locus_tag LOCUS_11440 2444 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 2587 2808 gene locus_tag LOCUS_11450 2587 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 2814 3038 gene locus_tag LOCUS_11460 2814 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 3050 3703 gene locus_tag LOCUS_11470 gene rpiA 3050 3703 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871128.1 protein_id gnl|my_center|LOCUS_11470 3881 5824 gene locus_tag LOCUS_11480 3881 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 5882 6376 gene locus_tag LOCUS_11490 5882 6376 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869894.1 protein_id gnl|my_center|LOCUS_11490 6573 6391 gene locus_tag LOCUS_11500 6573 6391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 6834 6583 gene locus_tag LOCUS_11510 6834 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 6896 7474 gene locus_tag LOCUS_11520 6896 7474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 8740 7487 gene locus_tag LOCUS_11530 8740 7487 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931016.1 protein_id gnl|my_center|LOCUS_11530 8878 9510 gene locus_tag LOCUS_11540 8878 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 9520 10476 gene locus_tag LOCUS_11550 gene guaA 9520 10476 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867924.1 protein_id gnl|my_center|LOCUS_11550 11176 10523 gene locus_tag LOCUS_11560 11176 10523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 11545 11288 gene locus_tag LOCUS_11570 11545 11288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 11633 12142 gene locus_tag LOCUS_11580 11633 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 13094 12186 gene locus_tag LOCUS_11590 13094 12186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 13960 13091 gene locus_tag LOCUS_11600 13960 13091 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249125.1 protein_id gnl|my_center|LOCUS_11600 <15530 14984 gene locus_tag LOCUS_11610 <15530 14984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249637.1:TIGR02253 family HAD-type hydrolase >Feature sequence40 1129 2274 gene locus_tag LOCUS_11620 1129 2274 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978108.1 protein_id gnl|my_center|LOCUS_11620 2267 3061 gene locus_tag LOCUS_11630 2267 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 3345 3058 gene locus_tag LOCUS_11640 3345 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 3397 3726 gene locus_tag LOCUS_11650 3397 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 3751 4167 gene locus_tag LOCUS_11660 3751 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 4604 4203 gene locus_tag LOCUS_11670 4604 4203 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496977.1 protein_id gnl|my_center|LOCUS_11670 5396 4743 gene locus_tag LOCUS_11680 gene fsa 5396 4743 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 protein_id gnl|my_center|LOCUS_11680 6416 5448 gene locus_tag LOCUS_11690 6416 5448 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_11690 7267 6413 gene locus_tag LOCUS_11700 7267 6413 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_11700 7929 7264 gene locus_tag LOCUS_11710 gene rpe 7929 7264 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811794.1 protein_id gnl|my_center|LOCUS_11710 8202 8624 gene locus_tag LOCUS_11720 8202 8624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 9391 8786 gene locus_tag LOCUS_11730 9391 8786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 10564 9404 gene locus_tag LOCUS_11740 10564 9404 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_11740 10746 11339 gene locus_tag LOCUS_11750 10746 11339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 11608 11333 gene locus_tag LOCUS_11760 11608 11333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 11850 11617 gene locus_tag LOCUS_11770 11850 11617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 11971 13359 gene locus_tag LOCUS_11780 gene purF 11971 13359 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060868.1 protein_id gnl|my_center|LOCUS_11780 13363 14946 gene locus_tag LOCUS_11790 gene pheT 13363 14946 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878921.1 protein_id gnl|my_center|LOCUS_11790 15282 15040 gene locus_tag LOCUS_11800 15282 15040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence41 543 22 gene locus_tag LOCUS_11810 543 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1215 694 gene locus_tag LOCUS_11820 1215 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 2967 1471 gene locus_tag LOCUS_11830 2967 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093039140.1 protein_id gnl|my_center|LOCUS_11830 4367 2964 gene locus_tag LOCUS_11840 4367 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 5727 4360 gene locus_tag LOCUS_11850 5727 4360 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060924.1 protein_id gnl|my_center|LOCUS_11850 6300 5737 gene locus_tag LOCUS_11860 6300 5737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 6857 6306 gene locus_tag LOCUS_11870 6857 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 7219 6869 gene locus_tag LOCUS_11880 7219 6869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 7288 7890 gene locus_tag LOCUS_11890 7288 7890 CDS product CRISPR-associated transcriptional regulator Csa3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061223.1 protein_id gnl|my_center|LOCUS_11890 7900 11085 gene locus_tag LOCUS_11900 7900 11085 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_11900 11082 14483 gene locus_tag LOCUS_11910 11082 14483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 >Feature sequence42 1153 173 gene locus_tag LOCUS_11920 1153 173 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081007.1 protein_id gnl|my_center|LOCUS_11920 2969 1233 gene locus_tag LOCUS_11930 2969 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 4484 3255 gene locus_tag LOCUS_11940 gene eno 4484 3255 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496902.1 protein_id gnl|my_center|LOCUS_11940 4633 5820 gene locus_tag LOCUS_11950 4633 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 5822 6013 gene locus_tag LOCUS_11960 5822 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 6020 6952 gene locus_tag LOCUS_11970 6020 6952 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867617.1 protein_id gnl|my_center|LOCUS_11970 7008 7760 gene locus_tag LOCUS_11980 7008 7760 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250729.1 protein_id gnl|my_center|LOCUS_11980 8184 7750 gene locus_tag LOCUS_11990 8184 7750 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391721.1 protein_id gnl|my_center|LOCUS_11990 8413 8171 gene locus_tag LOCUS_12000 8413 8171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 9822 8611 gene locus_tag LOCUS_12010 9822 8611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 10034 10789 gene locus_tag LOCUS_12020 10034 10789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence43 296 1534 gene locus_tag LOCUS_12030 296 1534 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023489.1 protein_id gnl|my_center|LOCUS_12030 4179 1744 gene locus_tag LOCUS_12040 4179 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 4527 5585 gene locus_tag LOCUS_12050 4527 5585 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_12050 5712 5891 gene locus_tag LOCUS_12060 5712 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 5896 7284 gene locus_tag LOCUS_12070 5896 7284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 9468 7501 gene locus_tag LOCUS_12080 9468 7501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 10196 9468 gene locus_tag LOCUS_12090 10196 9468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence44 <1 635 gene locus_tag LOCUS_12100 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064356.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase 708 1226 gene locus_tag LOCUS_12110 708 1226 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060730.1 protein_id gnl|my_center|LOCUS_12110 1525 2805 gene locus_tag LOCUS_12120 gene serS 1525 2805 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_12120 2850 3614 gene locus_tag LOCUS_12130 2850 3614 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868073.1 protein_id gnl|my_center|LOCUS_12130 3693 3980 gene locus_tag LOCUS_12140 3693 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 6193 4001 gene locus_tag LOCUS_12150 6193 4001 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060960.1 protein_id gnl|my_center|LOCUS_12150 6377 6664 gene locus_tag LOCUS_12160 6377 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12160 6737 7318 gene locus_tag LOCUS_12170 6737 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12170 7703 7371 gene locus_tag LOCUS_12180 7703 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 8551 7943 gene locus_tag LOCUS_12190 gene rpsG 8551 7943 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870560.1 protein_id gnl|my_center|LOCUS_12190 8994 8557 gene locus_tag LOCUS_12200 8994 8557 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867743.1 protein_id gnl|my_center|LOCUS_12200 9465 10028 gene locus_tag LOCUS_12210 9465 10028 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065619.1 protein_id gnl|my_center|LOCUS_12210 10179 11186 gene locus_tag LOCUS_12220 10179 11186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence45 375 1172 gene locus_tag LOCUS_12230 375 1172 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545553.1 protein_id gnl|my_center|LOCUS_12230 1186 1506 gene locus_tag LOCUS_12240 1186 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1500 1727 gene locus_tag LOCUS_12250 1500 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 3584 3826 gene locus_tag LOCUS_12260 3584 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 3832 4740 gene locus_tag LOCUS_12270 3832 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 4733 7144 gene locus_tag LOCUS_12280 4733 7144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 8017 7307 gene locus_tag LOCUS_12290 8017 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12290 9588 8719 gene locus_tag LOCUS_12300 9588 8719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 9908 9732 gene locus_tag LOCUS_12310 9908 9732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 10968 9901 gene locus_tag LOCUS_12320 10968 9901 CDS product orc1/cdc6 family replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289552.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence46 123 827 gene locus_tag LOCUS_12330 123 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 841 1644 gene locus_tag LOCUS_12340 841 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 2365 1694 gene locus_tag LOCUS_12350 2365 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 2808 2383 gene locus_tag LOCUS_12360 2808 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 2904 3848 gene locus_tag LOCUS_12370 2904 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 3917 6937 gene locus_tag LOCUS_12380 3917 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 7024 9687 gene locus_tag LOCUS_12390 7024 9687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence47 575 907 gene locus_tag LOCUS_12400 575 907 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021110.1 protein_id gnl|my_center|LOCUS_12400 910 1308 gene locus_tag LOCUS_12410 gene rpl14p 910 1308 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021111.1 protein_id gnl|my_center|LOCUS_12410 1308 1865 gene locus_tag LOCUS_12420 1308 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1871 2587 gene locus_tag LOCUS_12430 1871 2587 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875657.1 protein_id gnl|my_center|LOCUS_12430 2584 3093 gene locus_tag LOCUS_12440 2584 3093 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869969.1 protein_id gnl|my_center|LOCUS_12440 3099 3260 gene locus_tag LOCUS_12450 3099 3260 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763587.1 protein_id gnl|my_center|LOCUS_12450 3265 3648 gene locus_tag LOCUS_12460 3265 3648 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869971.1 protein_id gnl|my_center|LOCUS_12460 3658 4149 gene locus_tag LOCUS_12470 3658 4149 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875661.1 protein_id gnl|my_center|LOCUS_12470 4155 4676 gene locus_tag LOCUS_12480 4155 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 4687 5289 gene locus_tag LOCUS_12490 4687 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 5286 5783 gene locus_tag LOCUS_12500 5286 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 5789 6415 gene locus_tag LOCUS_12510 gene rpsE 5789 6415 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879398.1 protein_id gnl|my_center|LOCUS_12510 6417 6851 gene locus_tag LOCUS_12520 6417 6851 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867442.1 protein_id gnl|my_center|LOCUS_12520 6857 7273 gene locus_tag LOCUS_12530 6857 7273 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869978.1 protein_id gnl|my_center|LOCUS_12530 7384 8856 gene locus_tag LOCUS_12540 gene secY 7384 8856 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869979.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence48 284 583 gene locus_tag LOCUS_12550 284 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 2222 612 gene locus_tag LOCUS_12560 2222 612 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_12560 2323 4272 gene locus_tag LOCUS_12570 2323 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 4914 4219 gene locus_tag LOCUS_12580 4914 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 4980 5600 gene locus_tag LOCUS_12590 4980 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 5717 6349 gene locus_tag LOCUS_12600 5717 6349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 6385 7047 gene locus_tag LOCUS_12610 6385 7047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 8381 7131 gene locus_tag LOCUS_12620 8381 7131 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867288.1 protein_id gnl|my_center|LOCUS_12620 8635 8411 gene locus_tag LOCUS_12630 8635 8411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 9277 8762 gene locus_tag LOCUS_12640 9277 8762 CDS product DJ-1/PfpI/YhbO family deglycase/protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870481.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence49 823 224 gene locus_tag LOCUS_12650 823 224 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867925.1 protein_id gnl|my_center|LOCUS_12650 935 1384 gene locus_tag LOCUS_12660 935 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1517 1771 gene locus_tag LOCUS_12670 1517 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1840 3303 gene locus_tag LOCUS_12680 1840 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12680 3303 5138 gene locus_tag LOCUS_12690 3303 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12690 5144 7789 gene locus_tag LOCUS_12700 5144 7789 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879381.1 protein_id gnl|my_center|LOCUS_12700 7799 8866 gene locus_tag LOCUS_12710 gene rpoA2 7799 8866 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066196.1 protein_id gnl|my_center|LOCUS_12710 8877 9317 gene locus_tag LOCUS_12720 8877 9317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence50 1499 273 gene locus_tag LOCUS_12730 1499 273 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023091.1 protein_id gnl|my_center|LOCUS_12730 2076 2195 gene locus_tag LOCUS_12740 2076 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 6716 2244 gene locus_tag LOCUS_12750 6716 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 7702 6725 gene locus_tag LOCUS_12760 7702 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 8555 8079 gene locus_tag LOCUS_12770 8555 8079 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867764.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence51 <1 711 gene locus_tag LOCUS_12780 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937383.1:glucose-1-phosphate cytidylyltransferase 751 1737 gene locus_tag LOCUS_12790 751 1737 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244102.1 protein_id gnl|my_center|LOCUS_12790 1775 2224 gene locus_tag LOCUS_12800 1775 2224 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045300.1 protein_id gnl|my_center|LOCUS_12800 3159 2260 gene locus_tag LOCUS_12810 3159 2260 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980041.1 protein_id gnl|my_center|LOCUS_12810 4245 5132 gene locus_tag LOCUS_12820 4245 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 5101 6945 gene locus_tag LOCUS_12830 5101 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 6942 7619 gene locus_tag LOCUS_12840 6942 7619 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088737.1 protein_id gnl|my_center|LOCUS_12840 8198 7620 gene locus_tag LOCUS_12850 8198 7620 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583273.1 protein_id gnl|my_center|LOCUS_12850 8886 8203 gene locus_tag LOCUS_12860 8886 8203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence52 687 220 gene locus_tag LOCUS_12870 687 220 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583777.1 protein_id gnl|my_center|LOCUS_12870 1352 2908 gene locus_tag LOCUS_12880 1352 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 2978 3730 gene locus_tag LOCUS_12890 2978 3730 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064392.1 protein_id gnl|my_center|LOCUS_12890 3714 5489 gene locus_tag LOCUS_12900 3714 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 5512 5904 gene locus_tag LOCUS_12910 5512 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 6008 6484 gene locus_tag LOCUS_12920 6008 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 6481 6879 gene locus_tag LOCUS_12930 6481 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 6885 7757 gene locus_tag LOCUS_12940 6885 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence53 2146 1157 gene locus_tag LOCUS_12950 2146 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 2581 2186 gene locus_tag LOCUS_12960 2581 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 2795 2998 gene locus_tag LOCUS_12970 2795 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 3043 3759 gene locus_tag LOCUS_12980 3043 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 4619 3834 gene locus_tag LOCUS_12990 4619 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 5624 4755 gene locus_tag LOCUS_13000 5624 4755 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023015.1 protein_id gnl|my_center|LOCUS_13000 7458 5641 gene locus_tag LOCUS_13010 7458 5641 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545733.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence54 1945 224 gene locus_tag LOCUS_13020 1945 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 3034 1946 gene locus_tag LOCUS_13030 3034 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 3218 4513 gene locus_tag LOCUS_13040 3218 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 4503 7139 gene locus_tag LOCUS_13050 4503 7139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence55 620 360 gene locus_tag LOCUS_13060 620 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 861 625 gene locus_tag LOCUS_13070 861 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 990 1607 gene locus_tag LOCUS_13080 990 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 2962 1655 gene locus_tag LOCUS_13090 gene purB 2962 1655 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249516.1 protein_id gnl|my_center|LOCUS_13090 3095 3457 gene locus_tag LOCUS_13100 3095 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 3811 5118 gene locus_tag LOCUS_13110 3811 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 5200 6066 gene locus_tag LOCUS_13120 5200 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 6076 7194 gene locus_tag LOCUS_13130 6076 7194 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875787.1 protein_id gnl|my_center|LOCUS_13130 7315 7178 gene locus_tag LOCUS_13140 7315 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence56 2304 241 gene locus_tag LOCUS_13150 2304 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 2572 4200 gene locus_tag LOCUS_13160 2572 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 4384 7035 gene locus_tag LOCUS_13170 4384 7035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence57 473 1237 gene locus_tag LOCUS_13180 473 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1280 1765 gene locus_tag LOCUS_13190 1280 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021936.1 protein_id gnl|my_center|LOCUS_13190 3303 1927 gene locus_tag LOCUS_13200 gene glnA 3303 1927 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979431.1 protein_id gnl|my_center|LOCUS_13200 3401 4384 gene locus_tag LOCUS_13210 3401 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 4389 5693 gene locus_tag LOCUS_13220 gene glmM 4389 5693 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877192.1 protein_id gnl|my_center|LOCUS_13220 6794 5700 gene locus_tag LOCUS_13230 6794 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence58 548 679 gene locus_tag LOCUS_13240 548 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 737 2776 gene locus_tag LOCUS_13250 737 2776 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_13250 2770 4215 gene locus_tag LOCUS_13260 2770 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 4346 6208 gene locus_tag LOCUS_13270 4346 6208 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870191.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence59 890 1186 gene locus_tag LOCUS_13280 890 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1529 1236 gene locus_tag LOCUS_13290 1529 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1947 3617 gene locus_tag LOCUS_13300 1947 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 3740 4264 gene locus_tag LOCUS_13310 3740 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 4320 6020 gene locus_tag LOCUS_13320 4320 6020 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867608.1 protein_id gnl|my_center|LOCUS_13320 6087 6653 gene locus_tag LOCUS_13330 6087 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence60 1077 121 gene locus_tag LOCUS_13340 1077 121 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963414.1 protein_id gnl|my_center|LOCUS_13340 1784 1077 gene locus_tag LOCUS_13350 1784 1077 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146572.1 protein_id gnl|my_center|LOCUS_13350 3032 3865 gene locus_tag LOCUS_13360 3032 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 4436 4597 gene locus_tag LOCUS_13370 4436 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 4694 5584 gene locus_tag LOCUS_13380 4694 5584 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073150.1 protein_id gnl|my_center|LOCUS_13380 6372 5587 gene locus_tag LOCUS_13390 6372 5587 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965816.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence61 <1 5952 gene locus_tag LOCUS_13400 <1 5952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022478.1:NosD domain-containing protein >Feature sequence62 336 1664 gene locus_tag LOCUS_13410 336 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1700 2893 gene locus_tag LOCUS_13420 1700 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 4173 3022 gene locus_tag LOCUS_13430 4173 3022 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_13430 5244 4204 gene locus_tag LOCUS_13440 5244 4204 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871070.1 protein_id gnl|my_center|LOCUS_13440 6049 5321 gene locus_tag LOCUS_13450 6049 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 >Feature sequence63 482 916 gene locus_tag LOCUS_13460 482 916 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656400.1 protein_id gnl|my_center|LOCUS_13460 1553 954 gene locus_tag LOCUS_13470 1553 954 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876938.1 protein_id gnl|my_center|LOCUS_13470 1887 1573 gene locus_tag LOCUS_13480 1887 1573 CDS product DNA-directed RNA polymerase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868224.1 protein_id gnl|my_center|LOCUS_13480 2175 1900 gene locus_tag LOCUS_13490 2175 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 2399 2935 gene locus_tag LOCUS_13500 2399 2935 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742650.1 protein_id gnl|my_center|LOCUS_13500 2941 3525 gene locus_tag LOCUS_13510 2941 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 3796 3503 gene locus_tag LOCUS_13520 3796 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 4040 3789 gene locus_tag LOCUS_13530 4040 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 4836 4015 gene locus_tag LOCUS_13540 4836 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 >Feature sequence64 316 978 gene locus_tag LOCUS_13550 316 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1291 1091 gene locus_tag LOCUS_13560 1291 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 2096 5482 gene locus_tag LOCUS_13570 2096 5482 CDS product DNA-directed DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496881.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence65 304 1155 gene locus_tag LOCUS_13580 gene folD 304 1155 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_13580 1761 1144 gene locus_tag LOCUS_13590 1761 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1876 2478 gene locus_tag LOCUS_13600 1876 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 3190 2429 gene locus_tag LOCUS_13610 3190 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 3694 3473 gene locus_tag LOCUS_13620 3694 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 4236 3871 gene locus_tag LOCUS_13630 4236 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 4373 4236 gene locus_tag LOCUS_13640 4373 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 4751 5605 gene locus_tag LOCUS_13650 4751 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence66 765 340 gene locus_tag LOCUS_13660 765 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 983 1147 gene locus_tag LOCUS_13670 983 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1236 1802 gene locus_tag LOCUS_13680 1236 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 2426 1869 gene locus_tag LOCUS_13690 2426 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 2697 4016 gene locus_tag LOCUS_13700 2697 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 4362 4129 gene locus_tag LOCUS_13710 4362 4129 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 protein_id gnl|my_center|LOCUS_13710 4473 5036 gene locus_tag LOCUS_13720 4473 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 5735 5088 gene locus_tag LOCUS_13730 5735 5088 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240313.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence67 1549 755 gene locus_tag LOCUS_13740 1549 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 3008 1779 gene locus_tag LOCUS_13750 3008 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 4260 3034 gene locus_tag LOCUS_13760 4260 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence68 1086 142 gene locus_tag LOCUS_13770 1086 142 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072232.1 protein_id gnl|my_center|LOCUS_13770 2108 1539 gene locus_tag LOCUS_13780 2108 1539 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101673.1 protein_id gnl|my_center|LOCUS_13780 2572 2153 gene locus_tag LOCUS_13790 gene lrpA 2572 2153 CDS product HTH-type transcriptional regulator LrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251084.1 protein_id gnl|my_center|LOCUS_13790 2690 3253 gene locus_tag LOCUS_13800 gene ahpC 2690 3253 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810052.1 protein_id gnl|my_center|LOCUS_13800 3313 3690 gene locus_tag LOCUS_13810 3313 3690 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940441.1 protein_id gnl|my_center|LOCUS_13810 3715 4227 gene locus_tag LOCUS_13820 3715 4227 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878337.1 protein_id gnl|my_center|LOCUS_13820 5001 4261 gene locus_tag LOCUS_13830 5001 4261 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496393.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence69 81 212 gene locus_tag LOCUS_13840 81 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 408 722 gene locus_tag LOCUS_13850 408 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 1517 918 gene locus_tag LOCUS_13860 1517 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1719 1522 gene locus_tag LOCUS_13870 1719 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1827 2480 gene locus_tag LOCUS_13880 1827 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 3518 2604 gene locus_tag LOCUS_13890 3518 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 4342 3590 gene locus_tag LOCUS_13900 4342 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 >Feature sequence70 1027 2874 gene locus_tag LOCUS_13910 1027 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 2954 4144 gene locus_tag LOCUS_13920 2954 4144 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846342.1 protein_id gnl|my_center|LOCUS_13920 <4760 4159 gene locus_tag LOCUS_13930 <4760 4159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020155.1:DEAD/DEAH box helicase >Feature sequence71 872 1789 gene locus_tag LOCUS_13940 872 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 2458 1778 gene locus_tag LOCUS_13950 2458 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 2978 3316 gene locus_tag LOCUS_13960 2978 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 3329 4408 gene locus_tag LOCUS_13970 3329 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence72 2031 577 gene locus_tag LOCUS_13980 2031 577 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_13980 2908 2237 gene locus_tag LOCUS_13990 2908 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 3371 3138 gene locus_tag LOCUS_14000 3371 3138 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020108.1 protein_id gnl|my_center|LOCUS_14000 3590 3372 gene locus_tag LOCUS_14010 3590 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020107.1 protein_id gnl|my_center|LOCUS_14010 3875 4090 gene locus_tag LOCUS_14020 3875 4090 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048036534.1 protein_id gnl|my_center|LOCUS_14020 4087 4317 gene locus_tag LOCUS_14030 4087 4317 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545521.1 protein_id gnl|my_center|LOCUS_14030 >Feature sequence73 1618 1313 gene locus_tag LOCUS_14040 1618 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 1655 2275 gene locus_tag LOCUS_14050 gene purN 1655 2275 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence74 683 468 gene locus_tag LOCUS_14060 683 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 2038 848 gene locus_tag LOCUS_14070 gene sufS 2038 848 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228604.1 protein_id gnl|my_center|LOCUS_14070 3019 2039 gene locus_tag LOCUS_14080 3019 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 3076 3204 gene locus_tag LOCUS_14090 3076 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 3700 3218 gene locus_tag LOCUS_14100 3700 3218 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932996.1 protein_id gnl|my_center|LOCUS_14100 3814 4047 gene locus_tag LOCUS_14110 3814 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence75 768 280 gene locus_tag LOCUS_14120 768 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 2687 1134 gene locus_tag LOCUS_14130 2687 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 <4358 2844 gene locus_tag LOCUS_14140 <4358 2844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878137.1:isoleucine--tRNA ligase >Feature sequence76 2545 707 gene locus_tag LOCUS_14150 2545 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 3838 2750 gene locus_tag LOCUS_14160 3838 2750 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147341.1 protein_id gnl|my_center|LOCUS_14160 3895 4050 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttcaataccacattggttaattcgag >Feature sequence77 2149 2619 gene locus_tag LOCUS_14170 2149 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 2630 2830 gene locus_tag LOCUS_14180 2630 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 2833 3207 gene locus_tag LOCUS_14190 2833 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 >Feature sequence78 1351 1097 gene locus_tag LOCUS_14200 1351 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 3058 1358 gene locus_tag LOCUS_14210 3058 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 <3903 3289 gene locus_tag LOCUS_14220 <3903 3289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964979.1:ATP-dependent DNA helicase >Feature sequence79 1363 815 gene locus_tag LOCUS_14230 1363 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1491 1372 gene locus_tag LOCUS_14240 1491 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3338 3159 gene locus_tag LOCUS_14250 3338 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence80 630 52 gene locus_tag LOCUS_14260 630 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1171 1806 gene locus_tag LOCUS_14270 1171 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1799 2770 gene locus_tag LOCUS_14280 1799 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 2960 3271 gene locus_tag LOCUS_14290 2960 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 3300 3431 gene locus_tag LOCUS_14300 3300 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence81 187 1086 gene locus_tag LOCUS_14310 187 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1174 1308 gene locus_tag LOCUS_14320 1174 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1795 1295 gene locus_tag LOCUS_14330 1795 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 3240 1795 gene locus_tag LOCUS_14340 3240 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 >Feature sequence82 <1 1846 gene locus_tag LOCUS_14350 <1 1846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004524070.1:S8 family peptidase 2012 2896 gene locus_tag LOCUS_14360 2012 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence83 <1 208 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq taatttcaataccacattggttaattcgagac 608 342 gene locus_tag LOCUS_14370 gene cas2 608 342 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817554.1 protein_id gnl|my_center|LOCUS_14370 1582 614 gene locus_tag LOCUS_14380 gene cas1b 1582 614 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545291.1 protein_id gnl|my_center|LOCUS_14380 2085 1582 gene locus_tag LOCUS_14390 2085 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 3206 2091 gene locus_tag LOCUS_14400 3206 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence84 2769 412 gene locus_tag LOCUS_14410 2769 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 >Feature sequence85 1803 814 gene locus_tag LOCUS_14420 gene cas7b 1803 814 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence86 1858 1244 gene locus_tag LOCUS_14430 1858 1244 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870442.1 protein_id gnl|my_center|LOCUS_14430 1903 2298 gene locus_tag LOCUS_14440 1903 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence87 2936 1761 gene locus_tag LOCUS_14450 2936 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 >Feature sequence88 1128 70 gene locus_tag LOCUS_14460 1128 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 2026 1130 gene locus_tag LOCUS_14470 2026 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 <2824 2020 gene locus_tag LOCUS_14480 <2824 2020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083750460.1:CpaF family protein >Feature sequence89 1213 143 gene locus_tag LOCUS_14490 gene corA 1213 143 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081315.1 protein_id gnl|my_center|LOCUS_14490 1314 2513 gene locus_tag LOCUS_14500 1314 2513 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250756.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence90 383 48 gene locus_tag LOCUS_14510 383 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 649 951 gene locus_tag LOCUS_14520 649 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1053 1796 gene locus_tag LOCUS_14530 1053 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence91 >Feature sequence92 732 316 gene locus_tag LOCUS_14540 732 316 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870963.1 protein_id gnl|my_center|LOCUS_14540 854 2317 gene locus_tag LOCUS_14550 gene cysS 854 2317 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868520.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence93 218 808 gene locus_tag LOCUS_14560 218 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 783 1535 gene locus_tag LOCUS_14570 783 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 >Feature sequence94 448 1092 gene locus_tag LOCUS_14580 448 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1231 1659 gene locus_tag LOCUS_14590 1231 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1656 2078 gene locus_tag LOCUS_14600 1656 2078 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087886.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence95 44 2128 gene locus_tag LOCUS_14610 44 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610