>Feature sequence001 1147 107 gene locus_tag LOCUS_00010 1147 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2340 1144 gene locus_tag LOCUS_00020 2340 1144 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240521.1 protein_id gnl|my_center|LOCUS_00020 3037 2354 gene locus_tag LOCUS_00030 3037 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3611 3099 gene locus_tag LOCUS_00040 3611 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4176 3613 gene locus_tag LOCUS_00050 4176 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4509 4180 gene locus_tag LOCUS_00060 4509 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5426 4662 gene locus_tag LOCUS_00070 5426 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5885 6319 gene locus_tag LOCUS_00080 5885 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6487 6855 gene locus_tag LOCUS_00090 6487 6855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6852 7502 gene locus_tag LOCUS_00100 6852 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 7530 7817 gene locus_tag LOCUS_00110 gene groES 7530 7817 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103730.1 protein_id gnl|my_center|LOCUS_00110 7847 8191 gene locus_tag LOCUS_00120 7847 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 8331 9272 gene locus_tag LOCUS_00130 gene trxB 8331 9272 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583127.1 protein_id gnl|my_center|LOCUS_00130 9735 9310 gene locus_tag LOCUS_00140 9735 9310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 10520 9732 gene locus_tag LOCUS_00150 10520 9732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 12076 10643 gene locus_tag LOCUS_00160 12076 10643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 12290 13066 gene locus_tag LOCUS_00170 12290 13066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 14924 13176 gene locus_tag LOCUS_00180 14924 13176 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392090.1 protein_id gnl|my_center|LOCUS_00180 14851 15051 gene locus_tag LOCUS_00190 14851 15051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 15123 16187 gene locus_tag LOCUS_00200 15123 16187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 17005 16226 gene locus_tag LOCUS_00210 17005 16226 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583057.1 protein_id gnl|my_center|LOCUS_00210 17280 18035 gene locus_tag LOCUS_00220 17280 18035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 19523 18153 gene locus_tag LOCUS_00230 19523 18153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 19659 19964 gene locus_tag LOCUS_00240 19659 19964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 21030 19954 gene locus_tag LOCUS_00250 21030 19954 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246499.1 protein_id gnl|my_center|LOCUS_00250 21155 22939 gene locus_tag LOCUS_00260 21155 22939 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392558.1 protein_id gnl|my_center|LOCUS_00260 22914 23597 gene locus_tag LOCUS_00270 22914 23597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 23626 24732 gene locus_tag LOCUS_00280 23626 24732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 24729 27002 gene locus_tag LOCUS_00290 24729 27002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 26999 28981 gene locus_tag LOCUS_00300 26999 28981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 28957 30981 gene locus_tag LOCUS_00310 28957 30981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 30985 32022 gene locus_tag LOCUS_00320 30985 32022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 33190 32012 gene locus_tag LOCUS_00330 33190 32012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 34911 33187 gene locus_tag LOCUS_00340 34911 33187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 35827 34922 gene locus_tag LOCUS_00350 35827 34922 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 protein_id gnl|my_center|LOCUS_00350 36201 36274 gene locus_tag LOCUS_t00010 36201 36274 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 36354 36437 gene locus_tag LOCUS_t00020 36354 36437 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 36478 36552 gene locus_tag LOCUS_t00030 36478 36552 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 36568 36641 gene locus_tag LOCUS_t00040 36568 36641 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 36696 37892 gene locus_tag LOCUS_00360 gene tuf 36696 37892 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869930.1 protein_id gnl|my_center|LOCUS_00360 37902 38060 gene locus_tag LOCUS_00370 gene rpmG 37902 38060 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943500.1 protein_id gnl|my_center|LOCUS_00370 38163 38238 gene locus_tag LOCUS_t00050 38163 38238 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 38271 38630 gene locus_tag LOCUS_00380 38271 38630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 38644 39171 gene locus_tag LOCUS_00390 gene nusG 38644 39171 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_00390 39344 39766 gene locus_tag LOCUS_00400 gene rplK 39344 39766 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943497.1 protein_id gnl|my_center|LOCUS_00400 39849 40559 gene locus_tag LOCUS_00410 gene rplA 39849 40559 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_00410 40573 41109 gene locus_tag LOCUS_00420 gene rplJ 40573 41109 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_00420 41172 41558 gene locus_tag LOCUS_00430 gene rplL 41172 41558 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018245.1 protein_id gnl|my_center|LOCUS_00430 41678 45880 gene locus_tag LOCUS_00440 gene rpoB 41678 45880 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943493.1 protein_id gnl|my_center|LOCUS_00440 45957 50159 gene locus_tag LOCUS_00450 gene rpoC 45957 50159 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_00450 50367 50741 gene locus_tag LOCUS_00460 gene rpsL 50367 50741 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_00460 50754 51242 gene locus_tag LOCUS_00470 gene rpsG 50754 51242 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385326.1 protein_id gnl|my_center|LOCUS_00470 51366 53489 gene locus_tag LOCUS_00480 gene fusA 51366 53489 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_00480 53527 53835 gene locus_tag LOCUS_00490 gene rpsJ 53527 53835 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_00490 53864 54496 gene locus_tag LOCUS_00500 gene rplD 53864 54496 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938599.1 protein_id gnl|my_center|LOCUS_00500 54501 54806 gene locus_tag LOCUS_00510 54501 54806 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_00510 54819 55655 gene locus_tag LOCUS_00520 gene rplB 54819 55655 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_00520 55673 55951 gene locus_tag LOCUS_00530 gene rpsS 55673 55951 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938602.1 protein_id gnl|my_center|LOCUS_00530 55963 56358 gene locus_tag LOCUS_00540 gene rplV 55963 56358 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727697.1 protein_id gnl|my_center|LOCUS_00540 56369 57025 gene locus_tag LOCUS_00550 gene rpsC 56369 57025 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393931.1 protein_id gnl|my_center|LOCUS_00550 57077 57445 gene locus_tag LOCUS_00560 gene rplP 57077 57445 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943479.1 protein_id gnl|my_center|LOCUS_00560 57442 57669 gene locus_tag LOCUS_00570 57442 57669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 57662 57937 gene locus_tag LOCUS_00580 gene rpsQ 57662 57937 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943477.1 protein_id gnl|my_center|LOCUS_00580 57954 58322 gene locus_tag LOCUS_00590 gene rplN 57954 58322 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943476.1 protein_id gnl|my_center|LOCUS_00590 58322 58693 gene locus_tag LOCUS_00600 gene rplX 58322 58693 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156486.1 protein_id gnl|my_center|LOCUS_00600 58709 59335 gene locus_tag LOCUS_00610 gene rplE 58709 59335 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_00610 59347 59526 gene locus_tag LOCUS_00620 59347 59526 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943473.1 protein_id gnl|my_center|LOCUS_00620 59617 59937 gene locus_tag LOCUS_00630 gene rpsH 59617 59937 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558871.1 protein_id gnl|my_center|LOCUS_00630 59955 60494 gene locus_tag LOCUS_00640 gene rplF 59955 60494 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904134.1 protein_id gnl|my_center|LOCUS_00640 60507 60872 gene locus_tag LOCUS_00650 gene rplR 60507 60872 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549040.1 protein_id gnl|my_center|LOCUS_00650 60913 61404 gene locus_tag LOCUS_00660 gene rpsE 60913 61404 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938615.1 protein_id gnl|my_center|LOCUS_00660 61440 61637 gene locus_tag LOCUS_00670 gene rpmD 61440 61637 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776359.1 protein_id gnl|my_center|LOCUS_00670 61641 62579 gene locus_tag LOCUS_00680 61641 62579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 62638 63951 gene locus_tag LOCUS_00690 gene secY 62638 63951 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_00690 63966 64607 gene locus_tag LOCUS_00700 63966 64607 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_00700 64620 65402 gene locus_tag LOCUS_00710 gene map 64620 65402 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938619.1 protein_id gnl|my_center|LOCUS_00710 65566 65946 gene locus_tag LOCUS_00720 gene rpsM 65566 65946 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938621.1 protein_id gnl|my_center|LOCUS_00720 65946 66335 gene locus_tag LOCUS_00730 gene rpsK 65946 66335 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101799.1 protein_id gnl|my_center|LOCUS_00730 66599 67657 gene locus_tag LOCUS_00740 66599 67657 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_00740 67745 68152 gene locus_tag LOCUS_00750 67745 68152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 68251 69780 gene locus_tag LOCUS_00760 68251 69780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 69889 72450 gene locus_tag LOCUS_00770 69889 72450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 72582 74297 gene locus_tag LOCUS_00780 72582 74297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 74312 76759 gene locus_tag LOCUS_00790 74312 76759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 76775 77647 gene locus_tag LOCUS_00800 76775 77647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 78217 78495 gene locus_tag LOCUS_00810 78217 78495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 >Feature sequence002 880 2973 gene locus_tag LOCUS_00820 880 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 4366 2981 gene locus_tag LOCUS_00830 4366 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 6356 4350 gene locus_tag LOCUS_00840 6356 4350 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141615.1 protein_id gnl|my_center|LOCUS_00840 6784 6413 gene locus_tag LOCUS_00850 gene rplS 6784 6413 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564764.1 protein_id gnl|my_center|LOCUS_00850 9866 6951 gene locus_tag LOCUS_00860 9866 6951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 10527 9964 gene locus_tag LOCUS_00870 10527 9964 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523374.1 protein_id gnl|my_center|LOCUS_00870 10822 10559 gene locus_tag LOCUS_00880 10822 10559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 11368 10877 gene locus_tag LOCUS_00890 11368 10877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 13125 11440 gene locus_tag LOCUS_00900 13125 11440 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817748.1 protein_id gnl|my_center|LOCUS_00900 15456 13243 gene locus_tag LOCUS_00910 15456 13243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 16364 15459 gene locus_tag LOCUS_00920 16364 15459 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919042.1 protein_id gnl|my_center|LOCUS_00920 17210 16392 gene locus_tag LOCUS_00930 17210 16392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 18031 17207 gene locus_tag LOCUS_00940 18031 17207 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020650.1 protein_id gnl|my_center|LOCUS_00940 19940 18075 gene locus_tag LOCUS_00950 19940 18075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 20373 19909 gene locus_tag LOCUS_00960 gene nusB 20373 19909 CDS product N utilization substance protein NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830249.1 protein_id gnl|my_center|LOCUS_00960 20843 20373 gene locus_tag LOCUS_00970 gene ribE 20843 20373 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_00970 22204 20915 gene locus_tag LOCUS_00980 gene mnmE 22204 20915 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228302.1 protein_id gnl|my_center|LOCUS_00980 24476 22191 gene locus_tag LOCUS_00990 24476 22191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 24832 24473 gene locus_tag LOCUS_01000 24832 24473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 25005 24856 gene locus_tag LOCUS_01010 gene rpmH 25005 24856 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828326.1 protein_id gnl|my_center|LOCUS_01010 25450 25211 gene locus_tag LOCUS_01020 25450 25211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 25358 25708 gene locus_tag LOCUS_01030 25358 25708 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942666.1 protein_id gnl|my_center|LOCUS_01030 25721 28750 gene locus_tag LOCUS_01040 25721 28750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 28769 30172 gene locus_tag LOCUS_01050 28769 30172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 30212 30583 gene locus_tag LOCUS_01060 30212 30583 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921050.1 protein_id gnl|my_center|LOCUS_01060 30580 31062 gene locus_tag LOCUS_01070 30580 31062 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066438.1 protein_id gnl|my_center|LOCUS_01070 31034 33490 gene locus_tag LOCUS_01080 31034 33490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 33490 37113 gene locus_tag LOCUS_01090 33490 37113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 38749 37235 gene locus_tag LOCUS_01100 38749 37235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 40003 38759 gene locus_tag LOCUS_01110 40003 38759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 40428 40003 gene locus_tag LOCUS_01120 40428 40003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 40989 40516 gene locus_tag LOCUS_01130 gene ybeY 40989 40516 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880869.1 protein_id gnl|my_center|LOCUS_01130 43369 40877 gene locus_tag LOCUS_01140 43369 40877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 43649 44830 gene locus_tag LOCUS_01150 43649 44830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 44839 45966 gene locus_tag LOCUS_01160 gene bamB 44839 45966 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193323.1 protein_id gnl|my_center|LOCUS_01160 45966 46637 gene locus_tag LOCUS_01170 45966 46637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 46785 47567 gene locus_tag LOCUS_01180 46785 47567 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_01180 47652 48590 gene locus_tag LOCUS_01190 gene rsmH 47652 48590 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939782.1 protein_id gnl|my_center|LOCUS_01190 48587 49201 gene locus_tag LOCUS_01200 48587 49201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 49195 51423 gene locus_tag LOCUS_01210 49195 51423 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_01210 51425 52942 gene locus_tag LOCUS_01220 51425 52942 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057081.1 protein_id gnl|my_center|LOCUS_01220 52954 54366 gene locus_tag LOCUS_01230 52954 54366 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272578.1 protein_id gnl|my_center|LOCUS_01230 55125 54379 gene locus_tag LOCUS_01240 55125 54379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 55971 55129 gene locus_tag LOCUS_01250 55971 55129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 57152 55968 gene locus_tag LOCUS_01260 57152 55968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 57211 57633 gene locus_tag LOCUS_01270 57211 57633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 57787 57933 gene locus_tag LOCUS_01280 57787 57933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 57930 58571 gene locus_tag LOCUS_01290 57930 58571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 59745 58636 gene locus_tag LOCUS_01300 59745 58636 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731604.1 protein_id gnl|my_center|LOCUS_01300 >Feature sequence003 2815 1493 gene locus_tag LOCUS_01310 2815 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 3165 2848 gene locus_tag LOCUS_01320 3165 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 3164 3766 gene locus_tag LOCUS_01330 3164 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 4418 3753 gene locus_tag LOCUS_01340 4418 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 5888 4506 gene locus_tag LOCUS_01350 5888 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 8302 6047 gene locus_tag LOCUS_01360 8302 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 9468 8467 gene locus_tag LOCUS_01370 9468 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 10110 9481 gene locus_tag LOCUS_01380 10110 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 10462 11439 gene locus_tag LOCUS_01390 10462 11439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 11440 12030 gene locus_tag LOCUS_01400 11440 12030 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133795409.1 protein_id gnl|my_center|LOCUS_01400 12027 13181 gene locus_tag LOCUS_01410 12027 13181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 13286 14305 gene locus_tag LOCUS_01420 13286 14305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 14364 15146 gene locus_tag LOCUS_01430 gene trmD 14364 15146 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765874.1 protein_id gnl|my_center|LOCUS_01430 15143 15718 gene locus_tag LOCUS_01440 15143 15718 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941308.1 protein_id gnl|my_center|LOCUS_01440 15729 16544 gene locus_tag LOCUS_01450 gene dapF 15729 16544 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014772.1 protein_id gnl|my_center|LOCUS_01450 17709 17041 gene locus_tag LOCUS_01460 17709 17041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 17947 20034 gene locus_tag LOCUS_01470 17947 20034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 20759 20235 gene locus_tag LOCUS_01480 20759 20235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 20923 21399 gene locus_tag LOCUS_01490 20923 21399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 21527 22990 gene locus_tag LOCUS_01500 21527 22990 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_01500 23013 24191 gene locus_tag LOCUS_01510 23013 24191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 24244 25146 gene locus_tag LOCUS_01520 24244 25146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 25228 26034 gene locus_tag LOCUS_01530 25228 26034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 26060 27451 gene locus_tag LOCUS_01540 26060 27451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 27599 29452 gene locus_tag LOCUS_01550 27599 29452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 29494 30960 gene locus_tag LOCUS_01560 29494 30960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 32684 30981 gene locus_tag LOCUS_01570 32684 30981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 33282 32827 gene locus_tag LOCUS_01580 33282 32827 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939839.1 protein_id gnl|my_center|LOCUS_01580 34861 33338 gene locus_tag LOCUS_01590 34861 33338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 35841 34858 gene locus_tag LOCUS_01600 35841 34858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 36389 35841 gene locus_tag LOCUS_01610 36389 35841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 37168 36521 gene locus_tag LOCUS_01620 37168 36521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 38286 37402 gene locus_tag LOCUS_01630 38286 37402 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770019.1 protein_id gnl|my_center|LOCUS_01630 39915 38302 gene locus_tag LOCUS_01640 39915 38302 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257013.1 protein_id gnl|my_center|LOCUS_01640 40140 40067 gene locus_tag LOCUS_t00060 40140 40067 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 40307 41119 gene locus_tag LOCUS_01650 40307 41119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 41674 41186 gene locus_tag LOCUS_01660 41674 41186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 43813 41720 gene locus_tag LOCUS_01670 43813 41720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 44605 43817 gene locus_tag LOCUS_01680 44605 43817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 45225 44635 gene locus_tag LOCUS_01690 45225 44635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 45938 45222 gene locus_tag LOCUS_01700 45938 45222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 46166 47791 gene locus_tag LOCUS_01710 46166 47791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 47970 48923 gene locus_tag LOCUS_01720 47970 48923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 48945 49835 gene locus_tag LOCUS_01730 48945 49835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 49890 50990 gene locus_tag LOCUS_01740 49890 50990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 51011 53299 gene locus_tag LOCUS_01750 51011 53299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 55869 53338 gene locus_tag LOCUS_01760 55869 53338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 56037 57743 gene locus_tag LOCUS_01770 56037 57743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 >Feature sequence004 619 1866 gene locus_tag LOCUS_01780 619 1866 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_01780 3243 2068 gene locus_tag LOCUS_01790 3243 2068 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_01790 4022 3363 gene locus_tag LOCUS_01800 4022 3363 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260949.1 protein_id gnl|my_center|LOCUS_01800 5856 4048 gene locus_tag LOCUS_01810 5856 4048 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_01810 6069 7592 gene locus_tag LOCUS_01820 6069 7592 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357216.1 protein_id gnl|my_center|LOCUS_01820 7603 8478 gene locus_tag LOCUS_01830 7603 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 10127 8514 gene locus_tag LOCUS_01840 10127 8514 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942540.1 protein_id gnl|my_center|LOCUS_01840 10406 11140 gene locus_tag LOCUS_01850 10406 11140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 11243 11821 gene locus_tag LOCUS_01860 11243 11821 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888187.1 protein_id gnl|my_center|LOCUS_01860 11923 13722 gene locus_tag LOCUS_01870 11923 13722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 13834 16212 gene locus_tag LOCUS_01880 13834 16212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 16352 18727 gene locus_tag LOCUS_01890 gene lon 16352 18727 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947583.1 protein_id gnl|my_center|LOCUS_01890 18724 19962 gene locus_tag LOCUS_01900 18724 19962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 19959 20771 gene locus_tag LOCUS_01910 19959 20771 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_01910 22665 20788 gene locus_tag LOCUS_01920 22665 20788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 23450 22794 gene locus_tag LOCUS_01930 23450 22794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 24514 23531 gene locus_tag LOCUS_01940 24514 23531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 25082 24699 gene locus_tag LOCUS_01950 25082 24699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 25750 25100 gene locus_tag LOCUS_01960 gene thiE 25750 25100 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584007.1 protein_id gnl|my_center|LOCUS_01960 26793 25747 gene locus_tag LOCUS_01970 gene thiH 26793 25747 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_01970 27458 26829 gene locus_tag LOCUS_01980 27458 26829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946301.1 protein_id gnl|my_center|LOCUS_01980 27593 28192 gene locus_tag LOCUS_01990 27593 28192 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_01990 29026 28208 gene locus_tag LOCUS_02000 29026 28208 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945667.1 protein_id gnl|my_center|LOCUS_02000 29293 29919 gene locus_tag LOCUS_02010 gene trmB 29293 29919 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057818.1 protein_id gnl|my_center|LOCUS_02010 29889 31235 gene locus_tag LOCUS_02020 29889 31235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 32024 31284 gene locus_tag LOCUS_02030 32024 31284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 32416 32045 gene locus_tag LOCUS_02040 32416 32045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 33949 32438 gene locus_tag LOCUS_02050 33949 32438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 34098 34976 gene locus_tag LOCUS_02060 34098 34976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 38597 34962 gene locus_tag LOCUS_02070 38597 34962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 39294 38695 gene locus_tag LOCUS_02080 39294 38695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 40305 39388 gene locus_tag LOCUS_02090 40305 39388 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_02090 41501 40632 gene locus_tag LOCUS_02100 gene rsmI 41501 40632 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057354.1 protein_id gnl|my_center|LOCUS_02100 42610 41498 gene locus_tag LOCUS_02110 42610 41498 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938875.1 protein_id gnl|my_center|LOCUS_02110 43028 42579 gene locus_tag LOCUS_02120 43028 42579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 44305 43025 gene locus_tag LOCUS_02130 44305 43025 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791443.1 protein_id gnl|my_center|LOCUS_02130 44331 45773 gene locus_tag LOCUS_02140 44331 45773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 45871 47286 gene locus_tag LOCUS_02150 45871 47286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 47330 48313 gene locus_tag LOCUS_02160 47330 48313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 48310 49443 gene locus_tag LOCUS_02170 48310 49443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 49608 50795 gene locus_tag LOCUS_02180 49608 50795 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943657.1 protein_id gnl|my_center|LOCUS_02180 50792 52951 gene locus_tag LOCUS_02190 50792 52951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 >Feature sequence005 2497 932 gene locus_tag LOCUS_02200 2497 932 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681273.1 protein_id gnl|my_center|LOCUS_02200 4329 2512 gene locus_tag LOCUS_02210 gene glmS 4329 2512 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_02210 5202 4405 gene locus_tag LOCUS_02220 5202 4405 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162828730.1 protein_id gnl|my_center|LOCUS_02220 6520 5228 gene locus_tag LOCUS_02230 gene serS 6520 5228 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458807.1 protein_id gnl|my_center|LOCUS_02230 6729 7733 gene locus_tag LOCUS_02240 6729 7733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 10486 7721 gene locus_tag LOCUS_02250 10486 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 11128 10622 gene locus_tag LOCUS_02260 11128 10622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 11359 12741 gene locus_tag LOCUS_02270 gene mgtE 11359 12741 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705188.1 protein_id gnl|my_center|LOCUS_02270 12747 13607 gene locus_tag LOCUS_02280 12747 13607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 14838 13594 gene locus_tag LOCUS_02290 14838 13594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 14956 17124 gene locus_tag LOCUS_02300 gene glgX 14956 17124 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_02300 19582 17081 gene locus_tag LOCUS_02310 19582 17081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 19688 20506 gene locus_tag LOCUS_02320 19688 20506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 20517 22385 gene locus_tag LOCUS_02330 20517 22385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 22529 22987 gene locus_tag LOCUS_02340 22529 22987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 23374 24528 gene locus_tag LOCUS_02350 gene yqhD 23374 24528 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098716.1 protein_id gnl|my_center|LOCUS_02350 26073 24562 gene locus_tag LOCUS_02360 26073 24562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 27669 26080 gene locus_tag LOCUS_02370 27669 26080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 28451 27666 gene locus_tag LOCUS_02380 28451 27666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 29512 28448 gene locus_tag LOCUS_02390 29512 28448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 29716 30198 gene locus_tag LOCUS_02400 gene nuoE 29716 30198 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_02400 30195 32003 gene locus_tag LOCUS_02410 gene nuoF 30195 32003 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_02410 32041 34134 gene locus_tag LOCUS_02420 32041 34134 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931974.1 protein_id gnl|my_center|LOCUS_02420 35696 34269 gene locus_tag LOCUS_02430 35696 34269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 36271 35693 gene locus_tag LOCUS_02440 36271 35693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 37391 36294 gene locus_tag LOCUS_02450 37391 36294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 39008 37401 gene locus_tag LOCUS_02460 39008 37401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 39236 40318 gene locus_tag LOCUS_02470 gene asnA 39236 40318 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_02470 40403 40951 gene locus_tag LOCUS_02480 40403 40951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 41011 41217 gene locus_tag LOCUS_02490 gene rpmF 41011 41217 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638547.1 protein_id gnl|my_center|LOCUS_02490 41259 41717 gene locus_tag LOCUS_02500 gene rpiB 41259 41717 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_02500 41757 42893 gene locus_tag LOCUS_02510 gene ribD 41757 42893 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_02510 42900 43508 gene locus_tag LOCUS_02520 42900 43508 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881107.1 protein_id gnl|my_center|LOCUS_02520 43505 44665 gene locus_tag LOCUS_02530 43505 44665 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_02530 44662 46479 gene locus_tag LOCUS_02540 44662 46479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 46615 47466 gene locus_tag LOCUS_02550 46615 47466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 47598 48938 gene locus_tag LOCUS_02560 47598 48938 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202813.1 protein_id gnl|my_center|LOCUS_02560 49525 48947 gene locus_tag LOCUS_02570 49525 48947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 >Feature sequence006 2519 1017 gene locus_tag LOCUS_02580 2519 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 3455 2625 gene locus_tag LOCUS_02590 3455 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 3736 5733 gene locus_tag LOCUS_02600 3736 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 5756 6580 gene locus_tag LOCUS_02610 5756 6580 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_02610 6577 8151 gene locus_tag LOCUS_02620 6577 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 8181 9422 gene locus_tag LOCUS_02630 8181 9422 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528130.1 protein_id gnl|my_center|LOCUS_02630 10196 9450 gene locus_tag LOCUS_02640 10196 9450 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_02640 11233 10193 gene locus_tag LOCUS_02650 11233 10193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 12061 11246 gene locus_tag LOCUS_02660 12061 11246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 13217 12159 gene locus_tag LOCUS_02670 13217 12159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 13340 13729 gene locus_tag LOCUS_02680 13340 13729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 13819 14034 gene locus_tag LOCUS_02690 13819 14034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 14157 14804 gene locus_tag LOCUS_02700 14157 14804 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_02700 14994 15668 gene locus_tag LOCUS_02710 14994 15668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 16539 15742 gene locus_tag LOCUS_02720 16539 15742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 17758 16616 gene locus_tag LOCUS_02730 17758 16616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 19063 17810 gene locus_tag LOCUS_02740 19063 17810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 19797 19072 gene locus_tag LOCUS_02750 19797 19072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 20207 19938 gene locus_tag LOCUS_02760 gene rpsO 20207 19938 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_02760 21184 20213 gene locus_tag LOCUS_02770 gene truB 21184 20213 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_02770 22146 21181 gene locus_tag LOCUS_02780 22146 21181 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_02780 22607 22143 gene locus_tag LOCUS_02790 22607 22143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 22921 22652 gene locus_tag LOCUS_02800 22921 22652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 22817 23206 gene locus_tag LOCUS_02810 22817 23206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 23425 25137 gene locus_tag LOCUS_02820 23425 25137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 25508 26818 gene locus_tag LOCUS_02830 25508 26818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 27200 27931 gene locus_tag LOCUS_02840 27200 27931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 27960 30713 gene locus_tag LOCUS_02850 27960 30713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 30710 31207 gene locus_tag LOCUS_02860 30710 31207 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974912.1 protein_id gnl|my_center|LOCUS_02860 31283 31486 gene locus_tag LOCUS_02870 31283 31486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 32511 31498 gene locus_tag LOCUS_02880 32511 31498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 33643 32537 gene locus_tag LOCUS_02890 33643 32537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 33774 34496 gene locus_tag LOCUS_02900 33774 34496 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_02900 34870 34721 gene locus_tag LOCUS_02910 34870 34721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 34851 35702 gene locus_tag LOCUS_02920 34851 35702 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939764.1 protein_id gnl|my_center|LOCUS_02920 35712 38309 gene locus_tag LOCUS_02930 gene clpB 35712 38309 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_02930 39472 38306 gene locus_tag LOCUS_02940 39472 38306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 39950 39498 gene locus_tag LOCUS_02950 39950 39498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 40930 39947 gene locus_tag LOCUS_02960 40930 39947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 42838 41084 gene locus_tag LOCUS_02970 42838 41084 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_02970 44115 42835 gene locus_tag LOCUS_02980 44115 42835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 46141 44222 gene locus_tag LOCUS_02990 46141 44222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 46448 46705 gene locus_tag LOCUS_03000 46448 46705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 46730 47365 gene locus_tag LOCUS_03010 46730 47365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 47468 49717 gene locus_tag LOCUS_03020 47468 49717 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006742214.1 protein_id gnl|my_center|LOCUS_03020 >Feature sequence007 1825 1418 gene locus_tag LOCUS_03030 1825 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 2166 2873 gene locus_tag LOCUS_03040 2166 2873 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449739.1 protein_id gnl|my_center|LOCUS_03040 3428 2910 gene locus_tag LOCUS_03050 3428 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 3779 3447 gene locus_tag LOCUS_03060 3779 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 3957 4643 gene locus_tag LOCUS_03070 3957 4643 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815942.1 protein_id gnl|my_center|LOCUS_03070 5044 4679 gene locus_tag LOCUS_03080 5044 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 5688 5059 gene locus_tag LOCUS_03090 5688 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 6261 5698 gene locus_tag LOCUS_03100 6261 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 6641 6270 gene locus_tag LOCUS_03110 6641 6270 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940847.1 protein_id gnl|my_center|LOCUS_03110 7543 6743 gene locus_tag LOCUS_03120 7543 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 8275 7997 gene locus_tag LOCUS_03130 8275 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 8444 9904 gene locus_tag LOCUS_03140 8444 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 12524 9972 gene locus_tag LOCUS_03150 12524 9972 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_03150 13401 12577 gene locus_tag LOCUS_03160 13401 12577 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306772.1 protein_id gnl|my_center|LOCUS_03160 14402 13446 gene locus_tag LOCUS_03170 14402 13446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 14571 15719 gene locus_tag LOCUS_03180 14571 15719 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_03180 15719 17074 gene locus_tag LOCUS_03190 15719 17074 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_03190 17153 18802 gene locus_tag LOCUS_03200 17153 18802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 19019 19633 gene locus_tag LOCUS_03210 gene rpsD 19019 19633 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056002.1 protein_id gnl|my_center|LOCUS_03210 22886 19773 gene locus_tag LOCUS_03220 22886 19773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 23688 23119 gene locus_tag LOCUS_03230 23688 23119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 25024 23756 gene locus_tag LOCUS_03240 25024 23756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 26534 25032 gene locus_tag LOCUS_03250 26534 25032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 26711 27058 gene locus_tag LOCUS_03260 26711 27058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 28798 27167 gene locus_tag LOCUS_03270 gene hcp 28798 27167 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870473.1 protein_id gnl|my_center|LOCUS_03270 29354 28953 gene locus_tag LOCUS_03280 29354 28953 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228632.1 protein_id gnl|my_center|LOCUS_03280 30186 29380 gene locus_tag LOCUS_03290 30186 29380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 31030 30281 gene locus_tag LOCUS_03300 gene cobB 31030 30281 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868319.1 protein_id gnl|my_center|LOCUS_03300 31258 32973 gene locus_tag LOCUS_03310 31258 32973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 34521 33118 gene locus_tag LOCUS_03320 34521 33118 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392701.1 protein_id gnl|my_center|LOCUS_03320 36028 34616 gene locus_tag LOCUS_03330 36028 34616 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404498.1 protein_id gnl|my_center|LOCUS_03330 37512 36025 gene locus_tag LOCUS_03340 37512 36025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 39746 37509 gene locus_tag LOCUS_03350 39746 37509 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136932681.1 protein_id gnl|my_center|LOCUS_03350 39633 39953 gene locus_tag LOCUS_03360 39633 39953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 40977 40081 gene locus_tag LOCUS_03370 gene dapA 40977 40081 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 protein_id gnl|my_center|LOCUS_03370 41107 41625 gene locus_tag LOCUS_03380 41107 41625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 41641 42681 gene locus_tag LOCUS_03390 41641 42681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 42775 43986 gene locus_tag LOCUS_03400 42775 43986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 45432 44050 gene locus_tag LOCUS_03410 45432 44050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 45959 47593 gene locus_tag LOCUS_03420 45959 47593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 >Feature sequence008 680 315 gene locus_tag LOCUS_03430 680 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 928 2496 gene locus_tag LOCUS_03440 928 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 2515 4503 gene locus_tag LOCUS_03450 2515 4503 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265787.1 protein_id gnl|my_center|LOCUS_03450 4500 5249 gene locus_tag LOCUS_03460 4500 5249 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083961.1 protein_id gnl|my_center|LOCUS_03460 5250 6143 gene locus_tag LOCUS_03470 5250 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 6253 6828 gene locus_tag LOCUS_03480 6253 6828 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229712.1 protein_id gnl|my_center|LOCUS_03480 6848 7786 gene locus_tag LOCUS_03490 6848 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 8048 9391 gene locus_tag LOCUS_03500 gene preT 8048 9391 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136379.1 protein_id gnl|my_center|LOCUS_03500 9388 10632 gene locus_tag LOCUS_03510 gene preA 9388 10632 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956036.1 protein_id gnl|my_center|LOCUS_03510 10852 12306 gene locus_tag LOCUS_03520 10852 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 12299 14965 gene locus_tag LOCUS_03530 gene gyrA 12299 14965 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815974.1 protein_id gnl|my_center|LOCUS_03530 15048 15278 gene locus_tag LOCUS_03540 15048 15278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 15285 16742 gene locus_tag LOCUS_03550 15285 16742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 16739 17293 gene locus_tag LOCUS_03560 16739 17293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 17338 18246 gene locus_tag LOCUS_03570 17338 18246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 20443 18257 gene locus_tag LOCUS_03580 20443 18257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 22572 20440 gene locus_tag LOCUS_03590 22572 20440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 23315 22569 gene locus_tag LOCUS_03600 23315 22569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 24181 23312 gene locus_tag LOCUS_03610 24181 23312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 24300 25874 gene locus_tag LOCUS_03620 24300 25874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 26191 25958 gene locus_tag LOCUS_03630 26191 25958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 28215 26203 gene locus_tag LOCUS_03640 gene metG 28215 26203 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706089.1 protein_id gnl|my_center|LOCUS_03640 29446 28304 gene locus_tag LOCUS_03650 29446 28304 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_03650 29715 29536 gene locus_tag LOCUS_03660 29715 29536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 29714 30757 gene locus_tag LOCUS_03670 gene ftcD 29714 30757 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791589.1 protein_id gnl|my_center|LOCUS_03670 30797 31450 gene locus_tag LOCUS_03680 30797 31450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 31447 32304 gene locus_tag LOCUS_03690 31447 32304 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_03690 32309 33076 gene locus_tag LOCUS_03700 gene surE 32309 33076 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_03700 33073 34014 gene locus_tag LOCUS_03710 33073 34014 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 protein_id gnl|my_center|LOCUS_03710 34007 34534 gene locus_tag LOCUS_03720 34007 34534 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944687.1 protein_id gnl|my_center|LOCUS_03720 34551 34877 gene locus_tag LOCUS_03730 34551 34877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939234.1 protein_id gnl|my_center|LOCUS_03730 34867 35349 gene locus_tag LOCUS_03740 34867 35349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 35505 36719 gene locus_tag LOCUS_03750 35505 36719 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392999.1 protein_id gnl|my_center|LOCUS_03750 39593 36894 gene locus_tag LOCUS_03760 gene alaS 39593 36894 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_03760 40626 39574 gene locus_tag LOCUS_03770 gene ychF 40626 39574 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225667.1 protein_id gnl|my_center|LOCUS_03770 41352 40657 gene locus_tag LOCUS_03780 41352 40657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 43404 41446 gene locus_tag LOCUS_03790 43404 41446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 44192 43434 gene locus_tag LOCUS_03800 44192 43434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 44695 44213 gene locus_tag LOCUS_03810 44695 44213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 44811 45272 gene locus_tag LOCUS_03820 44811 45272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 45275 46726 gene locus_tag LOCUS_03830 45275 46726 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_03830 46713 46952 gene locus_tag LOCUS_03840 46713 46952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 >Feature sequence009 2037 1789 gene locus_tag LOCUS_03850 2037 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 4694 2163 gene locus_tag LOCUS_03860 4694 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 6057 4834 gene locus_tag LOCUS_03870 6057 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 7097 6054 gene locus_tag LOCUS_03880 gene purM 7097 6054 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_03880 7845 7129 gene locus_tag LOCUS_03890 7845 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 12216 7873 gene locus_tag LOCUS_03900 12216 7873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 12944 12213 gene locus_tag LOCUS_03910 12944 12213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 13630 12956 gene locus_tag LOCUS_03920 13630 12956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 14309 13656 gene locus_tag LOCUS_03930 14309 13656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 15406 14354 gene locus_tag LOCUS_03940 gene pilM 15406 14354 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181416674.1 protein_id gnl|my_center|LOCUS_03940 16925 15504 gene locus_tag LOCUS_03950 16925 15504 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_03950 18799 17036 gene locus_tag LOCUS_03960 18799 17036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 19443 19027 gene locus_tag LOCUS_03970 19443 19027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 19895 22069 gene locus_tag LOCUS_03980 19895 22069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 22066 24678 gene locus_tag LOCUS_03990 22066 24678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 25866 24760 gene locus_tag LOCUS_04000 25866 24760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 27204 25885 gene locus_tag LOCUS_04010 27204 25885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 27966 27322 gene locus_tag LOCUS_04020 27966 27322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 28637 27963 gene locus_tag LOCUS_04030 28637 27963 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870048.1 protein_id gnl|my_center|LOCUS_04030 29379 28645 gene locus_tag LOCUS_04040 29379 28645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 30521 29406 gene locus_tag LOCUS_04050 30521 29406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 30840 30547 gene locus_tag LOCUS_04060 30840 30547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 32221 30974 gene locus_tag LOCUS_04070 gene ftsZ 32221 30974 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232167.1 protein_id gnl|my_center|LOCUS_04070 33605 32328 gene locus_tag LOCUS_04080 gene ftsA 33605 32328 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_04080 34447 33728 gene locus_tag LOCUS_04090 34447 33728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 35825 34518 gene locus_tag LOCUS_04100 35825 34518 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_04100 36098 36880 gene locus_tag LOCUS_04110 36098 36880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 36943 39618 gene locus_tag LOCUS_04120 36943 39618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 39618 44639 gene locus_tag LOCUS_04130 39618 44639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 >Feature sequence010 553 143 gene locus_tag LOCUS_04140 553 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 8868 559 gene locus_tag LOCUS_04150 8868 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 10022 8886 gene locus_tag LOCUS_04160 10022 8886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 10147 11487 gene locus_tag LOCUS_04170 gene hisS 10147 11487 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964121.1 protein_id gnl|my_center|LOCUS_04170 11723 12331 gene locus_tag LOCUS_04180 11723 12331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 12359 13741 gene locus_tag LOCUS_04190 12359 13741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 13741 14355 gene locus_tag LOCUS_04200 13741 14355 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261151.1 protein_id gnl|my_center|LOCUS_04200 14352 16694 gene locus_tag LOCUS_04210 14352 16694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 16819 17454 gene locus_tag LOCUS_04220 16819 17454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 19521 17467 gene locus_tag LOCUS_04230 19521 17467 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925700.1 protein_id gnl|my_center|LOCUS_04230 19660 21531 gene locus_tag LOCUS_04240 19660 21531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04240 23421 21553 gene locus_tag LOCUS_04250 23421 21553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04250 24980 23598 gene locus_tag LOCUS_04260 24980 23598 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_04260 26108 25032 gene locus_tag LOCUS_04270 26108 25032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 26368 27555 gene locus_tag LOCUS_04280 26368 27555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 27586 27777 gene locus_tag LOCUS_04290 27586 27777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 27780 28196 gene locus_tag LOCUS_04300 27780 28196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 28193 29566 gene locus_tag LOCUS_04310 gene asnS 28193 29566 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058304.1 protein_id gnl|my_center|LOCUS_04310 29580 30437 gene locus_tag LOCUS_04320 29580 30437 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_04320 30427 32139 gene locus_tag LOCUS_04330 gene recN 30427 32139 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_04330 32193 32903 gene locus_tag LOCUS_04340 32193 32903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 33070 34413 gene locus_tag LOCUS_04350 33070 34413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 34433 34909 gene locus_tag LOCUS_04360 34433 34909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 34917 35951 gene locus_tag LOCUS_04370 34917 35951 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053082.1 protein_id gnl|my_center|LOCUS_04370 37425 36169 gene locus_tag LOCUS_04380 37425 36169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 37549 38127 gene locus_tag LOCUS_04390 37549 38127 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_04390 38210 39610 gene locus_tag LOCUS_04400 38210 39610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 39713 41218 gene locus_tag LOCUS_04410 39713 41218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 41410 41228 gene locus_tag LOCUS_04420 41410 41228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 >Feature sequence011 213 2192 gene locus_tag LOCUS_04430 213 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 2295 5195 gene locus_tag LOCUS_04440 2295 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 5317 6027 gene locus_tag LOCUS_04450 5317 6027 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_04450 6731 6033 gene locus_tag LOCUS_04460 gene phoU 6731 6033 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 protein_id gnl|my_center|LOCUS_04460 7558 6749 gene locus_tag LOCUS_04470 gene pstB 7558 6749 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930167.1 protein_id gnl|my_center|LOCUS_04470 8421 7555 gene locus_tag LOCUS_04480 gene pstA 8421 7555 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809638.1 protein_id gnl|my_center|LOCUS_04480 9357 8428 gene locus_tag LOCUS_04490 gene pstC 9357 8428 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656744.1 protein_id gnl|my_center|LOCUS_04490 9518 9378 gene locus_tag LOCUS_04500 9518 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 10687 9551 gene locus_tag LOCUS_04510 gene pstS 10687 9551 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809635.1 protein_id gnl|my_center|LOCUS_04510 12013 10787 gene locus_tag LOCUS_04520 12013 10787 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926950.1 protein_id gnl|my_center|LOCUS_04520 12307 13974 gene locus_tag LOCUS_04530 12307 13974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 16507 14030 gene locus_tag LOCUS_04540 16507 14030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 16672 17004 gene locus_tag LOCUS_04550 16672 17004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 17237 18295 gene locus_tag LOCUS_04560 17237 18295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 18309 21416 gene locus_tag LOCUS_04570 18309 21416 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942780.1 protein_id gnl|my_center|LOCUS_04570 21574 21924 gene locus_tag LOCUS_04580 21574 21924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 21921 23219 gene locus_tag LOCUS_04590 21921 23219 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_04590 24733 23312 gene locus_tag LOCUS_04600 24733 23312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 27372 24835 gene locus_tag LOCUS_04610 27372 24835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 27565 28644 gene locus_tag LOCUS_04620 27565 28644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 28758 30749 gene locus_tag LOCUS_04630 28758 30749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 33259 30746 gene locus_tag LOCUS_04640 33259 30746 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_04640 34359 33256 gene locus_tag LOCUS_04650 34359 33256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 34502 36013 gene locus_tag LOCUS_04660 34502 36013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 36104 36646 gene locus_tag LOCUS_04670 36104 36646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 37282 36866 gene locus_tag LOCUS_04680 37282 36866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 38116 37289 gene locus_tag LOCUS_04690 38116 37289 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942280.1 protein_id gnl|my_center|LOCUS_04690 41101 38123 gene locus_tag LOCUS_04700 41101 38123 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940439.1 protein_id gnl|my_center|LOCUS_04700 >Feature sequence012 2913 1489 gene locus_tag LOCUS_04710 gene xylB 2913 1489 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_04710 5793 3421 gene locus_tag LOCUS_04720 gene priA 5793 3421 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940804.1 protein_id gnl|my_center|LOCUS_04720 6697 5807 gene locus_tag LOCUS_04730 gene galU 6697 5807 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941523.1 protein_id gnl|my_center|LOCUS_04730 6951 7835 gene locus_tag LOCUS_04740 6951 7835 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_04740 7832 9442 gene locus_tag LOCUS_04750 7832 9442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 12019 9443 gene locus_tag LOCUS_04760 12019 9443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 14055 12076 gene locus_tag LOCUS_04770 14055 12076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 17486 14052 gene locus_tag LOCUS_04780 gene recB 17486 14052 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703321.1 protein_id gnl|my_center|LOCUS_04780 20886 17473 gene locus_tag LOCUS_04790 gene recC 20886 17473 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191961.1 protein_id gnl|my_center|LOCUS_04790 21064 22665 gene locus_tag LOCUS_04800 21064 22665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 23971 22700 gene locus_tag LOCUS_04810 23971 22700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 25067 23979 gene locus_tag LOCUS_04820 25067 23979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 25445 26719 gene locus_tag LOCUS_04830 25445 26719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 28222 26936 gene locus_tag LOCUS_04840 gene dnaA 28222 26936 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035259.1 protein_id gnl|my_center|LOCUS_04840 28567 30723 gene locus_tag LOCUS_04850 28567 30723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 30797 31627 gene locus_tag LOCUS_04860 30797 31627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 31624 34497 gene locus_tag LOCUS_04870 31624 34497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 34552 35838 gene locus_tag LOCUS_04880 gene tyrS 34552 35838 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332625.1 protein_id gnl|my_center|LOCUS_04880 35843 37558 gene locus_tag LOCUS_04890 35843 37558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 37563 39365 gene locus_tag LOCUS_04900 37563 39365 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814586.1 protein_id gnl|my_center|LOCUS_04900 >Feature sequence013 2912 2475 gene locus_tag LOCUS_04910 gene tolR 2912 2475 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390003.1 protein_id gnl|my_center|LOCUS_04910 3634 2927 gene locus_tag LOCUS_04920 gene tolQ 3634 2927 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_04920 4028 3714 gene locus_tag LOCUS_04930 4028 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 4457 4152 gene locus_tag LOCUS_04940 4457 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 4573 5565 gene locus_tag LOCUS_04950 4573 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 5642 6052 gene locus_tag LOCUS_04960 5642 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 7764 6079 gene locus_tag LOCUS_04970 7764 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 7836 9221 gene locus_tag LOCUS_04980 7836 9221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 9218 10444 gene locus_tag LOCUS_04990 9218 10444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 10552 21057 gene locus_tag LOCUS_05000 10552 21057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 21054 21272 gene locus_tag LOCUS_05010 21054 21272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 21354 22928 gene locus_tag LOCUS_05020 21354 22928 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_05020 22919 23677 gene locus_tag LOCUS_05030 22919 23677 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_05030 23686 25257 gene locus_tag LOCUS_05040 gene rny 23686 25257 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354863.1 protein_id gnl|my_center|LOCUS_05040 25254 25787 gene locus_tag LOCUS_05050 25254 25787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 25911 26336 gene locus_tag LOCUS_05060 25911 26336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 26386 29163 gene locus_tag LOCUS_05070 gene uvrA 26386 29163 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880409.1 protein_id gnl|my_center|LOCUS_05070 29254 29661 gene locus_tag LOCUS_05080 29254 29661 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392503.1 protein_id gnl|my_center|LOCUS_05080 29781 30341 gene locus_tag LOCUS_05090 29781 30341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 31255 30395 gene locus_tag LOCUS_05100 31255 30395 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140077.1 protein_id gnl|my_center|LOCUS_05100 32904 31252 gene locus_tag LOCUS_05110 32904 31252 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961616.1 protein_id gnl|my_center|LOCUS_05110 34277 32901 gene locus_tag LOCUS_05120 34277 32901 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_05120 35350 34274 gene locus_tag LOCUS_05130 35350 34274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 36267 35356 gene locus_tag LOCUS_05140 36267 35356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 >Feature sequence014 233 1408 gene locus_tag LOCUS_05150 233 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 3027 1510 gene locus_tag LOCUS_05160 3027 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 4366 3119 gene locus_tag LOCUS_05170 4366 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 5004 4414 gene locus_tag LOCUS_05180 5004 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 5205 5014 gene locus_tag LOCUS_05190 gene rpmB 5205 5014 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392437.1 protein_id gnl|my_center|LOCUS_05190 5454 5311 gene locus_tag LOCUS_05200 5454 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 7067 5757 gene locus_tag LOCUS_05210 7067 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 9252 7288 gene locus_tag LOCUS_05220 9252 7288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 10151 9237 gene locus_tag LOCUS_05230 10151 9237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 11023 10226 gene locus_tag LOCUS_05240 11023 10226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 12146 11028 gene locus_tag LOCUS_05250 12146 11028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 13607 12258 gene locus_tag LOCUS_05260 gene eno 13607 12258 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682247.1 protein_id gnl|my_center|LOCUS_05260 13861 17169 gene locus_tag LOCUS_05270 13861 17169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 17261 19174 gene locus_tag LOCUS_05280 17261 19174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 19235 19948 gene locus_tag LOCUS_05290 19235 19948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 19985 22405 gene locus_tag LOCUS_05300 19985 22405 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940909.1 protein_id gnl|my_center|LOCUS_05300 22481 24223 gene locus_tag LOCUS_05310 22481 24223 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403150.1 protein_id gnl|my_center|LOCUS_05310 25623 24409 gene locus_tag LOCUS_05320 25623 24409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 26368 25889 gene locus_tag LOCUS_05330 26368 25889 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814644.1 protein_id gnl|my_center|LOCUS_05330 26453 28072 gene locus_tag LOCUS_05340 26453 28072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 28180 29130 gene locus_tag LOCUS_05350 28180 29130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 29130 29909 gene locus_tag LOCUS_05360 29130 29909 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069331761.1 protein_id gnl|my_center|LOCUS_05360 29906 30898 gene locus_tag LOCUS_05370 29906 30898 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789856.1 protein_id gnl|my_center|LOCUS_05370 31035 32747 gene locus_tag LOCUS_05380 31035 32747 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230221.1 protein_id gnl|my_center|LOCUS_05380 33020 33448 gene locus_tag LOCUS_05390 33020 33448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 33564 34142 gene locus_tag LOCUS_05400 33564 34142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 >Feature sequence015 <1 1864 gene locus_tag LOCUS_05410 <1 1864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101347.1:glycosyl transferase family 1 1861 3267 gene locus_tag LOCUS_05420 1861 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 3284 4861 gene locus_tag LOCUS_05430 3284 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 4933 5490 gene locus_tag LOCUS_05440 4933 5490 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944032.1 protein_id gnl|my_center|LOCUS_05440 7360 5738 gene locus_tag LOCUS_05450 7360 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 8148 7375 gene locus_tag LOCUS_05460 8148 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 10594 8192 gene locus_tag LOCUS_05470 10594 8192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 11960 10740 gene locus_tag LOCUS_05480 11960 10740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 12587 12009 gene locus_tag LOCUS_05490 12587 12009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 14095 12584 gene locus_tag LOCUS_05500 14095 12584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 15091 14111 gene locus_tag LOCUS_05510 15091 14111 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122178.1 protein_id gnl|my_center|LOCUS_05510 15807 15094 gene locus_tag LOCUS_05520 gene tsaB 15807 15094 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_05520 17606 15810 gene locus_tag LOCUS_05530 17606 15810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 18453 17632 gene locus_tag LOCUS_05540 gene murI 18453 17632 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_05540 19246 18461 gene locus_tag LOCUS_05550 19246 18461 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022068.1 protein_id gnl|my_center|LOCUS_05550 19498 19884 gene locus_tag LOCUS_05560 19498 19884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 19984 20844 gene locus_tag LOCUS_05570 19984 20844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 20994 22928 gene locus_tag LOCUS_05580 20994 22928 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942656.1 protein_id gnl|my_center|LOCUS_05580 22962 24086 gene locus_tag LOCUS_05590 gene mraY 22962 24086 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_05590 26360 24105 gene locus_tag LOCUS_05600 26360 24105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 26638 27561 gene locus_tag LOCUS_05610 26638 27561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 27558 29099 gene locus_tag LOCUS_05620 27558 29099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 29142 31142 gene locus_tag LOCUS_05630 29142 31142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 >Feature sequence016 1442 741 gene locus_tag LOCUS_05640 1442 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 1572 3374 gene locus_tag LOCUS_05650 gene guaA 1572 3374 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234667.1 protein_id gnl|my_center|LOCUS_05650 3383 5839 gene locus_tag LOCUS_05660 3383 5839 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402856.1 protein_id gnl|my_center|LOCUS_05660 5842 7158 gene locus_tag LOCUS_05670 5842 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 7161 7865 gene locus_tag LOCUS_05680 7161 7865 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932971.1 protein_id gnl|my_center|LOCUS_05680 8182 8009 gene locus_tag LOCUS_05690 8182 8009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 8972 8187 gene locus_tag LOCUS_05700 8972 8187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 10229 8988 gene locus_tag LOCUS_05710 10229 8988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 12150 10243 gene locus_tag LOCUS_05720 12150 10243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 13096 12164 gene locus_tag LOCUS_05730 13096 12164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 13350 14111 gene locus_tag LOCUS_05740 13350 14111 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531971.1 protein_id gnl|my_center|LOCUS_05740 14114 14869 gene locus_tag LOCUS_05750 14114 14869 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261734.1 protein_id gnl|my_center|LOCUS_05750 14898 16694 gene locus_tag LOCUS_05760 14898 16694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 16725 17951 gene locus_tag LOCUS_05770 16725 17951 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 protein_id gnl|my_center|LOCUS_05770 17978 18709 gene locus_tag LOCUS_05780 17978 18709 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_05780 18706 20151 gene locus_tag LOCUS_05790 18706 20151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 20220 20564 gene locus_tag LOCUS_05800 20220 20564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 20536 22338 gene locus_tag LOCUS_05810 20536 22338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 22343 23359 gene locus_tag LOCUS_05820 22343 23359 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417097.1 protein_id gnl|my_center|LOCUS_05820 23454 24953 gene locus_tag LOCUS_05830 gene malQ 23454 24953 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056555.1 protein_id gnl|my_center|LOCUS_05830 25549 24935 gene locus_tag LOCUS_05840 25549 24935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 25651 26877 gene locus_tag LOCUS_05850 gene ftsW 25651 26877 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545997.1 protein_id gnl|my_center|LOCUS_05850 26912 27778 gene locus_tag LOCUS_05860 26912 27778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 27969 29627 gene locus_tag LOCUS_05870 27969 29627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 29654 30556 gene locus_tag LOCUS_05880 gene cysK 29654 30556 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence017 155 1918 gene locus_tag LOCUS_05890 155 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 3065 1926 gene locus_tag LOCUS_05900 3065 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 3200 3589 gene locus_tag LOCUS_05910 3200 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 3586 3957 gene locus_tag LOCUS_05920 3586 3957 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430159.1 protein_id gnl|my_center|LOCUS_05920 4060 4611 gene locus_tag LOCUS_05930 4060 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 5314 4559 gene locus_tag LOCUS_05940 5314 4559 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478451.1 protein_id gnl|my_center|LOCUS_05940 5418 8132 gene locus_tag LOCUS_05950 5418 8132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 8257 9918 gene locus_tag LOCUS_05960 8257 9918 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456248.1 protein_id gnl|my_center|LOCUS_05960 11106 9919 gene locus_tag LOCUS_05970 gene thiI 11106 9919 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872662.1 protein_id gnl|my_center|LOCUS_05970 12097 11129 gene locus_tag LOCUS_05980 gene arcC 12097 11129 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251108.1 protein_id gnl|my_center|LOCUS_05980 12902 12153 gene locus_tag LOCUS_05990 12902 12153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 13496 12912 gene locus_tag LOCUS_06000 13496 12912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 14085 13525 gene locus_tag LOCUS_06010 14085 13525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 14363 14854 gene locus_tag LOCUS_06020 14363 14854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 15050 15475 gene locus_tag LOCUS_06030 15050 15475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 15652 16965 gene locus_tag LOCUS_06040 15652 16965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 17961 17020 gene locus_tag LOCUS_06050 17961 17020 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258828.1 protein_id gnl|my_center|LOCUS_06050 19214 17958 gene locus_tag LOCUS_06060 gene glgC 19214 17958 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227648.1 protein_id gnl|my_center|LOCUS_06060 20006 19335 gene locus_tag LOCUS_06070 20006 19335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 20638 20006 gene locus_tag LOCUS_06080 20638 20006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 22149 20644 gene locus_tag LOCUS_06090 22149 20644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 23154 22294 gene locus_tag LOCUS_06100 23154 22294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 23704 23147 gene locus_tag LOCUS_06110 23704 23147 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791692.1 protein_id gnl|my_center|LOCUS_06110 24528 23701 gene locus_tag LOCUS_06120 24528 23701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 26055 24625 gene locus_tag LOCUS_06130 26055 24625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 28206 26242 gene locus_tag LOCUS_06140 gene pepF 28206 26242 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003348.1 protein_id gnl|my_center|LOCUS_06140 28382 28930 gene locus_tag LOCUS_06150 28382 28930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 29019 29795 gene locus_tag LOCUS_06160 29019 29795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 >Feature sequence018 550 1110 gene locus_tag LOCUS_06170 550 1110 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927009.1 protein_id gnl|my_center|LOCUS_06170 1247 1741 gene locus_tag LOCUS_06180 1247 1741 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966733.1 protein_id gnl|my_center|LOCUS_06180 2425 1910 gene locus_tag LOCUS_06190 2425 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 4279 2471 gene locus_tag LOCUS_06200 4279 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 4893 4276 gene locus_tag LOCUS_06210 4893 4276 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_06210 6204 4897 gene locus_tag LOCUS_06220 6204 4897 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556695.1 protein_id gnl|my_center|LOCUS_06220 7975 6197 gene locus_tag LOCUS_06230 7975 6197 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_06230 8682 7972 gene locus_tag LOCUS_06240 8682 7972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 9316 8693 gene locus_tag LOCUS_06250 9316 8693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 10915 9473 gene locus_tag LOCUS_06260 gene creD 10915 9473 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113266.1 protein_id gnl|my_center|LOCUS_06260 12860 11256 gene locus_tag LOCUS_06270 gene nadB 12860 11256 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_06270 12901 13905 gene locus_tag LOCUS_06280 gene lgt 12901 13905 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_06280 13902 14414 gene locus_tag LOCUS_06290 13902 14414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 14416 17616 gene locus_tag LOCUS_06300 14416 17616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 18624 18037 gene locus_tag LOCUS_06310 18624 18037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 19032 18799 gene locus_tag LOCUS_06320 19032 18799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 18914 20254 gene locus_tag LOCUS_06330 18914 20254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 20251 21564 gene locus_tag LOCUS_06340 20251 21564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 21774 22022 gene locus_tag LOCUS_06350 21774 22022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 22219 22842 gene locus_tag LOCUS_06360 22219 22842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 22839 23111 gene locus_tag LOCUS_06370 22839 23111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 23108 24832 gene locus_tag LOCUS_06380 23108 24832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 24829 25227 gene locus_tag LOCUS_06390 24829 25227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 25224 25499 gene locus_tag LOCUS_06400 25224 25499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 25593 25832 gene locus_tag LOCUS_06410 25593 25832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 25825 26148 gene locus_tag LOCUS_06420 25825 26148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 26153 26392 gene locus_tag LOCUS_06430 26153 26392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 26392 26790 gene locus_tag LOCUS_06440 26392 26790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 26792 27013 gene locus_tag LOCUS_06450 26792 27013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 27088 28227 gene locus_tag LOCUS_06460 27088 28227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 >Feature sequence019 845 2149 gene locus_tag LOCUS_06470 845 2149 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230479.1 protein_id gnl|my_center|LOCUS_06470 2181 3320 gene locus_tag LOCUS_06480 2181 3320 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_06480 5407 3392 gene locus_tag LOCUS_06490 5407 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 6518 5520 gene locus_tag LOCUS_06500 6518 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 8618 6531 gene locus_tag LOCUS_06510 8618 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 9116 8679 gene locus_tag LOCUS_06520 9116 8679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 9272 9619 gene locus_tag LOCUS_06530 9272 9619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 9616 10713 gene locus_tag LOCUS_06540 9616 10713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 10713 11018 gene locus_tag LOCUS_06550 10713 11018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 11193 12569 gene locus_tag LOCUS_06560 11193 12569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 13543 12614 gene locus_tag LOCUS_06570 13543 12614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 14295 13540 gene locus_tag LOCUS_06580 14295 13540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 17028 14395 gene locus_tag LOCUS_06590 17028 14395 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_06590 17368 17093 gene locus_tag LOCUS_06600 17368 17093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 17517 17762 gene locus_tag LOCUS_06610 17517 17762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 17798 19462 gene locus_tag LOCUS_06620 17798 19462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 21263 19464 gene locus_tag LOCUS_06630 21263 19464 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416624.1 protein_id gnl|my_center|LOCUS_06630 21463 21538 gene locus_tag LOCUS_t00070 21463 21538 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 21699 22826 gene locus_tag LOCUS_06640 21699 22826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 23752 22874 gene locus_tag LOCUS_06650 23752 22874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 24448 24014 gene locus_tag LOCUS_06660 24448 24014 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039646035.1 protein_id gnl|my_center|LOCUS_06660 25321 24518 gene locus_tag LOCUS_06670 25321 24518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_06670 28053 25474 gene locus_tag LOCUS_06680 28053 25474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 >Feature sequence020 2366 171 gene locus_tag LOCUS_06690 2366 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 2560 3669 gene locus_tag LOCUS_06700 2560 3669 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_06700 3704 4228 gene locus_tag LOCUS_06710 3704 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 4865 4164 gene locus_tag LOCUS_06720 4865 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 5264 7819 gene locus_tag LOCUS_06730 5264 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 8216 10270 gene locus_tag LOCUS_06740 8216 10270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 10273 11484 gene locus_tag LOCUS_06750 10273 11484 CDS product IQ calmodulin-binding- domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368619.1 protein_id gnl|my_center|LOCUS_06750 11728 13113 gene locus_tag LOCUS_06760 11728 13113 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530049.1 protein_id gnl|my_center|LOCUS_06760 13110 13706 gene locus_tag LOCUS_06770 13110 13706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 15393 13747 gene locus_tag LOCUS_06780 15393 13747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 15502 16452 gene locus_tag LOCUS_06790 15502 16452 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360255.1 protein_id gnl|my_center|LOCUS_06790 16449 17162 gene locus_tag LOCUS_06800 16449 17162 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_06800 17290 17934 gene locus_tag LOCUS_06810 17290 17934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 18897 18115 gene locus_tag LOCUS_06820 18897 18115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 19984 19115 gene locus_tag LOCUS_06830 19984 19115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 21313 19997 gene locus_tag LOCUS_06840 21313 19997 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448293.1 protein_id gnl|my_center|LOCUS_06840 21481 23817 gene locus_tag LOCUS_06850 21481 23817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 23905 25416 gene locus_tag LOCUS_06860 23905 25416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 >Feature sequence021 2328 19 gene locus_tag LOCUS_06870 2328 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 3172 2336 gene locus_tag LOCUS_06880 3172 2336 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943921.1 protein_id gnl|my_center|LOCUS_06880 3286 4839 gene locus_tag LOCUS_06890 gene rpoN 3286 4839 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_06890 4917 5516 gene locus_tag LOCUS_06900 gene raiA 4917 5516 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_06900 5789 7429 gene locus_tag LOCUS_06910 5789 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 7549 8283 gene locus_tag LOCUS_06920 7549 8283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 8296 8838 gene locus_tag LOCUS_06930 8296 8838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 8835 9986 gene locus_tag LOCUS_06940 8835 9986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 10154 10516 gene locus_tag LOCUS_06950 10154 10516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 12574 10661 gene locus_tag LOCUS_06960 gene mnmG 12574 10661 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948575.1 protein_id gnl|my_center|LOCUS_06960 14103 12571 gene locus_tag LOCUS_06970 14103 12571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 15366 14113 gene locus_tag LOCUS_06980 15366 14113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 15614 16051 gene locus_tag LOCUS_06990 15614 16051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 16164 16850 gene locus_tag LOCUS_07000 16164 16850 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328012.1 protein_id gnl|my_center|LOCUS_07000 16857 17972 gene locus_tag LOCUS_07010 16857 17972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 18042 19442 gene locus_tag LOCUS_07020 18042 19442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 19704 19943 gene locus_tag LOCUS_07030 19704 19943 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_07030 20038 21507 gene locus_tag LOCUS_07040 20038 21507 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393158.1 protein_id gnl|my_center|LOCUS_07040 21665 22870 gene locus_tag LOCUS_07050 21665 22870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 24708 22885 gene locus_tag LOCUS_07060 gene typA 24708 22885 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_07060 26753 24858 gene locus_tag LOCUS_07070 26753 24858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 >Feature sequence022 1792 569 gene locus_tag LOCUS_07080 1792 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 3215 1917 gene locus_tag LOCUS_07090 3215 1917 CDS product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706316.1 protein_id gnl|my_center|LOCUS_07090 6407 3348 gene locus_tag LOCUS_07100 6407 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 7181 6570 gene locus_tag LOCUS_07110 7181 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 7306 7998 gene locus_tag LOCUS_07120 7306 7998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 8112 8828 gene locus_tag LOCUS_07130 8112 8828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 10196 8874 gene locus_tag LOCUS_07140 10196 8874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 11074 10244 gene locus_tag LOCUS_07150 11074 10244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 12012 11089 gene locus_tag LOCUS_07160 12012 11089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 13705 12023 gene locus_tag LOCUS_07170 gene ettA 13705 12023 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_07170 14412 13831 gene locus_tag LOCUS_07180 14412 13831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 18157 14642 gene locus_tag LOCUS_07190 18157 14642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 18282 19124 gene locus_tag LOCUS_07200 18282 19124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 19121 21013 gene locus_tag LOCUS_07210 19121 21013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 21085 21525 gene locus_tag LOCUS_07220 21085 21525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 23360 21561 gene locus_tag LOCUS_07230 23360 21561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 23532 26891 gene locus_tag LOCUS_07240 23532 26891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 27056 27847 gene locus_tag LOCUS_07250 27056 27847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence023 <1 712 gene locus_tag LOCUS_07260 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258200.1:chromosome condensation regulator RCC1 728 4249 gene locus_tag LOCUS_07270 728 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 4257 5111 gene locus_tag LOCUS_07280 4257 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 7751 5664 gene locus_tag LOCUS_07290 7751 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 12085 7883 gene locus_tag LOCUS_07300 12085 7883 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200903603.1 protein_id gnl|my_center|LOCUS_07300 12980 12222 gene locus_tag LOCUS_07310 12980 12222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 13253 12987 gene locus_tag LOCUS_07320 13253 12987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 13932 13258 gene locus_tag LOCUS_07330 gene bscR 13932 13258 CDS product SctR family type III secretion system export apparatus subunit BscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809905.1 protein_id gnl|my_center|LOCUS_07330 14249 13929 gene locus_tag LOCUS_07340 14249 13929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 15019 14246 gene locus_tag LOCUS_07350 15019 14246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 15866 15063 gene locus_tag LOCUS_07360 15866 15063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 17085 15868 gene locus_tag LOCUS_07370 gene hemW 17085 15868 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729894.1 protein_id gnl|my_center|LOCUS_07370 17598 17137 gene locus_tag LOCUS_07380 17598 17137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 17699 18823 gene locus_tag LOCUS_07390 17699 18823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 18826 21135 gene locus_tag LOCUS_07400 gene topA 18826 21135 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940644.1 protein_id gnl|my_center|LOCUS_07400 21122 22636 gene locus_tag LOCUS_07410 gene trmFO 21122 22636 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_07410 22633 23247 gene locus_tag LOCUS_07420 22633 23247 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_07420 23240 23953 gene locus_tag LOCUS_07430 23240 23953 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_07430 23954 24679 gene locus_tag LOCUS_07440 23954 24679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 24676 25803 gene locus_tag LOCUS_07450 24676 25803 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878191.1 protein_id gnl|my_center|LOCUS_07450 25954 26331 gene locus_tag LOCUS_07460 25954 26331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence024 127 53 gene locus_tag LOCUS_t00080 127 53 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 208 135 gene locus_tag LOCUS_t00090 208 135 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1689 349 gene locus_tag LOCUS_07470 gene glmU 1689 349 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015965.1 protein_id gnl|my_center|LOCUS_07470 1877 2395 gene locus_tag LOCUS_07480 1877 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 2388 3692 gene locus_tag LOCUS_07490 gene rimO 2388 3692 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_07490 3797 4561 gene locus_tag LOCUS_07500 3797 4561 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 protein_id gnl|my_center|LOCUS_07500 4620 5168 gene locus_tag LOCUS_07510 4620 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 5200 6750 gene locus_tag LOCUS_07520 5200 6750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 6750 7799 gene locus_tag LOCUS_07530 gene recA 6750 7799 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537720.1 protein_id gnl|my_center|LOCUS_07530 7822 10230 gene locus_tag LOCUS_07540 7822 10230 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946660.1 protein_id gnl|my_center|LOCUS_07540 10395 12254 gene locus_tag LOCUS_07550 10395 12254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 12265 13179 gene locus_tag LOCUS_07560 12265 13179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 13803 13360 gene locus_tag LOCUS_07570 13803 13360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 14571 13951 gene locus_tag LOCUS_07580 gene wrbA 14571 13951 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941470.1 protein_id gnl|my_center|LOCUS_07580 15558 14689 gene locus_tag LOCUS_07590 15558 14689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 15704 15631 gene locus_tag LOCUS_t00100 15704 15631 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 15786 15712 gene locus_tag LOCUS_t00110 15786 15712 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16654 15878 gene locus_tag LOCUS_07600 16654 15878 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_07600 17522 16641 gene locus_tag LOCUS_07610 17522 16641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 18261 17479 gene locus_tag LOCUS_07620 18261 17479 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_07620 18905 18267 gene locus_tag LOCUS_07630 18905 18267 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_07630 19832 19005 gene locus_tag LOCUS_07640 19832 19005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 20348 19848 gene locus_tag LOCUS_07650 20348 19848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 22306 20423 gene locus_tag LOCUS_07660 22306 20423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 22445 23395 gene locus_tag LOCUS_07670 22445 23395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008194003.1 protein_id gnl|my_center|LOCUS_07670 23550 25445 gene locus_tag LOCUS_07680 gene dnaK 23550 25445 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391302.1 protein_id gnl|my_center|LOCUS_07680 >Feature sequence025 1934 2644 gene locus_tag LOCUS_07690 1934 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 2660 3505 gene locus_tag LOCUS_07700 gene nadC 2660 3505 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067615902.1 protein_id gnl|my_center|LOCUS_07700 3502 5208 gene locus_tag LOCUS_07710 3502 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 5447 6241 gene locus_tag LOCUS_07720 5447 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 10034 6354 gene locus_tag LOCUS_07730 10034 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 10818 10132 gene locus_tag LOCUS_07740 gene queC 10818 10132 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_07740 12735 10840 gene locus_tag LOCUS_07750 12735 10840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 14289 12802 gene locus_tag LOCUS_07760 gene gcvPB 14289 12802 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_07760 15652 14291 gene locus_tag LOCUS_07770 gene gcvPA 15652 14291 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390797.1 protein_id gnl|my_center|LOCUS_07770 16108 15722 gene locus_tag LOCUS_07780 gene gcvH 16108 15722 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903167.1 protein_id gnl|my_center|LOCUS_07780 17280 16168 gene locus_tag LOCUS_07790 gene gcvT 17280 16168 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_07790 18017 17472 gene locus_tag LOCUS_07800 18017 17472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 18818 18051 gene locus_tag LOCUS_07810 18818 18051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 19263 18889 gene locus_tag LOCUS_07820 gene dksA 19263 18889 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_07820 19731 19384 gene locus_tag LOCUS_07830 19731 19384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 19845 21479 gene locus_tag LOCUS_07840 19845 21479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 21607 22698 gene locus_tag LOCUS_07850 21607 22698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 23304 22765 gene locus_tag LOCUS_07860 23304 22765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 23804 23328 gene locus_tag LOCUS_07870 gene smpB 23804 23328 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971340.1 protein_id gnl|my_center|LOCUS_07870 25037 23826 gene locus_tag LOCUS_07880 25037 23826 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933267.1 protein_id gnl|my_center|LOCUS_07880 25137 25227 gene locus_tag LOCUS_t00120 25137 25227 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence026 1523 513 gene locus_tag LOCUS_07890 1523 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 3689 1629 gene locus_tag LOCUS_07900 3689 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 4027 4215 gene locus_tag LOCUS_07910 4027 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 4284 7424 gene locus_tag LOCUS_07920 gene ileS 4284 7424 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680710.1 protein_id gnl|my_center|LOCUS_07920 7440 8006 gene locus_tag LOCUS_07930 7440 8006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 8015 8938 gene locus_tag LOCUS_07940 8015 8938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 8956 9477 gene locus_tag LOCUS_07950 8956 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 9531 10427 gene locus_tag LOCUS_07960 9531 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 11518 10469 gene locus_tag LOCUS_07970 11518 10469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 15153 11533 gene locus_tag LOCUS_07980 15153 11533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 15734 15147 gene locus_tag LOCUS_07990 15734 15147 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_07990 17344 15731 gene locus_tag LOCUS_08000 17344 15731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 17487 17401 gene locus_tag LOCUS_t00130 17487 17401 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18088 18285 gene locus_tag LOCUS_08010 gene rpmI 18088 18285 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297539.1 protein_id gnl|my_center|LOCUS_08010 18307 18651 gene locus_tag LOCUS_08020 gene rplT 18307 18651 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830839.1 protein_id gnl|my_center|LOCUS_08020 18718 19023 gene locus_tag LOCUS_08030 18718 19023 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_08030 19049 19402 gene locus_tag LOCUS_08040 19049 19402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 19424 19499 gene locus_tag LOCUS_t00140 19424 19499 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 19568 19917 gene locus_tag LOCUS_tm00010 19568 19917 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 19921 21237 gene locus_tag LOCUS_08050 19921 21237 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038876.1 protein_id gnl|my_center|LOCUS_08050 21225 24560 gene locus_tag LOCUS_08060 21225 24560 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038877.1 protein_id gnl|my_center|LOCUS_08060 >Feature sequence027 356 3 gene locus_tag LOCUS_08070 356 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 562 4857 gene locus_tag LOCUS_08080 562 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 5044 7584 gene locus_tag LOCUS_08090 5044 7584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 7670 10267 gene locus_tag LOCUS_08100 7670 10267 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_08100 10282 12663 gene locus_tag LOCUS_08110 10282 12663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 12671 13597 gene locus_tag LOCUS_08120 12671 13597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 13594 14331 gene locus_tag LOCUS_08130 13594 14331 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250288.1 protein_id gnl|my_center|LOCUS_08130 14337 15614 gene locus_tag LOCUS_08140 14337 15614 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081357.1 protein_id gnl|my_center|LOCUS_08140 15708 18827 gene locus_tag LOCUS_08150 15708 18827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 18994 20934 gene locus_tag LOCUS_08160 18994 20934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 22927 20951 gene locus_tag LOCUS_08170 22927 20951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 23145 23843 gene locus_tag LOCUS_08180 23145 23843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 23989 25872 gene locus_tag LOCUS_08190 23989 25872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 >Feature sequence028 2519 993 gene locus_tag LOCUS_08200 2519 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 4626 2602 gene locus_tag LOCUS_08210 4626 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 7263 4651 gene locus_tag LOCUS_08220 7263 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 8688 7309 gene locus_tag LOCUS_08230 8688 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 9537 8695 gene locus_tag LOCUS_08240 9537 8695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 9770 10432 gene locus_tag LOCUS_08250 9770 10432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 10416 11846 gene locus_tag LOCUS_08260 gene nhaC 10416 11846 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 protein_id gnl|my_center|LOCUS_08260 11980 12495 gene locus_tag LOCUS_08270 11980 12495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 12696 14084 gene locus_tag LOCUS_08280 12696 14084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 14081 15214 gene locus_tag LOCUS_08290 14081 15214 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869500.1 protein_id gnl|my_center|LOCUS_08290 15211 16011 gene locus_tag LOCUS_08300 15211 16011 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879451.1 protein_id gnl|my_center|LOCUS_08300 16008 16787 gene locus_tag LOCUS_08310 16008 16787 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_08310 16789 17520 gene locus_tag LOCUS_08320 16789 17520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 17521 18285 gene locus_tag LOCUS_08330 17521 18285 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061125.1 protein_id gnl|my_center|LOCUS_08330 20321 18306 gene locus_tag LOCUS_08340 20321 18306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 20572 21501 gene locus_tag LOCUS_08350 20572 21501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 22013 21561 gene locus_tag LOCUS_08360 22013 21561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 22374 22039 gene locus_tag LOCUS_08370 22374 22039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 22726 22388 gene locus_tag LOCUS_08380 22726 22388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 22938 24956 gene locus_tag LOCUS_08390 22938 24956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 >Feature sequence029 930 1709 gene locus_tag LOCUS_08400 930 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 1750 2586 gene locus_tag LOCUS_08410 1750 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 2558 4069 gene locus_tag LOCUS_08420 gene xseA 2558 4069 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797807.1 protein_id gnl|my_center|LOCUS_08420 4066 4734 gene locus_tag LOCUS_08430 4066 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 4867 4792 gene locus_tag LOCUS_t00150 4867 4792 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5310 4960 gene locus_tag LOCUS_08440 5310 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 6647 5322 gene locus_tag LOCUS_08450 6647 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 6931 6644 gene locus_tag LOCUS_08460 6931 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 7198 8247 gene locus_tag LOCUS_08470 7198 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 8244 9140 gene locus_tag LOCUS_08480 8244 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 9177 9581 gene locus_tag LOCUS_08490 9177 9581 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_08490 9850 11382 gene locus_tag LOCUS_08500 9850 11382 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_08500 11673 12878 gene locus_tag LOCUS_08510 11673 12878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 12920 13603 gene locus_tag LOCUS_08520 12920 13603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 13596 16010 gene locus_tag LOCUS_08530 13596 16010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 16007 17365 gene locus_tag LOCUS_08540 16007 17365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 17542 18345 gene locus_tag LOCUS_08550 17542 18345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 18342 20177 gene locus_tag LOCUS_08560 18342 20177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 20208 21230 gene locus_tag LOCUS_08570 gene ansA 20208 21230 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722312.1 protein_id gnl|my_center|LOCUS_08570 21240 21977 gene locus_tag LOCUS_08580 gene rnc 21240 21977 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043238.1 protein_id gnl|my_center|LOCUS_08580 21974 23653 gene locus_tag LOCUS_08590 21974 23653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 23653 24801 gene locus_tag LOCUS_08600 23653 24801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 25519 24809 gene locus_tag LOCUS_08610 25519 24809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 >Feature sequence030 1572 373 gene locus_tag LOCUS_08620 1572 373 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707887.1 protein_id gnl|my_center|LOCUS_08620 2534 1668 gene locus_tag LOCUS_08630 gene prmC 2534 1668 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_08630 3514 2531 gene locus_tag LOCUS_08640 3514 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 3829 4815 gene locus_tag LOCUS_08650 3829 4815 CDS product lipin/Ned1/Smp2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966221.1 protein_id gnl|my_center|LOCUS_08650 4965 6662 gene locus_tag LOCUS_08660 4965 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 6703 7239 gene locus_tag LOCUS_08670 6703 7239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 7332 8237 gene locus_tag LOCUS_08680 7332 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 8242 8865 gene locus_tag LOCUS_08690 gene tmk 8242 8865 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762936.1 protein_id gnl|my_center|LOCUS_08690 8870 9673 gene locus_tag LOCUS_08700 8870 9673 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880179.1 protein_id gnl|my_center|LOCUS_08700 9750 10529 gene locus_tag LOCUS_08710 9750 10529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 10692 11207 gene locus_tag LOCUS_08720 10692 11207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 11204 12520 gene locus_tag LOCUS_08730 11204 12520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 12517 15645 gene locus_tag LOCUS_08740 12517 15645 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_08740 15642 17264 gene locus_tag LOCUS_08750 15642 17264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 17307 18017 gene locus_tag LOCUS_08760 gene ftsE 17307 18017 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632750.1 protein_id gnl|my_center|LOCUS_08760 18043 18879 gene locus_tag LOCUS_08770 18043 18879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 19044 19982 gene locus_tag LOCUS_08780 19044 19982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 20006 22237 gene locus_tag LOCUS_08790 20006 22237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 23621 22281 gene locus_tag LOCUS_08800 23621 22281 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 protein_id gnl|my_center|LOCUS_08800 24459 23749 gene locus_tag LOCUS_08810 24459 23749 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814072.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence031 86 943 gene locus_tag LOCUS_08820 86 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 2585 948 gene locus_tag LOCUS_08830 2585 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 2742 3017 gene locus_tag LOCUS_08840 2742 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 3591 3094 gene locus_tag LOCUS_08850 3591 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 3750 5402 gene locus_tag LOCUS_08860 3750 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 5505 5429 gene locus_tag LOCUS_t00160 5505 5429 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 5627 6511 gene locus_tag LOCUS_08870 5627 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 6516 7304 gene locus_tag LOCUS_08880 6516 7304 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_08880 7288 8130 gene locus_tag LOCUS_08890 gene tatC 7288 8130 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039160.1 protein_id gnl|my_center|LOCUS_08890 8211 9026 gene locus_tag LOCUS_08900 8211 9026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 9064 11580 gene locus_tag LOCUS_08910 9064 11580 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545339.1 protein_id gnl|my_center|LOCUS_08910 11577 11972 gene locus_tag LOCUS_08920 11577 11972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 12117 13415 gene locus_tag LOCUS_08930 12117 13415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 13434 15167 gene locus_tag LOCUS_08940 13434 15167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 15192 15392 gene locus_tag LOCUS_08950 15192 15392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 15515 16366 gene locus_tag LOCUS_08960 15515 16366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 16430 17641 gene locus_tag LOCUS_08970 16430 17641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 18574 17669 gene locus_tag LOCUS_08980 18574 17669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 19008 18571 gene locus_tag LOCUS_08990 19008 18571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 20196 19024 gene locus_tag LOCUS_09000 20196 19024 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927165.1 protein_id gnl|my_center|LOCUS_09000 20910 22979 gene locus_tag LOCUS_09010 20910 22979 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_09010 22976 23167 gene locus_tag LOCUS_09020 22976 23167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 23168 23863 gene locus_tag LOCUS_09030 23168 23863 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869386.1 protein_id gnl|my_center|LOCUS_09030 23978 24640 gene locus_tag LOCUS_09040 23978 24640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 >Feature sequence032 3213 1966 gene locus_tag LOCUS_09050 3213 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 3711 5051 gene locus_tag LOCUS_09060 3711 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 5060 6469 gene locus_tag LOCUS_09070 5060 6469 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804150.1 protein_id gnl|my_center|LOCUS_09070 6591 7391 gene locus_tag LOCUS_09080 6591 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 7764 8741 gene locus_tag LOCUS_09090 gene trxB 7764 8741 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_09090 10342 8738 gene locus_tag LOCUS_09100 10342 8738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 10695 11081 gene locus_tag LOCUS_09110 gene trxA 10695 11081 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784741.1 protein_id gnl|my_center|LOCUS_09110 11146 12549 gene locus_tag LOCUS_09120 gene murD 11146 12549 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_09120 12546 14051 gene locus_tag LOCUS_09130 12546 14051 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_09130 14045 15142 gene locus_tag LOCUS_09140 14045 15142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 15152 15751 gene locus_tag LOCUS_09150 15152 15751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 16753 15842 gene locus_tag LOCUS_09160 16753 15842 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942056.1 protein_id gnl|my_center|LOCUS_09160 17657 16737 gene locus_tag LOCUS_09170 17657 16737 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_09170 18544 17654 gene locus_tag LOCUS_09180 18544 17654 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_09180 18900 18541 gene locus_tag LOCUS_09190 18900 18541 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986701.1 protein_id gnl|my_center|LOCUS_09190 19238 18897 gene locus_tag LOCUS_09200 19238 18897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 19662 19240 gene locus_tag LOCUS_09210 19662 19240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 21210 19849 gene locus_tag LOCUS_09220 gene orpR 21210 19849 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_09220 22151 21291 gene locus_tag LOCUS_09230 22151 21291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 23980 22151 gene locus_tag LOCUS_09240 23980 22151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 25129 24038 gene locus_tag LOCUS_09250 25129 24038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 >Feature sequence033 55 1392 gene locus_tag LOCUS_09260 55 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 2375 1464 gene locus_tag LOCUS_09270 2375 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 3742 2372 gene locus_tag LOCUS_09280 3742 2372 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_09280 5692 3752 gene locus_tag LOCUS_09290 5692 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 6451 5777 gene locus_tag LOCUS_09300 6451 5777 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139327955.1 protein_id gnl|my_center|LOCUS_09300 6658 8802 gene locus_tag LOCUS_09310 6658 8802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 9682 8807 gene locus_tag LOCUS_09320 9682 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 9853 9779 gene locus_tag LOCUS_t00170 9853 9779 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10576 9908 gene locus_tag LOCUS_09330 10576 9908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 10750 13692 gene locus_tag LOCUS_09340 10750 13692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 14996 13734 gene locus_tag LOCUS_09350 14996 13734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 16727 14997 gene locus_tag LOCUS_09360 gene sppA 16727 14997 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898564.1 protein_id gnl|my_center|LOCUS_09360 19091 16914 gene locus_tag LOCUS_09370 19091 16914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 19325 19119 gene locus_tag LOCUS_09380 19325 19119 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938662.1 protein_id gnl|my_center|LOCUS_09380 20844 19330 gene locus_tag LOCUS_09390 20844 19330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 20767 20973 gene locus_tag LOCUS_09400 20767 20973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 21776 21018 gene locus_tag LOCUS_09410 21776 21018 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101477.1 protein_id gnl|my_center|LOCUS_09410 24068 21888 gene locus_tag LOCUS_09420 24068 21888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence034 4430 1800 gene locus_tag LOCUS_09430 4430 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 4796 7351 gene locus_tag LOCUS_09440 gene leuS 4796 7351 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938492.1 protein_id gnl|my_center|LOCUS_09440 7432 7821 gene locus_tag LOCUS_09450 gene mutT 7432 7821 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459573.1 protein_id gnl|my_center|LOCUS_09450 7884 9341 gene locus_tag LOCUS_09460 7884 9341 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_09460 9349 10230 gene locus_tag LOCUS_09470 9349 10230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 13322 10383 gene locus_tag LOCUS_09480 13322 10383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 14001 13471 gene locus_tag LOCUS_09490 14001 13471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 15555 14122 gene locus_tag LOCUS_09500 15555 14122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 16542 15592 gene locus_tag LOCUS_09510 16542 15592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 18436 16568 gene locus_tag LOCUS_09520 18436 16568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 18658 19428 gene locus_tag LOCUS_09530 18658 19428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 19519 21261 gene locus_tag LOCUS_09540 gene dnaK 19519 21261 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_09540 21265 22257 gene locus_tag LOCUS_09550 21265 22257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 22254 22907 gene locus_tag LOCUS_09560 22254 22907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 22956 24167 gene locus_tag LOCUS_09570 22956 24167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence035 104 943 gene locus_tag LOCUS_09580 104 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 975 2339 gene locus_tag LOCUS_09590 975 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 2487 3542 gene locus_tag LOCUS_09600 2487 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 4139 3591 gene locus_tag LOCUS_09610 gene amrA 4139 3591 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938040.1 protein_id gnl|my_center|LOCUS_09610 6130 4136 gene locus_tag LOCUS_09620 6130 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 6731 6132 gene locus_tag LOCUS_09630 6731 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 7515 6718 gene locus_tag LOCUS_09640 gene truA 7515 6718 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_09640 8246 7527 gene locus_tag LOCUS_09650 8246 7527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 9525 8239 gene locus_tag LOCUS_09660 9525 8239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 9753 10673 gene locus_tag LOCUS_09670 9753 10673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 11705 10704 gene locus_tag LOCUS_09680 11705 10704 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919044.1 protein_id gnl|my_center|LOCUS_09680 12050 12634 gene locus_tag LOCUS_09690 12050 12634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 14397 12631 gene locus_tag LOCUS_09700 14397 12631 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943502.1 protein_id gnl|my_center|LOCUS_09700 14516 14442 gene locus_tag LOCUS_t00180 14516 14442 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14697 14769 gene locus_tag LOCUS_t00190 14697 14769 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 14904 16232 gene locus_tag LOCUS_09710 14904 16232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 16393 16761 gene locus_tag LOCUS_09720 16393 16761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 16758 18197 gene locus_tag LOCUS_09730 16758 18197 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_09730 18206 19084 gene locus_tag LOCUS_09740 18206 19084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 19084 21624 gene locus_tag LOCUS_09750 19084 21624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 21777 22232 gene locus_tag LOCUS_09760 gene nuoE 21777 22232 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584034.1 protein_id gnl|my_center|LOCUS_09760 22245 23387 gene locus_tag LOCUS_09770 gene nuoF 22245 23387 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969255.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence036 224 655 gene locus_tag LOCUS_09780 224 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 3236 675 gene locus_tag LOCUS_09790 3236 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 3459 4778 gene locus_tag LOCUS_09800 3459 4778 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296689.1 protein_id gnl|my_center|LOCUS_09800 4903 6198 gene locus_tag LOCUS_09810 4903 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 6217 8583 gene locus_tag LOCUS_09820 gene rnr 6217 8583 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942131.1 protein_id gnl|my_center|LOCUS_09820 8590 9615 gene locus_tag LOCUS_09830 8590 9615 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_09830 9716 11101 gene locus_tag LOCUS_09840 9716 11101 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107821.1 protein_id gnl|my_center|LOCUS_09840 12223 11102 gene locus_tag LOCUS_09850 12223 11102 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545564.1 protein_id gnl|my_center|LOCUS_09850 13181 12396 gene locus_tag LOCUS_09860 13181 12396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 16737 13432 gene locus_tag LOCUS_09870 gene ygfK 16737 13432 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869176.1 protein_id gnl|my_center|LOCUS_09870 17101 16829 gene locus_tag LOCUS_09880 17101 16829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 17818 17144 gene locus_tag LOCUS_09890 17818 17144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 20377 17867 gene locus_tag LOCUS_09900 20377 17867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 20376 20939 gene locus_tag LOCUS_09910 20376 20939 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_09910 21067 23028 gene locus_tag LOCUS_09920 21067 23028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 >Feature sequence037 687 25 gene locus_tag LOCUS_09930 687 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 1730 738 gene locus_tag LOCUS_09940 1730 738 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417210.1 protein_id gnl|my_center|LOCUS_09940 1922 3187 gene locus_tag LOCUS_09950 1922 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 3220 4389 gene locus_tag LOCUS_09960 3220 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 6242 4473 gene locus_tag LOCUS_09970 6242 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 8350 6377 gene locus_tag LOCUS_09980 8350 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 8638 8892 gene locus_tag LOCUS_09990 gene rpsP 8638 8892 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071566.1 protein_id gnl|my_center|LOCUS_09990 8909 9442 gene locus_tag LOCUS_10000 gene rimM 8909 9442 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142459073.1 protein_id gnl|my_center|LOCUS_10000 9533 12457 gene locus_tag LOCUS_10010 9533 12457 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946456.1 protein_id gnl|my_center|LOCUS_10010 12464 13258 gene locus_tag LOCUS_10020 12464 13258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 13262 13600 gene locus_tag LOCUS_10030 13262 13600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 13712 16207 gene locus_tag LOCUS_10040 13712 16207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 16219 18105 gene locus_tag LOCUS_10050 16219 18105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 18937 18554 gene locus_tag LOCUS_10060 18937 18554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 19596 19036 gene locus_tag LOCUS_10070 19596 19036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 20713 19706 gene locus_tag LOCUS_10080 20713 19706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence038 561 1487 gene locus_tag LOCUS_10090 561 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 2241 1612 gene locus_tag LOCUS_10100 gene queE 2241 1612 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947757.1 protein_id gnl|my_center|LOCUS_10100 3164 2238 gene locus_tag LOCUS_10110 3164 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 3292 5082 gene locus_tag LOCUS_10120 3292 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 5139 6749 gene locus_tag LOCUS_10130 5139 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 6756 7397 gene locus_tag LOCUS_10140 6756 7397 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227223.1 protein_id gnl|my_center|LOCUS_10140 7394 8278 gene locus_tag LOCUS_10150 7394 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 8283 8852 gene locus_tag LOCUS_10160 8283 8852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 8849 9568 gene locus_tag LOCUS_10170 gene rph 8849 9568 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_10170 11128 10046 gene locus_tag LOCUS_10180 gene murG 11128 10046 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939774.1 protein_id gnl|my_center|LOCUS_10180 11300 12376 gene locus_tag LOCUS_10190 11300 12376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 12555 13835 gene locus_tag LOCUS_10200 12555 13835 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942174.1 protein_id gnl|my_center|LOCUS_10200 15471 13876 gene locus_tag LOCUS_10210 15471 13876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 18252 15517 gene locus_tag LOCUS_10220 18252 15517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 18477 21197 gene locus_tag LOCUS_10230 18477 21197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 21784 21431 gene locus_tag LOCUS_10240 21784 21431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 >Feature sequence039 1139 2860 gene locus_tag LOCUS_10250 1139 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 2911 3561 gene locus_tag LOCUS_10260 2911 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 3582 4712 gene locus_tag LOCUS_10270 3582 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 5317 4781 gene locus_tag LOCUS_10280 gene tsaA 5317 4781 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943048.1 protein_id gnl|my_center|LOCUS_10280 5829 5344 gene locus_tag LOCUS_10290 5829 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 6719 5844 gene locus_tag LOCUS_10300 6719 5844 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583758.1 protein_id gnl|my_center|LOCUS_10300 7412 6735 gene locus_tag LOCUS_10310 7412 6735 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166475.1 protein_id gnl|my_center|LOCUS_10310 8383 7409 gene locus_tag LOCUS_10320 8383 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 8463 9353 gene locus_tag LOCUS_10330 8463 9353 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174794.1 protein_id gnl|my_center|LOCUS_10330 9334 10374 gene locus_tag LOCUS_10340 9334 10374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 10485 11042 gene locus_tag LOCUS_10350 10485 11042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 11045 11509 gene locus_tag LOCUS_10360 11045 11509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 11530 13287 gene locus_tag LOCUS_10370 11530 13287 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228677.1 protein_id gnl|my_center|LOCUS_10370 13284 14639 gene locus_tag LOCUS_10380 13284 14639 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_10380 14623 15273 gene locus_tag LOCUS_10390 14623 15273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 16239 15319 gene locus_tag LOCUS_10400 16239 15319 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933107.1 protein_id gnl|my_center|LOCUS_10400 16767 16243 gene locus_tag LOCUS_10410 16767 16243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 17926 16796 gene locus_tag LOCUS_10420 17926 16796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 18111 19052 gene locus_tag LOCUS_10430 18111 19052 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723154.1 protein_id gnl|my_center|LOCUS_10430 19074 19760 gene locus_tag LOCUS_10440 19074 19760 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928794.1 protein_id gnl|my_center|LOCUS_10440 <21707 19815 gene locus_tag LOCUS_10450 <21707 19815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034285338.1:Calx-beta domain-containing protein >Feature sequence040 803 9 gene locus_tag LOCUS_10460 803 9 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 protein_id gnl|my_center|LOCUS_10460 1813 800 gene locus_tag LOCUS_10470 1813 800 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057738.1 protein_id gnl|my_center|LOCUS_10470 3843 1816 gene locus_tag LOCUS_10480 3843 1816 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964061.1 protein_id gnl|my_center|LOCUS_10480 4086 12104 gene locus_tag LOCUS_10490 4086 12104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 12109 13305 gene locus_tag LOCUS_10500 12109 13305 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939838.1 protein_id gnl|my_center|LOCUS_10500 15677 13278 gene locus_tag LOCUS_10510 15677 13278 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720592.1 protein_id gnl|my_center|LOCUS_10510 16654 15704 gene locus_tag LOCUS_10520 16654 15704 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_10520 17729 16689 gene locus_tag LOCUS_10530 17729 16689 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 protein_id gnl|my_center|LOCUS_10530 19220 17742 gene locus_tag LOCUS_10540 gene glpK 19220 17742 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_10540 21279 19225 gene locus_tag LOCUS_10550 21279 19225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 21235 21420 gene locus_tag LOCUS_10560 21235 21420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 >Feature sequence041 3124 1808 gene locus_tag LOCUS_10570 3124 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 3327 4460 gene locus_tag LOCUS_10580 3327 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 4711 6084 gene locus_tag LOCUS_10590 4711 6084 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257589.1 protein_id gnl|my_center|LOCUS_10590 8170 6140 gene locus_tag LOCUS_10600 8170 6140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 9814 8183 gene locus_tag LOCUS_10610 9814 8183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 9927 11609 gene locus_tag LOCUS_10620 gene hflX 9927 11609 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941674.1 protein_id gnl|my_center|LOCUS_10620 11613 13496 gene locus_tag LOCUS_10630 11613 13496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 14807 13740 gene locus_tag LOCUS_10640 14807 13740 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926950.1 protein_id gnl|my_center|LOCUS_10640 14924 16660 gene locus_tag LOCUS_10650 14924 16660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 16718 18493 gene locus_tag LOCUS_10660 16718 18493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 18571 19419 gene locus_tag LOCUS_10670 18571 19419 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_10670 19568 20686 gene locus_tag LOCUS_10680 gene mnmA 19568 20686 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence042 175 1935 gene locus_tag LOCUS_10690 175 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 3663 1990 gene locus_tag LOCUS_10700 3663 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 4124 3660 gene locus_tag LOCUS_10710 gene rimI 4124 3660 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243019.1 protein_id gnl|my_center|LOCUS_10710 4697 4137 gene locus_tag LOCUS_10720 gene yihA 4697 4137 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_10720 16062 4924 gene locus_tag LOCUS_10730 16062 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 16813 16325 gene locus_tag LOCUS_10740 16813 16325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 17706 16816 gene locus_tag LOCUS_10750 gene prmA 17706 16816 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816472.1 protein_id gnl|my_center|LOCUS_10750 18895 17696 gene locus_tag LOCUS_10760 gene ygeW 18895 17696 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978544.1 protein_id gnl|my_center|LOCUS_10760 20420 18972 gene locus_tag LOCUS_10770 gene hutI 20420 18972 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389058.1 protein_id gnl|my_center|LOCUS_10770 20748 20467 gene locus_tag LOCUS_10780 20748 20467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 20954 20745 gene locus_tag LOCUS_10790 20954 20745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 >Feature sequence043 158 1021 gene locus_tag LOCUS_10800 gene panC 158 1021 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_10800 1072 2730 gene locus_tag LOCUS_10810 1072 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 3715 2672 gene locus_tag LOCUS_10820 gene recA 3715 2672 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390446.1 protein_id gnl|my_center|LOCUS_10820 4173 3712 gene locus_tag LOCUS_10830 4173 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 6662 4341 gene locus_tag LOCUS_10840 6662 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 6944 8074 gene locus_tag LOCUS_10850 6944 8074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 8079 9455 gene locus_tag LOCUS_10860 8079 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 9456 10748 gene locus_tag LOCUS_10870 9456 10748 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140498.1 protein_id gnl|my_center|LOCUS_10870 10760 13849 gene locus_tag LOCUS_10880 10760 13849 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057001.1 protein_id gnl|my_center|LOCUS_10880 14948 13896 gene locus_tag LOCUS_10890 14948 13896 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671073.1 protein_id gnl|my_center|LOCUS_10890 16177 14963 gene locus_tag LOCUS_10900 16177 14963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 16531 16181 gene locus_tag LOCUS_10910 16531 16181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 17793 16528 gene locus_tag LOCUS_10920 17793 16528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 <21049 17876 gene locus_tag LOCUS_10930 <21049 17876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924811.1:acyl-CoA dehydratase activase >Feature sequence044 1211 348 gene locus_tag LOCUS_10940 1211 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 2387 1293 gene locus_tag LOCUS_10950 2387 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 3534 2389 gene locus_tag LOCUS_10960 3534 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 3729 4244 gene locus_tag LOCUS_10970 3729 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 6462 4528 gene locus_tag LOCUS_10980 gene speA 6462 4528 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144058.1 protein_id gnl|my_center|LOCUS_10980 6808 7986 gene locus_tag LOCUS_10990 6808 7986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 8005 9777 gene locus_tag LOCUS_11000 8005 9777 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_11000 9777 11879 gene locus_tag LOCUS_11010 9777 11879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 11886 13796 gene locus_tag LOCUS_11020 gene uvrC 11886 13796 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943890.1 protein_id gnl|my_center|LOCUS_11020 13960 13877 gene locus_tag LOCUS_t00200 13960 13877 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14102 14425 gene locus_tag LOCUS_11030 14102 14425 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_11030 14445 15857 gene locus_tag LOCUS_11040 14445 15857 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_11040 15888 17831 gene locus_tag LOCUS_11050 gene tkt 15888 17831 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927108.1 protein_id gnl|my_center|LOCUS_11050 17859 18338 gene locus_tag LOCUS_11060 17859 18338 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 protein_id gnl|my_center|LOCUS_11060 18412 18855 gene locus_tag LOCUS_11070 gene rnhA 18412 18855 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003511799.1 protein_id gnl|my_center|LOCUS_11070 19110 20327 gene locus_tag LOCUS_11080 19110 20327 CDS product 2-aminoethylphosphonate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525538.1 protein_id gnl|my_center|LOCUS_11080 20389 20856 gene locus_tag LOCUS_11090 20389 20856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence045 107 1060 gene locus_tag LOCUS_11100 107 1060 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_11100 1179 2504 gene locus_tag LOCUS_11110 1179 2504 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_11110 2626 3696 gene locus_tag LOCUS_11120 2626 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 3794 4777 gene locus_tag LOCUS_11130 3794 4777 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401697.1 protein_id gnl|my_center|LOCUS_11130 4786 6351 gene locus_tag LOCUS_11140 4786 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 6365 7834 gene locus_tag LOCUS_11150 6365 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 7834 8793 gene locus_tag LOCUS_11160 7834 8793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 8790 10064 gene locus_tag LOCUS_11170 gene rlmD 8790 10064 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942393.1 protein_id gnl|my_center|LOCUS_11170 10334 10666 gene locus_tag LOCUS_11180 10334 10666 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921010.1 protein_id gnl|my_center|LOCUS_11180 10775 11386 gene locus_tag LOCUS_11190 10775 11386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 11583 13661 gene locus_tag LOCUS_11200 11583 13661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 13658 14281 gene locus_tag LOCUS_11210 gene rnhB 13658 14281 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876654.1 protein_id gnl|my_center|LOCUS_11210 14415 15356 gene locus_tag LOCUS_11220 14415 15356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 16427 15372 gene locus_tag LOCUS_11230 16427 15372 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065472.1 protein_id gnl|my_center|LOCUS_11230 19474 16424 gene locus_tag LOCUS_11240 19474 16424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 20319 19501 gene locus_tag LOCUS_11250 20319 19501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 20921 20316 gene locus_tag LOCUS_11260 20921 20316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence046 1402 740 gene locus_tag LOCUS_11270 1402 740 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082723.1 protein_id gnl|my_center|LOCUS_11270 2664 1381 gene locus_tag LOCUS_11280 gene mtaB 2664 1381 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_11280 3469 2672 gene locus_tag LOCUS_11290 3469 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 4796 3507 gene locus_tag LOCUS_11300 4796 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 6382 4799 gene locus_tag LOCUS_11310 6382 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 8343 6439 gene locus_tag LOCUS_11320 8343 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 8644 10032 gene locus_tag LOCUS_11330 8644 10032 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544922.1 protein_id gnl|my_center|LOCUS_11330 10046 10561 gene locus_tag LOCUS_11340 10046 10561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 10887 10525 gene locus_tag LOCUS_11350 10887 10525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 11266 10892 gene locus_tag LOCUS_11360 11266 10892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 11368 11718 gene locus_tag LOCUS_11370 11368 11718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 12202 11816 gene locus_tag LOCUS_11380 12202 11816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 12111 12296 gene locus_tag LOCUS_11390 12111 12296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 13696 12434 gene locus_tag LOCUS_11400 gene murA 13696 12434 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_11400 15006 13711 gene locus_tag LOCUS_11410 gene clpX 15006 13711 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472302.1 protein_id gnl|my_center|LOCUS_11410 15315 15764 gene locus_tag LOCUS_11420 15315 15764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 15761 17836 gene locus_tag LOCUS_11430 15761 17836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 18779 18024 gene locus_tag LOCUS_11440 18779 18024 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_11440 19578 18784 gene locus_tag LOCUS_11450 19578 18784 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920880.1 protein_id gnl|my_center|LOCUS_11450 20365 19592 gene locus_tag LOCUS_11460 20365 19592 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719613.1 protein_id gnl|my_center|LOCUS_11460 <20893 20365 gene locus_tag LOCUS_11470 <20893 20365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941482.1:ABC transporter ATP-binding protein >Feature sequence047 2663 1539 gene locus_tag LOCUS_11480 2663 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 2880 3998 gene locus_tag LOCUS_11490 2880 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 4010 4333 gene locus_tag LOCUS_11500 4010 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 4337 4840 gene locus_tag LOCUS_11510 4337 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 6273 4888 gene locus_tag LOCUS_11520 gene pyk 6273 4888 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584142.1 protein_id gnl|my_center|LOCUS_11520 8221 6329 gene locus_tag LOCUS_11530 8221 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 9728 8307 gene locus_tag LOCUS_11540 9728 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 11254 9728 gene locus_tag LOCUS_11550 11254 9728 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507840.1 protein_id gnl|my_center|LOCUS_11550 12272 11259 gene locus_tag LOCUS_11560 12272 11259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 13014 12331 gene locus_tag LOCUS_11570 13014 12331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 13907 13158 gene locus_tag LOCUS_11580 13907 13158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 14830 14015 gene locus_tag LOCUS_11590 14830 14015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 15465 14845 gene locus_tag LOCUS_11600 15465 14845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 16253 15480 gene locus_tag LOCUS_11610 16253 15480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 16882 16262 gene locus_tag LOCUS_11620 16882 16262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 17515 16886 gene locus_tag LOCUS_11630 17515 16886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 18866 17526 gene locus_tag LOCUS_11640 18866 17526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 20591 18948 gene locus_tag LOCUS_11650 20591 18948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 >Feature sequence048 1474 1923 gene locus_tag LOCUS_11660 1474 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1955 2116 gene locus_tag LOCUS_11670 1955 2116 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869872.1 protein_id gnl|my_center|LOCUS_11670 2152 2718 gene locus_tag LOCUS_11680 2152 2718 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783570.1 protein_id gnl|my_center|LOCUS_11680 2759 3277 gene locus_tag LOCUS_11690 2759 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 4505 3486 gene locus_tag LOCUS_11700 4505 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 5239 4502 gene locus_tag LOCUS_11710 gene cps4B 5239 4502 CDS product capsular polysaccharide biosynthesis protein Cps4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922734.1 protein_id gnl|my_center|LOCUS_11710 5723 5256 gene locus_tag LOCUS_11720 5723 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 5895 6818 gene locus_tag LOCUS_11730 5895 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 8580 6883 gene locus_tag LOCUS_11740 8580 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 9844 8597 gene locus_tag LOCUS_11750 gene add 9844 8597 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838307.1 protein_id gnl|my_center|LOCUS_11750 10766 9834 gene locus_tag LOCUS_11760 10766 9834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 10932 11810 gene locus_tag LOCUS_11770 10932 11810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 12051 12623 gene locus_tag LOCUS_11780 12051 12623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 14560 12692 gene locus_tag LOCUS_11790 14560 12692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 15348 14725 gene locus_tag LOCUS_11800 15348 14725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 16386 15352 gene locus_tag LOCUS_11810 16386 15352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 17285 16398 gene locus_tag LOCUS_11820 17285 16398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 17629 17264 gene locus_tag LOCUS_11830 17629 17264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 19063 17654 gene locus_tag LOCUS_11840 19063 17654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence049 1678 1448 gene locus_tag LOCUS_11850 1678 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 3361 1823 gene locus_tag LOCUS_11860 3361 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 4469 3375 gene locus_tag LOCUS_11870 4469 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 6091 4529 gene locus_tag LOCUS_11880 6091 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 6340 7539 gene locus_tag LOCUS_11890 6340 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 7551 8540 gene locus_tag LOCUS_11900 7551 8540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 8537 9496 gene locus_tag LOCUS_11910 8537 9496 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267575.1 protein_id gnl|my_center|LOCUS_11910 9493 10164 gene locus_tag LOCUS_11920 9493 10164 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706961.1 protein_id gnl|my_center|LOCUS_11920 10223 12886 gene locus_tag LOCUS_11930 gene polA 10223 12886 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190446.1 protein_id gnl|my_center|LOCUS_11930 12937 13140 gene locus_tag LOCUS_11940 12937 13140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 13206 13481 gene locus_tag LOCUS_11950 13206 13481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 14270 13506 gene locus_tag LOCUS_11960 14270 13506 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044922.1 protein_id gnl|my_center|LOCUS_11960 18051 14284 gene locus_tag LOCUS_11970 18051 14284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 19101 18127 gene locus_tag LOCUS_11980 19101 18127 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360266.1 protein_id gnl|my_center|LOCUS_11980 20252 19098 gene locus_tag LOCUS_11990 20252 19098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence050 86 1909 gene locus_tag LOCUS_12000 gene acs 86 1909 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804877.1 protein_id gnl|my_center|LOCUS_12000 1915 4383 gene locus_tag LOCUS_12010 1915 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 4557 5795 gene locus_tag LOCUS_12020 4557 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 6262 5918 gene locus_tag LOCUS_12030 6262 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 7307 6675 gene locus_tag LOCUS_12040 7307 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 7592 8278 gene locus_tag LOCUS_12050 7592 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 10900 8357 gene locus_tag LOCUS_12060 10900 8357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 11118 13046 gene locus_tag LOCUS_12070 11118 13046 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_12070 13244 14725 gene locus_tag LOCUS_12080 13244 14725 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979130.1 protein_id gnl|my_center|LOCUS_12080 14742 16145 gene locus_tag LOCUS_12090 gene hydA 14742 16145 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030900.1 protein_id gnl|my_center|LOCUS_12090 16217 16999 gene locus_tag LOCUS_12100 16217 16999 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_12100 17016 18314 gene locus_tag LOCUS_12110 17016 18314 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_12110 18345 19460 gene locus_tag LOCUS_12120 18345 19460 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459608.1 protein_id gnl|my_center|LOCUS_12120 20166 19438 gene locus_tag LOCUS_12130 20166 19438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 >Feature sequence051 2123 789 gene locus_tag LOCUS_12140 2123 789 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_12140 2748 2410 gene locus_tag LOCUS_12150 2748 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 4216 3035 gene locus_tag LOCUS_12160 4216 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 6330 4213 gene locus_tag LOCUS_12170 6330 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 7273 6344 gene locus_tag LOCUS_12180 7273 6344 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 protein_id gnl|my_center|LOCUS_12180 8252 7311 gene locus_tag LOCUS_12190 8252 7311 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_12190 8923 8738 gene locus_tag LOCUS_12200 8923 8738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 8883 10523 gene locus_tag LOCUS_12210 8883 10523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 10997 13222 gene locus_tag LOCUS_12220 10997 13222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 13354 14223 gene locus_tag LOCUS_12230 13354 14223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 15924 14695 gene locus_tag LOCUS_12240 15924 14695 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435926.1 protein_id gnl|my_center|LOCUS_12240 16862 15927 gene locus_tag LOCUS_12250 16862 15927 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_12250 19751 16920 gene locus_tag LOCUS_12260 19751 16920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence052 67 720 gene locus_tag LOCUS_12270 gene atoD 67 720 CDS product acetate CoA-transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850540.1 protein_id gnl|my_center|LOCUS_12270 722 1384 gene locus_tag LOCUS_12280 722 1384 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047931.1 protein_id gnl|my_center|LOCUS_12280 2531 1539 gene locus_tag LOCUS_12290 2531 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 4827 2710 gene locus_tag LOCUS_12300 4827 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 8185 4937 gene locus_tag LOCUS_12310 8185 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 8316 10106 gene locus_tag LOCUS_12320 8316 10106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 11950 10322 gene locus_tag LOCUS_12330 11950 10322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 12066 14132 gene locus_tag LOCUS_12340 12066 14132 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_12340 15044 14343 gene locus_tag LOCUS_12350 15044 14343 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462325.1 protein_id gnl|my_center|LOCUS_12350 15161 15988 gene locus_tag LOCUS_12360 15161 15988 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065510.1 protein_id gnl|my_center|LOCUS_12360 16779 17564 gene locus_tag LOCUS_12370 16779 17564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 17593 17874 gene locus_tag LOCUS_12380 17593 17874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 18347 17916 gene locus_tag LOCUS_12390 18347 17916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 18921 18421 gene locus_tag LOCUS_12400 18921 18421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 <19937 19056 gene locus_tag LOCUS_12410 <19937 19056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943599.1:sensor domain-containing diguanylate cyclase >Feature sequence053 761 1165 gene locus_tag LOCUS_12420 761 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1234 3744 gene locus_tag LOCUS_12430 1234 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 3824 5830 gene locus_tag LOCUS_12440 3824 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 5837 7750 gene locus_tag LOCUS_12450 5837 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 8259 9173 gene locus_tag LOCUS_12460 8259 9173 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257278.1 protein_id gnl|my_center|LOCUS_12460 9212 10045 gene locus_tag LOCUS_12470 9212 10045 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257277.1 protein_id gnl|my_center|LOCUS_12470 10045 10986 gene locus_tag LOCUS_12480 10045 10986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 11038 11646 gene locus_tag LOCUS_12490 11038 11646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 11856 12488 gene locus_tag LOCUS_12500 11856 12488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 12490 12792 gene locus_tag LOCUS_12510 12490 12792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 12776 14314 gene locus_tag LOCUS_12520 12776 14314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 14315 15832 gene locus_tag LOCUS_12530 14315 15832 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707191.1 protein_id gnl|my_center|LOCUS_12530 15929 17353 gene locus_tag LOCUS_12540 15929 17353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 17350 18012 gene locus_tag LOCUS_12550 17350 18012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence054 <1 622 gene locus_tag LOCUS_12560 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938936.1:diaminopimelate decarboxylase 619 1809 gene locus_tag LOCUS_12570 619 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296451.1 protein_id gnl|my_center|LOCUS_12570 1806 2870 gene locus_tag LOCUS_12580 1806 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 2867 4231 gene locus_tag LOCUS_12590 2867 4231 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461820.1 protein_id gnl|my_center|LOCUS_12590 4224 5552 gene locus_tag LOCUS_12600 4224 5552 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940922.1 protein_id gnl|my_center|LOCUS_12600 5833 6282 gene locus_tag LOCUS_12610 5833 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 7490 6336 gene locus_tag LOCUS_12620 7490 6336 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 protein_id gnl|my_center|LOCUS_12620 9100 7490 gene locus_tag LOCUS_12630 9100 7490 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480009.1 protein_id gnl|my_center|LOCUS_12630 10357 9116 gene locus_tag LOCUS_12640 gene rlmI 10357 9116 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170850.1 protein_id gnl|my_center|LOCUS_12640 10499 12529 gene locus_tag LOCUS_12650 10499 12529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 13767 12664 gene locus_tag LOCUS_12660 13767 12664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 13969 17013 gene locus_tag LOCUS_12670 13969 17013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 17592 17065 gene locus_tag LOCUS_12680 17592 17065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 18256 17684 gene locus_tag LOCUS_12690 18256 17684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 18831 18304 gene locus_tag LOCUS_12700 18831 18304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence055 630 857 gene locus_tag LOCUS_12710 630 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 938 1279 gene locus_tag LOCUS_12720 938 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1276 2004 gene locus_tag LOCUS_12730 1276 2004 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967636.1 protein_id gnl|my_center|LOCUS_12730 2050 5181 gene locus_tag LOCUS_12740 2050 5181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 5178 7001 gene locus_tag LOCUS_12750 5178 7001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 7826 7209 gene locus_tag LOCUS_12760 7826 7209 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966112.1 protein_id gnl|my_center|LOCUS_12760 9917 7944 gene locus_tag LOCUS_12770 9917 7944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 10144 12270 gene locus_tag LOCUS_12780 10144 12270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 12290 13129 gene locus_tag LOCUS_12790 12290 13129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 13182 16211 gene locus_tag LOCUS_12800 13182 16211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 16223 17797 gene locus_tag LOCUS_12810 16223 17797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 17911 18423 gene locus_tag LOCUS_12820 17911 18423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence056 1880 75 gene locus_tag LOCUS_12830 1880 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 2889 1924 gene locus_tag LOCUS_12840 2889 1924 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921669.1 protein_id gnl|my_center|LOCUS_12840 3280 2939 gene locus_tag LOCUS_12850 3280 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 5323 3293 gene locus_tag LOCUS_12860 5323 3293 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036303.1 protein_id gnl|my_center|LOCUS_12860 5504 7225 gene locus_tag LOCUS_12870 5504 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 7222 7941 gene locus_tag LOCUS_12880 7222 7941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 8110 8532 gene locus_tag LOCUS_12890 gene rimP 8110 8532 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004411704.1 protein_id gnl|my_center|LOCUS_12890 8577 10190 gene locus_tag LOCUS_12900 gene nusA 8577 10190 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917934.1 protein_id gnl|my_center|LOCUS_12900 10221 10673 gene locus_tag LOCUS_12910 10221 10673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 10663 13569 gene locus_tag LOCUS_12920 gene infB 10663 13569 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942233.1 protein_id gnl|my_center|LOCUS_12920 13600 14217 gene locus_tag LOCUS_12930 13600 14217 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_12930 14225 14758 gene locus_tag LOCUS_12940 14225 14758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 14820 15311 gene locus_tag LOCUS_12950 14820 15311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 17305 15767 gene locus_tag LOCUS_12960 17305 15767 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_12960 18124 17390 gene locus_tag LOCUS_12970 gene pdxJ 18124 17390 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482574.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence057 1331 300 gene locus_tag LOCUS_12980 gene flhB 1331 300 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392310.1 protein_id gnl|my_center|LOCUS_12980 3900 1390 gene locus_tag LOCUS_12990 3900 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 5227 3902 gene locus_tag LOCUS_13000 5227 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 5565 5254 gene locus_tag LOCUS_13010 5565 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 7619 5562 gene locus_tag LOCUS_13020 gene glyS 7619 5562 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941242.1 protein_id gnl|my_center|LOCUS_13020 8493 7612 gene locus_tag LOCUS_13030 gene glyQ 8493 7612 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392140.1 protein_id gnl|my_center|LOCUS_13030 8727 9938 gene locus_tag LOCUS_13040 8727 9938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 10706 10110 gene locus_tag LOCUS_13050 10706 10110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 11667 10699 gene locus_tag LOCUS_13060 gene pdxA 11667 10699 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384456.1 protein_id gnl|my_center|LOCUS_13060 11946 11716 gene locus_tag LOCUS_13070 11946 11716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 12111 12629 gene locus_tag LOCUS_13080 12111 12629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 12647 14197 gene locus_tag LOCUS_13090 12647 14197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 14324 15670 gene locus_tag LOCUS_13100 14324 15670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 16270 15716 gene locus_tag LOCUS_13110 16270 15716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence058 3153 136 gene locus_tag LOCUS_13120 3153 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 4387 3155 gene locus_tag LOCUS_13130 4387 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 6738 4432 gene locus_tag LOCUS_13140 6738 4432 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 protein_id gnl|my_center|LOCUS_13140 7207 6731 gene locus_tag LOCUS_13150 7207 6731 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_13150 8059 7229 gene locus_tag LOCUS_13160 8059 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 8241 10616 gene locus_tag LOCUS_13170 8241 10616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 10709 11326 gene locus_tag LOCUS_13180 10709 11326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 15022 11504 gene locus_tag LOCUS_13190 15022 11504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence059 45 728 gene locus_tag LOCUS_13200 45 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 1520 771 gene locus_tag LOCUS_13210 1520 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1701 4295 gene locus_tag LOCUS_13220 1701 4295 CDS product chromosome condensation regulator RCC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258200.1 protein_id gnl|my_center|LOCUS_13220 4571 4326 gene locus_tag LOCUS_13230 4571 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 4806 6794 gene locus_tag LOCUS_13240 4806 6794 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941395.1 protein_id gnl|my_center|LOCUS_13240 6799 7722 gene locus_tag LOCUS_13250 6799 7722 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941400.1 protein_id gnl|my_center|LOCUS_13250 7719 8360 gene locus_tag LOCUS_13260 7719 8360 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941401.1 protein_id gnl|my_center|LOCUS_13260 8365 9849 gene locus_tag LOCUS_13270 8365 9849 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816730.1 protein_id gnl|my_center|LOCUS_13270 9846 11405 gene locus_tag LOCUS_13280 9846 11405 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941403.1 protein_id gnl|my_center|LOCUS_13280 11415 12176 gene locus_tag LOCUS_13290 11415 12176 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_13290 12392 15601 gene locus_tag LOCUS_13300 12392 15601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 15705 17906 gene locus_tag LOCUS_13310 15705 17906 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763503.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence060 60 974 gene locus_tag LOCUS_13320 60 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 971 1894 gene locus_tag LOCUS_13330 971 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 2602 1835 gene locus_tag LOCUS_13340 2602 1835 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274356.1 protein_id gnl|my_center|LOCUS_13340 4506 2596 gene locus_tag LOCUS_13350 gene feoB 4506 2596 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045027.1 protein_id gnl|my_center|LOCUS_13350 5243 4848 gene locus_tag LOCUS_13360 gene rpsI 5243 4848 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829818.1 protein_id gnl|my_center|LOCUS_13360 5689 5246 gene locus_tag LOCUS_13370 gene rplM 5689 5246 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_13370 6144 6344 gene locus_tag LOCUS_13380 6144 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 6371 7300 gene locus_tag LOCUS_13390 6371 7300 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805026.1 protein_id gnl|my_center|LOCUS_13390 7297 8355 gene locus_tag LOCUS_13400 7297 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 8360 9730 gene locus_tag LOCUS_13410 8360 9730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 9917 11707 gene locus_tag LOCUS_13420 9917 11707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 12625 11729 gene locus_tag LOCUS_13430 12625 11729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 13084 12635 gene locus_tag LOCUS_13440 13084 12635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 13906 13091 gene locus_tag LOCUS_13450 13906 13091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 14043 15656 gene locus_tag LOCUS_13460 gene rng 14043 15656 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_13460 15683 16807 gene locus_tag LOCUS_13470 15683 16807 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877642.1 protein_id gnl|my_center|LOCUS_13470 16900 16826 gene locus_tag LOCUS_t00210 16900 16826 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 17166 16906 gene locus_tag LOCUS_13480 gene rpsT 17166 16906 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942846.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence061 409 74 gene locus_tag LOCUS_13490 409 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 556 1098 gene locus_tag LOCUS_13500 556 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1170 3389 gene locus_tag LOCUS_13510 1170 3389 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124397.1 protein_id gnl|my_center|LOCUS_13510 3421 3570 gene locus_tag LOCUS_13520 3421 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 5054 3603 gene locus_tag LOCUS_13530 5054 3603 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 protein_id gnl|my_center|LOCUS_13530 6318 5062 gene locus_tag LOCUS_13540 6318 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 6671 7105 gene locus_tag LOCUS_13550 6671 7105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 7324 8688 gene locus_tag LOCUS_13560 7324 8688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 8682 9872 gene locus_tag LOCUS_13570 8682 9872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 9891 13043 gene locus_tag LOCUS_13580 9891 13043 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762065.1 protein_id gnl|my_center|LOCUS_13580 13057 13368 gene locus_tag LOCUS_13590 13057 13368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 13426 15006 gene locus_tag LOCUS_13600 13426 15006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 15003 16169 gene locus_tag LOCUS_13610 15003 16169 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929363.1 protein_id gnl|my_center|LOCUS_13610 16220 17215 gene locus_tag LOCUS_13620 16220 17215 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence062 103 372 gene locus_tag LOCUS_13630 103 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 372 1085 gene locus_tag LOCUS_13640 372 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 2915 1155 gene locus_tag LOCUS_13650 2915 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 5264 2964 gene locus_tag LOCUS_13660 5264 2964 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966095.1 protein_id gnl|my_center|LOCUS_13660 8139 5284 gene locus_tag LOCUS_13670 8139 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 8390 8317 gene locus_tag LOCUS_t00220 8390 8317 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 8566 10479 gene locus_tag LOCUS_13680 8566 10479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 10495 11010 gene locus_tag LOCUS_13690 10495 11010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 11004 12002 gene locus_tag LOCUS_13700 11004 12002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 12063 14771 gene locus_tag LOCUS_13710 12063 14771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 14993 15919 gene locus_tag LOCUS_13720 14993 15919 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_13720 16075 16353 gene locus_tag LOCUS_13730 gene ihfA 16075 16353 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300715.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence063 1731 940 gene locus_tag LOCUS_13740 1731 940 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082267.1 protein_id gnl|my_center|LOCUS_13740 1820 1736 gene locus_tag LOCUS_t00230 1820 1736 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1910 1834 gene locus_tag LOCUS_t00240 1910 1834 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2134 2412 gene locus_tag LOCUS_13750 2134 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 2638 4200 gene locus_tag LOCUS_13760 gene rny 2638 4200 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_13760 4190 5017 gene locus_tag LOCUS_13770 4190 5017 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_13770 5017 6441 gene locus_tag LOCUS_13780 5017 6441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 6456 7496 gene locus_tag LOCUS_13790 6456 7496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 7524 9371 gene locus_tag LOCUS_13800 7524 9371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 9326 10039 gene locus_tag LOCUS_13810 9326 10039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 10063 10992 gene locus_tag LOCUS_13820 10063 10992 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080645.1 protein_id gnl|my_center|LOCUS_13820 11306 11064 gene locus_tag LOCUS_13830 11306 11064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 11680 11817 gene locus_tag LOCUS_13840 11680 11817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 13051 11801 gene locus_tag LOCUS_13850 13051 11801 CDS product TIGR04013 family B12-binding domain/radical SAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082817.1 protein_id gnl|my_center|LOCUS_13850 14149 13058 gene locus_tag LOCUS_13860 gene nqrF 14149 13058 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763481.1 protein_id gnl|my_center|LOCUS_13860 14797 14162 gene locus_tag LOCUS_13870 gene nqrE 14797 14162 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071351.1 protein_id gnl|my_center|LOCUS_13870 15390 14794 gene locus_tag LOCUS_13880 gene nqrD 15390 14794 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119802.1 protein_id gnl|my_center|LOCUS_13880 16013 15387 gene locus_tag LOCUS_13890 16013 15387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 17100 16006 gene locus_tag LOCUS_13900 17100 16006 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763477.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence064 6567 7109 gene locus_tag LOCUS_13910 6567 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 7163 8413 gene locus_tag LOCUS_13920 7163 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 8406 9125 gene locus_tag LOCUS_13930 8406 9125 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_13930 9883 9239 gene locus_tag LOCUS_13940 9883 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 10536 10102 gene locus_tag LOCUS_13950 10536 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 11873 10554 gene locus_tag LOCUS_13960 11873 10554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 12037 13764 gene locus_tag LOCUS_13970 12037 13764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 13786 15360 gene locus_tag LOCUS_13980 13786 15360 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765024.1 protein_id gnl|my_center|LOCUS_13980 15365 16255 gene locus_tag LOCUS_13990 gene ttcA 15365 16255 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189298.1 protein_id gnl|my_center|LOCUS_13990 16258 17007 gene locus_tag LOCUS_14000 16258 17007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence065 1594 3249 gene locus_tag LOCUS_14010 gene groL 1594 3249 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_14010 3438 5693 gene locus_tag LOCUS_14020 gene pcrA 3438 5693 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233919.1 protein_id gnl|my_center|LOCUS_14020 6309 5680 gene locus_tag LOCUS_14030 6309 5680 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144231.1 protein_id gnl|my_center|LOCUS_14030 6549 6971 gene locus_tag LOCUS_14040 6549 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 7011 7463 gene locus_tag LOCUS_14050 7011 7463 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266264.1 protein_id gnl|my_center|LOCUS_14050 7547 9376 gene locus_tag LOCUS_14060 7547 9376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 9501 9842 gene locus_tag LOCUS_14070 9501 9842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 9872 10219 gene locus_tag LOCUS_14080 9872 10219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 10227 10568 gene locus_tag LOCUS_14090 10227 10568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 11227 10595 gene locus_tag LOCUS_14100 11227 10595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 11766 11227 gene locus_tag LOCUS_14110 11766 11227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 11828 12493 gene locus_tag LOCUS_14120 11828 12493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 14095 12539 gene locus_tag LOCUS_14130 14095 12539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 14198 15493 gene locus_tag LOCUS_14140 14198 15493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 15509 16996 gene locus_tag LOCUS_14150 15509 16996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 >Feature sequence066 2581 1316 gene locus_tag LOCUS_14160 2581 1316 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877033.1 protein_id gnl|my_center|LOCUS_14160 3826 2582 gene locus_tag LOCUS_14170 3826 2582 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762608.1 protein_id gnl|my_center|LOCUS_14170 4835 3807 gene locus_tag LOCUS_14180 4835 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 5020 5901 gene locus_tag LOCUS_14190 5020 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 6139 6882 gene locus_tag LOCUS_14200 6139 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 6930 8222 gene locus_tag LOCUS_14210 6930 8222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 8486 11914 gene locus_tag LOCUS_14220 8486 11914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 12527 11901 gene locus_tag LOCUS_14230 12527 11901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 12918 12547 gene locus_tag LOCUS_14240 12918 12547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 14939 12915 gene locus_tag LOCUS_14250 14939 12915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 15739 14951 gene locus_tag LOCUS_14260 15739 14951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 16331 15753 gene locus_tag LOCUS_14270 16331 15753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence067 127 2901 gene locus_tag LOCUS_14280 127 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 3218 3631 gene locus_tag LOCUS_14290 3218 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 4264 5829 gene locus_tag LOCUS_14300 4264 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 5852 6217 gene locus_tag LOCUS_14310 5852 6217 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927201.1 protein_id gnl|my_center|LOCUS_14310 6399 8249 gene locus_tag LOCUS_14320 6399 8249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 9032 8331 gene locus_tag LOCUS_14330 9032 8331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 10399 9593 gene locus_tag LOCUS_14340 10399 9593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 11430 10396 gene locus_tag LOCUS_14350 gene ltaE 11430 10396 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943783.1 protein_id gnl|my_center|LOCUS_14350 12703 11525 gene locus_tag LOCUS_14360 12703 11525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 14665 12719 gene locus_tag LOCUS_14370 14665 12719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 15095 16660 gene locus_tag LOCUS_14380 15095 16660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence068 1804 2400 gene locus_tag LOCUS_14390 1804 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 2403 3674 gene locus_tag LOCUS_14400 gene purD 2403 3674 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_14400 3678 4232 gene locus_tag LOCUS_14410 gene purE 3678 4232 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769750.1 protein_id gnl|my_center|LOCUS_14410 4229 5560 gene locus_tag LOCUS_14420 4229 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 6855 5584 gene locus_tag LOCUS_14430 6855 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 7348 6836 gene locus_tag LOCUS_14440 7348 6836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 8028 7375 gene locus_tag LOCUS_14450 8028 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 9183 8116 gene locus_tag LOCUS_14460 9183 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 9660 9187 gene locus_tag LOCUS_14470 9660 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 11508 9673 gene locus_tag LOCUS_14480 11508 9673 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080080.1 protein_id gnl|my_center|LOCUS_14480 12670 11519 gene locus_tag LOCUS_14490 12670 11519 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080082.1 protein_id gnl|my_center|LOCUS_14490 13175 12657 gene locus_tag LOCUS_14500 13175 12657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 13821 13165 gene locus_tag LOCUS_14510 13821 13165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 14704 13823 gene locus_tag LOCUS_14520 14704 13823 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080087.1 protein_id gnl|my_center|LOCUS_14520 16587 14716 gene locus_tag LOCUS_14530 16587 14716 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080094.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence069 1082 5347 gene locus_tag LOCUS_14540 1082 5347 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081484.1 protein_id gnl|my_center|LOCUS_14540 5360 6205 gene locus_tag LOCUS_14550 5360 6205 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671202.1 protein_id gnl|my_center|LOCUS_14550 6256 6786 gene locus_tag LOCUS_14560 6256 6786 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393765.1 protein_id gnl|my_center|LOCUS_14560 8536 7013 gene locus_tag LOCUS_14570 8536 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 8505 8723 gene locus_tag LOCUS_14580 8505 8723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 11198 8760 gene locus_tag LOCUS_14590 11198 8760 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_14590 11288 11635 gene locus_tag LOCUS_14600 11288 11635 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_14600 11642 12619 gene locus_tag LOCUS_14610 11642 12619 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085654.1 protein_id gnl|my_center|LOCUS_14610 12784 13329 gene locus_tag LOCUS_14620 12784 13329 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766706.1 protein_id gnl|my_center|LOCUS_14620 15523 13373 gene locus_tag LOCUS_14630 15523 13373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 15903 15520 gene locus_tag LOCUS_14640 15903 15520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 >Feature sequence070 2571 823 gene locus_tag LOCUS_14650 2571 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 3713 2574 gene locus_tag LOCUS_14660 3713 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 4689 3730 gene locus_tag LOCUS_14670 4689 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 4981 9423 gene locus_tag LOCUS_14680 4981 9423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 9429 9857 gene locus_tag LOCUS_14690 9429 9857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 9859 10473 gene locus_tag LOCUS_14700 9859 10473 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_14700 10983 10474 gene locus_tag LOCUS_14710 gene def 10983 10474 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114101.1 protein_id gnl|my_center|LOCUS_14710 11124 12131 gene locus_tag LOCUS_14720 11124 12131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 13383 12142 gene locus_tag LOCUS_14730 13383 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 15119 13386 gene locus_tag LOCUS_14740 15119 13386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 16319 15222 gene locus_tag LOCUS_14750 gene serC 16319 15222 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence071 1383 2036 gene locus_tag LOCUS_14760 1383 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 2080 3951 gene locus_tag LOCUS_14770 2080 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 3999 5213 gene locus_tag LOCUS_14780 3999 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 5493 7661 gene locus_tag LOCUS_14790 5493 7661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 7763 8548 gene locus_tag LOCUS_14800 7763 8548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 8549 9022 gene locus_tag LOCUS_14810 gene greA 8549 9022 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530066.1 protein_id gnl|my_center|LOCUS_14810 9019 9207 gene locus_tag LOCUS_14820 9019 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 9200 9427 gene locus_tag LOCUS_14830 9200 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 9589 10101 gene locus_tag LOCUS_14840 9589 10101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 10175 10438 gene locus_tag LOCUS_14850 10175 10438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 10552 12924 gene locus_tag LOCUS_14860 10552 12924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 13059 16205 gene locus_tag LOCUS_14870 13059 16205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 >Feature sequence072 1674 1399 gene locus_tag LOCUS_14880 1674 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 2436 1687 gene locus_tag LOCUS_14890 2436 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 4159 2603 gene locus_tag LOCUS_14900 4159 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 5031 4156 gene locus_tag LOCUS_14910 5031 4156 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 protein_id gnl|my_center|LOCUS_14910 5832 5044 gene locus_tag LOCUS_14920 5832 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 7180 5864 gene locus_tag LOCUS_14930 7180 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 7771 7286 gene locus_tag LOCUS_14940 7771 7286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 8134 7784 gene locus_tag LOCUS_14950 8134 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 10249 8159 gene locus_tag LOCUS_14960 10249 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 9924 10018 gene locus_tag LOCUS_t00250 9924 10018 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 10412 11383 gene locus_tag LOCUS_14970 10412 11383 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897225.1 protein_id gnl|my_center|LOCUS_14970 11421 12353 gene locus_tag LOCUS_14980 gene nadA 11421 12353 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940699.1 protein_id gnl|my_center|LOCUS_14980 12350 13024 gene locus_tag LOCUS_14990 12350 13024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 13005 14324 gene locus_tag LOCUS_15000 gene fliI 13005 14324 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_15000 14370 15770 gene locus_tag LOCUS_15010 14370 15770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence073 2640 808 gene locus_tag LOCUS_15020 2640 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 3783 2686 gene locus_tag LOCUS_15030 3783 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 4892 3795 gene locus_tag LOCUS_15040 4892 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 6478 5024 gene locus_tag LOCUS_15050 6478 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 9609 6475 gene locus_tag LOCUS_15060 9609 6475 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460042.1 protein_id gnl|my_center|LOCUS_15060 10589 9621 gene locus_tag LOCUS_15070 10589 9621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 11397 10684 gene locus_tag LOCUS_15080 11397 10684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 13366 11414 gene locus_tag LOCUS_15090 13366 11414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 >Feature sequence074 2102 4291 gene locus_tag LOCUS_15100 2102 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 4336 5070 gene locus_tag LOCUS_15110 gene uppS 4336 5070 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705097.1 protein_id gnl|my_center|LOCUS_15110 5078 5902 gene locus_tag LOCUS_15120 5078 5902 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_15120 5999 7231 gene locus_tag LOCUS_15130 5999 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 9691 7388 gene locus_tag LOCUS_15140 9691 7388 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057163.1 protein_id gnl|my_center|LOCUS_15140 10520 9726 gene locus_tag LOCUS_15150 10520 9726 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903261.1 protein_id gnl|my_center|LOCUS_15150 11123 10566 gene locus_tag LOCUS_15160 gene frr 11123 10566 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942563.1 protein_id gnl|my_center|LOCUS_15160 13196 11214 gene locus_tag LOCUS_15170 13196 11214 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583112.1 protein_id gnl|my_center|LOCUS_15170 14993 13230 gene locus_tag LOCUS_15180 14993 13230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 <15732 15094 gene locus_tag LOCUS_15190 <15732 15094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763417.1:NADP-dependent malic enzyme >Feature sequence075 2195 1329 gene locus_tag LOCUS_15200 gene folD 2195 1329 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_15200 3118 2192 gene locus_tag LOCUS_15210 3118 2192 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_15210 3921 3115 gene locus_tag LOCUS_15220 3921 3115 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_15220 4207 4857 gene locus_tag LOCUS_15230 gene lexA 4207 4857 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_15230 4934 6268 gene locus_tag LOCUS_15240 gene wbpA 4934 6268 CDS product UDP-N-acetyl-D-glucosamine 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113429.1 protein_id gnl|my_center|LOCUS_15240 6337 7662 gene locus_tag LOCUS_15250 6337 7662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 8057 7686 gene locus_tag LOCUS_15260 8057 7686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 8687 8100 gene locus_tag LOCUS_15270 8687 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 8839 8765 gene locus_tag LOCUS_t00260 8839 8765 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9301 8900 gene locus_tag LOCUS_15280 9301 8900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 9418 11598 gene locus_tag LOCUS_15290 9418 11598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 >Feature sequence076 3993 2347 gene locus_tag LOCUS_15300 3993 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 5124 4090 gene locus_tag LOCUS_15310 5124 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 5169 5468 gene locus_tag LOCUS_15320 5169 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence077 259 2124 gene locus_tag LOCUS_15330 259 2124 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048401.1 protein_id gnl|my_center|LOCUS_15330 2294 3205 gene locus_tag LOCUS_15340 2294 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 4545 3649 gene locus_tag LOCUS_15350 gene xerD 4545 3649 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942464.1 protein_id gnl|my_center|LOCUS_15350 4710 9074 gene locus_tag LOCUS_15360 4710 9074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 9203 10090 gene locus_tag LOCUS_15370 9203 10090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 10178 11575 gene locus_tag LOCUS_15380 10178 11575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 12687 11743 gene locus_tag LOCUS_15390 12687 11743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 13551 12706 gene locus_tag LOCUS_15400 13551 12706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 14694 13723 gene locus_tag LOCUS_15410 14694 13723 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794285.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence078 675 1178 gene locus_tag LOCUS_15420 675 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1383 2708 gene locus_tag LOCUS_15430 1383 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 2710 3882 gene locus_tag LOCUS_15440 2710 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 3893 6769 gene locus_tag LOCUS_15450 3893 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 6766 7374 gene locus_tag LOCUS_15460 6766 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 7358 8113 gene locus_tag LOCUS_15470 7358 8113 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065332.1 protein_id gnl|my_center|LOCUS_15470 8106 8801 gene locus_tag LOCUS_15480 8106 8801 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065331.1 protein_id gnl|my_center|LOCUS_15480 10422 8893 gene locus_tag LOCUS_15490 10422 8893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 11204 10545 gene locus_tag LOCUS_15500 11204 10545 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009627764.1 protein_id gnl|my_center|LOCUS_15500 11274 13484 gene locus_tag LOCUS_15510 11274 13484 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 protein_id gnl|my_center|LOCUS_15510 13481 13981 gene locus_tag LOCUS_15520 13481 13981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 13978 14919 gene locus_tag LOCUS_15530 13978 14919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence079 1956 874 gene locus_tag LOCUS_15540 1956 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 2993 1944 gene locus_tag LOCUS_15550 gene tsaD 2993 1944 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056353.1 protein_id gnl|my_center|LOCUS_15550 5656 3005 gene locus_tag LOCUS_15560 5656 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 5932 8175 gene locus_tag LOCUS_15570 5932 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 8236 9165 gene locus_tag LOCUS_15580 8236 9165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 9185 10348 gene locus_tag LOCUS_15590 9185 10348 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209537.1 protein_id gnl|my_center|LOCUS_15590 10398 11882 gene locus_tag LOCUS_15600 10398 11882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 12031 14226 gene locus_tag LOCUS_15610 12031 14226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 14241 14816 gene locus_tag LOCUS_15620 14241 14816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 >Feature sequence080 387 133 gene locus_tag LOCUS_15630 387 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1059 418 gene locus_tag LOCUS_15640 1059 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1434 1856 gene locus_tag LOCUS_15650 1434 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1863 3287 gene locus_tag LOCUS_15660 1863 3287 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_15660 3376 5679 gene locus_tag LOCUS_15670 3376 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 5690 6340 gene locus_tag LOCUS_15680 5690 6340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 6422 8779 gene locus_tag LOCUS_15690 6422 8779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 8792 10432 gene locus_tag LOCUS_15700 8792 10432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 10588 12189 gene locus_tag LOCUS_15710 10588 12189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 13287 12190 gene locus_tag LOCUS_15720 13287 12190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 14360 13284 gene locus_tag LOCUS_15730 14360 13284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence081 1062 436 gene locus_tag LOCUS_15740 gene ruvA 1062 436 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931954.1 protein_id gnl|my_center|LOCUS_15740 1541 1059 gene locus_tag LOCUS_15750 gene ruvC 1541 1059 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941736.1 protein_id gnl|my_center|LOCUS_15750 2322 1567 gene locus_tag LOCUS_15760 2322 1567 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_15760 2828 2349 gene locus_tag LOCUS_15770 2828 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 4786 2954 gene locus_tag LOCUS_15780 4786 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 8382 4804 gene locus_tag LOCUS_15790 8382 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 10251 8470 gene locus_tag LOCUS_15800 10251 8470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 11593 10385 gene locus_tag LOCUS_15810 11593 10385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 12140 11598 gene locus_tag LOCUS_15820 gene lspA 12140 11598 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812559.1 protein_id gnl|my_center|LOCUS_15820 12323 12787 gene locus_tag LOCUS_15830 12323 12787 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439693.1 protein_id gnl|my_center|LOCUS_15830 12887 13402 gene locus_tag LOCUS_15840 12887 13402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 13481 14458 gene locus_tag LOCUS_15850 13481 14458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence082 2378 1185 gene locus_tag LOCUS_15860 2378 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 3218 2517 gene locus_tag LOCUS_15870 3218 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 4314 3286 gene locus_tag LOCUS_15880 4314 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 5213 4311 gene locus_tag LOCUS_15890 gene lgt 5213 4311 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_15890 6502 5210 gene locus_tag LOCUS_15900 6502 5210 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940462.1 protein_id gnl|my_center|LOCUS_15900 9379 6515 gene locus_tag LOCUS_15910 9379 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 10795 9389 gene locus_tag LOCUS_15920 gene glnA 10795 9389 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_15920 10993 12528 gene locus_tag LOCUS_15930 10993 12528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 12538 13161 gene locus_tag LOCUS_15940 12538 13161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence083 3458 1302 gene locus_tag LOCUS_15950 3458 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 3632 4258 gene locus_tag LOCUS_15960 3632 4258 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071153.1 protein_id gnl|my_center|LOCUS_15960 7230 4798 gene locus_tag LOCUS_15970 7230 4798 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545339.1 protein_id gnl|my_center|LOCUS_15970 10542 7288 gene locus_tag LOCUS_15980 10542 7288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 10709 12880 gene locus_tag LOCUS_15990 10709 12880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence084 3263 2121 gene locus_tag LOCUS_16000 3263 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 5000 3498 gene locus_tag LOCUS_16010 5000 3498 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860933.1 protein_id gnl|my_center|LOCUS_16010 6181 5003 gene locus_tag LOCUS_16020 6181 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 8689 6191 gene locus_tag LOCUS_16030 8689 6191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 8931 8851 gene locus_tag LOCUS_t00270 8931 8851 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8964 9116 gene locus_tag LOCUS_16040 8964 9116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 9113 9301 gene locus_tag LOCUS_16050 9113 9301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 9942 10856 gene locus_tag LOCUS_16060 9942 10856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 13285 10985 gene locus_tag LOCUS_16070 13285 10985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence085 232 2034 gene locus_tag LOCUS_16080 gene lepA 232 2034 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_16080 2027 3082 gene locus_tag LOCUS_16090 2027 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 3207 5111 gene locus_tag LOCUS_16100 3207 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 5165 6253 gene locus_tag LOCUS_16110 5165 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 6289 7128 gene locus_tag LOCUS_16120 6289 7128 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_16120 9258 7234 gene locus_tag LOCUS_16130 9258 7234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 11880 9376 gene locus_tag LOCUS_16140 11880 9376 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_16140 12057 12254 gene locus_tag LOCUS_16150 12057 12254 CDS product DUF6485 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081411.1 protein_id gnl|my_center|LOCUS_16150 12276 12767 gene locus_tag LOCUS_16160 12276 12767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 13550 12900 gene locus_tag LOCUS_16170 13550 12900 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940552.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence086 127 1788 gene locus_tag LOCUS_16180 gene gpmI 127 1788 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_16180 1785 2300 gene locus_tag LOCUS_16190 1785 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 2741 3778 gene locus_tag LOCUS_16200 2741 3778 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880304.1 protein_id gnl|my_center|LOCUS_16200 3775 4311 gene locus_tag LOCUS_16210 3775 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 4360 7008 gene locus_tag LOCUS_16220 4360 7008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 8266 6995 gene locus_tag LOCUS_16230 8266 6995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 8806 8285 gene locus_tag LOCUS_16240 8806 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 9335 8823 gene locus_tag LOCUS_16250 9335 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 9891 10778 gene locus_tag LOCUS_16260 9891 10778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 10814 12127 gene locus_tag LOCUS_16270 10814 12127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 12140 12793 gene locus_tag LOCUS_16280 12140 12793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 >Feature sequence087 <1 519 gene locus_tag LOCUS_16290 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143435.1:ribosome small subunit-dependent GTPase A 851 600 gene locus_tag LOCUS_16300 851 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 1106 1474 gene locus_tag LOCUS_16310 1106 1474 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256185.1 protein_id gnl|my_center|LOCUS_16310 1471 2229 gene locus_tag LOCUS_16320 1471 2229 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880615.1 protein_id gnl|my_center|LOCUS_16320 2231 5359 gene locus_tag LOCUS_16330 2231 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 5356 6273 gene locus_tag LOCUS_16340 5356 6273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 6270 6989 gene locus_tag LOCUS_16350 6270 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 7000 7464 gene locus_tag LOCUS_16360 7000 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 7461 8552 gene locus_tag LOCUS_16370 7461 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 10432 8681 gene locus_tag LOCUS_16380 10432 8681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 11605 10478 gene locus_tag LOCUS_16390 11605 10478 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268950.1 protein_id gnl|my_center|LOCUS_16390 11759 12547 gene locus_tag LOCUS_16400 11759 12547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 12558 13037 gene locus_tag LOCUS_16410 12558 13037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 13013 13942 gene locus_tag LOCUS_16420 13013 13942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence088 <1 2850 gene locus_tag LOCUS_16430 <1 2850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730064.1:type I polyketide synthase 2852 3274 gene locus_tag LOCUS_16440 gene acpS 2852 3274 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256379.1 protein_id gnl|my_center|LOCUS_16440 3271 8754 gene locus_tag LOCUS_16450 3271 8754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 12250 8759 gene locus_tag LOCUS_16460 12250 8759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 13076 12321 gene locus_tag LOCUS_16470 gene sfsA 13076 12321 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943351.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence089 1211 6 gene locus_tag LOCUS_16480 1211 6 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763759.1 protein_id gnl|my_center|LOCUS_16480 2563 1208 gene locus_tag LOCUS_16490 gene thrC 2563 1208 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_16490 4071 2608 gene locus_tag LOCUS_16500 4071 2608 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808794.1 protein_id gnl|my_center|LOCUS_16500 6844 4199 gene locus_tag LOCUS_16510 6844 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 8933 6909 gene locus_tag LOCUS_16520 8933 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 9142 10497 gene locus_tag LOCUS_16530 9142 10497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 10594 12174 gene locus_tag LOCUS_16540 10594 12174 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144137.1 protein_id gnl|my_center|LOCUS_16540 12171 13319 gene locus_tag LOCUS_16550 12171 13319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 >Feature sequence090 452 108 gene locus_tag LOCUS_16560 452 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 5172 487 gene locus_tag LOCUS_16570 5172 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 5272 6825 gene locus_tag LOCUS_16580 5272 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 7781 6951 gene locus_tag LOCUS_16590 7781 6951 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201882.1 protein_id gnl|my_center|LOCUS_16590 8190 8924 gene locus_tag LOCUS_16600 8190 8924 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870048.1 protein_id gnl|my_center|LOCUS_16600 9013 9085 gene locus_tag LOCUS_t00280 9013 9085 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9152 10096 gene locus_tag LOCUS_16610 9152 10096 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_16610 10182 10847 gene locus_tag LOCUS_16620 10182 10847 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976390.1 protein_id gnl|my_center|LOCUS_16620 10875 11447 gene locus_tag LOCUS_16630 gene pth 10875 11447 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence091 223 1509 gene locus_tag LOCUS_16640 223 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 2728 1541 gene locus_tag LOCUS_16650 2728 1541 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462194.1 protein_id gnl|my_center|LOCUS_16650 4224 2824 gene locus_tag LOCUS_16660 4224 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 4446 4784 gene locus_tag LOCUS_16670 4446 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 4781 6103 gene locus_tag LOCUS_16680 4781 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 6194 6391 gene locus_tag LOCUS_16690 6194 6391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 8276 6432 gene locus_tag LOCUS_16700 8276 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 9673 8393 gene locus_tag LOCUS_16710 gene clpX 9673 8393 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_16710 10283 9675 gene locus_tag LOCUS_16720 gene clpP 10283 9675 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545892.1 protein_id gnl|my_center|LOCUS_16720 11692 10295 gene locus_tag LOCUS_16730 gene tig 11692 10295 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460612.1 protein_id gnl|my_center|LOCUS_16730 12063 13382 gene locus_tag LOCUS_16740 12063 13382 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence092 1341 256 gene locus_tag LOCUS_16750 1341 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1777 1379 gene locus_tag LOCUS_16760 1777 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 1950 3881 gene locus_tag LOCUS_16770 1950 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 3985 4443 gene locus_tag LOCUS_16780 3985 4443 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143392.1 protein_id gnl|my_center|LOCUS_16780 4440 5750 gene locus_tag LOCUS_16790 4440 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796266.1 protein_id gnl|my_center|LOCUS_16790 5954 5751 gene locus_tag LOCUS_16800 5954 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 6507 5998 gene locus_tag LOCUS_16810 6507 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 7681 6515 gene locus_tag LOCUS_16820 gene metK 7681 6515 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_16820 7923 9203 gene locus_tag LOCUS_16830 7923 9203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 9200 10900 gene locus_tag LOCUS_16840 9200 10900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 10897 11259 gene locus_tag LOCUS_16850 10897 11259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 11298 11858 gene locus_tag LOCUS_16860 11298 11858 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127205.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence093 674 2320 gene locus_tag LOCUS_16870 674 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 2432 3697 gene locus_tag LOCUS_16880 2432 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 3768 5324 gene locus_tag LOCUS_16890 3768 5324 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 protein_id gnl|my_center|LOCUS_16890 5339 6673 gene locus_tag LOCUS_16900 5339 6673 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 protein_id gnl|my_center|LOCUS_16900 6725 8071 gene locus_tag LOCUS_16910 6725 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 9848 8097 gene locus_tag LOCUS_16920 9848 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 9880 12516 gene locus_tag LOCUS_16930 9880 12516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 12695 13342 gene locus_tag LOCUS_16940 12695 13342 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938215.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence094 2352 838 gene locus_tag LOCUS_16950 2352 838 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228236.1 protein_id gnl|my_center|LOCUS_16950 3467 2358 gene locus_tag LOCUS_16960 3467 2358 CDS product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233828.1 protein_id gnl|my_center|LOCUS_16960 5565 3487 gene locus_tag LOCUS_16970 5565 3487 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_16970 6735 5617 gene locus_tag LOCUS_16980 6735 5617 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969095.1 protein_id gnl|my_center|LOCUS_16980 7059 6739 gene locus_tag LOCUS_16990 7059 6739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 8128 7091 gene locus_tag LOCUS_17000 8128 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 8731 8144 gene locus_tag LOCUS_17010 8731 8144 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930580.1 protein_id gnl|my_center|LOCUS_17010 10330 8744 gene locus_tag LOCUS_17020 10330 8744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 11180 10380 gene locus_tag LOCUS_17030 11180 10380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 12638 11379 gene locus_tag LOCUS_17040 12638 11379 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914065.1 protein_id gnl|my_center|LOCUS_17040 <13458 12642 gene locus_tag LOCUS_17050 <13458 12642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939216.1:tol-pal system protein YbgF >Feature sequence095 11 724 gene locus_tag LOCUS_17060 11 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 775 1692 gene locus_tag LOCUS_17070 775 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 1799 3994 gene locus_tag LOCUS_17080 1799 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 4529 4056 gene locus_tag LOCUS_17090 4529 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 5070 4717 gene locus_tag LOCUS_17100 5070 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 5499 5086 gene locus_tag LOCUS_17110 5499 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 6610 5552 gene locus_tag LOCUS_17120 6610 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 7127 6627 gene locus_tag LOCUS_17130 7127 6627 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 protein_id gnl|my_center|LOCUS_17130 7108 7248 gene locus_tag LOCUS_17140 7108 7248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 7756 7268 gene locus_tag LOCUS_17150 7756 7268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 7893 9650 gene locus_tag LOCUS_17160 7893 9650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 9955 10911 gene locus_tag LOCUS_17170 9955 10911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 11377 11009 gene locus_tag LOCUS_17180 11377 11009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 11643 12299 gene locus_tag LOCUS_17190 11643 12299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 12296 13165 gene locus_tag LOCUS_17200 12296 13165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence096 264 542 gene locus_tag LOCUS_17210 264 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 619 1440 gene locus_tag LOCUS_17220 619 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 2605 1448 gene locus_tag LOCUS_17230 2605 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 2754 3842 gene locus_tag LOCUS_17240 2754 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 4434 3892 gene locus_tag LOCUS_17250 4434 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 4508 4684 gene locus_tag LOCUS_17260 4508 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 4821 5576 gene locus_tag LOCUS_17270 4821 5576 CDS product DtxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330364.1 protein_id gnl|my_center|LOCUS_17270 5603 7033 gene locus_tag LOCUS_17280 5603 7033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 8175 7165 gene locus_tag LOCUS_17290 8175 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 9405 8194 gene locus_tag LOCUS_17300 9405 8194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 10280 9471 gene locus_tag LOCUS_17310 10280 9471 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250866.1 protein_id gnl|my_center|LOCUS_17310 11365 10277 gene locus_tag LOCUS_17320 gene prfA 11365 10277 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940174.1 protein_id gnl|my_center|LOCUS_17320 12300 11368 gene locus_tag LOCUS_17330 12300 11368 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393875.1 protein_id gnl|my_center|LOCUS_17330 12697 12440 gene locus_tag LOCUS_17340 12697 12440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 12714 12810 gene locus_tag LOCUS_t00290 12714 12810 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 12988 12842 gene locus_tag LOCUS_17350 12988 12842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence097 325 1587 gene locus_tag LOCUS_17360 325 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 1648 1722 gene locus_tag LOCUS_t00300 1648 1722 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1856 2494 gene locus_tag LOCUS_17370 1856 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 3648 2686 gene locus_tag LOCUS_17380 3648 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 4118 3645 gene locus_tag LOCUS_17390 4118 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 6126 4207 gene locus_tag LOCUS_17400 6126 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 6311 7510 gene locus_tag LOCUS_17410 gene rocD 6311 7510 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391213.1 protein_id gnl|my_center|LOCUS_17410 7518 7988 gene locus_tag LOCUS_17420 7518 7988 CDS product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940845.1 protein_id gnl|my_center|LOCUS_17420 8613 7999 gene locus_tag LOCUS_17430 8613 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 8812 9822 gene locus_tag LOCUS_17440 8812 9822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 10202 9819 gene locus_tag LOCUS_17450 10202 9819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 11260 10259 gene locus_tag LOCUS_17460 11260 10259 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_17460 11960 11271 gene locus_tag LOCUS_17470 11960 11271 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_17470 12210 12494 gene locus_tag LOCUS_17480 12210 12494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence098 3895 536 gene locus_tag LOCUS_17490 3895 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 4773 3892 gene locus_tag LOCUS_17500 4773 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 4929 5921 gene locus_tag LOCUS_17510 4929 5921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 5918 6820 gene locus_tag LOCUS_17520 5918 6820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 6842 8608 gene locus_tag LOCUS_17530 6842 8608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 8620 10080 gene locus_tag LOCUS_17540 8620 10080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 10070 11716 gene locus_tag LOCUS_17550 10070 11716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 11784 12674 gene locus_tag LOCUS_17560 11784 12674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence099 2128 11 gene locus_tag LOCUS_17570 2128 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 3184 2180 gene locus_tag LOCUS_17580 3184 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 3672 3187 gene locus_tag LOCUS_17590 gene tadA 3672 3187 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815124.1 protein_id gnl|my_center|LOCUS_17590 4449 3673 gene locus_tag LOCUS_17600 gene tpiA 4449 3673 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_17600 5658 4468 gene locus_tag LOCUS_17610 5658 4468 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_17610 6721 5720 gene locus_tag LOCUS_17620 gene gap 6721 5720 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942274.1 protein_id gnl|my_center|LOCUS_17620 6796 8073 gene locus_tag LOCUS_17630 6796 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 9993 8104 gene locus_tag LOCUS_17640 9993 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 12643 10124 gene locus_tag LOCUS_17650 12643 10124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 >Feature sequence100 1686 259 gene locus_tag LOCUS_17660 1686 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 1744 2583 gene locus_tag LOCUS_17670 gene thiD 1744 2583 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972916.1 protein_id gnl|my_center|LOCUS_17670 2705 3658 gene locus_tag LOCUS_17680 2705 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 3658 4596 gene locus_tag LOCUS_17690 3658 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 4605 5045 gene locus_tag LOCUS_17700 4605 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 5068 6744 gene locus_tag LOCUS_17710 5068 6744 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929181.1 protein_id gnl|my_center|LOCUS_17710 6758 7393 gene locus_tag LOCUS_17720 6758 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 7820 7452 gene locus_tag LOCUS_17730 7820 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 8794 7820 gene locus_tag LOCUS_17740 8794 7820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 9541 8834 gene locus_tag LOCUS_17750 9541 8834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 11471 9606 gene locus_tag LOCUS_17760 11471 9606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 12482 11481 gene locus_tag LOCUS_17770 12482 11481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence101 1170 475 gene locus_tag LOCUS_17780 1170 475 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795919.1 protein_id gnl|my_center|LOCUS_17780 1700 1167 gene locus_tag LOCUS_17790 1700 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 1987 1760 gene locus_tag LOCUS_17800 1987 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 2223 3713 gene locus_tag LOCUS_17810 2223 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 3727 4299 gene locus_tag LOCUS_17820 3727 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 4391 7597 gene locus_tag LOCUS_17830 4391 7597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 9775 7691 gene locus_tag LOCUS_17840 9775 7691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 10539 9772 gene locus_tag LOCUS_17850 10539 9772 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235485.1 protein_id gnl|my_center|LOCUS_17850 10757 11737 gene locus_tag LOCUS_17860 10757 11737 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838603.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence102 692 1609 gene locus_tag LOCUS_17870 gene era 692 1609 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546764.1 protein_id gnl|my_center|LOCUS_17870 1606 2946 gene locus_tag LOCUS_17880 gene der 1606 2946 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_17880 2933 3745 gene locus_tag LOCUS_17890 2933 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 3757 4119 gene locus_tag LOCUS_17900 3757 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 4222 4986 gene locus_tag LOCUS_17910 4222 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 5051 7525 gene locus_tag LOCUS_17920 gene lon 5051 7525 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_17920 8788 7583 gene locus_tag LOCUS_17930 8788 7583 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459119.1 protein_id gnl|my_center|LOCUS_17930 9694 8906 gene locus_tag LOCUS_17940 9694 8906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 11137 9761 gene locus_tag LOCUS_17950 11137 9761 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839227.1 protein_id gnl|my_center|LOCUS_17950 11718 11197 gene locus_tag LOCUS_17960 11718 11197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence103 <1 1014 gene locus_tag LOCUS_17970 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074319.1:alpha/beta fold hydrolase 1133 3541 gene locus_tag LOCUS_17980 1133 3541 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_17980 4157 3603 gene locus_tag LOCUS_17990 4157 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 5144 4221 gene locus_tag LOCUS_18000 5144 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 5717 5148 gene locus_tag LOCUS_18010 5717 5148 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792111.1 protein_id gnl|my_center|LOCUS_18010 11815 5714 gene locus_tag LOCUS_18020 11815 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 12725 11964 gene locus_tag LOCUS_18030 12725 11964 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072997.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence104 499 194 gene locus_tag LOCUS_18040 499 194 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_18040 921 496 gene locus_tag LOCUS_18050 921 496 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_18050 2622 937 gene locus_tag LOCUS_18060 2622 937 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963991.1 protein_id gnl|my_center|LOCUS_18060 3119 2619 gene locus_tag LOCUS_18070 3119 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 4766 3129 gene locus_tag LOCUS_18080 4766 3129 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131629.1 protein_id gnl|my_center|LOCUS_18080 5068 4763 gene locus_tag LOCUS_18090 5068 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 6624 5065 gene locus_tag LOCUS_18100 6624 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 8137 6638 gene locus_tag LOCUS_18110 8137 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 8825 8145 gene locus_tag LOCUS_18120 8825 8145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 9409 8879 gene locus_tag LOCUS_18130 9409 8879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 10440 9406 gene locus_tag LOCUS_18140 10440 9406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 10571 11923 gene locus_tag LOCUS_18150 gene mgtE 10571 11923 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696042.1 protein_id gnl|my_center|LOCUS_18150 12454 12017 gene locus_tag LOCUS_18160 12454 12017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence105 <1 3331 gene locus_tag LOCUS_18170 <1 3331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962333.1:OmpA family protein 3400 3786 gene locus_tag LOCUS_18180 3400 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 4560 3823 gene locus_tag LOCUS_18190 4560 3823 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259513.1 protein_id gnl|my_center|LOCUS_18190 6401 4566 gene locus_tag LOCUS_18200 6401 4566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 8193 6493 gene locus_tag LOCUS_18210 8193 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 8444 8758 gene locus_tag LOCUS_18220 8444 8758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 8880 10802 gene locus_tag LOCUS_18230 8880 10802 CDS product DUF3857 and transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108263.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence106 292 810 gene locus_tag LOCUS_18240 292 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 1635 823 gene locus_tag LOCUS_18250 1635 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 2891 1677 gene locus_tag LOCUS_18260 2891 1677 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023814.1 protein_id gnl|my_center|LOCUS_18260 3036 3737 gene locus_tag LOCUS_18270 3036 3737 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_18270 3738 6110 gene locus_tag LOCUS_18280 3738 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 6205 10539 gene locus_tag LOCUS_18290 6205 10539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 10681 11784 gene locus_tag LOCUS_18300 gene ugpC 10681 11784 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972815.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence107 200 4459 gene locus_tag LOCUS_18310 200 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 4470 8501 gene locus_tag LOCUS_18320 4470 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 8677 8991 gene locus_tag LOCUS_18330 gene rplU 8677 8991 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869646.1 protein_id gnl|my_center|LOCUS_18330 9002 9262 gene locus_tag LOCUS_18340 gene rpmA 9002 9262 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938227.1 protein_id gnl|my_center|LOCUS_18340 9339 10343 gene locus_tag LOCUS_18350 gene obgE 9339 10343 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 protein_id gnl|my_center|LOCUS_18350 10440 12266 gene locus_tag LOCUS_18360 10440 12266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 >Feature sequence108 2887 1613 gene locus_tag LOCUS_18370 2887 1613 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224220.1 protein_id gnl|my_center|LOCUS_18370 4136 2880 gene locus_tag LOCUS_18380 4136 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 5125 4133 gene locus_tag LOCUS_18390 5125 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 6108 5236 gene locus_tag LOCUS_18400 6108 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 6880 6101 gene locus_tag LOCUS_18410 6880 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 7258 7010 gene locus_tag LOCUS_18420 7258 7010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 7430 8827 gene locus_tag LOCUS_18430 7430 8827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 8858 10276 gene locus_tag LOCUS_18440 8858 10276 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence109 3103 638 gene locus_tag LOCUS_18450 3103 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 4210 3122 gene locus_tag LOCUS_18460 gene dnaJ 4210 3122 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230872.1 protein_id gnl|my_center|LOCUS_18460 4396 6531 gene locus_tag LOCUS_18470 4396 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 7502 6648 gene locus_tag LOCUS_18480 7502 6648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 8016 7528 gene locus_tag LOCUS_18490 8016 7528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 8765 8013 gene locus_tag LOCUS_18500 8765 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 9771 8869 gene locus_tag LOCUS_18510 9771 8869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 11675 9768 gene locus_tag LOCUS_18520 11675 9768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 12017 11679 gene locus_tag LOCUS_18530 12017 11679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 >Feature sequence110 1841 1473 gene locus_tag LOCUS_18540 1841 1473 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867829.1 protein_id gnl|my_center|LOCUS_18540 2599 1838 gene locus_tag LOCUS_18550 2599 1838 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080100.1 protein_id gnl|my_center|LOCUS_18550 2846 2592 gene locus_tag LOCUS_18560 2846 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 3118 2843 gene locus_tag LOCUS_18570 3118 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 3372 3118 gene locus_tag LOCUS_18580 3372 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 3851 3369 gene locus_tag LOCUS_18590 3851 3369 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080108.1 protein_id gnl|my_center|LOCUS_18590 4268 3906 gene locus_tag LOCUS_18600 4268 3906 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583889.1 protein_id gnl|my_center|LOCUS_18600 4832 4461 gene locus_tag LOCUS_18610 4832 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 6397 4919 gene locus_tag LOCUS_18620 6397 4919 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767873.1 protein_id gnl|my_center|LOCUS_18620 6539 7882 gene locus_tag LOCUS_18630 6539 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 8992 7934 gene locus_tag LOCUS_18640 8992 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_18640 9299 11971 gene locus_tag LOCUS_18650 gene ppdK 9299 11971 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082976.1 protein_id gnl|my_center|LOCUS_18650 12446 11979 gene locus_tag LOCUS_18660 gene bcp 12446 11979 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582794.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence111 16 1131 gene locus_tag LOCUS_18670 16 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 1210 1491 gene locus_tag LOCUS_18680 1210 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 1524 2453 gene locus_tag LOCUS_18690 1524 2453 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_18690 2486 3436 gene locus_tag LOCUS_18700 gene holB 2486 3436 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_18700 3622 4650 gene locus_tag LOCUS_18710 3622 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 4647 5699 gene locus_tag LOCUS_18720 4647 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 5696 6484 gene locus_tag LOCUS_18730 5696 6484 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815002.1 protein_id gnl|my_center|LOCUS_18730 6503 7447 gene locus_tag LOCUS_18740 6503 7447 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_18740 7529 8647 gene locus_tag LOCUS_18750 gene prfB 7529 8647 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_18750 8644 10167 gene locus_tag LOCUS_18760 8644 10167 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545027.1 protein_id gnl|my_center|LOCUS_18760 >Feature sequence112 3889 3197 gene locus_tag LOCUS_18770 3889 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 5310 4072 gene locus_tag LOCUS_18780 5310 4072 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_18780 6229 5345 gene locus_tag LOCUS_18790 6229 5345 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 protein_id gnl|my_center|LOCUS_18790 6388 6849 gene locus_tag LOCUS_18800 6388 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 7005 8780 gene locus_tag LOCUS_18810 7005 8780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 8797 9156 gene locus_tag LOCUS_18820 8797 9156 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146466.1 protein_id gnl|my_center|LOCUS_18820 9170 10699 gene locus_tag LOCUS_18830 9170 10699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 10701 11825 gene locus_tag LOCUS_18840 10701 11825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 >Feature sequence113 <1 954 gene locus_tag LOCUS_18850 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010908566.1:signal peptide peptidase SppA 1019 2662 gene locus_tag LOCUS_18860 1019 2662 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_18860 2659 5406 gene locus_tag LOCUS_18870 2659 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 5409 7022 gene locus_tag LOCUS_18880 5409 7022 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_18880 7019 8704 gene locus_tag LOCUS_18890 7019 8704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 8685 9512 gene locus_tag LOCUS_18900 gene dapB 8685 9512 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119175.1 protein_id gnl|my_center|LOCUS_18900 9783 11168 gene locus_tag LOCUS_18910 9783 11168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence114 332 1402 gene locus_tag LOCUS_18920 332 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2332 1625 gene locus_tag LOCUS_18930 2332 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 3909 3244 gene locus_tag LOCUS_18940 gene cmk 3909 3244 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908300.1 protein_id gnl|my_center|LOCUS_18940 4832 3912 gene locus_tag LOCUS_18950 4832 3912 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_18950 5563 4829 gene locus_tag LOCUS_18960 5563 4829 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989827.1 protein_id gnl|my_center|LOCUS_18960 7367 5553 gene locus_tag LOCUS_18970 7367 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 8127 7447 gene locus_tag LOCUS_18980 8127 7447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 8654 11659 gene locus_tag LOCUS_18990 8654 11659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 >Feature sequence115 1080 1985 gene locus_tag LOCUS_19000 1080 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 2009 4264 gene locus_tag LOCUS_19010 gene ligA 2009 4264 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082648.1 protein_id gnl|my_center|LOCUS_19010 4261 4950 gene locus_tag LOCUS_19020 4261 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 4958 7903 gene locus_tag LOCUS_19030 4958 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 7903 9186 gene locus_tag LOCUS_19040 7903 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 9332 11788 gene locus_tag LOCUS_19050 gene gyrB 9332 11788 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070020.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence116 2508 274 gene locus_tag LOCUS_19060 2508 274 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765304.1 protein_id gnl|my_center|LOCUS_19060 3505 2528 gene locus_tag LOCUS_19070 3505 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 5089 3533 gene locus_tag LOCUS_19080 5089 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 6349 5246 gene locus_tag LOCUS_19090 gene rodA 6349 5246 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_19090 8240 6369 gene locus_tag LOCUS_19100 gene mrdA 8240 6369 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_19100 8758 8237 gene locus_tag LOCUS_19110 8758 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 9690 8767 gene locus_tag LOCUS_19120 9690 8767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 10750 9710 gene locus_tag LOCUS_19130 10750 9710 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_19130 11664 10885 gene locus_tag LOCUS_19140 11664 10885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence117 1410 364 gene locus_tag LOCUS_19150 1410 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 2083 1394 gene locus_tag LOCUS_19160 2083 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 3019 2084 gene locus_tag LOCUS_19170 3019 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 3560 3048 gene locus_tag LOCUS_19180 3560 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 4074 3589 gene locus_tag LOCUS_19190 gene infC 4074 3589 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070690874.1 protein_id gnl|my_center|LOCUS_19190 5974 4229 gene locus_tag LOCUS_19200 gene thrS 5974 4229 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_19200 6140 6068 gene locus_tag LOCUS_t00310 6140 6068 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6776 6414 gene locus_tag LOCUS_19210 6776 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 8219 6786 gene locus_tag LOCUS_19220 gene lpdA 8219 6786 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049374229.1 protein_id gnl|my_center|LOCUS_19220 10365 8419 gene locus_tag LOCUS_19230 10365 8419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 11561 10569 gene locus_tag LOCUS_19240 11561 10569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence118 1730 2719 gene locus_tag LOCUS_19250 1730 2719 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_19250 2747 3625 gene locus_tag LOCUS_19260 2747 3625 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_19260 3622 5202 gene locus_tag LOCUS_19270 3622 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 5189 6343 gene locus_tag LOCUS_19280 5189 6343 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_19280 6340 7398 gene locus_tag LOCUS_19290 6340 7398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 7395 8399 gene locus_tag LOCUS_19300 7395 8399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 8444 10312 gene locus_tag LOCUS_19310 8444 10312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 10474 11202 gene locus_tag LOCUS_19320 10474 11202 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 protein_id gnl|my_center|LOCUS_19320 >Feature sequence119 2117 1485 gene locus_tag LOCUS_19330 2117 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 3485 2121 gene locus_tag LOCUS_19340 3485 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 3658 5640 gene locus_tag LOCUS_19350 3658 5640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 5653 6561 gene locus_tag LOCUS_19360 5653 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 9951 6577 gene locus_tag LOCUS_19370 9951 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 10151 10078 gene locus_tag LOCUS_t00320 10151 10078 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 10187 11173 gene locus_tag LOCUS_19380 10187 11173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence120 1405 815 gene locus_tag LOCUS_19390 1405 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 3141 1408 gene locus_tag LOCUS_19400 gene argS 3141 1408 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869400.1 protein_id gnl|my_center|LOCUS_19400 3274 5850 gene locus_tag LOCUS_19410 3274 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 6634 5981 gene locus_tag LOCUS_19420 6634 5981 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815780.1 protein_id gnl|my_center|LOCUS_19420 7405 6692 gene locus_tag LOCUS_19430 gene pyrH 7405 6692 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933439.1 protein_id gnl|my_center|LOCUS_19430 8084 7428 gene locus_tag LOCUS_19440 gene tsf 8084 7428 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_19440 8982 8116 gene locus_tag LOCUS_19450 gene rpsB 8982 8116 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_19450 9716 9150 gene locus_tag LOCUS_19460 9716 9150 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970974.1 protein_id gnl|my_center|LOCUS_19460 >Feature sequence121 1 1167 gene locus_tag LOCUS_19470 1 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 1406 3568 gene locus_tag LOCUS_19480 1406 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 3798 5042 gene locus_tag LOCUS_19490 gene ablA 3798 5042 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_19490 5044 5559 gene locus_tag LOCUS_19500 5044 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 5593 6084 gene locus_tag LOCUS_19510 5593 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 6121 6897 gene locus_tag LOCUS_19520 6121 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 6963 7712 gene locus_tag LOCUS_19530 6963 7712 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903416.1 protein_id gnl|my_center|LOCUS_19530 7713 9347 gene locus_tag LOCUS_19540 7713 9347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 >Feature sequence122 <1 1462 gene locus_tag LOCUS_19550 <1 1462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941832.1:murein biosynthesis integral membrane protein MurJ 3822 1498 gene locus_tag LOCUS_19560 3822 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 4838 3846 gene locus_tag LOCUS_19570 4838 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 5714 4854 gene locus_tag LOCUS_19580 5714 4854 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_19580 7049 5724 gene locus_tag LOCUS_19590 7049 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 9580 7115 gene locus_tag LOCUS_19600 9580 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 10643 9597 gene locus_tag LOCUS_19610 10643 9597 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103018905.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence123 978 646 gene locus_tag LOCUS_19620 978 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 2000 3301 gene locus_tag LOCUS_19630 2000 3301 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_19630 3403 4227 gene locus_tag LOCUS_19640 3403 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 4242 6074 gene locus_tag LOCUS_19650 4242 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 6861 6316 gene locus_tag LOCUS_19660 6861 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 9161 6858 gene locus_tag LOCUS_19670 9161 6858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 10567 9161 gene locus_tag LOCUS_19680 10567 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 >Feature sequence124 2288 1446 gene locus_tag LOCUS_19690 2288 1446 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065352.1 protein_id gnl|my_center|LOCUS_19690 2836 2441 gene locus_tag LOCUS_19700 2836 2441 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922983.1 protein_id gnl|my_center|LOCUS_19700 3348 2926 gene locus_tag LOCUS_19710 3348 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 4734 3622 gene locus_tag LOCUS_19720 4734 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 6195 4765 gene locus_tag LOCUS_19730 gene dnaB 6195 4765 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_19730 6671 6219 gene locus_tag LOCUS_19740 gene rplI 6671 6219 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938257.1 protein_id gnl|my_center|LOCUS_19740 6928 6689 gene locus_tag LOCUS_19750 6928 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 7443 6934 gene locus_tag LOCUS_19760 7443 6934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 7654 7729 gene locus_tag LOCUS_t00330 7654 7729 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7751 8305 gene locus_tag LOCUS_19770 7751 8305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 8313 9503 gene locus_tag LOCUS_19780 8313 9503 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880313.1 protein_id gnl|my_center|LOCUS_19780 9518 9934 gene locus_tag LOCUS_19790 9518 9934 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187960.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence125 <1 1764 gene locus_tag LOCUS_19800 <1 1764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259275.1:histone deacetylase family protein 2643 1768 gene locus_tag LOCUS_19810 gene zupT 2643 1768 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940881.1 protein_id gnl|my_center|LOCUS_19810 2531 2773 gene locus_tag LOCUS_19820 2531 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 2957 4168 gene locus_tag LOCUS_19830 2957 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 4395 4700 gene locus_tag LOCUS_19840 4395 4700 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001406079.1 protein_id gnl|my_center|LOCUS_19840 4697 5572 gene locus_tag LOCUS_19850 4697 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19850 6126 5641 gene locus_tag LOCUS_19860 6126 5641 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943074.1 protein_id gnl|my_center|LOCUS_19860 6765 6199 gene locus_tag LOCUS_19870 6765 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 7065 8102 gene locus_tag LOCUS_19880 7065 8102 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_19880 9033 8320 gene locus_tag LOCUS_19890 9033 8320 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 protein_id gnl|my_center|LOCUS_19890 9489 10157 gene locus_tag LOCUS_19900 9489 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 >Feature sequence126 2154 1024 gene locus_tag LOCUS_19910 2154 1024 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_19910 2600 2157 gene locus_tag LOCUS_19920 2600 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 3335 2655 gene locus_tag LOCUS_19930 3335 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 6941 3456 gene locus_tag LOCUS_19940 6941 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 7296 6931 gene locus_tag LOCUS_19950 7296 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 7433 8281 gene locus_tag LOCUS_19960 7433 8281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 8465 8875 gene locus_tag LOCUS_19970 8465 8875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 9420 9668 gene locus_tag LOCUS_19980 9420 9668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 9892 10113 gene locus_tag LOCUS_19990 9892 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 >Feature sequence127 127 552 gene locus_tag LOCUS_20000 127 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 647 2413 gene locus_tag LOCUS_20010 gene lnt 647 2413 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339441.1 protein_id gnl|my_center|LOCUS_20010 2406 3542 gene locus_tag LOCUS_20020 2406 3542 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287956.1 protein_id gnl|my_center|LOCUS_20020 3684 5132 gene locus_tag LOCUS_20030 3684 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 5206 6978 gene locus_tag LOCUS_20040 5206 6978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 6989 7711 gene locus_tag LOCUS_20050 6989 7711 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 protein_id gnl|my_center|LOCUS_20050 7835 7918 gene locus_tag LOCUS_t00340 7835 7918 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7958 8046 gene locus_tag LOCUS_t00350 7958 8046 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8064 8138 gene locus_tag LOCUS_t00360 8064 8138 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8152 9024 gene locus_tag LOCUS_20060 8152 9024 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965124.1 protein_id gnl|my_center|LOCUS_20060 <10457 9861 gene locus_tag LOCUS_20070 <10457 9861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994041.1:glucoamylase family protein >Feature sequence128 1839 2798 gene locus_tag LOCUS_20080 1839 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 2891 4039 gene locus_tag LOCUS_20090 2891 4039 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103387.1 protein_id gnl|my_center|LOCUS_20090 4759 4070 gene locus_tag LOCUS_20100 4759 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 6582 5428 gene locus_tag LOCUS_20110 6582 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 8931 9083 gene locus_tag LOCUS_20120 8931 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 9235 9471 gene locus_tag LOCUS_20130 9235 9471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 10178 9489 gene locus_tag LOCUS_20140 10178 9489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 >Feature sequence129 1811 2899 gene locus_tag LOCUS_20150 1811 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 3086 3790 gene locus_tag LOCUS_20160 3086 3790 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_20160 3774 6227 gene locus_tag LOCUS_20170 gene bamA 3774 6227 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_20170 6227 6739 gene locus_tag LOCUS_20180 6227 6739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 6827 7387 gene locus_tag LOCUS_20190 6827 7387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 7371 9086 gene locus_tag LOCUS_20200 7371 9086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 10134 9112 gene locus_tag LOCUS_20210 10134 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence130 <1 555 gene locus_tag LOCUS_20220 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042440436.1:ATP-dependent helicase HrpB 819 1736 gene locus_tag LOCUS_20230 819 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 3690 1822 gene locus_tag LOCUS_20240 3690 1822 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119127.1 protein_id gnl|my_center|LOCUS_20240 5231 3906 gene locus_tag LOCUS_20250 5231 3906 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_20250 5514 6761 gene locus_tag LOCUS_20260 gene rho 5514 6761 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_20260 6778 7266 gene locus_tag LOCUS_20270 6778 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 7279 8085 gene locus_tag LOCUS_20280 7279 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 >Feature sequence131 725 336 gene locus_tag LOCUS_20290 725 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 1216 1962 gene locus_tag LOCUS_20300 1216 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 2380 2799 gene locus_tag LOCUS_20310 2380 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 2822 3355 gene locus_tag LOCUS_20320 2822 3355 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905680.1 protein_id gnl|my_center|LOCUS_20320 5495 3522 gene locus_tag LOCUS_20330 5495 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 6255 5824 gene locus_tag LOCUS_20340 6255 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 6631 7353 gene locus_tag LOCUS_20350 6631 7353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 7545 9560 gene locus_tag LOCUS_20360 7545 9560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 9963 9646 gene locus_tag LOCUS_20370 9963 9646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 10196 10056 gene locus_tag LOCUS_20380 10196 10056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence132 1523 135 gene locus_tag LOCUS_20390 gene murC 1523 135 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_20390 3776 1587 gene locus_tag LOCUS_20400 3776 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 4759 3818 gene locus_tag LOCUS_20410 4759 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 4910 5983 gene locus_tag LOCUS_20420 4910 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 6159 7976 gene locus_tag LOCUS_20430 6159 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 9905 8022 gene locus_tag LOCUS_20440 9905 8022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence133 >Feature sequence134 414 977 gene locus_tag LOCUS_20450 414 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 1915 869 gene locus_tag LOCUS_20460 1915 869 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257479.1 protein_id gnl|my_center|LOCUS_20460 2837 2016 gene locus_tag LOCUS_20470 2837 2016 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_20470 3128 3931 gene locus_tag LOCUS_20480 3128 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 4065 5633 gene locus_tag LOCUS_20490 4065 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 5648 7729 gene locus_tag LOCUS_20500 gene fusA 5648 7729 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_20500 7788 8669 gene locus_tag LOCUS_20510 gene speB 7788 8669 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_20510 9192 8854 gene locus_tag LOCUS_20520 9192 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 >Feature sequence135 1 348 gene locus_tag LOCUS_20530 1 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 360 1373 gene locus_tag LOCUS_20540 360 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 3198 1465 gene locus_tag LOCUS_20550 3198 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 4413 3472 gene locus_tag LOCUS_20560 4413 3472 CDS product alanine-tRNA synthetase second additional domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816923.1 protein_id gnl|my_center|LOCUS_20560 4727 4410 gene locus_tag LOCUS_20570 4727 4410 CDS product DUF4387 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583697.1 protein_id gnl|my_center|LOCUS_20570 6093 4729 gene locus_tag LOCUS_20580 6093 4729 CDS product acyclic terpene utilization AtuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817377.1 protein_id gnl|my_center|LOCUS_20580 7343 6060 gene locus_tag LOCUS_20590 7343 6060 CDS product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817376.1 protein_id gnl|my_center|LOCUS_20590 8835 7390 gene locus_tag LOCUS_20600 8835 7390 CDS product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423320.1 protein_id gnl|my_center|LOCUS_20600 10021 8873 gene locus_tag LOCUS_20610 gene glmL 10021 8873 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167697.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence136 3051 3908 gene locus_tag LOCUS_20620 3051 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 4050 4643 gene locus_tag LOCUS_20630 4050 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 4798 5970 gene locus_tag LOCUS_20640 4798 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 5987 7240 gene locus_tag LOCUS_20650 5987 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 8033 7368 gene locus_tag LOCUS_20660 8033 7368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 8316 9074 gene locus_tag LOCUS_20670 8316 9074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence137 282 1214 gene locus_tag LOCUS_20680 282 1214 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026644807.1 protein_id gnl|my_center|LOCUS_20680 1360 4626 gene locus_tag LOCUS_20690 1360 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 4638 6359 gene locus_tag LOCUS_20700 4638 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 6463 7347 gene locus_tag LOCUS_20710 6463 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 9684 7360 gene locus_tag LOCUS_20720 9684 7360 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082972.1 protein_id gnl|my_center|LOCUS_20720 >Feature sequence138 <1 1896 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgcccccccgaagaggggcgac 2412 2122 gene locus_tag LOCUS_20730 gene cas2 2412 2122 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626042.1 protein_id gnl|my_center|LOCUS_20730 3451 2423 gene locus_tag LOCUS_20740 gene cas1c 3451 2423 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_20740 4068 3448 gene locus_tag LOCUS_20750 gene cas4 4068 3448 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176710.1 protein_id gnl|my_center|LOCUS_20750 4947 4084 gene locus_tag LOCUS_20760 gene cas7c 4947 4084 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932804.1 protein_id gnl|my_center|LOCUS_20760 6738 4960 gene locus_tag LOCUS_20770 gene cas8c 6738 4960 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926986.1 protein_id gnl|my_center|LOCUS_20770 7418 6735 gene locus_tag LOCUS_20780 gene cas5c 7418 6735 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932806.1 protein_id gnl|my_center|LOCUS_20780 9656 7434 gene locus_tag LOCUS_20790 gene cas3 9656 7434 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932807.1 protein_id gnl|my_center|LOCUS_20790 >Feature sequence139 2194 314 gene locus_tag LOCUS_20800 2194 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 2121 2378 gene locus_tag LOCUS_20810 2121 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 2537 3835 gene locus_tag LOCUS_20820 gene purB 2537 3835 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393548.1 protein_id gnl|my_center|LOCUS_20820 3841 4803 gene locus_tag LOCUS_20830 3841 4803 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681898.1 protein_id gnl|my_center|LOCUS_20830 4835 6241 gene locus_tag LOCUS_20840 gene purF 4835 6241 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_20840 6234 7217 gene locus_tag LOCUS_20850 6234 7217 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792172.1 protein_id gnl|my_center|LOCUS_20850 7214 8626 gene locus_tag LOCUS_20860 7214 8626 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_20860 8607 9656 gene locus_tag LOCUS_20870 8607 9656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 >Feature sequence140 907 569 gene locus_tag LOCUS_20880 907 569 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537736.1 protein_id gnl|my_center|LOCUS_20880 2657 1470 gene locus_tag LOCUS_20890 2657 1470 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933712.1 protein_id gnl|my_center|LOCUS_20890 5061 2881 gene locus_tag LOCUS_20900 5061 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 6381 5116 gene locus_tag LOCUS_20910 6381 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 6274 6594 gene locus_tag LOCUS_20920 6274 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 6860 8710 gene locus_tag LOCUS_20930 gene ftsH 6860 8710 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_20930 8726 9595 gene locus_tag LOCUS_20940 gene folP 8726 9595 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644433.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence141 360 91 gene locus_tag LOCUS_20950 360 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 2006 357 gene locus_tag LOCUS_20960 gene recJ 2006 357 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_20960 3608 2166 gene locus_tag LOCUS_20970 3608 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 5507 3618 gene locus_tag LOCUS_20980 5507 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 6001 5528 gene locus_tag LOCUS_20990 6001 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 6361 8205 gene locus_tag LOCUS_21000 6361 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence142 1300 1737 gene locus_tag LOCUS_21010 1300 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 1816 3906 gene locus_tag LOCUS_21020 1816 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 4020 6272 gene locus_tag LOCUS_21030 4020 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 6279 7541 gene locus_tag LOCUS_21040 6279 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 7658 9325 gene locus_tag LOCUS_21050 7658 9325 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791319.1 protein_id gnl|my_center|LOCUS_21050 9618 9418 gene locus_tag LOCUS_21060 9618 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence143 485 2086 gene locus_tag LOCUS_21070 485 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2096 3001 gene locus_tag LOCUS_21080 2096 3001 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466560.1 protein_id gnl|my_center|LOCUS_21080 4689 3322 gene locus_tag LOCUS_21090 4689 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 7205 4671 gene locus_tag LOCUS_21100 7205 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 8356 8787 gene locus_tag LOCUS_21110 8356 8787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 9452 8736 gene locus_tag LOCUS_21120 9452 8736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence144 1081 1530 gene locus_tag LOCUS_21130 1081 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 1670 4681 gene locus_tag LOCUS_21140 1670 4681 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_21140 8849 4758 gene locus_tag LOCUS_21150 8849 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence145 363 1583 gene locus_tag LOCUS_21160 gene arsB 363 1583 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_21160 1590 3212 gene locus_tag LOCUS_21170 1590 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 3255 4286 gene locus_tag LOCUS_21180 3255 4286 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922490.1 protein_id gnl|my_center|LOCUS_21180 4389 6107 gene locus_tag LOCUS_21190 4389 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 6216 6494 gene locus_tag LOCUS_21200 6216 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 6487 7317 gene locus_tag LOCUS_21210 6487 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 7324 7893 gene locus_tag LOCUS_21220 7324 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 7924 8766 gene locus_tag LOCUS_21230 gene cdaA 7924 8766 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_21230 >Feature sequence146 1296 16 gene locus_tag LOCUS_21240 1296 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 1577 2611 gene locus_tag LOCUS_21250 1577 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 2634 3092 gene locus_tag LOCUS_21260 2634 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 3089 3286 gene locus_tag LOCUS_21270 3089 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 3419 4708 gene locus_tag LOCUS_21280 3419 4708 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_21280 4705 7020 gene locus_tag LOCUS_21290 4705 7020 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_21290 7586 7008 gene locus_tag LOCUS_21300 7586 7008 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_21300 7837 9471 gene locus_tag LOCUS_21310 7837 9471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence147 356 907 gene locus_tag LOCUS_21320 356 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 911 2347 gene locus_tag LOCUS_21330 911 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 2351 4390 gene locus_tag LOCUS_21340 2351 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 4734 6452 gene locus_tag LOCUS_21350 4734 6452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 6465 7706 gene locus_tag LOCUS_21360 gene coaBC 6465 7706 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460556.1 protein_id gnl|my_center|LOCUS_21360 8494 7655 gene locus_tag LOCUS_21370 gene lgt 8494 7655 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204658.1 protein_id gnl|my_center|LOCUS_21370 >Feature sequence148 <1 1760 gene locus_tag LOCUS_21380 <1 1760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258200.1:chromosome condensation regulator RCC1 1947 2342 gene locus_tag LOCUS_21390 1947 2342 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932629.1 protein_id gnl|my_center|LOCUS_21390 2793 2359 gene locus_tag LOCUS_21400 2793 2359 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939303.1 protein_id gnl|my_center|LOCUS_21400 2998 4020 gene locus_tag LOCUS_21410 gene asd 2998 4020 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256126.1 protein_id gnl|my_center|LOCUS_21410 4024 5190 gene locus_tag LOCUS_21420 4024 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 5272 5712 gene locus_tag LOCUS_21430 5272 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 6099 6824 gene locus_tag LOCUS_21440 6099 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 7915 6989 gene locus_tag LOCUS_21450 7915 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 8115 9062 gene locus_tag LOCUS_21460 8115 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence149 2695 2300 gene locus_tag LOCUS_21470 2695 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 4321 2798 gene locus_tag LOCUS_21480 4321 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 5878 4325 gene locus_tag LOCUS_21490 5878 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 6134 5814 gene locus_tag LOCUS_21500 6134 5814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 8307 6169 gene locus_tag LOCUS_21510 8307 6169 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444553.1 protein_id gnl|my_center|LOCUS_21510 8851 8615 gene locus_tag LOCUS_21520 8851 8615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 8949 9125 gene locus_tag LOCUS_21530 8949 9125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 >Feature sequence150 <1 1549 gene locus_tag LOCUS_21540 <1 1549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258200.1:chromosome condensation regulator RCC1 1557 2234 gene locus_tag LOCUS_21550 1557 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 4172 2262 gene locus_tag LOCUS_21560 4172 2262 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224279.1 protein_id gnl|my_center|LOCUS_21560 4515 5054 gene locus_tag LOCUS_21570 4515 5054 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044348005.1 protein_id gnl|my_center|LOCUS_21570 5425 6420 gene locus_tag LOCUS_21580 5425 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 6417 6848 gene locus_tag LOCUS_21590 6417 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 7036 9228 gene locus_tag LOCUS_21600 7036 9228 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071095.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence151 3000 1444 gene locus_tag LOCUS_21610 3000 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 4224 3079 gene locus_tag LOCUS_21620 4224 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 6019 4232 gene locus_tag LOCUS_21630 gene ptsP 6019 4232 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_21630 6292 6026 gene locus_tag LOCUS_21640 6292 6026 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792685.1 protein_id gnl|my_center|LOCUS_21640 7183 6332 gene locus_tag LOCUS_21650 gene rapZ 7183 6332 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_21650 8158 7199 gene locus_tag LOCUS_21660 gene hprK 8158 7199 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942530.1 protein_id gnl|my_center|LOCUS_21660 >Feature sequence152 396 740 gene locus_tag LOCUS_21670 396 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 792 1004 gene locus_tag LOCUS_21680 792 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 1073 2122 gene locus_tag LOCUS_21690 1073 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 3446 2706 gene locus_tag LOCUS_21700 3446 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 4129 6699 gene locus_tag LOCUS_21710 4129 6699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 7891 6800 gene locus_tag LOCUS_21720 7891 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 9253 7964 gene locus_tag LOCUS_21730 9253 7964 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475806.1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence153 2852 831 gene locus_tag LOCUS_21740 2852 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 5034 2971 gene locus_tag LOCUS_21750 5034 2971 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770054.1 protein_id gnl|my_center|LOCUS_21750 6284 5169 gene locus_tag LOCUS_21760 6284 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 6607 6284 gene locus_tag LOCUS_21770 6607 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 7944 6733 gene locus_tag LOCUS_21780 7944 6733 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_21780 8270 9316 gene locus_tag LOCUS_21790 8270 9316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence154 339 1478 gene locus_tag LOCUS_21800 339 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 1688 2434 gene locus_tag LOCUS_21810 1688 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 2763 2527 gene locus_tag LOCUS_21820 2763 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 3974 2766 gene locus_tag LOCUS_21830 3974 2766 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940443.1 protein_id gnl|my_center|LOCUS_21830 4533 4021 gene locus_tag LOCUS_21840 4533 4021 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870310.1 protein_id gnl|my_center|LOCUS_21840 4910 4530 gene locus_tag LOCUS_21850 4910 4530 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940441.1 protein_id gnl|my_center|LOCUS_21850 5404 4970 gene locus_tag LOCUS_21860 5404 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 6348 5491 gene locus_tag LOCUS_21870 6348 5491 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938861.1 protein_id gnl|my_center|LOCUS_21870 8059 6341 gene locus_tag LOCUS_21880 8059 6341 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545733.1 protein_id gnl|my_center|LOCUS_21880 9009 8080 gene locus_tag LOCUS_21890 9009 8080 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937965.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence155 767 24 gene locus_tag LOCUS_21900 gene pgeF 767 24 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_21900 1006 1785 gene locus_tag LOCUS_21910 1006 1785 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870123.1 protein_id gnl|my_center|LOCUS_21910 1776 2531 gene locus_tag LOCUS_21920 1776 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 2498 4699 gene locus_tag LOCUS_21930 2498 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 4859 6115 gene locus_tag LOCUS_21940 4859 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 6201 7667 gene locus_tag LOCUS_21950 6201 7667 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_21950 7674 9002 gene locus_tag LOCUS_21960 7674 9002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 >Feature sequence156 <1 976 gene locus_tag LOCUS_21970 <1 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705015.1:DUF932 domain-containing protein 1418 1191 gene locus_tag LOCUS_21980 1418 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 1561 2343 gene locus_tag LOCUS_21990 1561 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 2350 4530 gene locus_tag LOCUS_22000 2350 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 4599 5567 gene locus_tag LOCUS_22010 4599 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 6323 5643 gene locus_tag LOCUS_22020 6323 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 6849 6304 gene locus_tag LOCUS_22030 6849 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 7062 7718 gene locus_tag LOCUS_22040 7062 7718 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966058.1 protein_id gnl|my_center|LOCUS_22040 8511 7792 gene locus_tag LOCUS_22050 8511 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 8887 8498 gene locus_tag LOCUS_22060 8887 8498 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_22060 >Feature sequence157 989 18 gene locus_tag LOCUS_22070 989 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 1539 994 gene locus_tag LOCUS_22080 gene fpvI 1539 994 CDS product pyoverdine signaling pathway sigma factor FpvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103620.1 protein_id gnl|my_center|LOCUS_22080 2776 1667 gene locus_tag LOCUS_22090 2776 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 2957 4195 gene locus_tag LOCUS_22100 2957 4195 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_22100 4271 5326 gene locus_tag LOCUS_22110 4271 5326 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062349.1 protein_id gnl|my_center|LOCUS_22110 5507 5283 gene locus_tag LOCUS_22120 5507 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 5801 5559 gene locus_tag LOCUS_22130 5801 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 6732 5842 gene locus_tag LOCUS_22140 6732 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 7121 6729 gene locus_tag LOCUS_22150 7121 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 7764 7111 gene locus_tag LOCUS_22160 7764 7111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 8321 7803 gene locus_tag LOCUS_22170 8321 7803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 >Feature sequence158 1176 232 gene locus_tag LOCUS_22180 1176 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 3809 1176 gene locus_tag LOCUS_22190 3809 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 4768 4049 gene locus_tag LOCUS_22200 4768 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 5237 4782 gene locus_tag LOCUS_22210 5237 4782 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200660.1 protein_id gnl|my_center|LOCUS_22210 5979 5314 gene locus_tag LOCUS_22220 5979 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 6991 6047 gene locus_tag LOCUS_22230 6991 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 7128 7203 gene locus_tag LOCUS_t00370 7128 7203 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 7203 7916 gene locus_tag LOCUS_22240 7203 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 >Feature sequence159 <1 2611 gene locus_tag LOCUS_22250 <1 2611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815782.1:alpha-2-macroglobulin 3706 3005 gene locus_tag LOCUS_22260 3706 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 5183 3981 gene locus_tag LOCUS_22270 gene alr 5183 3981 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982425.1 protein_id gnl|my_center|LOCUS_22270 6028 5174 gene locus_tag LOCUS_22280 6028 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 6029 6310 gene locus_tag LOCUS_22290 6029 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 7502 6336 gene locus_tag LOCUS_22300 gene orr 7502 6336 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_22300 7945 7499 gene locus_tag LOCUS_22310 7945 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 <8706 7958 gene locus_tag LOCUS_22320 <8706 7958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729850.1:sodium:solute symporter >Feature sequence160 <1 2566 gene locus_tag LOCUS_22330 <1 2566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479971.1:M66 family metalloprotease 2723 3919 gene locus_tag LOCUS_22340 2723 3919 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280517.1 protein_id gnl|my_center|LOCUS_22340 3925 4353 gene locus_tag LOCUS_22350 gene ndk 3925 4353 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883257.1 protein_id gnl|my_center|LOCUS_22350 4340 5449 gene locus_tag LOCUS_22360 4340 5449 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073191.1 protein_id gnl|my_center|LOCUS_22360 5436 8303 gene locus_tag LOCUS_22370 5436 8303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 >Feature sequence161 82 417 gene locus_tag LOCUS_22380 82 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 431 1780 gene locus_tag LOCUS_22390 431 1780 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_22390 1761 2870 gene locus_tag LOCUS_22400 1761 2870 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941973.1 protein_id gnl|my_center|LOCUS_22400 2962 4278 gene locus_tag LOCUS_22410 2962 4278 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_22410 4388 5920 gene locus_tag LOCUS_22420 4388 5920 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 protein_id gnl|my_center|LOCUS_22420 6679 5975 gene locus_tag LOCUS_22430 6679 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 6884 7942 gene locus_tag LOCUS_22440 6884 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 >Feature sequence162 607 1407 gene locus_tag LOCUS_22450 607 1407 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 protein_id gnl|my_center|LOCUS_22450 1631 3547 gene locus_tag LOCUS_22460 1631 3547 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_22460 3579 4868 gene locus_tag LOCUS_22470 3579 4868 CDS product ATP citrate lyase citrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932767.1 protein_id gnl|my_center|LOCUS_22470 4884 6758 gene locus_tag LOCUS_22480 4884 6758 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932766.1 protein_id gnl|my_center|LOCUS_22480 6906 7100 gene locus_tag LOCUS_22490 6906 7100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 7170 7763 gene locus_tag LOCUS_22500 7170 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 >Feature sequence163 3103 464 gene locus_tag LOCUS_22510 gene mutS 3103 464 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938938.1 protein_id gnl|my_center|LOCUS_22510 3488 3075 gene locus_tag LOCUS_22520 3488 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 4795 3485 gene locus_tag LOCUS_22530 gene ssnA 4795 3485 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906298.1 protein_id gnl|my_center|LOCUS_22530 6171 4777 gene locus_tag LOCUS_22540 gene hydA 6171 4777 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228420.1 protein_id gnl|my_center|LOCUS_22540 >Feature sequence164 <1 2784 gene locus_tag LOCUS_22550 <1 2784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942050.1:DNA polymerase III subunit alpha 4199 3084 gene locus_tag LOCUS_22560 4199 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 4254 5213 gene locus_tag LOCUS_22570 4254 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 5833 5201 gene locus_tag LOCUS_22580 5833 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 8226 5830 gene locus_tag LOCUS_22590 8226 5830 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143626.1 protein_id gnl|my_center|LOCUS_22590 >Feature sequence165 1117 614 gene locus_tag LOCUS_22600 1117 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 1449 1114 gene locus_tag LOCUS_22610 1449 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 1996 1442 gene locus_tag LOCUS_22620 1996 1442 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_22620 2193 2810 gene locus_tag LOCUS_22630 2193 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 2918 4696 gene locus_tag LOCUS_22640 gene aspS 2918 4696 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_22640 4778 6523 gene locus_tag LOCUS_22650 4778 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 7415 6609 gene locus_tag LOCUS_22660 gene mazG 7415 6609 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080649.1 protein_id gnl|my_center|LOCUS_22660 >Feature sequence166 372 935 gene locus_tag LOCUS_22670 gene efp 372 935 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810907.1 protein_id gnl|my_center|LOCUS_22670 947 2140 gene locus_tag LOCUS_22680 gene epmA 947 2140 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_22680 2145 2912 gene locus_tag LOCUS_22690 2145 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 2909 3451 gene locus_tag LOCUS_22700 2909 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 3444 3701 gene locus_tag LOCUS_22710 3444 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 3724 4365 gene locus_tag LOCUS_22720 gene pgsA 3724 4365 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249014.1 protein_id gnl|my_center|LOCUS_22720 4358 5782 gene locus_tag LOCUS_22730 4358 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 5772 6152 gene locus_tag LOCUS_22740 5772 6152 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112869.1 protein_id gnl|my_center|LOCUS_22740 6169 7512 gene locus_tag LOCUS_22750 6169 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 7509 7772 gene locus_tag LOCUS_22760 7509 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 8154 7942 gene locus_tag LOCUS_22770 8154 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 >Feature sequence167 <1 516 gene locus_tag LOCUS_22780 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120586.1:serine/threonine-protein kinase 1096 623 gene locus_tag LOCUS_22790 1096 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021936.1 protein_id gnl|my_center|LOCUS_22790 1551 1153 gene locus_tag LOCUS_22800 1551 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 1862 2857 gene locus_tag LOCUS_22810 1862 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 4146 2866 gene locus_tag LOCUS_22820 4146 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 4287 6200 gene locus_tag LOCUS_22830 4287 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 6340 8415 gene locus_tag LOCUS_22840 6340 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 >Feature sequence168 1286 348 gene locus_tag LOCUS_22850 gene porB 1286 348 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496444.1 protein_id gnl|my_center|LOCUS_22850 2458 1283 gene locus_tag LOCUS_22860 gene porA 2458 1283 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250933.1 protein_id gnl|my_center|LOCUS_22860 2751 2458 gene locus_tag LOCUS_22870 gene porD 2751 2458 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020092.1 protein_id gnl|my_center|LOCUS_22870 3307 2744 gene locus_tag LOCUS_22880 3307 2744 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_22880 3701 4996 gene locus_tag LOCUS_22890 3701 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 4993 6330 gene locus_tag LOCUS_22900 4993 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 6422 7723 gene locus_tag LOCUS_22910 6422 7723 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087700.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence169 1757 1023 gene locus_tag LOCUS_22920 1757 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 3955 1784 gene locus_tag LOCUS_22930 3955 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 5316 4165 gene locus_tag LOCUS_22940 5316 4165 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_22940 5933 5229 gene locus_tag LOCUS_22950 5933 5229 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545169.1 protein_id gnl|my_center|LOCUS_22950 6309 5986 gene locus_tag LOCUS_22960 6309 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 6215 6631 gene locus_tag LOCUS_22970 6215 6631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 6645 7400 gene locus_tag LOCUS_22980 6645 7400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 7610 7407 gene locus_tag LOCUS_22990 7610 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 >Feature sequence170 423 2075 gene locus_tag LOCUS_23000 423 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 2147 2977 gene locus_tag LOCUS_23010 2147 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 3088 6267 gene locus_tag LOCUS_23020 3088 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 7036 6476 gene locus_tag LOCUS_23030 7036 6476 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193543.1 protein_id gnl|my_center|LOCUS_23030 7360 7052 gene locus_tag LOCUS_23040 7360 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 >Feature sequence171 1311 40 gene locus_tag LOCUS_23050 1311 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 1929 1435 gene locus_tag LOCUS_23060 gene tpx 1929 1435 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538561.1 protein_id gnl|my_center|LOCUS_23060 2139 2390 gene locus_tag LOCUS_23070 2139 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 2387 4672 gene locus_tag LOCUS_23080 2387 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 4804 5670 gene locus_tag LOCUS_23090 4804 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 5795 7789 gene locus_tag LOCUS_23100 5795 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence172 1289 123 gene locus_tag LOCUS_23110 1289 123 CDS product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184801.1 protein_id gnl|my_center|LOCUS_23110 1505 3064 gene locus_tag LOCUS_23120 1505 3064 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470643.1 protein_id gnl|my_center|LOCUS_23120 3114 3527 gene locus_tag LOCUS_23130 3114 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 3949 3578 gene locus_tag LOCUS_23140 3949 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 4050 7244 gene locus_tag LOCUS_23150 4050 7244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 >Feature sequence173 2473 2030 gene locus_tag LOCUS_23160 2473 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 2623 4272 gene locus_tag LOCUS_23170 2623 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 4363 5781 gene locus_tag LOCUS_23180 4363 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 5952 6365 gene locus_tag LOCUS_23190 gene trxA 5952 6365 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 protein_id gnl|my_center|LOCUS_23190 6466 7359 gene locus_tag LOCUS_23200 6466 7359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 >Feature sequence174 1467 19 gene locus_tag LOCUS_23210 1467 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 2354 1527 gene locus_tag LOCUS_23220 2354 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 3896 2472 gene locus_tag LOCUS_23230 3896 2472 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006102898.1 protein_id gnl|my_center|LOCUS_23230 5418 3901 gene locus_tag LOCUS_23240 5418 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 7022 5433 gene locus_tag LOCUS_23250 7022 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence175 243 106 gene locus_tag LOCUS_23260 243 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 1018 767 gene locus_tag LOCUS_23270 1018 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 1322 4291 gene locus_tag LOCUS_23280 1322 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 4284 4844 gene locus_tag LOCUS_23290 4284 4844 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_23290 4849 5775 gene locus_tag LOCUS_23300 4849 5775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 5766 7028 gene locus_tag LOCUS_23310 5766 7028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 7961 7065 gene locus_tag LOCUS_23320 7961 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 >Feature sequence176 1177 1746 gene locus_tag LOCUS_23330 1177 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2935 1790 gene locus_tag LOCUS_23340 2935 1790 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144029.1 protein_id gnl|my_center|LOCUS_23340 3022 3744 gene locus_tag LOCUS_23350 3022 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 3762 4442 gene locus_tag LOCUS_23360 3762 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 5370 4501 gene locus_tag LOCUS_23370 5370 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 7313 5526 gene locus_tag LOCUS_23380 7313 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 >Feature sequence177 222 1976 gene locus_tag LOCUS_23390 222 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 1990 2868 gene locus_tag LOCUS_23400 1990 2868 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788072.1 protein_id gnl|my_center|LOCUS_23400 3874 2885 gene locus_tag LOCUS_23410 3874 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 4082 5764 gene locus_tag LOCUS_23420 4082 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 6067 5834 gene locus_tag LOCUS_23430 6067 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 6227 7273 gene locus_tag LOCUS_23440 6227 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 >Feature sequence178 2225 348 gene locus_tag LOCUS_23450 2225 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 2431 3093 gene locus_tag LOCUS_23460 2431 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 3395 6568 gene locus_tag LOCUS_23470 3395 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 >Feature sequence179 2182 680 gene locus_tag LOCUS_23480 2182 680 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258274.1 protein_id gnl|my_center|LOCUS_23480 3672 2326 gene locus_tag LOCUS_23490 3672 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 4340 3885 gene locus_tag LOCUS_23500 4340 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 4771 4394 gene locus_tag LOCUS_23510 4771 4394 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942008.1 protein_id gnl|my_center|LOCUS_23510 5528 4797 gene locus_tag LOCUS_23520 5528 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 7498 5660 gene locus_tag LOCUS_23530 7498 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 >Feature sequence180 2486 1314 gene locus_tag LOCUS_23540 2486 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 3021 2494 gene locus_tag LOCUS_23550 3021 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 3339 3139 gene locus_tag LOCUS_23560 3339 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 3699 3427 gene locus_tag LOCUS_23570 gene groES 3699 3427 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330007.1 protein_id gnl|my_center|LOCUS_23570 6013 3887 gene locus_tag LOCUS_23580 6013 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 7076 5988 gene locus_tag LOCUS_23590 gene hydE 7076 5988 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393236.1 protein_id gnl|my_center|LOCUS_23590 7500 7069 gene locus_tag LOCUS_23600 7500 7069 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479949.1 protein_id gnl|my_center|LOCUS_23600 >Feature sequence181 1226 420 gene locus_tag LOCUS_23610 1226 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 1486 3645 gene locus_tag LOCUS_23620 1486 3645 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_23620 4267 3671 gene locus_tag LOCUS_23630 4267 3671 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546826.1 protein_id gnl|my_center|LOCUS_23630 4471 4304 gene locus_tag LOCUS_23640 4471 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 4606 6114 gene locus_tag LOCUS_23650 4606 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 7021 6125 gene locus_tag LOCUS_23660 gene hslO 7021 6125 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943960.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence182 1 1206 gene locus_tag LOCUS_23670 1 1206 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020871.1 protein_id gnl|my_center|LOCUS_23670 1227 1802 gene locus_tag LOCUS_23680 gene pyrE 1227 1802 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940203.1 protein_id gnl|my_center|LOCUS_23680 1799 2476 gene locus_tag LOCUS_23690 1799 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 2489 3307 gene locus_tag LOCUS_23700 2489 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 3310 4134 gene locus_tag LOCUS_23710 3310 4134 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142331.1 protein_id gnl|my_center|LOCUS_23710 5163 4183 gene locus_tag LOCUS_23720 5163 4183 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943100.1 protein_id gnl|my_center|LOCUS_23720 6226 5189 gene locus_tag LOCUS_23730 6226 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 6436 7392 gene locus_tag LOCUS_23740 6436 7392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 >Feature sequence183 321 884 gene locus_tag LOCUS_23750 321 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 1092 2444 gene locus_tag LOCUS_23760 1092 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 3816 2584 gene locus_tag LOCUS_23770 gene hydF 3816 2584 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392791.1 protein_id gnl|my_center|LOCUS_23770 5204 3813 gene locus_tag LOCUS_23780 5204 3813 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939054.1 protein_id gnl|my_center|LOCUS_23780 6591 5221 gene locus_tag LOCUS_23790 gene hydG 6591 5221 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939053.1 protein_id gnl|my_center|LOCUS_23790 7335 6685 gene locus_tag LOCUS_23800 7335 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 >Feature sequence184 152 1534 gene locus_tag LOCUS_23810 152 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 3033 1612 gene locus_tag LOCUS_23820 3033 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 3262 3810 gene locus_tag LOCUS_23830 3262 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 5033 3843 gene locus_tag LOCUS_23840 5033 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 5211 6545 gene locus_tag LOCUS_23850 5211 6545 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141651.1 protein_id gnl|my_center|LOCUS_23850 7037 6675 gene locus_tag LOCUS_23860 7037 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 7376 7218 gene locus_tag LOCUS_23870 7376 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence185 1602 649 gene locus_tag LOCUS_23880 1602 649 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023359.1 protein_id gnl|my_center|LOCUS_23880 3651 1693 gene locus_tag LOCUS_23890 3651 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 6879 3754 gene locus_tag LOCUS_23900 6879 3754 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_23900 7030 7560 gene locus_tag LOCUS_23910 7030 7560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 >Feature sequence186 600 3041 gene locus_tag LOCUS_23920 600 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 3049 4452 gene locus_tag LOCUS_23930 3049 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 4483 6231 gene locus_tag LOCUS_23940 4483 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 6762 6337 gene locus_tag LOCUS_23950 6762 6337 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943826.1 protein_id gnl|my_center|LOCUS_23950 7097 6759 gene locus_tag LOCUS_23960 7097 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 >Feature sequence187 833 72 gene locus_tag LOCUS_23970 833 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 1571 2014 gene locus_tag LOCUS_23980 1571 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062537442.1 protein_id gnl|my_center|LOCUS_23980 2011 2784 gene locus_tag LOCUS_23990 2011 2784 CDS product DUF1829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213043995.1 protein_id gnl|my_center|LOCUS_23990 2845 4896 gene locus_tag LOCUS_24000 2845 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 7161 4927 gene locus_tag LOCUS_24010 7161 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence188 1382 2557 gene locus_tag LOCUS_24020 1382 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 3262 2561 gene locus_tag LOCUS_24030 3262 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 4267 3317 gene locus_tag LOCUS_24040 4267 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 4233 4859 gene locus_tag LOCUS_24050 4233 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 7209 4873 gene locus_tag LOCUS_24060 gene recG 7209 4873 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence189 67 642 gene locus_tag LOCUS_24070 67 642 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_24070 688 1131 gene locus_tag LOCUS_24080 688 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 1134 2627 gene locus_tag LOCUS_24090 1134 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 3814 2681 gene locus_tag LOCUS_24100 3814 2681 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270458.1 protein_id gnl|my_center|LOCUS_24100 5296 3854 gene locus_tag LOCUS_24110 5296 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 5655 5485 gene locus_tag LOCUS_24120 5655 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 7099 5687 gene locus_tag LOCUS_24130 7099 5687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 7287 7120 gene locus_tag LOCUS_24140 7287 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 7524 7449 gene locus_tag LOCUS_t00380 7524 7449 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence190 652 1203 gene locus_tag LOCUS_24150 652 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 1339 3408 gene locus_tag LOCUS_24160 1339 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 4869 3595 gene locus_tag LOCUS_24170 4869 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 6662 5001 gene locus_tag LOCUS_24180 6662 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 >Feature sequence191 539 2710 gene locus_tag LOCUS_24190 539 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 2707 3159 gene locus_tag LOCUS_24200 2707 3159 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_24200 3182 4732 gene locus_tag LOCUS_24210 3182 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 5227 4796 gene locus_tag LOCUS_24220 5227 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 5669 6817 gene locus_tag LOCUS_24230 5669 6817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 >Feature sequence192 2004 373 gene locus_tag LOCUS_24240 2004 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 3287 2094 gene locus_tag LOCUS_24250 3287 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 4465 3293 gene locus_tag LOCUS_24260 4465 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 5709 4492 gene locus_tag LOCUS_24270 5709 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 6922 5714 gene locus_tag LOCUS_24280 6922 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence193 1366 3477 gene locus_tag LOCUS_24290 1366 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 4201 3518 gene locus_tag LOCUS_24300 4201 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 4259 5731 gene locus_tag LOCUS_24310 4259 5731 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941686.1 protein_id gnl|my_center|LOCUS_24310 5728 6933 gene locus_tag LOCUS_24320 5728 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 >Feature sequence194 29 814 gene locus_tag LOCUS_24330 29 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 822 3218 gene locus_tag LOCUS_24340 822 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 3300 4619 gene locus_tag LOCUS_24350 3300 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 4790 7015 gene locus_tag LOCUS_24360 4790 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 >Feature sequence195 784 3048 gene locus_tag LOCUS_24370 784 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 3045 4409 gene locus_tag LOCUS_24380 3045 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 5358 4549 gene locus_tag LOCUS_24390 5358 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence196 3303 2131 gene locus_tag LOCUS_24400 3303 2131 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022798454.1 protein_id gnl|my_center|LOCUS_24400 5378 3300 gene locus_tag LOCUS_24410 5378 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 6664 5813 gene locus_tag LOCUS_24420 6664 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 7428 6661 gene locus_tag LOCUS_24430 7428 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 >Feature sequence197 3229 428 gene locus_tag LOCUS_24440 3229 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 4495 3305 gene locus_tag LOCUS_24450 4495 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 6388 4544 gene locus_tag LOCUS_24460 6388 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 >Feature sequence198 1234 449 gene locus_tag LOCUS_24470 1234 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 1658 1215 gene locus_tag LOCUS_24480 1658 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 2899 1667 gene locus_tag LOCUS_24490 gene gspF 2899 1667 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070565.1 protein_id gnl|my_center|LOCUS_24490 4679 2913 gene locus_tag LOCUS_24500 4679 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 7354 4685 gene locus_tag LOCUS_24510 gene gspD 7354 4685 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940997.1 protein_id gnl|my_center|LOCUS_24510 >Feature sequence199 518 201 gene locus_tag LOCUS_24520 gene trxA 518 201 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125291.1 protein_id gnl|my_center|LOCUS_24520 749 1231 gene locus_tag LOCUS_24530 749 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 1367 4525 gene locus_tag LOCUS_24540 1367 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 4639 5274 gene locus_tag LOCUS_24550 4639 5274 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809919.1 protein_id gnl|my_center|LOCUS_24550 >Feature sequence200 <1 515 gene locus_tag LOCUS_24560 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268572.1:NAD(P)H-dependent oxidoreductase 568 855 gene locus_tag LOCUS_24570 568 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 3021 856 gene locus_tag LOCUS_24580 3021 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 3187 3609 gene locus_tag LOCUS_24590 gene arfB 3187 3609 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387858.1 protein_id gnl|my_center|LOCUS_24590 7159 3629 gene locus_tag LOCUS_24600 7159 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 >Feature sequence201 899 147 gene locus_tag LOCUS_24610 899 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 1569 982 gene locus_tag LOCUS_24620 1569 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 3145 1571 gene locus_tag LOCUS_24630 3145 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 3281 3799 gene locus_tag LOCUS_24640 3281 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 3772 4119 gene locus_tag LOCUS_24650 3772 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 4116 4973 gene locus_tag LOCUS_24660 4116 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 6271 5009 gene locus_tag LOCUS_24670 6271 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 7217 6327 gene locus_tag LOCUS_24680 7217 6327 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940333.1 protein_id gnl|my_center|LOCUS_24680 >Feature sequence202 2726 1716 gene locus_tag LOCUS_24690 2726 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 2897 3496 gene locus_tag LOCUS_24700 2897 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 3509 4435 gene locus_tag LOCUS_24710 3509 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 5894 4419 gene locus_tag LOCUS_24720 5894 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 7164 6007 gene locus_tag LOCUS_24730 7164 6007 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584144.1 protein_id gnl|my_center|LOCUS_24730 >Feature sequence203 1626 199 gene locus_tag LOCUS_24740 1626 199 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_24740 1547 1804 gene locus_tag LOCUS_24750 1547 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 4017 1765 gene locus_tag LOCUS_24760 4017 1765 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072577.1 protein_id gnl|my_center|LOCUS_24760 <7328 4154 gene locus_tag LOCUS_24770 <7328 4154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957294.1:ankyrin repeat domain-containing protein >Feature sequence204 2 1060 gene locus_tag LOCUS_24780 2 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 1057 1665 gene locus_tag LOCUS_24790 1057 1665 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869131.1 protein_id gnl|my_center|LOCUS_24790 1672 2619 gene locus_tag LOCUS_24800 1672 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 2629 2970 gene locus_tag LOCUS_24810 2629 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 3916 2945 gene locus_tag LOCUS_24820 3916 2945 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529823.1 protein_id gnl|my_center|LOCUS_24820 4074 5702 gene locus_tag LOCUS_24830 gene pruA 4074 5702 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404266.1 protein_id gnl|my_center|LOCUS_24830 5760 6812 gene locus_tag LOCUS_24840 5760 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 >Feature sequence205 954 1619 gene locus_tag LOCUS_24850 954 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 1632 2651 gene locus_tag LOCUS_24860 1632 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 3839 2676 gene locus_tag LOCUS_24870 3839 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 5016 3991 gene locus_tag LOCUS_24880 5016 3991 CDS product putative manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439447.1 protein_id gnl|my_center|LOCUS_24880 5567 5106 gene locus_tag LOCUS_24890 5567 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 5738 6340 gene locus_tag LOCUS_24900 5738 6340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 >Feature sequence206 1310 312 gene locus_tag LOCUS_24910 gene amrB 1310 312 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_24910 2839 1403 gene locus_tag LOCUS_24920 2839 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 2920 4698 gene locus_tag LOCUS_24930 2920 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 4769 5695 gene locus_tag LOCUS_24940 4769 5695 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_24940 6372 5785 gene locus_tag LOCUS_24950 6372 5785 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_24950 6854 6384 gene locus_tag LOCUS_24960 6854 6384 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_24960 >Feature sequence207 947 1648 gene locus_tag LOCUS_24970 947 1648 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_24970 1699 2472 gene locus_tag LOCUS_24980 1699 2472 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394583.1 protein_id gnl|my_center|LOCUS_24980 2487 3602 gene locus_tag LOCUS_24990 gene dnaJ 2487 3602 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940501.1 protein_id gnl|my_center|LOCUS_24990 3815 6970 gene locus_tag LOCUS_25000 3815 6970 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224245890.1 protein_id gnl|my_center|LOCUS_25000 >Feature sequence208 405 620 gene locus_tag LOCUS_25010 405 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 991 830 gene locus_tag LOCUS_25020 991 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 1203 2111 gene locus_tag LOCUS_25030 1203 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 2521 3978 gene locus_tag LOCUS_25040 2521 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 4955 4107 gene locus_tag LOCUS_25050 4955 4107 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_25050 6622 4955 gene locus_tag LOCUS_25060 6622 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 <7222 6619 gene locus_tag LOCUS_25070 <7222 6619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887206.1:extracellular solute-binding protein >Feature sequence209 385 1743 gene locus_tag LOCUS_25080 385 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 1955 3040 gene locus_tag LOCUS_25090 1955 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 3113 4180 gene locus_tag LOCUS_25100 3113 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 4197 4790 gene locus_tag LOCUS_25110 4197 4790 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107707.1 protein_id gnl|my_center|LOCUS_25110 4790 7072 gene locus_tag LOCUS_25120 4790 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 >Feature sequence210 2048 870 gene locus_tag LOCUS_25130 2048 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 3072 2077 gene locus_tag LOCUS_25140 3072 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 4720 3077 gene locus_tag LOCUS_25150 gene ffh 4720 3077 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903281.1 protein_id gnl|my_center|LOCUS_25150 5752 4739 gene locus_tag LOCUS_25160 5752 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 7077 5764 gene locus_tag LOCUS_25170 7077 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence211 391 957 gene locus_tag LOCUS_25180 391 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 1062 1436 gene locus_tag LOCUS_25190 1062 1436 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_25190 1644 2225 gene locus_tag LOCUS_25200 1644 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 3430 2306 gene locus_tag LOCUS_25210 3430 2306 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_25210 3852 3628 gene locus_tag LOCUS_25220 3852 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 4265 5599 gene locus_tag LOCUS_25230 4265 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 5801 6469 gene locus_tag LOCUS_25240 5801 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 6743 6381 gene locus_tag LOCUS_25250 6743 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 >Feature sequence212 17 844 gene locus_tag LOCUS_25260 17 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 976 2226 gene locus_tag LOCUS_25270 976 2226 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_25270 2248 3363 gene locus_tag LOCUS_25280 2248 3363 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969607.1 protein_id gnl|my_center|LOCUS_25280 4172 3372 gene locus_tag LOCUS_25290 4172 3372 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963914.1 protein_id gnl|my_center|LOCUS_25290 6117 4204 gene locus_tag LOCUS_25300 6117 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 7016 6126 gene locus_tag LOCUS_25310 7016 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 >Feature sequence213 2746 926 gene locus_tag LOCUS_25320 2746 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 3030 4139 gene locus_tag LOCUS_25330 3030 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107436.1 protein_id gnl|my_center|LOCUS_25330 4159 5247 gene locus_tag LOCUS_25340 4159 5247 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765630.1 protein_id gnl|my_center|LOCUS_25340 5653 5258 gene locus_tag LOCUS_25350 5653 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 5876 6085 gene locus_tag LOCUS_25360 5876 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 6082 6504 gene locus_tag LOCUS_25370 6082 6504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 6801 6529 gene locus_tag LOCUS_25380 6801 6529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 >Feature sequence214 2255 837 gene locus_tag LOCUS_25390 2255 837 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865209.1 protein_id gnl|my_center|LOCUS_25390 2331 4193 gene locus_tag LOCUS_25400 2331 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 5484 4858 gene locus_tag LOCUS_25410 5484 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 5798 6004 gene locus_tag LOCUS_25420 5798 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 6922 6311 gene locus_tag LOCUS_25430 6922 6311 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249791.1 protein_id gnl|my_center|LOCUS_25430 >Feature sequence215 6947 1983 gene locus_tag LOCUS_25440 6947 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 >Feature sequence216 987 214 gene locus_tag LOCUS_25450 987 214 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772043.1 protein_id gnl|my_center|LOCUS_25450 1388 1059 gene locus_tag LOCUS_25460 1388 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 1572 1790 gene locus_tag LOCUS_25470 1572 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 2182 3501 gene locus_tag LOCUS_25480 2182 3501 CDS product IS4-like element ISDha5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808317.1 protein_id gnl|my_center|LOCUS_25480 4049 3600 gene locus_tag LOCUS_25490 4049 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 4545 4063 gene locus_tag LOCUS_25500 4545 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 <6870 5128 gene locus_tag LOCUS_25510 <6870 5128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000015200.1:rhs element protein RhsC >Feature sequence217 2263 1100 gene locus_tag LOCUS_25520 2263 1100 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929363.1 protein_id gnl|my_center|LOCUS_25520 2826 2275 gene locus_tag LOCUS_25530 2826 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 5680 2798 gene locus_tag LOCUS_25540 5680 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 6093 5677 gene locus_tag LOCUS_25550 6093 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 6734 6090 gene locus_tag LOCUS_25560 6734 6090 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_25560 >Feature sequence218 78 1538 gene locus_tag LOCUS_25570 78 1538 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_25570 1554 3764 gene locus_tag LOCUS_25580 1554 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 3959 5281 gene locus_tag LOCUS_25590 3959 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 5323 6594 gene locus_tag LOCUS_25600 5323 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 6672 6746 gene locus_tag LOCUS_t00390 6672 6746 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6754 6827 gene locus_tag LOCUS_t00400 6754 6827 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence219 580 158 gene locus_tag LOCUS_25610 gene glmS 580 158 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710390.1 protein_id gnl|my_center|LOCUS_25610 1566 577 gene locus_tag LOCUS_25620 1566 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 1812 3854 gene locus_tag LOCUS_25630 1812 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 3957 5849 gene locus_tag LOCUS_25640 3957 5849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 >Feature sequence220 1292 666 gene locus_tag LOCUS_25650 1292 666 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939535.1 protein_id gnl|my_center|LOCUS_25650 1994 1335 gene locus_tag LOCUS_25660 gene rplC 1994 1335 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892823.1 protein_id gnl|my_center|LOCUS_25660 2206 4284 gene locus_tag LOCUS_25670 2206 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 >Feature sequence221 4986 3637 gene locus_tag LOCUS_25680 4986 3637 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255954.1 protein_id gnl|my_center|LOCUS_25680 5751 5047 gene locus_tag LOCUS_25690 5751 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence222 56 880 gene locus_tag LOCUS_25700 56 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 1027 1407 gene locus_tag LOCUS_25710 1027 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 1519 2052 gene locus_tag LOCUS_25720 1519 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 2070 3272 gene locus_tag LOCUS_25730 2070 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 3276 3833 gene locus_tag LOCUS_25740 3276 3833 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084194.1 protein_id gnl|my_center|LOCUS_25740 5008 4100 gene locus_tag LOCUS_25750 5008 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 5181 5579 gene locus_tag LOCUS_25760 5181 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 5585 6373 gene locus_tag LOCUS_25770 5585 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 >Feature sequence223 95 1492 gene locus_tag LOCUS_25780 gene rmuC 95 1492 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478725.1 protein_id gnl|my_center|LOCUS_25780 2272 1493 gene locus_tag LOCUS_25790 2272 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 2892 2269 gene locus_tag LOCUS_25800 2892 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 3601 2978 gene locus_tag LOCUS_25810 3601 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 5002 3629 gene locus_tag LOCUS_25820 5002 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 5144 5767 gene locus_tag LOCUS_25830 5144 5767 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483174.1 protein_id gnl|my_center|LOCUS_25830 <6749 5788 gene locus_tag LOCUS_25840 <6749 5788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096849.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence224 195 1982 gene locus_tag LOCUS_25850 195 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 3153 1987 gene locus_tag LOCUS_25860 gene corA 3153 1987 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_25860 3916 3290 gene locus_tag LOCUS_25870 3916 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 4125 5123 gene locus_tag LOCUS_25880 4125 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 5230 6420 gene locus_tag LOCUS_25890 5230 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 >Feature sequence225 1572 679 gene locus_tag LOCUS_25900 gene lipA 1572 679 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174105.1 protein_id gnl|my_center|LOCUS_25900 2411 1569 gene locus_tag LOCUS_25910 2411 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 2613 3305 gene locus_tag LOCUS_25920 2613 3305 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944972.1 protein_id gnl|my_center|LOCUS_25920 3310 4065 gene locus_tag LOCUS_25930 3310 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 4074 4364 gene locus_tag LOCUS_25940 4074 4364 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324359.1 protein_id gnl|my_center|LOCUS_25940 4392 5870 gene locus_tag LOCUS_25950 4392 5870 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075647.1 protein_id gnl|my_center|LOCUS_25950 >Feature sequence226 1344 382 gene locus_tag LOCUS_25960 1344 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 2016 1369 gene locus_tag LOCUS_25970 2016 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 2167 3162 gene locus_tag LOCUS_25980 gene holA 2167 3162 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942847.1 protein_id gnl|my_center|LOCUS_25980 3896 3210 gene locus_tag LOCUS_25990 3896 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 4630 3989 gene locus_tag LOCUS_26000 gene udk 4630 3989 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986880.1 protein_id gnl|my_center|LOCUS_26000 <6701 4660 gene locus_tag LOCUS_26010 <6701 4660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942167.1:phenylalanine--tRNA ligase subunit beta >Feature sequence227 1131 49 gene locus_tag LOCUS_26020 1131 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 1319 3580 gene locus_tag LOCUS_26030 1319 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 3986 3693 gene locus_tag LOCUS_26040 3986 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 4034 4357 gene locus_tag LOCUS_26050 4034 4357 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091383635.1 protein_id gnl|my_center|LOCUS_26050 5660 4506 gene locus_tag LOCUS_26060 5660 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 <6680 5814 gene locus_tag LOCUS_26070 <6680 5814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004531095.1:phosphodiesterase >Feature sequence228 2300 1584 gene locus_tag LOCUS_26080 2300 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 3063 2506 gene locus_tag LOCUS_26090 3063 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 4869 3214 gene locus_tag LOCUS_26100 4869 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 5603 5007 gene locus_tag LOCUS_26110 5603 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 >Feature sequence229 2308 1034 gene locus_tag LOCUS_26120 2308 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 5896 2411 gene locus_tag LOCUS_26130 gene mfd 5896 2411 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence230 1453 1058 gene locus_tag LOCUS_26140 1453 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 2077 1529 gene locus_tag LOCUS_26150 2077 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 2541 4358 gene locus_tag LOCUS_26160 2541 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 6032 4812 gene locus_tag LOCUS_26170 6032 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 >Feature sequence231 1138 566 gene locus_tag LOCUS_26180 1138 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 2112 1135 gene locus_tag LOCUS_26190 gene murB 2112 1135 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_26190 2211 3737 gene locus_tag LOCUS_26200 2211 3737 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500125.1 protein_id gnl|my_center|LOCUS_26200 3725 4801 gene locus_tag LOCUS_26210 3725 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 5200 5991 gene locus_tag LOCUS_26220 5200 5991 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648699.1 protein_id gnl|my_center|LOCUS_26220 >Feature sequence232 <1 1283 gene locus_tag LOCUS_26230 <1 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256390.1:Stk1 family PASTA domain-containing Ser/Thr kinase 1361 3094 gene locus_tag LOCUS_26240 1361 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 3233 4663 gene locus_tag LOCUS_26250 3233 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 5125 4691 gene locus_tag LOCUS_26260 5125 4691 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791034.1 protein_id gnl|my_center|LOCUS_26260 5741 5157 gene locus_tag LOCUS_26270 5741 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 <6555 5738 gene locus_tag LOCUS_26280 <6555 5738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000892682.1:patatin family protein >Feature sequence233 283 2274 gene locus_tag LOCUS_26290 gene nuoF 283 2274 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817338.1 protein_id gnl|my_center|LOCUS_26290 2286 4004 gene locus_tag LOCUS_26300 2286 4004 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_26300 3994 5997 gene locus_tag LOCUS_26310 3994 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 6013 6402 gene locus_tag LOCUS_26320 6013 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 >Feature sequence234 222 4028 gene locus_tag LOCUS_26330 222 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 6260 4077 gene locus_tag LOCUS_26340 6260 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence235 1964 648 gene locus_tag LOCUS_26350 1964 648 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152423784.1 protein_id gnl|my_center|LOCUS_26350 2694 2050 gene locus_tag LOCUS_26360 2694 2050 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_26360 2935 3522 gene locus_tag LOCUS_26370 gene rsmD 2935 3522 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241227.1 protein_id gnl|my_center|LOCUS_26370 3485 3976 gene locus_tag LOCUS_26380 gene coaD 3485 3976 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941899.1 protein_id gnl|my_center|LOCUS_26380 4909 4007 gene locus_tag LOCUS_26390 4909 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 6308 4944 gene locus_tag LOCUS_26400 6308 4944 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_26400 >Feature sequence236 2563 632 gene locus_tag LOCUS_26410 2563 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 4883 2676 gene locus_tag LOCUS_26420 4883 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 5407 5219 gene locus_tag LOCUS_26430 5407 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 >Feature sequence237 1156 2157 gene locus_tag LOCUS_26440 1156 2157 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680714.1 protein_id gnl|my_center|LOCUS_26440 2268 2759 gene locus_tag LOCUS_26450 2268 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 3544 2795 gene locus_tag LOCUS_26460 3544 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 4456 3734 gene locus_tag LOCUS_26470 4456 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 6299 4710 gene locus_tag LOCUS_26480 6299 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 >Feature sequence238 1654 2739 gene locus_tag LOCUS_26490 1654 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 2771 3103 gene locus_tag LOCUS_26500 2771 3103 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878370.1 protein_id gnl|my_center|LOCUS_26500 3108 3566 gene locus_tag LOCUS_26510 3108 3566 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207496.1 protein_id gnl|my_center|LOCUS_26510 3756 4592 gene locus_tag LOCUS_26520 3756 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 4685 5953 gene locus_tag LOCUS_26530 4685 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 6291 5983 gene locus_tag LOCUS_26540 6291 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 >Feature sequence239 86 646 gene locus_tag LOCUS_26550 86 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 677 1372 gene locus_tag LOCUS_26560 677 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679004.1 protein_id gnl|my_center|LOCUS_26560 3449 1341 gene locus_tag LOCUS_26570 3449 1341 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_26570 4065 3439 gene locus_tag LOCUS_26580 gene gmk 4065 3439 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938199.1 protein_id gnl|my_center|LOCUS_26580 4941 4069 gene locus_tag LOCUS_26590 4941 4069 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942879.1 protein_id gnl|my_center|LOCUS_26590 5082 5771 gene locus_tag LOCUS_26600 5082 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 5781 6197 gene locus_tag LOCUS_26610 5781 6197 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933077.1 protein_id gnl|my_center|LOCUS_26610 >Feature sequence240 1983 31 gene locus_tag LOCUS_26620 1983 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 2591 2061 gene locus_tag LOCUS_26630 2591 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 3549 2578 gene locus_tag LOCUS_26640 3549 2578 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140221.1 protein_id gnl|my_center|LOCUS_26640 6209 3513 gene locus_tag LOCUS_26650 6209 3513 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_26650 >Feature sequence241 257 1957 gene locus_tag LOCUS_26660 257 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 2324 4060 gene locus_tag LOCUS_26670 2324 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 4170 4544 gene locus_tag LOCUS_26680 4170 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 4902 6104 gene locus_tag LOCUS_26690 4902 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 >Feature sequence242 255 620 gene locus_tag LOCUS_26700 255 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 1040 1159 gene locus_tag LOCUS_26710 1040 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 2923 1283 gene locus_tag LOCUS_26720 2923 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 3526 3200 gene locus_tag LOCUS_26730 3526 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 4554 4751 gene locus_tag LOCUS_26740 4554 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 4830 5081 gene locus_tag LOCUS_26750 4830 5081 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_26750 5259 5417 gene locus_tag LOCUS_26760 5259 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26760 >Feature sequence243 3012 526 gene locus_tag LOCUS_26770 3012 526 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784260.1 protein_id gnl|my_center|LOCUS_26770 3793 3017 gene locus_tag LOCUS_26780 gene rlmB 3793 3017 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393958.1 protein_id gnl|my_center|LOCUS_26780 4527 3790 gene locus_tag LOCUS_26790 gene pyrF 4527 3790 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942107.1 protein_id gnl|my_center|LOCUS_26790 6008 4539 gene locus_tag LOCUS_26800 6008 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 >Feature sequence244 923 348 gene locus_tag LOCUS_26810 923 348 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869337.1 protein_id gnl|my_center|LOCUS_26810 1679 936 gene locus_tag LOCUS_26820 1679 936 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_26820 2764 1676 gene locus_tag LOCUS_26830 2764 1676 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869339.1 protein_id gnl|my_center|LOCUS_26830 3007 2774 gene locus_tag LOCUS_26840 3007 2774 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869641.1 protein_id gnl|my_center|LOCUS_26840 3801 3055 gene locus_tag LOCUS_26850 3801 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420704.1 protein_id gnl|my_center|LOCUS_26850 6130 3962 gene locus_tag LOCUS_26860 6130 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 >Feature sequence245 515 1531 gene locus_tag LOCUS_26870 515 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 1657 3591 gene locus_tag LOCUS_26880 1657 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 >Feature sequence246 2803 1961 gene locus_tag LOCUS_26890 2803 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 3282 2800 gene locus_tag LOCUS_26900 3282 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 4087 3293 gene locus_tag LOCUS_26910 4087 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 4273 5733 gene locus_tag LOCUS_26920 4273 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 >Feature sequence247 980 2737 gene locus_tag LOCUS_26930 980 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 2807 4270 gene locus_tag LOCUS_26940 2807 4270 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175182.1 protein_id gnl|my_center|LOCUS_26940 4267 4779 gene locus_tag LOCUS_26950 4267 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 >Feature sequence248 3532 4134 gene locus_tag LOCUS_26960 3532 4134 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230856.1 protein_id gnl|my_center|LOCUS_26960 4131 5525 gene locus_tag LOCUS_26970 4131 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence249 2 1123 gene locus_tag LOCUS_26980 2 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 1123 1371 gene locus_tag LOCUS_26990 1123 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 1551 2186 gene locus_tag LOCUS_27000 1551 2186 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894436.1 protein_id gnl|my_center|LOCUS_27000 2289 2948 gene locus_tag LOCUS_27010 2289 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 2961 3515 gene locus_tag LOCUS_27020 2961 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 4228 3617 gene locus_tag LOCUS_27030 gene recR 4228 3617 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058038.1 protein_id gnl|my_center|LOCUS_27030 4578 4237 gene locus_tag LOCUS_27040 4578 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 <6082 4591 gene locus_tag LOCUS_27050 <6082 4591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940771.1:DNA polymerase III subunit gamma/tau >Feature sequence250 509 2782 gene locus_tag LOCUS_27060 509 2782 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546134.1 protein_id gnl|my_center|LOCUS_27060 2789 4426 gene locus_tag LOCUS_27070 gene cysS 2789 4426 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_27070 4429 5055 gene locus_tag LOCUS_27080 4429 5055 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918417.1 protein_id gnl|my_center|LOCUS_27080 >Feature sequence251 2301 1624 gene locus_tag LOCUS_27090 gene lipB 2301 1624 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 protein_id gnl|my_center|LOCUS_27090 3371 2286 gene locus_tag LOCUS_27100 3371 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 4577 3519 gene locus_tag LOCUS_27110 4577 3519 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409666.1 protein_id gnl|my_center|LOCUS_27110 4991 4611 gene locus_tag LOCUS_27120 4991 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 5779 5024 gene locus_tag LOCUS_27130 5779 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 >Feature sequence252 2169 217 gene locus_tag LOCUS_27140 gene acs 2169 217 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529021.1 protein_id gnl|my_center|LOCUS_27140 2609 3862 gene locus_tag LOCUS_27150 gene pepT 2609 3862 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401270.1 protein_id gnl|my_center|LOCUS_27150 3875 5959 gene locus_tag LOCUS_27160 3875 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 >Feature sequence253 698 1417 gene locus_tag LOCUS_27170 698 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 1574 2542 gene locus_tag LOCUS_27180 gene mdtA 1574 2542 CDS product multidrug efflux RND transporter subunit MdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678939.1 protein_id gnl|my_center|LOCUS_27180 2539 5631 gene locus_tag LOCUS_27190 2539 5631 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_27190 >Feature sequence254 915 739 gene locus_tag LOCUS_27200 915 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 1283 924 gene locus_tag LOCUS_27210 1283 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 3517 1298 gene locus_tag LOCUS_27220 3517 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 3746 4063 gene locus_tag LOCUS_27230 3746 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 4380 3949 gene locus_tag LOCUS_27240 4380 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 >Feature sequence255 341 1189 gene locus_tag LOCUS_27250 gene nifU 341 1189 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942655.1 protein_id gnl|my_center|LOCUS_27250 1211 2386 gene locus_tag LOCUS_27260 gene nifS 1211 2386 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_27260 2512 3063 gene locus_tag LOCUS_27270 2512 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 4446 3205 gene locus_tag LOCUS_27280 4446 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 5836 4421 gene locus_tag LOCUS_27290 5836 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 >Feature sequence256 <1 801 gene locus_tag LOCUS_27300 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970013.1:Flp pilus assembly protein CpaB 818 1660 gene locus_tag LOCUS_27310 818 1660 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136348290.1 protein_id gnl|my_center|LOCUS_27310 1663 2538 gene locus_tag LOCUS_27320 1663 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 2539 3948 gene locus_tag LOCUS_27330 2539 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 >Feature sequence257 655 1977 gene locus_tag LOCUS_27340 655 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 1970 3853 gene locus_tag LOCUS_27350 gene nuoF 1970 3853 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_27350 3853 5841 gene locus_tag LOCUS_27360 3853 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 >Feature sequence258 653 1957 gene locus_tag LOCUS_27370 653 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 1950 3836 gene locus_tag LOCUS_27380 gene nuoF 1950 3836 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_27380 3836 5824 gene locus_tag LOCUS_27390 3836 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 >Feature sequence259 <1 596 gene locus_tag LOCUS_27400 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057478.1:endonuclease III 665 1621 gene locus_tag LOCUS_27410 665 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 1624 1992 gene locus_tag LOCUS_27420 1624 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 1989 2783 gene locus_tag LOCUS_27430 1989 2783 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407737.1 protein_id gnl|my_center|LOCUS_27430 4460 2796 gene locus_tag LOCUS_27440 4460 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 <5935 4652 gene locus_tag LOCUS_27450 <5935 4652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_147373220.1:glutamate--tRNA ligase >Feature sequence260 <1 1990 gene locus_tag LOCUS_27460 <1 1990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037624.1:PilC/PilY family type IV pilus protein 1968 2462 gene locus_tag LOCUS_27470 1968 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 2459 3517 gene locus_tag LOCUS_27480 2459 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 3517 4062 gene locus_tag LOCUS_27490 3517 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 4112 4789 gene locus_tag LOCUS_27500 4112 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 4794 5873 gene locus_tag LOCUS_27510 4794 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 >Feature sequence261 700 1350 gene locus_tag LOCUS_27520 700 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 1343 2635 gene locus_tag LOCUS_27530 1343 2635 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566866.1 protein_id gnl|my_center|LOCUS_27530 2664 3911 gene locus_tag LOCUS_27540 2664 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 4313 4086 gene locus_tag LOCUS_27550 4313 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 >Feature sequence262 819 232 gene locus_tag LOCUS_27560 819 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 2124 829 gene locus_tag LOCUS_27570 2124 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 3192 2197 gene locus_tag LOCUS_27580 3192 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 3856 3332 gene locus_tag LOCUS_27590 3856 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 3818 4912 gene locus_tag LOCUS_27600 3818 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 <5808 5135 gene locus_tag LOCUS_27610 <5808 5135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000027757.1:site-specific integrase >Feature sequence263 1958 573 gene locus_tag LOCUS_27620 1958 573 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253024.1 protein_id gnl|my_center|LOCUS_27620 2395 4392 gene locus_tag LOCUS_27630 2395 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 4464 5426 gene locus_tag LOCUS_27640 gene fni 4464 5426 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875688.1 protein_id gnl|my_center|LOCUS_27640 >Feature sequence264 1612 275 gene locus_tag LOCUS_27650 gene rsxC 1612 275 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_27650 2529 1609 gene locus_tag LOCUS_27660 2529 1609 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355995.1 protein_id gnl|my_center|LOCUS_27660 3113 2535 gene locus_tag LOCUS_27670 gene rsxA 3113 2535 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_27670 4723 3251 gene locus_tag LOCUS_27680 4723 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 5619 4738 gene locus_tag LOCUS_27690 5619 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence265 1979 3 gene locus_tag LOCUS_27700 1979 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 2212 3483 gene locus_tag LOCUS_27710 2212 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 >Feature sequence266 685 1344 gene locus_tag LOCUS_27720 685 1344 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918895.1 protein_id gnl|my_center|LOCUS_27720 1500 3335 gene locus_tag LOCUS_27730 1500 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 4817 3432 gene locus_tag LOCUS_27740 4817 3432 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_27740 5590 4841 gene locus_tag LOCUS_27750 5590 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 >Feature sequence267 2104 1361 gene locus_tag LOCUS_27760 2104 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 2258 4993 gene locus_tag LOCUS_27770 2258 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27770 5012 5611 gene locus_tag LOCUS_27780 5012 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 >Feature sequence268 <1 943 gene locus_tag LOCUS_27790 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943962.1:diguanylate cyclase 2137 962 gene locus_tag LOCUS_27800 2137 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 >Feature sequence269 204 2645 gene locus_tag LOCUS_27810 204 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 2635 4173 gene locus_tag LOCUS_27820 2635 4173 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294598.1 protein_id gnl|my_center|LOCUS_27820 <5639 4242 gene locus_tag LOCUS_27830 <5639 4242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258810.1:serine/threonine-protein kinase >Feature sequence270 113 1834 gene locus_tag LOCUS_27840 113 1834 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_27840 1841 2446 gene locus_tag LOCUS_27850 1841 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 3586 2555 gene locus_tag LOCUS_27860 3586 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 5248 3710 gene locus_tag LOCUS_27870 5248 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 >Feature sequence271 118 2718 gene locus_tag LOCUS_27880 118 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 2722 5328 gene locus_tag LOCUS_27890 gene pepN 2722 5328 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940973.1 protein_id gnl|my_center|LOCUS_27890 >Feature sequence272 2132 72 gene locus_tag LOCUS_27900 2132 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 2645 2136 gene locus_tag LOCUS_27910 2645 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 3414 2659 gene locus_tag LOCUS_27920 3414 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 3898 3416 gene locus_tag LOCUS_27930 3898 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 4280 4495 gene locus_tag LOCUS_27940 4280 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 >Feature sequence273 459 944 gene locus_tag LOCUS_27950 459 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 1482 982 gene locus_tag LOCUS_27960 gene mog 1482 982 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943343.1 protein_id gnl|my_center|LOCUS_27960 2754 1501 gene locus_tag LOCUS_27970 2754 1501 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879946.1 protein_id gnl|my_center|LOCUS_27970 3224 5314 gene locus_tag LOCUS_27980 3224 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 >Feature sequence274 2471 381 gene locus_tag LOCUS_27990 gene bcrD 2471 381 CDS product SctV family type III secretion system export apparatus subunit BcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930831.1 protein_id gnl|my_center|LOCUS_27990 2978 2478 gene locus_tag LOCUS_28000 2978 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 3162 4094 gene locus_tag LOCUS_28010 3162 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 5443 4265 gene locus_tag LOCUS_28020 5443 4265 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 protein_id gnl|my_center|LOCUS_28020 >Feature sequence275 >Feature sequence276 <1 501 gene locus_tag LOCUS_28030 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010884009.1:ExeM/NucH family extracellular endonuclease 527 2152 gene locus_tag LOCUS_28040 527 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 2197 3195 gene locus_tag LOCUS_28050 2197 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 3198 5396 gene locus_tag LOCUS_28060 3198 5396 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206290416.1 protein_id gnl|my_center|LOCUS_28060 >Feature sequence277 2183 66 gene locus_tag LOCUS_28070 2183 66 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444553.1 protein_id gnl|my_center|LOCUS_28070 2379 2693 gene locus_tag LOCUS_28080 2379 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 2653 3873 gene locus_tag LOCUS_28090 gene trpB 2653 3873 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482634.1 protein_id gnl|my_center|LOCUS_28090 >Feature sequence278 2183 66 gene locus_tag LOCUS_28100 2183 66 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444553.1 protein_id gnl|my_center|LOCUS_28100 2380 2694 gene locus_tag LOCUS_28110 2380 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 2654 3874 gene locus_tag LOCUS_28120 gene trpB 2654 3874 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482634.1 protein_id gnl|my_center|LOCUS_28120 >Feature sequence279 1116 394 gene locus_tag LOCUS_28130 1116 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 1613 1185 gene locus_tag LOCUS_28140 1613 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 1740 1811 gene locus_tag LOCUS_t00410 1740 1811 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1882 3234 gene locus_tag LOCUS_28150 gene miaB 1882 3234 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927876.1 protein_id gnl|my_center|LOCUS_28150 3406 3903 gene locus_tag LOCUS_28160 3406 3903 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938863.1 protein_id gnl|my_center|LOCUS_28160 3920 4096 gene locus_tag LOCUS_28170 3920 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 >Feature sequence280 286 1563 gene locus_tag LOCUS_28180 gene eno 286 1563 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869074.1 protein_id gnl|my_center|LOCUS_28180 1582 1971 gene locus_tag LOCUS_28190 gene crcB 1582 1971 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938890.1 protein_id gnl|my_center|LOCUS_28190 2124 2741 gene locus_tag LOCUS_28200 2124 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 2752 3297 gene locus_tag LOCUS_28210 2752 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 >Feature sequence281 3784 614 gene locus_tag LOCUS_28220 3784 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 4312 4055 gene locus_tag LOCUS_28230 4312 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 4697 4909 gene locus_tag LOCUS_28240 4697 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 >Feature sequence282 516 2102 gene locus_tag LOCUS_28250 516 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 3097 2192 gene locus_tag LOCUS_28260 3097 2192 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_28260 3763 3101 gene locus_tag LOCUS_28270 3763 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 4609 3767 gene locus_tag LOCUS_28280 gene mtnP 4609 3767 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_28280 >Feature sequence283 182 1735 gene locus_tag LOCUS_28290 182 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 1787 3097 gene locus_tag LOCUS_28300 1787 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 5193 3142 gene locus_tag LOCUS_28310 5193 3142 CDS product chromosome condensation regulator RCC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258200.1 protein_id gnl|my_center|LOCUS_28310 >Feature sequence284 53 913 gene locus_tag LOCUS_28320 53 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 983 1984 gene locus_tag LOCUS_28330 983 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 1981 3093 gene locus_tag LOCUS_28340 1981 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 3087 4355 gene locus_tag LOCUS_28350 3087 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 4594 4791 gene locus_tag LOCUS_28360 4594 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 >Feature sequence285 271 2463 gene locus_tag LOCUS_28370 271 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 3285 2830 gene locus_tag LOCUS_28380 3285 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 3456 4577 gene locus_tag LOCUS_28390 3456 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 >Feature sequence286 646 74 gene locus_tag LOCUS_28400 646 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 1294 656 gene locus_tag LOCUS_28410 1294 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 1862 1296 gene locus_tag LOCUS_28420 1862 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 2022 2564 gene locus_tag LOCUS_28430 2022 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 2635 4854 gene locus_tag LOCUS_28440 2635 4854 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048283.1 protein_id gnl|my_center|LOCUS_28440 >Feature sequence287 255 3728 gene locus_tag LOCUS_28450 255 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 3725 5227 gene locus_tag LOCUS_28460 3725 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 >Feature sequence288 414 1028 gene locus_tag LOCUS_28470 414 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245105.1 protein_id gnl|my_center|LOCUS_28470 1112 2320 gene locus_tag LOCUS_28480 1112 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 2432 3790 gene locus_tag LOCUS_28490 2432 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 4260 3802 gene locus_tag LOCUS_28500 4260 3802 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094124518.1 protein_id gnl|my_center|LOCUS_28500 4446 5105 gene locus_tag LOCUS_28510 4446 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 >Feature sequence289 1565 1107 gene locus_tag LOCUS_28520 1565 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 2133 1558 gene locus_tag LOCUS_28530 2133 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 2795 2292 gene locus_tag LOCUS_28540 2795 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 2871 3977 gene locus_tag LOCUS_28550 2871 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 3981 4112 gene locus_tag LOCUS_28560 3981 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 4227 5150 gene locus_tag LOCUS_28570 4227 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 >Feature sequence290 <1 616 gene locus_tag LOCUS_28580 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963949.1:peptide chain release factor 3 696 1649 gene locus_tag LOCUS_28590 696 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 4695 1801 gene locus_tag LOCUS_28600 4695 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 >Feature sequence291 1657 446 gene locus_tag LOCUS_28610 1657 446 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103754.1 protein_id gnl|my_center|LOCUS_28610 3891 1720 gene locus_tag LOCUS_28620 3891 1720 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142622.1 protein_id gnl|my_center|LOCUS_28620 <5152 4271 gene locus_tag LOCUS_28630 <5152 4271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262314.1:anaerobic nitric oxide reductase flavorubredoxin >Feature sequence292 1097 663 gene locus_tag LOCUS_28640 1097 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 2525 1173 gene locus_tag LOCUS_28650 2525 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 3739 2522 gene locus_tag LOCUS_28660 3739 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 3796 4761 gene locus_tag LOCUS_28670 3796 4761 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 protein_id gnl|my_center|LOCUS_28670 >Feature sequence293 265 834 gene locus_tag LOCUS_28680 265 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 874 1266 gene locus_tag LOCUS_28690 874 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 1472 1825 gene locus_tag LOCUS_28700 1472 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 2028 2732 gene locus_tag LOCUS_28710 2028 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 3559 2822 gene locus_tag LOCUS_28720 3559 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 4770 3832 gene locus_tag LOCUS_28730 4770 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 >Feature sequence294 680 96 gene locus_tag LOCUS_28740 680 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 1371 712 gene locus_tag LOCUS_28750 1371 712 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 protein_id gnl|my_center|LOCUS_28750 1535 1933 gene locus_tag LOCUS_28760 1535 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 1941 3887 gene locus_tag LOCUS_28770 1941 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 3898 4401 gene locus_tag LOCUS_28780 3898 4401 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803694.1 protein_id gnl|my_center|LOCUS_28780 >Feature sequence295 101 1405 gene locus_tag LOCUS_28790 101 1405 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048040655.1 protein_id gnl|my_center|LOCUS_28790 1490 2902 gene locus_tag LOCUS_28800 1490 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 3093 4103 gene locus_tag LOCUS_28810 3093 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 >Feature sequence296 947 249 gene locus_tag LOCUS_28820 947 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 1217 1687 gene locus_tag LOCUS_28830 1217 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 2020 1733 gene locus_tag LOCUS_28840 2020 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 2304 2666 gene locus_tag LOCUS_28850 2304 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 5057 2781 gene locus_tag LOCUS_28860 5057 2781 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922073.1 protein_id gnl|my_center|LOCUS_28860 >Feature sequence297 400 1014 gene locus_tag LOCUS_28870 400 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 1995 1117 gene locus_tag LOCUS_28880 1995 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 2133 3953 gene locus_tag LOCUS_28890 2133 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 3980 4816 gene locus_tag LOCUS_28900 3980 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 >Feature sequence298 <1 1869 gene locus_tag LOCUS_28910 <1 1869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256397.1:alpha-amylase family glycosyl hydrolase 1879 3159 gene locus_tag LOCUS_28920 1879 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 3215 4801 gene locus_tag LOCUS_28930 3215 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 >Feature sequence299 1426 1166 gene locus_tag LOCUS_28940 1426 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 3442 1559 gene locus_tag LOCUS_28950 3442 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 >Feature sequence300 >Feature sequence301 1307 558 gene locus_tag LOCUS_28960 1307 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 1527 1766 gene locus_tag LOCUS_28970 1527 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 1837 2751 gene locus_tag LOCUS_28980 1837 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 3016 2753 gene locus_tag LOCUS_28990 3016 2753 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927120.1 protein_id gnl|my_center|LOCUS_28990 3215 2976 gene locus_tag LOCUS_29000 3215 2976 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933584.1 protein_id gnl|my_center|LOCUS_29000 <4888 3320 gene locus_tag LOCUS_29010 <4888 3320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056442.1:YifB family Mg chelatase-like AAA ATPase >Feature sequence302 1110 10 gene locus_tag LOCUS_29020 1110 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 2224 1112 gene locus_tag LOCUS_29030 2224 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 2345 3469 gene locus_tag LOCUS_29040 2345 3469 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993997.1 protein_id gnl|my_center|LOCUS_29040 3487 4836 gene locus_tag LOCUS_29050 gene glmM 3487 4836 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_29050 >Feature sequence303 3505 686 gene locus_tag LOCUS_29060 gene uvrA 3505 686 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_29060 3891 4346 gene locus_tag LOCUS_29070 gene tnpA 3891 4346 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_29070 >Feature sequence304 29 208 gene locus_tag LOCUS_29080 29 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 1679 225 gene locus_tag LOCUS_29090 1679 225 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_29090 3027 1693 gene locus_tag LOCUS_29100 gene trkA 3027 1693 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021496.1 protein_id gnl|my_center|LOCUS_29100 4457 3198 gene locus_tag LOCUS_29110 4457 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 >Feature sequence305 3164 2436 gene locus_tag LOCUS_29120 3164 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 3456 4526 gene locus_tag LOCUS_29130 3456 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 >Feature sequence306 1360 857 gene locus_tag LOCUS_29140 1360 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 1924 1397 gene locus_tag LOCUS_29150 1924 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 2989 2021 gene locus_tag LOCUS_29160 2989 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 3888 4406 gene locus_tag LOCUS_29170 3888 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 >Feature sequence307 1573 452 gene locus_tag LOCUS_29180 1573 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 2962 1583 gene locus_tag LOCUS_29190 2962 1583 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_29190 3867 2959 gene locus_tag LOCUS_29200 3867 2959 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626423.1 protein_id gnl|my_center|LOCUS_29200 <4806 3864 gene locus_tag LOCUS_29210 <4806 3864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095832.1:tRNA guanosine(34) transglycosylase Tgt >Feature sequence308 <1 1912 gene locus_tag LOCUS_29220 <1 1912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943038.1:PocR ligand-binding domain-containing protein 4368 1933 gene locus_tag LOCUS_29230 4368 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 >Feature sequence309 <1 1129 gene locus_tag LOCUS_29240 <1 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193073.1:family 10 glycosylhydrolase 1816 1532 gene locus_tag LOCUS_29250 1816 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 2423 2268 gene locus_tag LOCUS_29260 2423 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 3318 2500 gene locus_tag LOCUS_29270 3318 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 4679 3702 gene locus_tag LOCUS_29280 gene trpS 4679 3702 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016366.1 protein_id gnl|my_center|LOCUS_29280 >Feature sequence310 601 290 gene locus_tag LOCUS_29290 601 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 684 1361 gene locus_tag LOCUS_29300 684 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 1377 2861 gene locus_tag LOCUS_29310 1377 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 >Feature sequence311 462 1679 gene locus_tag LOCUS_29320 gene ydfH 462 1679 CDS product two-component system sensor histidine kinase YdfH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886422.1 protein_id gnl|my_center|LOCUS_29320 1766 3271 gene locus_tag LOCUS_29330 1766 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 >Feature sequence312 1907 3268 gene locus_tag LOCUS_29340 1907 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 4602 3916 gene locus_tag LOCUS_29350 4602 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 >Feature sequence313 814 2691 gene locus_tag LOCUS_29360 gene gor 814 2691 CDS product glyceraldehyde-3-phosphate:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868698.1 protein_id gnl|my_center|LOCUS_29360 2746 3573 gene locus_tag LOCUS_29370 2746 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 >Feature sequence314 605 387 gene locus_tag LOCUS_29380 605 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 808 581 gene locus_tag LOCUS_29390 808 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 1067 2050 gene locus_tag LOCUS_29400 1067 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 3090 2059 gene locus_tag LOCUS_29410 3090 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 3393 3136 gene locus_tag LOCUS_29420 3393 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 <4646 3434 gene locus_tag LOCUS_29430 <4646 3434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965302.1:NAD(P)H-dependent oxidoreductase >Feature sequence315 <1 1740 gene locus_tag LOCUS_29440 <1 1740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258200.1:chromosome condensation regulator RCC1 1801 4380 gene locus_tag LOCUS_29450 1801 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 >Feature sequence316 427 1149 gene locus_tag LOCUS_29460 427 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 1496 1729 gene locus_tag LOCUS_29470 1496 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 1876 2850 gene locus_tag LOCUS_29480 1876 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 2974 3852 gene locus_tag LOCUS_29490 2974 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 >Feature sequence317 2288 165 gene locus_tag LOCUS_29500 2288 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 3616 2429 gene locus_tag LOCUS_29510 3616 2429 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_29510 4486 3755 gene locus_tag LOCUS_29520 4486 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 >Feature sequence318 32 1135 gene locus_tag LOCUS_29530 32 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 1204 3294 gene locus_tag LOCUS_29540 1204 3294 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206614.1 protein_id gnl|my_center|LOCUS_29540 >Feature sequence319 754 368 gene locus_tag LOCUS_29550 754 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 2828 897 gene locus_tag LOCUS_29560 2828 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 3601 2900 gene locus_tag LOCUS_29570 3601 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 >Feature sequence320 49 2148 gene locus_tag LOCUS_29580 49 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 2230 2892 gene locus_tag LOCUS_29590 2230 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 3214 2873 gene locus_tag LOCUS_29600 3214 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 >Feature sequence321 978 187 gene locus_tag LOCUS_29610 978 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 1061 1134 gene locus_tag LOCUS_t00420 1061 1134 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2329 1154 gene locus_tag LOCUS_29620 2329 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 3240 4262 gene locus_tag LOCUS_29630 3240 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 >Feature sequence322 <1 697 gene locus_tag LOCUS_29640 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941791.1:chromosome segregation protein SMC 864 3956 gene locus_tag LOCUS_29650 864 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 >Feature sequence323 930 2825 gene locus_tag LOCUS_29660 930 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 3385 4470 gene locus_tag LOCUS_29670 3385 4470 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_29670 >Feature sequence324 1635 286 gene locus_tag LOCUS_29680 gene rsmB 1635 286 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_29680 2567 1632 gene locus_tag LOCUS_29690 gene fmt 2567 1632 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_29690 4157 2616 gene locus_tag LOCUS_29700 4157 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 >Feature sequence325 <1 1571 gene locus_tag LOCUS_29710 <1 1571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943038.1:PocR ligand-binding domain-containing protein 1764 3674 gene locus_tag LOCUS_29720 1764 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 >Feature sequence326 155 1438 gene locus_tag LOCUS_29730 gene thiC 155 1438 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184001.1 protein_id gnl|my_center|LOCUS_29730 1514 2335 gene locus_tag LOCUS_29740 1514 2335 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190175.1 protein_id gnl|my_center|LOCUS_29740 2375 2860 gene locus_tag LOCUS_29750 2375 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 4117 2870 gene locus_tag LOCUS_29760 gene rpsA 4117 2870 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_29760 >Feature sequence327 494 1864 gene locus_tag LOCUS_29770 494 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 1964 2500 gene locus_tag LOCUS_29780 1964 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 2481 3212 gene locus_tag LOCUS_29790 2481 3212 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530633.1 protein_id gnl|my_center|LOCUS_29790 3627 3118 gene locus_tag LOCUS_29800 3627 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 4161 3628 gene locus_tag LOCUS_29810 4161 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 >Feature sequence328 296 2413 gene locus_tag LOCUS_29820 gene pnp 296 2413 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_29820 >Feature sequence329 2887 761 gene locus_tag LOCUS_29830 2887 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 3816 2884 gene locus_tag LOCUS_29840 3816 2884 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121418.1 protein_id gnl|my_center|LOCUS_29840 >Feature sequence330 2152 590 gene locus_tag LOCUS_29850 2152 590 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393460.1 protein_id gnl|my_center|LOCUS_29850 2292 4301 gene locus_tag LOCUS_29860 2292 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 >Feature sequence331 2 574 gene locus_tag LOCUS_29870 2 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 677 1342 gene locus_tag LOCUS_29880 677 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 1339 2100 gene locus_tag LOCUS_29890 1339 2100 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821952.1 protein_id gnl|my_center|LOCUS_29890 2321 2653 gene locus_tag LOCUS_29900 2321 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 2816 3433 gene locus_tag LOCUS_29910 2816 3433 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 protein_id gnl|my_center|LOCUS_29910 <4263 3437 gene locus_tag LOCUS_29920 <4263 3437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_139375234.1:S41 family peptidase >Feature sequence332 1373 2644 gene locus_tag LOCUS_29930 1373 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 2721 4226 gene locus_tag LOCUS_29940 2721 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 >Feature sequence333 988 1602 gene locus_tag LOCUS_29950 988 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 1605 1850 gene locus_tag LOCUS_29960 1605 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 1847 2245 gene locus_tag LOCUS_29970 1847 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 2387 2815 gene locus_tag LOCUS_29980 2387 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 <4165 2891 gene locus_tag LOCUS_29990 <4165 2891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003723073.1:Rqc2 family fibronectin-binding protein FbpA >Feature sequence334 1116 568 gene locus_tag LOCUS_30000 1116 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 1890 1189 gene locus_tag LOCUS_30010 1890 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942125.1 protein_id gnl|my_center|LOCUS_30010 2639 1890 gene locus_tag LOCUS_30020 2639 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 3252 2641 gene locus_tag LOCUS_30030 3252 2641 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528992.1 protein_id gnl|my_center|LOCUS_30030 3809 3342 gene locus_tag LOCUS_30040 3809 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 >Feature sequence335 732 1664 gene locus_tag LOCUS_30050 gene yddG 732 1664 CDS product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390803.1 protein_id gnl|my_center|LOCUS_30050 >Feature sequence336 1694 435 gene locus_tag LOCUS_30060 1694 435 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_30060 1807 3771 gene locus_tag LOCUS_30070 1807 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 >Feature sequence337 1921 284 gene locus_tag LOCUS_30080 1921 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 3748 2021 gene locus_tag LOCUS_30090 3748 2021 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329982.1 protein_id gnl|my_center|LOCUS_30090 >Feature sequence338 <1 1103 gene locus_tag LOCUS_30100 <1 1103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003106059.1:MBL fold metallo-hydrolase 1173 2660 gene locus_tag LOCUS_30110 1173 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 3891 2983 gene locus_tag LOCUS_30120 3891 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 >Feature sequence339 576 280 gene locus_tag LOCUS_30130 576 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 1879 599 gene locus_tag LOCUS_30140 1879 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 3092 1905 gene locus_tag LOCUS_30150 3092 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 >Feature sequence340 <1 679 gene locus_tag LOCUS_30160 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269235.1:efflux RND transporter periplasmic adaptor subunit 683 3781 gene locus_tag LOCUS_30170 683 3781 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 protein_id gnl|my_center|LOCUS_30170 3753 4061 gene locus_tag LOCUS_30180 3753 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 >Feature sequence341 <1 1399 gene locus_tag LOCUS_30190 <1 1399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680159.1:formylglycine-generating enzyme family protein 1743 1919 gene locus_tag LOCUS_30200 1743 1919 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390530.1 protein_id gnl|my_center|LOCUS_30200 1959 4031 gene locus_tag LOCUS_30210 gene fusA 1959 4031 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_30210 >Feature sequence342 >Feature sequence343 745 161 gene locus_tag LOCUS_30220 745 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 967 3954 gene locus_tag LOCUS_30230 967 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 >Feature sequence344 1056 394 gene locus_tag LOCUS_30240 1056 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 1781 1053 gene locus_tag LOCUS_30250 1781 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 2344 1778 gene locus_tag LOCUS_30260 2344 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 2823 2485 gene locus_tag LOCUS_30270 2823 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 3306 2833 gene locus_tag LOCUS_30280 3306 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 >Feature sequence345 646 89 gene locus_tag LOCUS_30290 646 89 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016982.1 protein_id gnl|my_center|LOCUS_30290 2070 748 gene locus_tag LOCUS_30300 2070 748 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994245.1 protein_id gnl|my_center|LOCUS_30300 2325 2140 gene locus_tag LOCUS_30310 2325 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 2346 3602 gene locus_tag LOCUS_30320 2346 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 >Feature sequence346 224 673 gene locus_tag LOCUS_30330 224 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 1961 909 gene locus_tag LOCUS_30340 gene kdd 1961 909 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_30340 2227 2009 gene locus_tag LOCUS_30350 gene infA 2227 2009 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006583256.1 protein_id gnl|my_center|LOCUS_30350 2690 2364 gene locus_tag LOCUS_30360 2690 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 <4007 2874 gene locus_tag LOCUS_30370 <4007 2874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141450.1:FG-GAP-like repeat-containing protein >Feature sequence347 3723 190 gene locus_tag LOCUS_30380 3723 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 3886 3698 gene locus_tag LOCUS_30390 3886 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 >Feature sequence348 1938 529 gene locus_tag LOCUS_30400 1938 529 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_30400 3040 2246 gene locus_tag LOCUS_30410 3040 2246 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259198.1 protein_id gnl|my_center|LOCUS_30410 3258 3073 gene locus_tag LOCUS_30420 3258 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 >Feature sequence349 1023 352 gene locus_tag LOCUS_30430 1023 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 1286 2086 gene locus_tag LOCUS_30440 1286 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 >Feature sequence350 982 1410 gene locus_tag LOCUS_30450 982 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 1407 1988 gene locus_tag LOCUS_30460 1407 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 1978 2520 gene locus_tag LOCUS_30470 gene atpH 1978 2520 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393858.1 protein_id gnl|my_center|LOCUS_30470 >Feature sequence351 1210 401 gene locus_tag LOCUS_30480 1210 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 1554 2480 gene locus_tag LOCUS_30490 1554 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 >Feature sequence352 2 313 gene locus_tag LOCUS_30500 2 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 306 698 gene locus_tag LOCUS_30510 306 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 907 2583 gene locus_tag LOCUS_30520 907 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 >Feature sequence353 267 1232 gene locus_tag LOCUS_30530 267 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 1608 1967 gene locus_tag LOCUS_30540 1608 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 1984 2832 gene locus_tag LOCUS_30550 1984 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 2829 3878 gene locus_tag LOCUS_30560 2829 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 >Feature sequence354 1990 614 gene locus_tag LOCUS_30570 1990 614 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937720.1 protein_id gnl|my_center|LOCUS_30570 >Feature sequence355 >Feature sequence356 3511 1742 gene locus_tag LOCUS_30580 3511 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 >Feature sequence357 68 1102 gene locus_tag LOCUS_30590 68 1102 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753043.1 protein_id gnl|my_center|LOCUS_30590 2767 1220 gene locus_tag LOCUS_30600 2767 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 >Feature sequence358 1076 87 gene locus_tag LOCUS_30610 1076 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 1219 1722 gene locus_tag LOCUS_30620 1219 1722 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942345.1 protein_id gnl|my_center|LOCUS_30620 3263 1758 gene locus_tag LOCUS_30630 3263 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 3766 3338 gene locus_tag LOCUS_30640 3766 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 >Feature sequence359 2 916 gene locus_tag LOCUS_30650 2 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 1050 2276 gene locus_tag LOCUS_30660 1050 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 2360 3103 gene locus_tag LOCUS_30670 2360 3103 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_30670 3121 3774 gene locus_tag LOCUS_30680 3121 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 >Feature sequence360 780 631 gene locus_tag LOCUS_30690 780 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 1267 818 gene locus_tag LOCUS_30700 1267 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 2705 1281 gene locus_tag LOCUS_30710 gene atpD 2705 1281 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_30710 3529 2702 gene locus_tag LOCUS_30720 gene atpG 3529 2702 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 protein_id gnl|my_center|LOCUS_30720 >Feature sequence361 353 2266 gene locus_tag LOCUS_30730 353 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 2548 2976 gene locus_tag LOCUS_30740 2548 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 2980 3540 gene locus_tag LOCUS_30750 2980 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 >Feature sequence362 <1 1218 gene locus_tag LOCUS_30760 <1 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930426.1:sigma-54 dependent transcriptional regulator 1454 2005 gene locus_tag LOCUS_30770 1454 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 2002 3735 gene locus_tag LOCUS_30780 2002 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 >Feature sequence363 586 1410 gene locus_tag LOCUS_30790 586 1410 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073210.1 protein_id gnl|my_center|LOCUS_30790 1424 1879 gene locus_tag LOCUS_30800 1424 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 2959 2207 gene locus_tag LOCUS_30810 2959 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 >Feature sequence364 >Feature sequence365 529 1866 gene locus_tag LOCUS_30820 gene murD 529 1866 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_30820 1966 3420 gene locus_tag LOCUS_30830 1966 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 3540 3615 gene locus_tag LOCUS_t00430 3540 3615 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3624 3698 gene locus_tag LOCUS_t00440 3624 3698 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence366 769 682 gene locus_tag LOCUS_t00450 769 682 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 896 809 gene locus_tag LOCUS_t00460 896 809 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1087 2013 gene locus_tag LOCUS_30840 gene miaA 1087 2013 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_30840 >Feature sequence367 2018 1620 gene locus_tag LOCUS_30850 2018 1620 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_30850 2523 2008 gene locus_tag LOCUS_30860 2523 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 >Feature sequence368 1708 992 gene locus_tag LOCUS_30870 1708 992 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031156.1 protein_id gnl|my_center|LOCUS_30870 >Feature sequence369 <1 648 gene locus_tag LOCUS_30880 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393297.1:site-specific integrase 2484 778 gene locus_tag LOCUS_30890 2484 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 2681 3298 gene locus_tag LOCUS_30900 2681 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 >Feature sequence370 1307 1828 gene locus_tag LOCUS_30910 1307 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 1902 2249 gene locus_tag LOCUS_30920 1902 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 2388 3293 gene locus_tag LOCUS_30930 2388 3293 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940332.1 protein_id gnl|my_center|LOCUS_30930 >Feature sequence371 224 60 gene locus_tag LOCUS_30940 224 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 603 217 gene locus_tag LOCUS_30950 603 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 2374 605 gene locus_tag LOCUS_30960 2374 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 3261 2371 gene locus_tag LOCUS_30970 3261 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 >Feature sequence372 1444 134 gene locus_tag LOCUS_30980 gene glgC 1444 134 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227648.1 protein_id gnl|my_center|LOCUS_30980 1655 1975 gene locus_tag LOCUS_30990 1655 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 1975 2781 gene locus_tag LOCUS_31000 1975 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 >Feature sequence373 2693 2004 gene locus_tag LOCUS_31010 2693 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 >Feature sequence374 1275 196 gene locus_tag LOCUS_31020 1275 196 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_31020 1578 3359 gene locus_tag LOCUS_31030 1578 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 >Feature sequence375 <1 505 gene locus_tag LOCUS_31040 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232058.1:ribulose-phosphate 3-epimerase 3436 551 gene locus_tag LOCUS_31050 3436 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 >Feature sequence376 <1 505 gene locus_tag LOCUS_31060 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232058.1:ribulose-phosphate 3-epimerase 3433 560 gene locus_tag LOCUS_31070 3433 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 >Feature sequence377 <1 909 gene locus_tag LOCUS_31080 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023514.1:acetate kinase 2918 1080 gene locus_tag LOCUS_31090 2918 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 >Feature sequence378 1047 1256 gene locus_tag LOCUS_31100 1047 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 1485 1410 gene locus_tag LOCUS_t00470 1485 1410 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2471 1665 gene locus_tag LOCUS_31110 2471 1665 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 protein_id gnl|my_center|LOCUS_31110 3376 2468 gene locus_tag LOCUS_31120 3376 2468 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_31120 >Feature sequence379 1219 1761 gene locus_tag LOCUS_31130 1219 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 3069 1801 gene locus_tag LOCUS_31140 3069 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 >Feature sequence380 205 621 gene locus_tag LOCUS_31150 205 621 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942875.1 protein_id gnl|my_center|LOCUS_31150 701 1042 gene locus_tag LOCUS_31160 701 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 1055 1426 gene locus_tag LOCUS_31170 1055 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 1430 2332 gene locus_tag LOCUS_31180 1430 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 >Feature sequence381 491 2386 gene locus_tag LOCUS_31190 491 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 <3396 2448 gene locus_tag LOCUS_31200 <3396 2448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942299.1:response regulator >Feature sequence382 1166 828 gene locus_tag LOCUS_31210 1166 828 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142672.1 protein_id gnl|my_center|LOCUS_31210 2147 1215 gene locus_tag LOCUS_31220 2147 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 3265 2300 gene locus_tag LOCUS_31230 gene cysK 3265 2300 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090573.1 protein_id gnl|my_center|LOCUS_31230 >Feature sequence383 2760 310 gene locus_tag LOCUS_31240 2760 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 >Feature sequence384 865 1314 gene locus_tag LOCUS_31250 865 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 1444 3222 gene locus_tag LOCUS_31260 1444 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 >Feature sequence385 678 1067 gene locus_tag LOCUS_31270 678 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 1092 1241 gene locus_tag LOCUS_31280 1092 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 1306 3315 gene locus_tag LOCUS_31290 gene mutL 1306 3315 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390696.1 protein_id gnl|my_center|LOCUS_31290 >Feature sequence386 <1 662 gene locus_tag LOCUS_31300 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003105929.1:GGDEF domain-containing protein 2250 1954 gene locus_tag LOCUS_31310 2250 1954 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257768.1 protein_id gnl|my_center|LOCUS_31310 2684 2247 gene locus_tag LOCUS_31320 2684 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 >Feature sequence387 >Feature sequence388 2548 548 gene locus_tag LOCUS_31330 2548 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 >Feature sequence389 1346 81 gene locus_tag LOCUS_31340 1346 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 2964 1399 gene locus_tag LOCUS_31350 2964 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 >Feature sequence390 1143 2081 gene locus_tag LOCUS_31360 1143 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 >Feature sequence391 916 194 gene locus_tag LOCUS_31370 916 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 1347 2963 gene locus_tag LOCUS_31380 1347 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 >Feature sequence392 >Feature sequence393 109 1317 gene locus_tag LOCUS_31390 109 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 >Feature sequence394 <1 1072 gene locus_tag LOCUS_31400 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861071.1:CotH kinase family protein 2428 1073 gene locus_tag LOCUS_31410 gene hslU 2428 1073 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_31410 2984 2448 gene locus_tag LOCUS_31420 gene hslV 2984 2448 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881090.1 protein_id gnl|my_center|LOCUS_31420 >Feature sequence395 273 1841 gene locus_tag LOCUS_31430 273 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 1976 3046 gene locus_tag LOCUS_31440 1976 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 >Feature sequence396 984 34 gene locus_tag LOCUS_31450 984 34 CDS product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016994.1 protein_id gnl|my_center|LOCUS_31450 1534 1319 gene locus_tag LOCUS_31460 1534 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 1752 2162 gene locus_tag LOCUS_31470 1752 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31470 2199 2573 gene locus_tag LOCUS_31480 2199 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31480 2732 2580 gene locus_tag LOCUS_31490 2732 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 >Feature sequence397 1912 329 gene locus_tag LOCUS_31500 1912 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 2495 2842 gene locus_tag LOCUS_31510 2495 2842 CDS product DUF6404 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142452.1 protein_id gnl|my_center|LOCUS_31510 >Feature sequence398 <1 2291 gene locus_tag LOCUS_31520 <1 2291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943038.1:PocR ligand-binding domain-containing protein 3026 2412 gene locus_tag LOCUS_31530 3026 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 >Feature sequence399 2392 263 gene locus_tag LOCUS_31540 2392 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 2579 2842 gene locus_tag LOCUS_31550 2579 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 >Feature sequence400 1237 110 gene locus_tag LOCUS_31560 1237 110 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975598.1 protein_id gnl|my_center|LOCUS_31560 1399 2601 gene locus_tag LOCUS_31570 1399 2601 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_31570 >Feature sequence401 94 759 gene locus_tag LOCUS_31580 94 759 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283612.1 protein_id gnl|my_center|LOCUS_31580 760 1383 gene locus_tag LOCUS_31590 760 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 >Feature sequence402 195 1451 gene locus_tag LOCUS_31600 195 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 <2950 1724 gene locus_tag LOCUS_31610 <2950 1724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021662.1:MFS transporter >Feature sequence403 <1 2737 gene locus_tag LOCUS_31620 <1 2737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258200.1:chromosome condensation regulator RCC1 >Feature sequence404 1512 2918 gene locus_tag LOCUS_31630 1512 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 >Feature sequence405 1042 149 gene locus_tag LOCUS_31640 1042 149 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259515.1 protein_id gnl|my_center|LOCUS_31640 1615 1094 gene locus_tag LOCUS_31650 1615 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 2779 1622 gene locus_tag LOCUS_31660 2779 1622 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144029.1 protein_id gnl|my_center|LOCUS_31660 >Feature sequence406 1868 2446 gene locus_tag LOCUS_31670 1868 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 >Feature sequence407 1573 890 gene locus_tag LOCUS_31680 1573 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 1805 2551 gene locus_tag LOCUS_31690 1805 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 >Feature sequence408 272 478 gene locus_tag LOCUS_31700 272 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 664 494 gene locus_tag LOCUS_31710 664 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 596 760 gene locus_tag LOCUS_31720 596 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 1040 1282 gene locus_tag LOCUS_31730 1040 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 1712 1957 gene locus_tag LOCUS_31740 1712 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 <2845 2080 gene locus_tag LOCUS_31750 <2845 2080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027999870.1:tandem-95 repeat protein >Feature sequence409 526 2463 gene locus_tag LOCUS_31760 526 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 >Feature sequence410 175 1686 gene locus_tag LOCUS_31770 175 1686 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390163.1 protein_id gnl|my_center|LOCUS_31770 2524 1733 gene locus_tag LOCUS_31780 2524 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 >Feature sequence411 1118 444 gene locus_tag LOCUS_31790 1118 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 1272 2189 gene locus_tag LOCUS_31800 1272 2189 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788892.1 protein_id gnl|my_center|LOCUS_31800 >Feature sequence412 2143 296 gene locus_tag LOCUS_31810 2143 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 >Feature sequence413 2052 853 gene locus_tag LOCUS_31820 2052 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 >Feature sequence414 567 1175 gene locus_tag LOCUS_31830 567 1175 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026312796.1 protein_id gnl|my_center|LOCUS_31830 1172 2125 gene locus_tag LOCUS_31840 1172 2125 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970323.1 protein_id gnl|my_center|LOCUS_31840 >Feature sequence415 2140 2523 gene locus_tag LOCUS_31850 2140 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 >Feature sequence416 233 1393 gene locus_tag LOCUS_31860 233 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 >Feature sequence417 194 790 gene locus_tag LOCUS_31870 194 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 888 1604 gene locus_tag LOCUS_31880 888 1604 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_31880 >Feature sequence418 >Feature sequence419 1252 2664 gene locus_tag LOCUS_31890 1252 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 >Feature sequence420 396 67 gene locus_tag LOCUS_31900 396 67 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719341.1 protein_id gnl|my_center|LOCUS_31900 1097 528 gene locus_tag LOCUS_31910 1097 528 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065087.1 protein_id gnl|my_center|LOCUS_31910 2265 1105 gene locus_tag LOCUS_31920 2265 1105 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 protein_id gnl|my_center|LOCUS_31920 >Feature sequence421 110 514 gene locus_tag LOCUS_31930 110 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 628 1863 gene locus_tag LOCUS_31940 gene clpX 628 1863 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 protein_id gnl|my_center|LOCUS_31940 <2658 1910 gene locus_tag LOCUS_31950 <2658 1910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257228.1:prolipoprotein diacylglyceryl transferase >Feature sequence422 1052 414 gene locus_tag LOCUS_31960 1052 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 >Feature sequence423 <1 1396 gene locus_tag LOCUS_31970 <1 1396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258200.1:chromosome condensation regulator RCC1 2220 1519 gene locus_tag LOCUS_31980 2220 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 >Feature sequence424 385 1719 gene locus_tag LOCUS_31990 385 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 >Feature sequence425 1044 2066 gene locus_tag LOCUS_32000 1044 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 >Feature sequence426 37 861 gene locus_tag LOCUS_32010 37 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 >Feature sequence427 1593 271 gene locus_tag LOCUS_32020 1593 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 >Feature sequence428 <1 1851 gene locus_tag LOCUS_32030 <1 1851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942744.1:catalase/peroxidase HPI 2472 1876 gene locus_tag LOCUS_32040 2472 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 >Feature sequence429 >Feature sequence430 >Feature sequence431 688 8 gene locus_tag LOCUS_32050 688 8 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813002.1 protein_id gnl|my_center|LOCUS_32050 962 2005 gene locus_tag LOCUS_32060 gene pheS 962 2005 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053743.1 protein_id gnl|my_center|LOCUS_32060 >Feature sequence432 >Feature sequence433 124 789 gene locus_tag LOCUS_32070 124 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 1457 1290 gene locus_tag LOCUS_32080 1457 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 2537 1473 gene locus_tag LOCUS_32090 2537 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 >Feature sequence434 <2510 27 gene locus_tag LOCUS_32100 <2510 27 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071542276.1:alanine racemase 1956 2043 gene locus_tag LOCUS_t00480 1956 2043 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence435 717 1040 gene locus_tag LOCUS_32110 717 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 2247 1054 gene locus_tag LOCUS_32120 2247 1054 CDS product ISAs1-like element ISEc5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421020.1 protein_id gnl|my_center|LOCUS_32120 >Feature sequence436 >Feature sequence437 2195 288 gene locus_tag LOCUS_32130 gene nuoF 2195 288 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817338.1 protein_id gnl|my_center|LOCUS_32130 >Feature sequence438 >Feature sequence439 1 1170 gene locus_tag LOCUS_32140 1 1170 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 protein_id gnl|my_center|LOCUS_32140 1167 1580 gene locus_tag LOCUS_32150 1167 1580 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925454.1 protein_id gnl|my_center|LOCUS_32150 >Feature sequence440 >Feature sequence441 807 475 gene locus_tag LOCUS_32160 807 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 996 1175 gene locus_tag LOCUS_32170 996 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 1259 2347 gene locus_tag LOCUS_32180 1259 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 >Feature sequence442 <1 577 gene locus_tag LOCUS_32190 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000390080.1:site-specific tyrosine recombinase XerD 701 1414 gene locus_tag LOCUS_32200 701 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 1416 1700 gene locus_tag LOCUS_32210 1416 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 1754 1984 gene locus_tag LOCUS_32220 1754 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 >Feature sequence443 <1 527 gene locus_tag LOCUS_32230 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546781.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA 524 1975 gene locus_tag LOCUS_32240 gene gatB 524 1975 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_32240 >Feature sequence444 >Feature sequence445 <2389 1343 gene locus_tag LOCUS_32250 <2389 1343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461245.1:MBOAT family protein >Feature sequence446 <2381 674 gene locus_tag LOCUS_32260 <2381 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943710.1:RNA polymerase sigma factor RpoD >Feature sequence447 172 651 gene locus_tag LOCUS_32270 172 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 721 1833 gene locus_tag LOCUS_32280 721 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 >Feature sequence448 1450 578 gene locus_tag LOCUS_32290 1450 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 <2352 1447 gene locus_tag LOCUS_32300 <2352 1447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788156.1:RnfABCDGE type electron transport complex subunit D >Feature sequence449 317 883 gene locus_tag LOCUS_32310 317 883 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023653.1 protein_id gnl|my_center|LOCUS_32310 1220 2188 gene locus_tag LOCUS_32320 1220 2188 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921409.1 protein_id gnl|my_center|LOCUS_32320 >Feature sequence450 125 1315 gene locus_tag LOCUS_32330 125 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 >Feature sequence451 2311 503 gene locus_tag LOCUS_32340 2311 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 >Feature sequence452 1604 66 gene locus_tag LOCUS_32350 1604 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 >Feature sequence453 <1 656 gene locus_tag LOCUS_32360 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941635.1:choice-of-anchor J domain-containing protein 2080 668 gene locus_tag LOCUS_32370 2080 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 >Feature sequence454 >Feature sequence455 >Feature sequence456 1851 322 gene locus_tag LOCUS_32380 1851 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 >Feature sequence457 <1 711 gene locus_tag LOCUS_32390 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_152945460.1:efflux RND transporter permease subunit 708 1019 gene locus_tag LOCUS_32400 708 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 >Feature sequence458 51 1676 gene locus_tag LOCUS_32410 51 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 1771 1616 gene locus_tag LOCUS_32420 1771 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 1923 2234 gene locus_tag LOCUS_32430 1923 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 >Feature sequence459 53 304 gene locus_tag LOCUS_32440 53 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 355 2061 gene locus_tag LOCUS_32450 355 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 >Feature sequence460 436 2157 gene locus_tag LOCUS_32460 436 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 >Feature sequence461 1455 181 gene locus_tag LOCUS_32470 1455 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 >Feature sequence462 2249 234 gene locus_tag LOCUS_32480 2249 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 >Feature sequence463 438 653 gene locus_tag LOCUS_32490 438 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 2157 802 gene locus_tag LOCUS_32500 2157 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 >Feature sequence464 >Feature sequence465 301 1650 gene locus_tag LOCUS_32510 301 1650 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_32510 1647 2252 gene locus_tag LOCUS_32520 1647 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 >Feature sequence466 1567 194 gene locus_tag LOCUS_32530 gene pilR 1567 194 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_32530 2098 1607 gene locus_tag LOCUS_32540 2098 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 >Feature sequence467 941 573 gene locus_tag LOCUS_32550 gene queD 941 573 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268282.1 protein_id gnl|my_center|LOCUS_32550 <2238 1055 gene locus_tag LOCUS_32560 <2238 1055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932494.1:SO_0444 family Cu/Zn efflux transporter >Feature sequence468 >Feature sequence469 28 696 gene locus_tag LOCUS_32570 28 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 696 1568 gene locus_tag LOCUS_32580 696 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 >Feature sequence470 <1 1327 gene locus_tag LOCUS_32590 <1 1327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258200.1:chromosome condensation regulator RCC1 1501 2121 gene locus_tag LOCUS_32600 1501 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 >Feature sequence471 <1 1278 gene locus_tag LOCUS_32610 <1 1278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068264.1:calcium-translocating P-type ATPase, PMCA-type 1278 1790 gene locus_tag LOCUS_32620 1278 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 >Feature sequence472 >Feature sequence473 860 177 gene locus_tag LOCUS_32630 860 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 1078 1548 gene locus_tag LOCUS_32640 1078 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 2176 1559 gene locus_tag LOCUS_32650 2176 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 >Feature sequence474 1757 303 gene locus_tag LOCUS_32660 1757 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 1887 2045 gene locus_tag LOCUS_32670 1887 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 >Feature sequence475 963 523 gene locus_tag LOCUS_32680 963 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 1289 960 gene locus_tag LOCUS_32690 1289 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 1905 1282 gene locus_tag LOCUS_32700 1905 1282 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800553.1 protein_id gnl|my_center|LOCUS_32700 >Feature sequence476 1428 292 gene locus_tag LOCUS_32710 1428 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 2107 1418 gene locus_tag LOCUS_32720 2107 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 >Feature sequence477 <1 540 gene locus_tag LOCUS_32730 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388812.1:3-hydroxybutyrate dehydrogenase 537 1469 gene locus_tag LOCUS_32740 537 1469 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256060.1 protein_id gnl|my_center|LOCUS_32740 1807 2133 gene locus_tag LOCUS_32750 1807 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 >Feature sequence478 471 1379 gene locus_tag LOCUS_32760 471 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 >Feature sequence479 >Feature sequence480 >Feature sequence481 841 1410 gene locus_tag LOCUS_32770 841 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 1509 1437 gene locus_tag LOCUS_t00490 1509 1437 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence482 1320 136 gene locus_tag LOCUS_32780 gene chrA 1320 136 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972738.1 protein_id gnl|my_center|LOCUS_32780 >Feature sequence483 1168 965 gene locus_tag LOCUS_32790 1168 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 <2087 1253 gene locus_tag LOCUS_32800 <2087 1253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140199.1:S-methyl-5-thioribose-1-phosphate isomerase >Feature sequence484 19 1242 gene locus_tag LOCUS_32810 19 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 <2082 1309 gene locus_tag LOCUS_32820 <2082 1309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861083.1:RluA family pseudouridine synthase >Feature sequence485 67 699 gene locus_tag LOCUS_32830 67 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 1343 816 gene locus_tag LOCUS_32840 1343 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 >Feature sequence486 1517 711 gene locus_tag LOCUS_32850 1517 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 >Feature sequence487 <1 1344 gene locus_tag LOCUS_32860 <1 1344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968692.1:type I restriction endonuclease subunit R >Feature sequence488 1018 167 gene locus_tag LOCUS_32870 1018 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 2023 1091 gene locus_tag LOCUS_32880 2023 1091 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879085.1 protein_id gnl|my_center|LOCUS_32880 >Feature sequence489 139 1749 gene locus_tag LOCUS_32890 139 1749 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090936308.1 protein_id gnl|my_center|LOCUS_32890 >Feature sequence490 >Feature sequence491 <1 671 gene locus_tag LOCUS_32900 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003105929.1:GGDEF domain-containing protein 807 1457 gene locus_tag LOCUS_32910 807 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 >Feature sequence492 <1 1393 gene locus_tag LOCUS_32920 <1 1393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228557.1:HAMP domain-containing protein >Feature sequence493 >Feature sequence494 31 1827 gene locus_tag LOCUS_32930 31 1827 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256471.1 protein_id gnl|my_center|LOCUS_32930 >Feature sequence495 82 363 gene locus_tag LOCUS_32940 82 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 412 1758 gene locus_tag LOCUS_32950 412 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 >Feature sequence496 708 1814 gene locus_tag LOCUS_32960 gene amrS 708 1814 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942373.1 protein_id gnl|my_center|LOCUS_32960