>Feature sequence001 345 1103 gene locus_tag LOCUS_00010 345 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1118 2002 gene locus_tag LOCUS_00020 1118 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2093 3304 gene locus_tag LOCUS_00030 2093 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3392 3976 gene locus_tag LOCUS_00040 3392 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4091 9343 gene locus_tag LOCUS_00050 4091 9343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 9345 10169 gene locus_tag LOCUS_00060 9345 10169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 10351 10962 gene locus_tag LOCUS_00070 10351 10962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 10969 11295 gene locus_tag LOCUS_00080 10969 11295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11298 11588 gene locus_tag LOCUS_00090 11298 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022032.1 protein_id gnl|my_center|LOCUS_00090 11585 12442 gene locus_tag LOCUS_00100 11585 12442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12445 12882 gene locus_tag LOCUS_00110 12445 12882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13009 13416 gene locus_tag LOCUS_00120 13009 13416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13604 16390 gene locus_tag LOCUS_00130 13604 16390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 16511 18361 gene locus_tag LOCUS_00140 16511 18361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18502 21891 gene locus_tag LOCUS_00150 gene rpoB 18502 21891 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393945.1 protein_id gnl|my_center|LOCUS_00150 21891 25667 gene locus_tag LOCUS_00160 21891 25667 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399740.1 protein_id gnl|my_center|LOCUS_00160 25813 26244 gene locus_tag LOCUS_00170 gene rpsL 25813 26244 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142337.1 protein_id gnl|my_center|LOCUS_00170 >Feature sequence002 835 1026 gene locus_tag LOCUS_00180 835 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 1114 1305 gene locus_tag LOCUS_00190 1114 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 1302 1547 gene locus_tag LOCUS_00200 1302 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 1513 2151 gene locus_tag LOCUS_00210 1513 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 2799 3002 gene locus_tag LOCUS_00220 2799 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 2984 3643 gene locus_tag LOCUS_00230 2984 3643 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890562.1 protein_id gnl|my_center|LOCUS_00230 4709 4329 gene locus_tag LOCUS_00240 4709 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 5569 5210 gene locus_tag LOCUS_00250 5569 5210 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_00250 5937 5566 gene locus_tag LOCUS_00260 5937 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 6567 6112 gene locus_tag LOCUS_00270 6567 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 6806 6564 gene locus_tag LOCUS_00280 6806 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 7159 7455 gene locus_tag LOCUS_00290 7159 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 7445 7720 gene locus_tag LOCUS_00300 7445 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 8248 8060 gene locus_tag LOCUS_00310 8248 8060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 8830 8558 gene locus_tag LOCUS_00320 8830 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 8844 9671 gene locus_tag LOCUS_00330 8844 9671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 9726 10307 gene locus_tag LOCUS_00340 9726 10307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 11087 10317 gene locus_tag LOCUS_00350 11087 10317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 12330 11911 gene locus_tag LOCUS_00360 12330 11911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 16091 12339 gene locus_tag LOCUS_00370 16091 12339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 16711 16088 gene locus_tag LOCUS_00380 16711 16088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 17694 16717 gene locus_tag LOCUS_00390 17694 16717 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022155.1 protein_id gnl|my_center|LOCUS_00390 18355 17708 gene locus_tag LOCUS_00400 18355 17708 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087865.1 protein_id gnl|my_center|LOCUS_00400 19304 18336 gene locus_tag LOCUS_00410 19304 18336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 20136 19297 gene locus_tag LOCUS_00420 20136 19297 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250673.1 protein_id gnl|my_center|LOCUS_00420 20831 20139 gene locus_tag LOCUS_00430 20831 20139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 21931 20828 gene locus_tag LOCUS_00440 21931 20828 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250672.1 protein_id gnl|my_center|LOCUS_00440 22907 21933 gene locus_tag LOCUS_00450 22907 21933 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393837.1 protein_id gnl|my_center|LOCUS_00450 24409 22988 gene locus_tag LOCUS_00460 24409 22988 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_00460 >Feature sequence003 1851 925 gene locus_tag LOCUS_00470 1851 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 3878 1848 gene locus_tag LOCUS_00480 3878 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 4513 4031 gene locus_tag LOCUS_00490 4513 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 5566 4514 gene locus_tag LOCUS_00500 5566 4514 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546785.1 protein_id gnl|my_center|LOCUS_00500 7227 5563 gene locus_tag LOCUS_00510 7227 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 7699 7307 gene locus_tag LOCUS_00520 7699 7307 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525347.1 protein_id gnl|my_center|LOCUS_00520 8177 7788 gene locus_tag LOCUS_00530 8177 7788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 8317 8535 gene locus_tag LOCUS_00540 8317 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 8528 9142 gene locus_tag LOCUS_00550 8528 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 10325 9147 gene locus_tag LOCUS_00560 10325 9147 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_00560 10527 11582 gene locus_tag LOCUS_00570 10527 11582 CDS product guanosine monophosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948530.1 protein_id gnl|my_center|LOCUS_00570 12047 11586 gene locus_tag LOCUS_00580 12047 11586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 12448 13116 gene locus_tag LOCUS_00590 12448 13116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 15126 13105 gene locus_tag LOCUS_00600 15126 13105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 15327 15160 gene locus_tag LOCUS_00610 15327 15160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 16508 15330 gene locus_tag LOCUS_00620 16508 15330 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022386.1 protein_id gnl|my_center|LOCUS_00620 18052 16505 gene locus_tag LOCUS_00630 18052 16505 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_00630 20866 18059 gene locus_tag LOCUS_00640 20866 18059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 21791 20943 gene locus_tag LOCUS_00650 21791 20943 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_00650 22801 21800 gene locus_tag LOCUS_00660 22801 21800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 >Feature sequence004 1178 342 gene locus_tag LOCUS_00670 1178 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 2117 1197 gene locus_tag LOCUS_00680 2117 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 2611 2114 gene locus_tag LOCUS_00690 2611 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 5570 2628 gene locus_tag LOCUS_00700 5570 2628 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_00700 5941 5747 gene locus_tag LOCUS_00710 5941 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 7724 5964 gene locus_tag LOCUS_00720 7724 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 10020 7789 gene locus_tag LOCUS_00730 10020 7789 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_00730 10305 10036 gene locus_tag LOCUS_00740 10305 10036 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660478.1 protein_id gnl|my_center|LOCUS_00740 10772 12199 gene locus_tag LOCUS_00750 10772 12199 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889552.1 protein_id gnl|my_center|LOCUS_00750 12886 12614 gene locus_tag LOCUS_00760 12886 12614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 13539 12883 gene locus_tag LOCUS_00770 13539 12883 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 protein_id gnl|my_center|LOCUS_00770 14920 13904 gene locus_tag LOCUS_00780 14920 13904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 15600 14923 gene locus_tag LOCUS_00790 15600 14923 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_00790 15718 16506 gene locus_tag LOCUS_00800 15718 16506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 17153 16512 gene locus_tag LOCUS_00810 17153 16512 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890562.1 protein_id gnl|my_center|LOCUS_00810 17419 17105 gene locus_tag LOCUS_00820 17419 17105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 18097 17774 gene locus_tag LOCUS_00830 18097 17774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 18325 18104 gene locus_tag LOCUS_00840 18325 18104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 19308 18328 gene locus_tag LOCUS_00850 19308 18328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 20564 19713 gene locus_tag LOCUS_00860 20564 19713 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_00860 21075 21413 gene locus_tag LOCUS_00870 21075 21413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 21410 21682 gene locus_tag LOCUS_00880 21410 21682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 >Feature sequence005 37 2589 gene locus_tag LOCUS_00890 37 2589 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023974.1 protein_id gnl|my_center|LOCUS_00890 5275 2591 gene locus_tag LOCUS_00900 5275 2591 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545920.1 protein_id gnl|my_center|LOCUS_00900 6026 6685 gene locus_tag LOCUS_00910 6026 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 6675 7586 gene locus_tag LOCUS_00920 6675 7586 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545034.1 protein_id gnl|my_center|LOCUS_00920 7784 8335 gene locus_tag LOCUS_00930 7784 8335 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879236.1 protein_id gnl|my_center|LOCUS_00930 8385 8729 gene locus_tag LOCUS_00940 8385 8729 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599895.1 protein_id gnl|my_center|LOCUS_00940 8764 9036 gene locus_tag LOCUS_00950 8764 9036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 9042 11870 gene locus_tag LOCUS_00960 9042 11870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 11873 13579 gene locus_tag LOCUS_00970 11873 13579 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545733.1 protein_id gnl|my_center|LOCUS_00970 13814 14503 gene locus_tag LOCUS_00980 13814 14503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 15213 14527 gene locus_tag LOCUS_00990 15213 14527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 15436 15221 gene locus_tag LOCUS_01000 15436 15221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 15900 15433 gene locus_tag LOCUS_01010 15900 15433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 16579 15938 gene locus_tag LOCUS_01020 16579 15938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 17847 16645 gene locus_tag LOCUS_01030 17847 16645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 18627 17959 gene locus_tag LOCUS_01040 18627 17959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979847.1 protein_id gnl|my_center|LOCUS_01040 20016 19291 gene locus_tag LOCUS_01050 gene pflA 20016 19291 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202364.1 protein_id gnl|my_center|LOCUS_01050 <21741 20154 gene locus_tag LOCUS_01060 <21741 20154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766750.1:formate C-acetyltransferase >Feature sequence006 3259 1616 gene locus_tag LOCUS_01070 3259 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 4947 3256 gene locus_tag LOCUS_01080 4947 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 6161 6424 gene locus_tag LOCUS_01090 6161 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 6879 6586 gene locus_tag LOCUS_01100 6879 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 7238 6882 gene locus_tag LOCUS_01110 7238 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 7344 8495 gene locus_tag LOCUS_01120 7344 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 8503 9039 gene locus_tag LOCUS_01130 8503 9039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 9036 14483 gene locus_tag LOCUS_01140 9036 14483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 16281 14614 gene locus_tag LOCUS_01150 16281 14614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 <16798 16289 gene locus_tag LOCUS_01160 <16798 16289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257202.1:glycosyltransferase family 2 protein >Feature sequence007 <1 918 gene locus_tag LOCUS_01170 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_020646568.1:ATP-binding protein 1006 1716 gene locus_tag LOCUS_01180 1006 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 3001 3804 gene locus_tag LOCUS_01190 3001 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 3831 4460 gene locus_tag LOCUS_01200 3831 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 4664 5353 gene locus_tag LOCUS_01210 4664 5353 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268013.1 protein_id gnl|my_center|LOCUS_01210 5790 5470 gene locus_tag LOCUS_01220 5790 5470 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404971.1 protein_id gnl|my_center|LOCUS_01220 6023 5859 gene locus_tag LOCUS_01230 6023 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 6428 6063 gene locus_tag LOCUS_01240 6428 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 6521 6718 gene locus_tag LOCUS_01250 6521 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 7004 7720 gene locus_tag LOCUS_01260 7004 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 7722 8585 gene locus_tag LOCUS_01270 7722 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 8589 9788 gene locus_tag LOCUS_01280 8589 9788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 10545 9778 gene locus_tag LOCUS_01290 10545 9778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 11438 10725 gene locus_tag LOCUS_01300 11438 10725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 12069 11455 gene locus_tag LOCUS_01310 12069 11455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 12356 12538 gene locus_tag LOCUS_01320 12356 12538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 13105 15078 gene locus_tag LOCUS_01330 13105 15078 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_01330 15661 15849 gene locus_tag LOCUS_01340 15661 15849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 15851 16096 gene locus_tag LOCUS_01350 15851 16096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 16089 16739 gene locus_tag LOCUS_01360 16089 16739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 >Feature sequence008 1547 3094 gene locus_tag LOCUS_01370 1547 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 4256 3168 gene locus_tag LOCUS_01380 4256 3168 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975141.1 protein_id gnl|my_center|LOCUS_01380 4409 5257 gene locus_tag LOCUS_01390 4409 5257 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704060.1 protein_id gnl|my_center|LOCUS_01390 5934 5377 gene locus_tag LOCUS_01400 5934 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 6752 6150 gene locus_tag LOCUS_01410 gene recR 6752 6150 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559169.1 protein_id gnl|my_center|LOCUS_01410 7834 6908 gene locus_tag LOCUS_01420 7834 6908 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475682.1 protein_id gnl|my_center|LOCUS_01420 8314 8024 gene locus_tag LOCUS_01430 8314 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 10117 8438 gene locus_tag LOCUS_01440 10117 8438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 10626 10240 gene locus_tag LOCUS_01450 10626 10240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 10828 10637 gene locus_tag LOCUS_01460 10828 10637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 11100 10930 gene locus_tag LOCUS_01470 11100 10930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 11200 14616 gene locus_tag LOCUS_01480 11200 14616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 14628 15569 gene locus_tag LOCUS_01490 14628 15569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 15902 15573 gene locus_tag LOCUS_01500 15902 15573 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816465.1 protein_id gnl|my_center|LOCUS_01500 >Feature sequence009 558 118 gene locus_tag LOCUS_01510 558 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 3012 655 gene locus_tag LOCUS_01520 3012 655 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023974.1 protein_id gnl|my_center|LOCUS_01520 4687 3161 gene locus_tag LOCUS_01530 4687 3161 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_01530 4919 6286 gene locus_tag LOCUS_01540 4919 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 8049 6295 gene locus_tag LOCUS_01550 gene thrS 8049 6295 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080983.1 protein_id gnl|my_center|LOCUS_01550 8281 9282 gene locus_tag LOCUS_01560 8281 9282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 9289 10044 gene locus_tag LOCUS_01570 9289 10044 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088547.1 protein_id gnl|my_center|LOCUS_01570 10041 10751 gene locus_tag LOCUS_01580 10041 10751 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206686.1 protein_id gnl|my_center|LOCUS_01580 11971 11405 gene locus_tag LOCUS_01590 11971 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01590 12204 13241 gene locus_tag LOCUS_01600 12204 13241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 13684 15465 gene locus_tag LOCUS_01610 gene dnaG 13684 15465 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392160.1 protein_id gnl|my_center|LOCUS_01610 >Feature sequence010 1306 2112 gene locus_tag LOCUS_01620 1306 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 2085 3626 gene locus_tag LOCUS_01630 2085 3626 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966799.1 protein_id gnl|my_center|LOCUS_01630 3763 4164 gene locus_tag LOCUS_01640 3763 4164 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227874.1 protein_id gnl|my_center|LOCUS_01640 4242 5228 gene locus_tag LOCUS_01650 4242 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 5237 5467 gene locus_tag LOCUS_01660 5237 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 5496 6863 gene locus_tag LOCUS_01670 5496 6863 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057799.1 protein_id gnl|my_center|LOCUS_01670 8184 6850 gene locus_tag LOCUS_01680 8184 6850 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869758.1 protein_id gnl|my_center|LOCUS_01680 10033 8189 gene locus_tag LOCUS_01690 10033 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 13027 10070 gene locus_tag LOCUS_01700 gene uvrA 13027 10070 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_01700 13965 13279 gene locus_tag LOCUS_01710 13965 13279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 14383 14159 gene locus_tag LOCUS_01720 14383 14159 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545521.1 protein_id gnl|my_center|LOCUS_01720 14659 14384 gene locus_tag LOCUS_01730 14659 14384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 >Feature sequence011 150 533 gene locus_tag LOCUS_01740 150 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 1466 528 gene locus_tag LOCUS_01750 1466 528 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965124.1 protein_id gnl|my_center|LOCUS_01750 2448 1441 gene locus_tag LOCUS_01760 2448 1441 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356585.1 protein_id gnl|my_center|LOCUS_01760 2890 2537 gene locus_tag LOCUS_01770 2890 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 4388 2874 gene locus_tag LOCUS_01780 4388 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 5942 4449 gene locus_tag LOCUS_01790 5942 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 6838 6023 gene locus_tag LOCUS_01800 6838 6023 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_01800 8170 7739 gene locus_tag LOCUS_01810 8170 7739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 8428 8204 gene locus_tag LOCUS_01820 8428 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 9953 8508 gene locus_tag LOCUS_01830 gene metG 9953 8508 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041424295.1 protein_id gnl|my_center|LOCUS_01830 10595 11329 gene locus_tag LOCUS_01840 10595 11329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 11351 11863 gene locus_tag LOCUS_01850 11351 11863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 11923 13863 gene locus_tag LOCUS_01860 gene dnaK 11923 13863 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257940.1 protein_id gnl|my_center|LOCUS_01860 13870 14403 gene locus_tag LOCUS_01870 13870 14403 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024220.1 protein_id gnl|my_center|LOCUS_01870 >Feature sequence012 123 434 gene locus_tag LOCUS_01880 123 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 431 652 gene locus_tag LOCUS_01890 431 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 745 1356 gene locus_tag LOCUS_01900 745 1356 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_01900 1667 2494 gene locus_tag LOCUS_01910 1667 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 2642 3202 gene locus_tag LOCUS_01920 2642 3202 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730082.1 protein_id gnl|my_center|LOCUS_01920 3986 3678 gene locus_tag LOCUS_01930 3986 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 4051 4788 gene locus_tag LOCUS_01940 4051 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 4867 5964 gene locus_tag LOCUS_01950 4867 5964 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_01950 5974 6633 gene locus_tag LOCUS_01960 5974 6633 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_01960 7162 8793 gene locus_tag LOCUS_01970 7162 8793 CDS product IS1634-like element ISMsm6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727513.1 protein_id gnl|my_center|LOCUS_01970 9704 9039 gene locus_tag LOCUS_01980 9704 9039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 10740 9778 gene locus_tag LOCUS_01990 10740 9778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 12902 12153 gene locus_tag LOCUS_02000 12902 12153 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_02000 14142 12961 gene locus_tag LOCUS_02010 14142 12961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 >Feature sequence013 1635 454 gene locus_tag LOCUS_02020 1635 454 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860940.1 protein_id gnl|my_center|LOCUS_02020 1841 2449 gene locus_tag LOCUS_02030 1841 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 2510 3418 gene locus_tag LOCUS_02040 gene gldA 2510 3418 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_02040 3425 5605 gene locus_tag LOCUS_02050 3425 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 5595 6467 gene locus_tag LOCUS_02060 5595 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 6767 6474 gene locus_tag LOCUS_02070 6767 6474 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932501.1 protein_id gnl|my_center|LOCUS_02070 7071 6742 gene locus_tag LOCUS_02080 7071 6742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 8866 7376 gene locus_tag LOCUS_02090 8866 7376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 8958 11078 gene locus_tag LOCUS_02100 gene recQ 8958 11078 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929065.1 protein_id gnl|my_center|LOCUS_02100 11451 11113 gene locus_tag LOCUS_02110 11451 11113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 <13941 11524 gene locus_tag LOCUS_02120 <13941 11524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545108.1:preprotein translocase subunit SecA >Feature sequence014 747 469 gene locus_tag LOCUS_02130 747 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 905 1240 gene locus_tag LOCUS_02140 905 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 2214 2285 gene locus_tag LOCUS_t00010 2214 2285 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2314 3771 gene locus_tag LOCUS_02150 2314 3771 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_02150 4002 4304 gene locus_tag LOCUS_02160 4002 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 4291 4710 gene locus_tag LOCUS_02170 4291 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 4753 5325 gene locus_tag LOCUS_02180 4753 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02180 5333 5581 gene locus_tag LOCUS_02190 5333 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02190 6018 5632 gene locus_tag LOCUS_02200 6018 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 6099 6944 gene locus_tag LOCUS_02210 6099 6944 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_02210 7037 7960 gene locus_tag LOCUS_02220 7037 7960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 7962 9098 gene locus_tag LOCUS_02230 7962 9098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 9243 9425 gene locus_tag LOCUS_02240 9243 9425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 9418 9963 gene locus_tag LOCUS_02250 9418 9963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 9968 12277 gene locus_tag LOCUS_02260 9968 12277 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229101.1 protein_id gnl|my_center|LOCUS_02260 13025 12297 gene locus_tag LOCUS_02270 gene rsmI 13025 12297 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880697.1 protein_id gnl|my_center|LOCUS_02270 <13663 13071 gene locus_tag LOCUS_02280 <13663 13071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000413738.1:transcriptional repressor LexA >Feature sequence015 624 698 gene locus_tag LOCUS_t00020 624 698 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1659 721 gene locus_tag LOCUS_02290 gene metA 1659 721 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121523.1 protein_id gnl|my_center|LOCUS_02290 2989 1676 gene locus_tag LOCUS_02300 2989 1676 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137848.1 protein_id gnl|my_center|LOCUS_02300 3517 3281 gene locus_tag LOCUS_02310 3517 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 4520 3639 gene locus_tag LOCUS_02320 4520 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 4789 5745 gene locus_tag LOCUS_02330 gene fbp 4789 5745 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939127.1 protein_id gnl|my_center|LOCUS_02330 5738 6919 gene locus_tag LOCUS_02340 gene pgk 5738 6919 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942273.1 protein_id gnl|my_center|LOCUS_02340 7075 8694 gene locus_tag LOCUS_02350 7075 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 9015 9293 gene locus_tag LOCUS_02360 9015 9293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 9296 9580 gene locus_tag LOCUS_02370 9296 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 12157 9620 gene locus_tag LOCUS_02380 gene ppsA 12157 9620 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_02380 >Feature sequence016 230 1201 gene locus_tag LOCUS_02390 230 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 1369 1968 gene locus_tag LOCUS_02400 1369 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 2813 1971 gene locus_tag LOCUS_02410 2813 1971 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_02410 3639 2947 gene locus_tag LOCUS_02420 3639 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 4024 3833 gene locus_tag LOCUS_02430 4024 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 4590 4318 gene locus_tag LOCUS_02440 4590 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 4879 4808 gene locus_tag LOCUS_t00030 4879 4808 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5269 4916 gene locus_tag LOCUS_02450 5269 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 5354 6454 gene locus_tag LOCUS_02460 gene recA 5354 6454 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_02460 6470 6949 gene locus_tag LOCUS_02470 6470 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 7007 8281 gene locus_tag LOCUS_02480 gene rny 7007 8281 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258580.1 protein_id gnl|my_center|LOCUS_02480 8442 8714 gene locus_tag LOCUS_02490 8442 8714 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895910.1 protein_id gnl|my_center|LOCUS_02490 9297 9827 gene locus_tag LOCUS_02500 9297 9827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 9895 10143 gene locus_tag LOCUS_02510 9895 10143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 10150 10362 gene locus_tag LOCUS_02520 10150 10362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 10367 10924 gene locus_tag LOCUS_02530 10367 10924 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707037.1 protein_id gnl|my_center|LOCUS_02530 10968 11255 gene locus_tag LOCUS_02540 10968 11255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 11227 11457 gene locus_tag LOCUS_02550 11227 11457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 <13054 11469 gene locus_tag LOCUS_02560 <13054 11469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876111.1:ATP-dependent DNA helicase >Feature sequence017 370 1935 gene locus_tag LOCUS_02570 370 1935 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942982.1 protein_id gnl|my_center|LOCUS_02570 1969 2844 gene locus_tag LOCUS_02580 1969 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 3284 3784 gene locus_tag LOCUS_02590 3284 3784 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_02590 3850 4032 gene locus_tag LOCUS_02600 3850 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 4130 4420 gene locus_tag LOCUS_02610 4130 4420 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869934.1 protein_id gnl|my_center|LOCUS_02610 4417 4770 gene locus_tag LOCUS_02620 4417 4770 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_02620 5849 6550 gene locus_tag LOCUS_02630 5849 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 6767 7687 gene locus_tag LOCUS_02640 gene ansA 6767 7687 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722312.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02640 7863 8612 gene locus_tag LOCUS_02650 7863 8612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 8609 9022 gene locus_tag LOCUS_02660 8609 9022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 9022 9516 gene locus_tag LOCUS_02670 9022 9516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 9513 9680 gene locus_tag LOCUS_02680 9513 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 9814 10020 gene locus_tag LOCUS_02690 9814 10020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 10258 11466 gene locus_tag LOCUS_02700 10258 11466 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355958.1 protein_id gnl|my_center|LOCUS_02700 11470 12714 gene locus_tag LOCUS_02710 11470 12714 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_02710 >Feature sequence018 669 1637 gene locus_tag LOCUS_02720 669 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 1640 2491 gene locus_tag LOCUS_02730 1640 2491 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_02730 2494 3411 gene locus_tag LOCUS_02740 2494 3411 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073085104.1 protein_id gnl|my_center|LOCUS_02740 3697 4311 gene locus_tag LOCUS_02750 3697 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 4322 5926 gene locus_tag LOCUS_02760 4322 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 6490 6263 gene locus_tag LOCUS_02770 6490 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 6759 6472 gene locus_tag LOCUS_02780 6759 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 6898 7305 gene locus_tag LOCUS_02790 6898 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 7310 8488 gene locus_tag LOCUS_02800 7310 8488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 8530 9105 gene locus_tag LOCUS_02810 8530 9105 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957191.1 protein_id gnl|my_center|LOCUS_02810 9102 10538 gene locus_tag LOCUS_02820 9102 10538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 10555 11466 gene locus_tag LOCUS_02830 gene secF 10555 11466 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258878.1 protein_id gnl|my_center|LOCUS_02830 11926 11474 gene locus_tag LOCUS_02840 11926 11474 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_02840 12711 11923 gene locus_tag LOCUS_02850 12711 11923 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083729.1 protein_id gnl|my_center|LOCUS_02850 >Feature sequence019 541 251 gene locus_tag LOCUS_02860 541 251 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869934.1 protein_id gnl|my_center|LOCUS_02860 1654 1316 gene locus_tag LOCUS_02870 1654 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 2013 2615 gene locus_tag LOCUS_02880 2013 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 2618 7774 gene locus_tag LOCUS_02890 2618 7774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 7798 8823 gene locus_tag LOCUS_02900 7798 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 9471 9244 gene locus_tag LOCUS_02910 9471 9244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 9404 10465 gene locus_tag LOCUS_02920 9404 10465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 10365 12335 gene locus_tag LOCUS_02930 10365 12335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 >Feature sequence020 1118 468 gene locus_tag LOCUS_02940 1118 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 4074 2989 gene locus_tag LOCUS_02950 4074 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 5086 4418 gene locus_tag LOCUS_02960 5086 4418 CDS product TdeIII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546419.1 protein_id gnl|my_center|LOCUS_02960 6779 5205 gene locus_tag LOCUS_02970 6779 5205 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682204.1 protein_id gnl|my_center|LOCUS_02970 7623 6805 gene locus_tag LOCUS_02980 7623 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 8839 9048 gene locus_tag LOCUS_02990 8839 9048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 9286 9948 gene locus_tag LOCUS_03000 9286 9948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 10746 9982 gene locus_tag LOCUS_03010 10746 9982 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881131.1 protein_id gnl|my_center|LOCUS_03010 11731 10790 gene locus_tag LOCUS_03020 11731 10790 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_03020 >Feature sequence021 665 165 gene locus_tag LOCUS_03030 665 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 1287 895 gene locus_tag LOCUS_03040 1287 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 1582 3273 gene locus_tag LOCUS_03050 gene ilvB 1582 3273 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962617.1 protein_id gnl|my_center|LOCUS_03050 3322 5010 gene locus_tag LOCUS_03060 3322 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 5606 5007 gene locus_tag LOCUS_03070 5606 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 5757 5560 gene locus_tag LOCUS_03080 5757 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 7021 5882 gene locus_tag LOCUS_03090 7021 5882 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_03090 7426 7163 gene locus_tag LOCUS_03100 7426 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 8157 7423 gene locus_tag LOCUS_03110 8157 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 8475 10673 gene locus_tag LOCUS_03120 8475 10673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 11008 12084 gene locus_tag LOCUS_03130 gene ilvC 11008 12084 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761037.1 protein_id gnl|my_center|LOCUS_03130 >Feature sequence022 2885 1500 gene locus_tag LOCUS_03140 gene fabF 2885 1500 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938500.1 protein_id gnl|my_center|LOCUS_03140 3889 2942 gene locus_tag LOCUS_03150 gene fabD 3889 2942 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392463.1 protein_id gnl|my_center|LOCUS_03150 4275 3964 gene locus_tag LOCUS_03160 4275 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 6297 4393 gene locus_tag LOCUS_03170 6297 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 6388 7023 gene locus_tag LOCUS_03180 6388 7023 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174997.1 protein_id gnl|my_center|LOCUS_03180 7026 7835 gene locus_tag LOCUS_03190 7026 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 8049 8570 gene locus_tag LOCUS_03200 8049 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 8708 8636 gene locus_tag LOCUS_t00040 8708 8636 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 9185 9260 gene locus_tag LOCUS_t00050 9185 9260 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9757 9326 gene locus_tag LOCUS_03210 9757 9326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 11616 9763 gene locus_tag LOCUS_03220 11616 9763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 >Feature sequence023 341 1468 gene locus_tag LOCUS_03230 341 1468 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932520.1 protein_id gnl|my_center|LOCUS_03230 1465 2586 gene locus_tag LOCUS_03240 1465 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 3716 2583 gene locus_tag LOCUS_03250 3716 2583 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057430.1 protein_id gnl|my_center|LOCUS_03250 4679 3816 gene locus_tag LOCUS_03260 4679 3816 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350017.1 protein_id gnl|my_center|LOCUS_03260 6014 4983 gene locus_tag LOCUS_03270 6014 4983 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258891.1 protein_id gnl|my_center|LOCUS_03270 6352 7563 gene locus_tag LOCUS_03280 6352 7563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 7701 7629 gene locus_tag LOCUS_t00060 7701 7629 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7782 7856 gene locus_tag LOCUS_t00070 7782 7856 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8047 8247 gene locus_tag LOCUS_03290 8047 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 8252 9046 gene locus_tag LOCUS_03300 8252 9046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 9054 9680 gene locus_tag LOCUS_03310 9054 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 9677 10132 gene locus_tag LOCUS_03320 9677 10132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 10163 11395 gene locus_tag LOCUS_03330 10163 11395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 >Feature sequence024 2345 867 gene locus_tag LOCUS_03340 2345 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 3524 2457 gene locus_tag LOCUS_03350 gene nusA 3524 2457 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583567.1 protein_id gnl|my_center|LOCUS_03350 5994 3574 gene locus_tag LOCUS_03360 5994 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 10296 6415 gene locus_tag LOCUS_03370 10296 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 >Feature sequence025 417 4316 gene locus_tag LOCUS_03380 417 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 4683 4321 gene locus_tag LOCUS_03390 4683 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 4766 5242 gene locus_tag LOCUS_03400 4766 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 5289 5786 gene locus_tag LOCUS_03410 5289 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 5886 6164 gene locus_tag LOCUS_03420 5886 6164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 6340 7054 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctcaaatacaaatatcacatttctacttttgtagat 7096 7932 gene locus_tag LOCUS_03430 7096 7932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 8881 7883 gene locus_tag LOCUS_03440 8881 7883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 9885 9007 gene locus_tag LOCUS_03450 9885 9007 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261738.1 protein_id gnl|my_center|LOCUS_03450 10304 9894 gene locus_tag LOCUS_03460 10304 9894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 <11285 10704 gene locus_tag LOCUS_03470 <11285 10704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583373.1:energy-coupling factor transporter ATPase >Feature sequence026 1130 567 gene locus_tag LOCUS_03480 1130 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 1519 2679 gene locus_tag LOCUS_03490 1519 2679 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_03490 3136 2798 gene locus_tag LOCUS_03500 3136 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 5788 3338 gene locus_tag LOCUS_03510 5788 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 5896 5824 gene locus_tag LOCUS_t00080 5896 5824 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6023 7243 gene locus_tag LOCUS_03520 6023 7243 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254572.1 protein_id gnl|my_center|LOCUS_03520 7338 8417 gene locus_tag LOCUS_03530 7338 8417 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794794.1 protein_id gnl|my_center|LOCUS_03530 8424 9098 gene locus_tag LOCUS_03540 8424 9098 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262011.1 protein_id gnl|my_center|LOCUS_03540 9103 10290 gene locus_tag LOCUS_03550 9103 10290 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_03550 10379 11017 gene locus_tag LOCUS_03560 10379 11017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 >Feature sequence027 3 494 gene locus_tag LOCUS_03570 3 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 535 1101 gene locus_tag LOCUS_03580 535 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 1271 2758 gene locus_tag LOCUS_03590 1271 2758 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023091.1 protein_id gnl|my_center|LOCUS_03590 3447 5606 gene locus_tag LOCUS_03600 3447 5606 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477318.1 protein_id gnl|my_center|LOCUS_03600 5819 7027 gene locus_tag LOCUS_03610 5819 7027 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104822.1 protein_id gnl|my_center|LOCUS_03610 7097 7576 gene locus_tag LOCUS_03620 7097 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 8196 7735 gene locus_tag LOCUS_03630 8196 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 8908 8243 gene locus_tag LOCUS_03640 8908 8243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 9734 8910 gene locus_tag LOCUS_03650 gene dat 9734 8910 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233305.1 protein_id gnl|my_center|LOCUS_03650 9867 10259 gene locus_tag LOCUS_03660 9867 10259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 10381 10647 gene locus_tag LOCUS_03670 10381 10647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 10613 10885 gene locus_tag LOCUS_03680 10613 10885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 >Feature sequence028 2028 2537 gene locus_tag LOCUS_03690 2028 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 3442 2534 gene locus_tag LOCUS_03700 3442 2534 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347675.1 protein_id gnl|my_center|LOCUS_03700 4254 3442 gene locus_tag LOCUS_03710 4254 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 4973 4251 gene locus_tag LOCUS_03720 4973 4251 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933673.1 protein_id gnl|my_center|LOCUS_03720 6084 4957 gene locus_tag LOCUS_03730 6084 4957 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942890.1 protein_id gnl|my_center|LOCUS_03730 7116 6172 gene locus_tag LOCUS_03740 7116 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 7213 7141 gene locus_tag LOCUS_t00090 7213 7141 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7306 7875 gene locus_tag LOCUS_03750 gene lepB 7306 7875 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583882.1 protein_id gnl|my_center|LOCUS_03750 8699 7878 gene locus_tag LOCUS_03760 8699 7878 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185518.1 protein_id gnl|my_center|LOCUS_03760 8943 8692 gene locus_tag LOCUS_03770 gene rpmA 8943 8692 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053061.1 protein_id gnl|my_center|LOCUS_03770 9523 9131 gene locus_tag LOCUS_03780 gene rplU 9523 9131 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_03780 >Feature sequence029 1105 221 gene locus_tag LOCUS_03790 1105 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 1775 1107 gene locus_tag LOCUS_03800 1775 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 2428 1883 gene locus_tag LOCUS_03810 2428 1883 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767792.1 protein_id gnl|my_center|LOCUS_03810 3198 2581 gene locus_tag LOCUS_03820 3198 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 4150 5025 gene locus_tag LOCUS_03830 4150 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 5502 5107 gene locus_tag LOCUS_03840 5502 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 5891 5532 gene locus_tag LOCUS_03850 5891 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 6115 5948 gene locus_tag LOCUS_03860 6115 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 6723 6337 gene locus_tag LOCUS_03870 6723 6337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 7231 6824 gene locus_tag LOCUS_03880 7231 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03880 8310 7261 gene locus_tag LOCUS_03890 8310 7261 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064796.1 protein_id gnl|my_center|LOCUS_03890 9861 8317 gene locus_tag LOCUS_03900 9861 8317 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851467.1 protein_id gnl|my_center|LOCUS_03900 10223 10149 gene locus_tag LOCUS_t00100 10223 10149 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence030 94 366 gene locus_tag LOCUS_03910 94 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 898 1800 gene locus_tag LOCUS_03920 898 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 1909 2508 gene locus_tag LOCUS_03930 1909 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 2691 2996 gene locus_tag LOCUS_03940 2691 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 3737 3072 gene locus_tag LOCUS_03950 gene ung 3737 3072 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_03950 4219 3827 gene locus_tag LOCUS_03960 4219 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 4451 4200 gene locus_tag LOCUS_03970 4451 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 5323 4580 gene locus_tag LOCUS_03980 5323 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 5408 6382 gene locus_tag LOCUS_03990 gene mltG 5408 6382 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438164.1 protein_id gnl|my_center|LOCUS_03990 6432 6869 gene locus_tag LOCUS_04000 6432 6869 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086294.1 protein_id gnl|my_center|LOCUS_04000 6875 7726 gene locus_tag LOCUS_04010 6875 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 7731 7988 gene locus_tag LOCUS_04020 7731 7988 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422778.1 protein_id gnl|my_center|LOCUS_04020 8999 7989 gene locus_tag LOCUS_04030 8999 7989 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963514.1 protein_id gnl|my_center|LOCUS_04030 >Feature sequence031 621 238 gene locus_tag LOCUS_04040 621 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 892 1074 gene locus_tag LOCUS_04050 892 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 1245 3086 gene locus_tag LOCUS_04060 gene argS 1245 3086 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765307.1 protein_id gnl|my_center|LOCUS_04060 3157 4290 gene locus_tag LOCUS_04070 3157 4290 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_04070 4509 5804 gene locus_tag LOCUS_04080 4509 5804 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846674.1 protein_id gnl|my_center|LOCUS_04080 6511 5801 gene locus_tag LOCUS_04090 6511 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 6700 7905 gene locus_tag LOCUS_04100 6700 7905 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_04100 7949 9271 gene locus_tag LOCUS_04110 7949 9271 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_04110 9367 9939 gene locus_tag LOCUS_04120 9367 9939 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763353.1 protein_id gnl|my_center|LOCUS_04120 >Feature sequence032 698 171 gene locus_tag LOCUS_04130 698 171 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256759.1 protein_id gnl|my_center|LOCUS_04130 1084 794 gene locus_tag LOCUS_04140 gene rpsF 1084 794 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980921.1 protein_id gnl|my_center|LOCUS_04140 2296 1118 gene locus_tag LOCUS_04150 gene ychF 2296 1118 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_04150 3207 2569 gene locus_tag LOCUS_04160 3207 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 3387 3211 gene locus_tag LOCUS_04170 3387 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 4435 3833 gene locus_tag LOCUS_04180 4435 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 4842 4600 gene locus_tag LOCUS_04190 4842 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 5089 4811 gene locus_tag LOCUS_04200 5089 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 5811 5203 gene locus_tag LOCUS_04210 5811 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 6506 5814 gene locus_tag LOCUS_04220 6506 5814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 6637 6846 gene locus_tag LOCUS_04230 6637 6846 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533400.1 protein_id gnl|my_center|LOCUS_04230 7143 7625 gene locus_tag LOCUS_04240 7143 7625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 9398 8277 gene locus_tag LOCUS_04250 9398 8277 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480366.1 protein_id gnl|my_center|LOCUS_04250 >Feature sequence033 1965 1324 gene locus_tag LOCUS_04260 gene frr 1965 1324 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293875.1 protein_id gnl|my_center|LOCUS_04260 2410 1955 gene locus_tag LOCUS_04270 gene tsf 2410 1955 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259403.1 protein_id gnl|my_center|LOCUS_04270 3513 2557 gene locus_tag LOCUS_04280 3513 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 3739 5337 gene locus_tag LOCUS_04290 3739 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 5340 6701 gene locus_tag LOCUS_04300 5340 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 6862 7698 gene locus_tag LOCUS_04310 6862 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 7701 8744 gene locus_tag LOCUS_04320 7701 8744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 <9460 8759 gene locus_tag LOCUS_04330 <9460 8759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583175.1:serine hydroxymethyltransferase >Feature sequence034 1071 64 gene locus_tag LOCUS_04340 1071 64 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_04340 1869 1204 gene locus_tag LOCUS_04350 1869 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 3372 1954 gene locus_tag LOCUS_04360 gene murC 3372 1954 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018214193.1 protein_id gnl|my_center|LOCUS_04360 6054 3379 gene locus_tag LOCUS_04370 6054 3379 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970308.1 protein_id gnl|my_center|LOCUS_04370 6421 6056 gene locus_tag LOCUS_04380 6421 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 7082 6405 gene locus_tag LOCUS_04390 7082 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 9226 7079 gene locus_tag LOCUS_04400 9226 7079 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970307.1 protein_id gnl|my_center|LOCUS_04400 >Feature sequence035 641 414 gene locus_tag LOCUS_04410 641 414 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391841.1 protein_id gnl|my_center|LOCUS_04410 885 634 gene locus_tag LOCUS_04420 885 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 1685 1425 gene locus_tag LOCUS_04430 1685 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 1928 1689 gene locus_tag LOCUS_04440 1928 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 2562 2185 gene locus_tag LOCUS_04450 2562 2185 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_04450 3932 2676 gene locus_tag LOCUS_04460 3932 2676 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_04460 6195 4066 gene locus_tag LOCUS_04470 6195 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 6755 6192 gene locus_tag LOCUS_04480 6755 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 8034 6805 gene locus_tag LOCUS_04490 8034 6805 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_04490 >Feature sequence036 2030 894 gene locus_tag LOCUS_04500 2030 894 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014989.1 protein_id gnl|my_center|LOCUS_04500 3118 2027 gene locus_tag LOCUS_04510 3118 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 4251 3190 gene locus_tag LOCUS_04520 4251 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 5040 4255 gene locus_tag LOCUS_04530 5040 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 6149 5037 gene locus_tag LOCUS_04540 6149 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 7111 6146 gene locus_tag LOCUS_04550 7111 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 7218 7880 gene locus_tag LOCUS_04560 7218 7880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 8028 8561 gene locus_tag LOCUS_04570 8028 8561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 9223 8618 gene locus_tag LOCUS_04580 9223 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 >Feature sequence037 290 787 gene locus_tag LOCUS_04590 290 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 784 1779 gene locus_tag LOCUS_04600 784 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 1776 2465 gene locus_tag LOCUS_04610 1776 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 2470 3231 gene locus_tag LOCUS_04620 2470 3231 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972477.1 protein_id gnl|my_center|LOCUS_04620 3241 4173 gene locus_tag LOCUS_04630 3241 4173 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_04630 4175 4423 gene locus_tag LOCUS_04640 4175 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 4440 4706 gene locus_tag LOCUS_04650 4440 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 4707 5444 gene locus_tag LOCUS_04660 4707 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 5449 6108 gene locus_tag LOCUS_04670 5449 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 6134 6424 gene locus_tag LOCUS_04680 6134 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 6457 6816 gene locus_tag LOCUS_04690 6457 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 6991 7362 gene locus_tag LOCUS_04700 6991 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 7625 8200 gene locus_tag LOCUS_04710 7625 8200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 8197 8541 gene locus_tag LOCUS_04720 8197 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 >Feature sequence038 1391 498 gene locus_tag LOCUS_04730 1391 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 3175 1541 gene locus_tag LOCUS_04740 3175 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 4716 3172 gene locus_tag LOCUS_04750 4716 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 8031 4744 gene locus_tag LOCUS_04760 8031 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 9205 8495 gene locus_tag LOCUS_04770 9205 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 >Feature sequence039 1209 187 gene locus_tag LOCUS_04780 gene ruvB 1209 187 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_04780 1906 1331 gene locus_tag LOCUS_04790 gene ruvA 1906 1331 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689924.1 protein_id gnl|my_center|LOCUS_04790 2424 2143 gene locus_tag LOCUS_04800 2424 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 2744 2421 gene locus_tag LOCUS_04810 2744 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 3731 2898 gene locus_tag LOCUS_04820 3731 2898 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_04820 3983 3747 gene locus_tag LOCUS_04830 3983 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 6751 4076 gene locus_tag LOCUS_04840 6751 4076 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034260979.1 protein_id gnl|my_center|LOCUS_04840 7063 6755 gene locus_tag LOCUS_04850 7063 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 8966 7053 gene locus_tag LOCUS_04860 8966 7053 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201781412.1 protein_id gnl|my_center|LOCUS_04860 >Feature sequence040 2279 1242 gene locus_tag LOCUS_04870 2279 1242 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060900.1 protein_id gnl|my_center|LOCUS_04870 3556 2402 gene locus_tag LOCUS_04880 gene hmgA 3556 2402 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870211.1 protein_id gnl|my_center|LOCUS_04880 3616 3798 gene locus_tag LOCUS_04890 3616 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 3880 4149 gene locus_tag LOCUS_04900 3880 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 4136 4366 gene locus_tag LOCUS_04910 4136 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 4724 4993 gene locus_tag LOCUS_04920 4724 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 4965 5393 gene locus_tag LOCUS_04930 4965 5393 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484774.1 protein_id gnl|my_center|LOCUS_04930 7857 5419 gene locus_tag LOCUS_04940 gene mgtA 7857 5419 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948085.1 protein_id gnl|my_center|LOCUS_04940 8655 7876 gene locus_tag LOCUS_04950 8655 7876 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382909.1 protein_id gnl|my_center|LOCUS_04950 >Feature sequence041 347 3712 gene locus_tag LOCUS_04960 347 3712 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_04960 3709 4734 gene locus_tag LOCUS_04970 3709 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 4742 8332 gene locus_tag LOCUS_04980 4742 8332 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891828.1 protein_id gnl|my_center|LOCUS_04980 >Feature sequence042 1534 704 gene locus_tag LOCUS_04990 1534 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 2340 1531 gene locus_tag LOCUS_05000 gene fabG 2340 1531 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_05000 2510 3280 gene locus_tag LOCUS_05010 2510 3280 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545308.1 protein_id gnl|my_center|LOCUS_05010 3363 3926 gene locus_tag LOCUS_05020 3363 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 3993 7196 gene locus_tag LOCUS_05030 3993 7196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 7244 8353 gene locus_tag LOCUS_05040 7244 8353 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078864641.1 protein_id gnl|my_center|LOCUS_05040 >Feature sequence043 1103 801 gene locus_tag LOCUS_05050 1103 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 2589 1213 gene locus_tag LOCUS_05060 gene atpD 2589 1213 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874955.1 protein_id gnl|my_center|LOCUS_05060 3481 2609 gene locus_tag LOCUS_05070 gene atpG 3481 2609 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_05070 4950 3478 gene locus_tag LOCUS_05080 gene atpA 4950 3478 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582549.1 protein_id gnl|my_center|LOCUS_05080 5500 5012 gene locus_tag LOCUS_05090 5500 5012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 6291 5572 gene locus_tag LOCUS_05100 6291 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 7169 6387 gene locus_tag LOCUS_05110 7169 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 >Feature sequence044 506 1828 gene locus_tag LOCUS_05120 506 1828 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879940.1 protein_id gnl|my_center|LOCUS_05120 1825 2787 gene locus_tag LOCUS_05130 1825 2787 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_05130 2808 6395 gene locus_tag LOCUS_05140 2808 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 6405 6689 gene locus_tag LOCUS_05150 6405 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 6885 7856 gene locus_tag LOCUS_05160 gene gmd 6885 7856 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_05160 >Feature sequence045 212 829 gene locus_tag LOCUS_05170 212 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 816 1535 gene locus_tag LOCUS_05180 816 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 2232 7007 gene locus_tag LOCUS_05190 2232 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 >Feature sequence046 475 140 gene locus_tag LOCUS_05200 475 140 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142392.1 protein_id gnl|my_center|LOCUS_05200 782 468 gene locus_tag LOCUS_05210 782 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 834 1235 gene locus_tag LOCUS_05220 834 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 1253 2224 gene locus_tag LOCUS_05230 gene obgE 1253 2224 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881354.1 protein_id gnl|my_center|LOCUS_05230 3350 2199 gene locus_tag LOCUS_05240 gene tsaD 3350 2199 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706529.1 protein_id gnl|my_center|LOCUS_05240 3810 3364 gene locus_tag LOCUS_05250 3810 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 4295 3810 gene locus_tag LOCUS_05260 gene rfaE2 4295 3810 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896999.1 protein_id gnl|my_center|LOCUS_05260 5827 4415 gene locus_tag LOCUS_05270 5827 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 6025 7485 gene locus_tag LOCUS_05280 6025 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 7472 8380 gene locus_tag LOCUS_05290 7472 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 >Feature sequence047 <1 1908 gene locus_tag LOCUS_05300 <1 1908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_020404386.1:glycosyltransferase 1937 2683 gene locus_tag LOCUS_05310 1937 2683 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_05310 3749 3153 gene locus_tag LOCUS_05320 3749 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 4006 4203 gene locus_tag LOCUS_05330 4006 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 5608 4853 gene locus_tag LOCUS_05340 5608 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 5942 5868 gene locus_tag LOCUS_t00110 5942 5868 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 6015 7796 gene locus_tag LOCUS_05350 gene polX 6015 7796 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_05350 7793 8350 gene locus_tag LOCUS_05360 7793 8350 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_05360 >Feature sequence048 306 1280 gene locus_tag LOCUS_05370 gene nadC 306 1280 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867134.1 protein_id gnl|my_center|LOCUS_05370 1496 2278 gene locus_tag LOCUS_05380 1496 2278 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871480.1 protein_id gnl|my_center|LOCUS_05380 2517 2891 gene locus_tag LOCUS_05390 2517 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 4187 2973 gene locus_tag LOCUS_05400 4187 2973 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_05400 4678 4376 gene locus_tag LOCUS_05410 4678 4376 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_05410 5188 4919 gene locus_tag LOCUS_05420 5188 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 5336 5262 gene locus_tag LOCUS_t00120 5336 5262 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5663 5400 gene locus_tag LOCUS_05430 5663 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 6573 5728 gene locus_tag LOCUS_05440 gene pheA 6573 5728 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870142.1 protein_id gnl|my_center|LOCUS_05440 7322 6570 gene locus_tag LOCUS_05450 7322 6570 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957934.1 protein_id gnl|my_center|LOCUS_05450 8034 7375 gene locus_tag LOCUS_05460 8034 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 >Feature sequence049 1488 475 gene locus_tag LOCUS_05470 1488 475 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939813.1 protein_id gnl|my_center|LOCUS_05470 2700 1630 gene locus_tag LOCUS_05480 2700 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 3599 2697 gene locus_tag LOCUS_05490 3599 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 6593 3660 gene locus_tag LOCUS_05500 6593 3660 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_05500 7733 6600 gene locus_tag LOCUS_05510 7733 6600 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681145.1 protein_id gnl|my_center|LOCUS_05510 8055 7849 gene locus_tag LOCUS_05520 8055 7849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 >Feature sequence050 190 393 gene locus_tag LOCUS_05530 190 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 1047 292 gene locus_tag LOCUS_05540 1047 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 2278 1127 gene locus_tag LOCUS_05550 2278 1127 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940843.1 protein_id gnl|my_center|LOCUS_05550 3025 2366 gene locus_tag LOCUS_05560 3025 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 4216 3182 gene locus_tag LOCUS_05570 4216 3182 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064796.1 protein_id gnl|my_center|LOCUS_05570 4450 4378 gene locus_tag LOCUS_t00130 4450 4378 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4679 5866 gene locus_tag LOCUS_05580 4679 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 5876 7192 gene locus_tag LOCUS_05590 5876 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 7800 7189 gene locus_tag LOCUS_05600 7800 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 8162 7896 gene locus_tag LOCUS_05610 8162 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 >Feature sequence051 332 1069 gene locus_tag LOCUS_05620 gene atpB 332 1069 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768272.1 protein_id gnl|my_center|LOCUS_05620 1103 1309 gene locus_tag LOCUS_05630 gene atpE 1103 1309 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258898.1 protein_id gnl|my_center|LOCUS_05630 1422 1928 gene locus_tag LOCUS_05640 1422 1928 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258897.1 protein_id gnl|my_center|LOCUS_05640 1930 2283 gene locus_tag LOCUS_05650 1930 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 2280 3821 gene locus_tag LOCUS_05660 gene atpA 2280 3821 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016337.1 protein_id gnl|my_center|LOCUS_05660 3825 4691 gene locus_tag LOCUS_05670 gene atpG 3825 4691 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948667.1 protein_id gnl|my_center|LOCUS_05670 4784 6202 gene locus_tag LOCUS_05680 gene atpD 4784 6202 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_05680 6215 6646 gene locus_tag LOCUS_05690 6215 6646 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_05690 7530 6673 gene locus_tag LOCUS_05700 7530 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 >Feature sequence052 1423 671 gene locus_tag LOCUS_05710 1423 671 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059649.1 protein_id gnl|my_center|LOCUS_05710 2356 1427 gene locus_tag LOCUS_05720 2356 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 2804 2364 gene locus_tag LOCUS_05730 2804 2364 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392661.1 protein_id gnl|my_center|LOCUS_05730 3179 3015 gene locus_tag LOCUS_05740 3179 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 5201 3591 gene locus_tag LOCUS_05750 5201 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 6415 5588 gene locus_tag LOCUS_05760 6415 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 7657 6416 gene locus_tag LOCUS_05770 7657 6416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 >Feature sequence053 2614 2117 gene locus_tag LOCUS_05780 2614 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 2915 2619 gene locus_tag LOCUS_05790 2915 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 3963 2917 gene locus_tag LOCUS_05800 gene gvpN 3963 2917 CDS product gas vesicle protein GvpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890517.1 protein_id gnl|my_center|LOCUS_05800 4293 3994 gene locus_tag LOCUS_05810 4293 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 5150 4611 gene locus_tag LOCUS_05820 5150 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 6147 5248 gene locus_tag LOCUS_05830 6147 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 6695 6483 gene locus_tag LOCUS_05840 6695 6483 CDS product gas vesicle structural protein GvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724507.1 protein_id gnl|my_center|LOCUS_05840 7135 7500 gene locus_tag LOCUS_05850 7135 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 >Feature sequence054 193 266 gene locus_tag LOCUS_t00140 193 266 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 641 4450 gene locus_tag LOCUS_r00010 641 4450 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4553 5194 gene locus_tag LOCUS_05860 4553 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 5866 5978 gene locus_tag LOCUS_r00020 5866 5978 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 6218 7324 gene locus_tag LOCUS_05870 6218 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 >Feature sequence055 503 2326 gene locus_tag LOCUS_05880 gene mrdA 503 2326 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105194.1 protein_id gnl|my_center|LOCUS_05880 2990 2610 gene locus_tag LOCUS_05890 2990 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 3157 3312 gene locus_tag LOCUS_05900 3157 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 3309 3566 gene locus_tag LOCUS_05910 3309 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 3578 4690 gene locus_tag LOCUS_05920 gene dprA 3578 4690 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_05920 5156 4848 gene locus_tag LOCUS_05930 5156 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 5709 5107 gene locus_tag LOCUS_05940 5709 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 6484 7368 gene locus_tag LOCUS_05950 6484 7368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 >Feature sequence056 256 2415 gene locus_tag LOCUS_05960 gene topA 256 2415 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259747.1 protein_id gnl|my_center|LOCUS_05960 3038 3637 gene locus_tag LOCUS_05970 3038 3637 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927009.1 protein_id gnl|my_center|LOCUS_05970 4044 5766 gene locus_tag LOCUS_r00030 4044 5766 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 6277 6350 gene locus_tag LOCUS_t00150 6277 6350 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 6403 6585 gene locus_tag LOCUS_05980 6403 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 6620 6692 gene locus_tag LOCUS_t00160 6620 6692 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 6813 7613 gene locus_tag LOCUS_05990 6813 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 >Feature sequence057 3318 3019 gene locus_tag LOCUS_06000 3318 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 3572 4012 gene locus_tag LOCUS_06010 3572 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 4874 4728 gene locus_tag LOCUS_06020 4874 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 5941 6735 gene locus_tag LOCUS_06030 5941 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 <7591 6739 gene locus_tag LOCUS_06040 <7591 6739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244102.1:GDP-mannose 4,6-dehydratase >Feature sequence058 656 258 gene locus_tag LOCUS_06050 656 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 1118 714 gene locus_tag LOCUS_06060 gene sodN 1118 714 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_06060 2238 1159 gene locus_tag LOCUS_06070 2238 1159 CDS product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052806.1 protein_id gnl|my_center|LOCUS_06070 2659 2240 gene locus_tag LOCUS_06080 gene rnhA 2659 2240 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814734.1 protein_id gnl|my_center|LOCUS_06080 3200 4162 gene locus_tag LOCUS_06090 3200 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 4232 4798 gene locus_tag LOCUS_06100 4232 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 4804 5226 gene locus_tag LOCUS_06110 4804 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 5503 5901 gene locus_tag LOCUS_06120 5503 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 5930 6532 gene locus_tag LOCUS_06130 5930 6532 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359392.1 protein_id gnl|my_center|LOCUS_06130 6927 6589 gene locus_tag LOCUS_06140 6927 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 <7496 6945 gene locus_tag LOCUS_06150 <7496 6945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040132.1:ATP-dependent chaperone ClpB >Feature sequence059 526 1911 gene locus_tag LOCUS_06160 526 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 2025 2699 gene locus_tag LOCUS_06170 2025 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 3505 2756 gene locus_tag LOCUS_06180 3505 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 3544 6099 gene locus_tag LOCUS_06190 3544 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 6113 6952 gene locus_tag LOCUS_06200 6113 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 >Feature sequence060 311 976 gene locus_tag LOCUS_06210 311 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 1236 973 gene locus_tag LOCUS_06220 1236 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 1345 1419 gene locus_tag LOCUS_t00170 1345 1419 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1666 2013 gene locus_tag LOCUS_06230 1666 2013 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932502.1 protein_id gnl|my_center|LOCUS_06230 1994 2272 gene locus_tag LOCUS_06240 1994 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 2503 2769 gene locus_tag LOCUS_06250 2503 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 2766 3053 gene locus_tag LOCUS_06260 2766 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 3429 3626 gene locus_tag LOCUS_06270 3429 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 3744 4187 gene locus_tag LOCUS_06280 3744 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 4192 5064 gene locus_tag LOCUS_06290 4192 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 5104 5547 gene locus_tag LOCUS_06300 5104 5547 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_06300 5691 5762 gene locus_tag LOCUS_t00180 5691 5762 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5851 6171 gene locus_tag LOCUS_06310 5851 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 6180 6428 gene locus_tag LOCUS_06320 6180 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 6487 6930 gene locus_tag LOCUS_06330 6487 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 >Feature sequence061 1713 280 gene locus_tag LOCUS_06340 1713 280 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157499.1 protein_id gnl|my_center|LOCUS_06340 4101 1735 gene locus_tag LOCUS_06350 4101 1735 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477318.1 protein_id gnl|my_center|LOCUS_06350 <7109 4107 gene locus_tag LOCUS_06360 <7109 4107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883927.1:DNA methyltransferase >Feature sequence062 1294 719 gene locus_tag LOCUS_06370 1294 719 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084180.1 protein_id gnl|my_center|LOCUS_06370 1674 2222 gene locus_tag LOCUS_06380 1674 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 2228 3370 gene locus_tag LOCUS_06390 gene rffA 2228 3370 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211981.1 protein_id gnl|my_center|LOCUS_06390 3367 4302 gene locus_tag LOCUS_06400 3367 4302 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989618.1 protein_id gnl|my_center|LOCUS_06400 <7077 5986 gene locus_tag LOCUS_06410 <7077 5986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957791.1:ATP-binding protein >Feature sequence063 445 191 gene locus_tag LOCUS_06420 445 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 1294 449 gene locus_tag LOCUS_06430 1294 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 3192 1303 gene locus_tag LOCUS_06440 gene pheT 3192 1303 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016058.1 protein_id gnl|my_center|LOCUS_06440 4248 3196 gene locus_tag LOCUS_06450 gene pheS 4248 3196 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736387.1 protein_id gnl|my_center|LOCUS_06450 4644 4294 gene locus_tag LOCUS_06460 gene rplT 4644 4294 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192938.1 protein_id gnl|my_center|LOCUS_06460 4915 4712 gene locus_tag LOCUS_06470 4915 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 5456 4890 gene locus_tag LOCUS_06480 gene infC 5456 4890 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830789.1 protein_id gnl|my_center|LOCUS_06480 <7000 5440 gene locus_tag LOCUS_06490 <7000 5440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002262802.1:threonine--tRNA ligase >Feature sequence064 183 1193 gene locus_tag LOCUS_06500 gene prfB 183 1193 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082004.1 protein_id gnl|my_center|LOCUS_06500 1385 2305 gene locus_tag LOCUS_06510 1385 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 2302 2472 gene locus_tag LOCUS_06520 2302 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 3056 2574 gene locus_tag LOCUS_06530 gene folK 3056 2574 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545434.1 protein_id gnl|my_center|LOCUS_06530 3427 3053 gene locus_tag LOCUS_06540 gene folB 3427 3053 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421018.1 protein_id gnl|my_center|LOCUS_06540 4402 3551 gene locus_tag LOCUS_06550 4402 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 5729 4377 gene locus_tag LOCUS_06560 5729 4377 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294071.1 protein_id gnl|my_center|LOCUS_06560 5777 6229 gene locus_tag LOCUS_06570 5777 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 >Feature sequence065 487 1110 gene locus_tag LOCUS_06580 487 1110 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544953.1 protein_id gnl|my_center|LOCUS_06580 1174 1617 gene locus_tag LOCUS_06590 gene ribE 1174 1617 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351731.1 protein_id gnl|my_center|LOCUS_06590 1614 2846 gene locus_tag LOCUS_06600 1614 2846 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987154.1 protein_id gnl|my_center|LOCUS_06600 2875 3963 gene locus_tag LOCUS_06610 gene ribD 2875 3963 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943609.1 protein_id gnl|my_center|LOCUS_06610 4315 3944 gene locus_tag LOCUS_06620 4315 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 4460 4386 gene locus_tag LOCUS_t00190 4460 4386 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4724 5719 gene locus_tag LOCUS_06630 4724 5719 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643221.1 protein_id gnl|my_center|LOCUS_06630 6310 5723 gene locus_tag LOCUS_06640 6310 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 6410 6338 gene locus_tag LOCUS_t00200 6410 6338 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence066 1824 388 gene locus_tag LOCUS_06650 1824 388 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256733.1 protein_id gnl|my_center|LOCUS_06650 2229 2588 gene locus_tag LOCUS_06660 2229 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 2572 3234 gene locus_tag LOCUS_06670 gene rncS 2572 3234 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_06670 3251 3484 gene locus_tag LOCUS_06680 gene rpsP 3251 3484 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545141.1 protein_id gnl|my_center|LOCUS_06680 3517 3759 gene locus_tag LOCUS_06690 3517 3759 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460446.1 protein_id gnl|my_center|LOCUS_06690 3803 4564 gene locus_tag LOCUS_06700 gene trmD 3803 4564 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_06700 5307 4561 gene locus_tag LOCUS_06710 5307 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 5846 5304 gene locus_tag LOCUS_06720 5846 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 <6863 5839 gene locus_tag LOCUS_06730 <6863 5839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228636.1:type IV pilus assembly protein PilM >Feature sequence067 1122 85 gene locus_tag LOCUS_06740 1122 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 1328 1119 gene locus_tag LOCUS_06750 1328 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 1580 1353 gene locus_tag LOCUS_06760 1580 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 1909 3531 gene locus_tag LOCUS_06770 1909 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 3580 4209 gene locus_tag LOCUS_06780 3580 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 4467 6221 gene locus_tag LOCUS_06790 4467 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 >Feature sequence068 3 998 gene locus_tag LOCUS_06800 gene coxFIC1 3 998 CDS product Dot/Icm type IV secretion system effector CoxFIC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769896.1 protein_id gnl|my_center|LOCUS_06800 2029 1802 gene locus_tag LOCUS_06810 2029 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 2265 3017 gene locus_tag LOCUS_06820 2265 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 3103 4599 gene locus_tag LOCUS_06830 3103 4599 CDS product IS1634-like element IS1549 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726646.1 protein_id gnl|my_center|LOCUS_06830 4632 4853 gene locus_tag LOCUS_06840 4632 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 4955 5173 gene locus_tag LOCUS_06850 4955 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 5250 5471 gene locus_tag LOCUS_06860 5250 5471 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418727.1 protein_id gnl|my_center|LOCUS_06860 5475 5975 gene locus_tag LOCUS_06870 5475 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 6178 6492 gene locus_tag LOCUS_06880 6178 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 >Feature sequence069 1826 315 gene locus_tag LOCUS_06890 1826 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 2257 2592 gene locus_tag LOCUS_06900 2257 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06900 3376 2825 gene locus_tag LOCUS_06910 3376 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 4490 3450 gene locus_tag LOCUS_06920 4490 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 5054 4785 gene locus_tag LOCUS_06930 5054 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 5169 5387 gene locus_tag LOCUS_06940 5169 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 5502 6206 gene locus_tag LOCUS_06950 gene radC 5502 6206 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964554.1 protein_id gnl|my_center|LOCUS_06950 >Feature sequence070 53 137 gene locus_tag LOCUS_t00210 53 137 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 391 465 gene locus_tag LOCUS_t00220 391 465 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1435 2151 gene locus_tag LOCUS_06960 1435 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 2161 2775 gene locus_tag LOCUS_06970 2161 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 2769 2960 gene locus_tag LOCUS_06980 2769 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 2985 4244 gene locus_tag LOCUS_06990 2985 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 4424 4900 gene locus_tag LOCUS_07000 4424 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 5125 6696 gene locus_tag LOCUS_07010 5125 6696 CDS product IS1634-like element IS1549 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726646.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence071 407 1324 gene locus_tag LOCUS_07020 407 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 1321 2439 gene locus_tag LOCUS_07030 1321 2439 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057430.1 protein_id gnl|my_center|LOCUS_07030 2427 3590 gene locus_tag LOCUS_07040 2427 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 3643 4914 gene locus_tag LOCUS_07050 3643 4914 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_07050 6106 4973 gene locus_tag LOCUS_07060 6106 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 >Feature sequence072 253 1449 gene locus_tag LOCUS_07070 253 1449 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940837.1 protein_id gnl|my_center|LOCUS_07070 1446 2696 gene locus_tag LOCUS_07080 gene lysA 1446 2696 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462285.1 protein_id gnl|my_center|LOCUS_07080 2969 5572 gene locus_tag LOCUS_07090 2969 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 5582 5992 gene locus_tag LOCUS_07100 5582 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 >Feature sequence073 <1 870 gene locus_tag LOCUS_07110 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258726.1:galactose-1-phosphate uridylyltransferase 890 1975 gene locus_tag LOCUS_07120 gene aroC 890 1975 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_07120 2201 5854 gene locus_tag LOCUS_07130 2201 5854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence074 1051 410 gene locus_tag LOCUS_07140 1051 410 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404464.1 protein_id gnl|my_center|LOCUS_07140 1573 1884 gene locus_tag LOCUS_07150 1573 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 1947 2144 gene locus_tag LOCUS_07160 1947 2144 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_07160 2248 2610 gene locus_tag LOCUS_07170 2248 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 2686 3192 gene locus_tag LOCUS_07180 2686 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 3244 3684 gene locus_tag LOCUS_07190 3244 3684 CDS product DUF1761 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553178.1 protein_id gnl|my_center|LOCUS_07190 3715 4164 gene locus_tag LOCUS_07200 3715 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 4167 4637 gene locus_tag LOCUS_07210 4167 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 4627 4956 gene locus_tag LOCUS_07220 4627 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 5111 5509 gene locus_tag LOCUS_07230 5111 5509 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023551.1 protein_id gnl|my_center|LOCUS_07230 >Feature sequence075 1334 150 gene locus_tag LOCUS_07240 gene serC 1334 150 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052351.1 protein_id gnl|my_center|LOCUS_07240 3337 1448 gene locus_tag LOCUS_07250 3337 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 3647 4867 gene locus_tag LOCUS_07260 3647 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 4864 5310 gene locus_tag LOCUS_07270 4864 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 5326 6519 gene locus_tag LOCUS_07280 5326 6519 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444448.1 protein_id gnl|my_center|LOCUS_07280 >Feature sequence076 1482 1394 gene locus_tag LOCUS_t00230 1482 1394 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1970 1533 gene locus_tag LOCUS_07290 1970 1533 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546746.1 protein_id gnl|my_center|LOCUS_07290 2339 2022 gene locus_tag LOCUS_07300 2339 2022 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384381.1 protein_id gnl|my_center|LOCUS_07300 2550 3527 gene locus_tag LOCUS_07310 2550 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 3616 3543 gene locus_tag LOCUS_t00240 3616 3543 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3799 3710 gene locus_tag LOCUS_t00250 3799 3710 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3867 4463 gene locus_tag LOCUS_07320 3867 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 4766 4840 gene locus_tag LOCUS_t00260 4766 4840 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4920 5007 gene locus_tag LOCUS_t00270 4920 5007 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5277 5828 gene locus_tag LOCUS_07330 5277 5828 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947367.1 protein_id gnl|my_center|LOCUS_07330 6233 5829 gene locus_tag LOCUS_07340 6233 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 6500 6237 gene locus_tag LOCUS_07350 6500 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 >Feature sequence077 585 211 gene locus_tag LOCUS_07360 gene rplN 585 211 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183030.1 protein_id gnl|my_center|LOCUS_07360 869 582 gene locus_tag LOCUS_07370 869 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 1071 862 gene locus_tag LOCUS_07380 1071 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 1483 1073 gene locus_tag LOCUS_07390 gene rplP 1483 1073 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_07390 2156 1506 gene locus_tag LOCUS_07400 gene rpsC 2156 1506 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810152.1 protein_id gnl|my_center|LOCUS_07400 2770 2264 gene locus_tag LOCUS_07410 2770 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 3061 2777 gene locus_tag LOCUS_07420 gene rpsS 3061 2777 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326800.1 protein_id gnl|my_center|LOCUS_07420 3800 3066 gene locus_tag LOCUS_07430 gene rplB 3800 3066 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393934.1 protein_id gnl|my_center|LOCUS_07430 4133 3813 gene locus_tag LOCUS_07440 gene rplW 4133 3813 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393935.1 protein_id gnl|my_center|LOCUS_07440 5043 4261 gene locus_tag LOCUS_07450 gene rplD 5043 4261 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966411.1 protein_id gnl|my_center|LOCUS_07450 5866 5081 gene locus_tag LOCUS_07460 gene rplC 5866 5081 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258231.1 protein_id gnl|my_center|LOCUS_07460 6288 5980 gene locus_tag LOCUS_07470 gene rpsJ 6288 5980 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393938.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence078 2543 528 gene locus_tag LOCUS_07480 2543 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 <6469 2852 gene locus_tag LOCUS_07490 <6469 2852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141541.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence079 519 58 gene locus_tag LOCUS_07500 519 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 3317 1539 gene locus_tag LOCUS_07510 3317 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 3734 3892 gene locus_tag LOCUS_07520 3734 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 4529 4708 gene locus_tag LOCUS_07530 4529 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 6300 5002 gene locus_tag LOCUS_07540 6300 5002 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256439.1 protein_id gnl|my_center|LOCUS_07540 >Feature sequence080 282 1361 gene locus_tag LOCUS_07550 282 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 1408 1701 gene locus_tag LOCUS_07560 1408 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 1848 3341 gene locus_tag LOCUS_07570 gene trpE 1848 3341 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643621.1 protein_id gnl|my_center|LOCUS_07570 3394 4188 gene locus_tag LOCUS_07580 3394 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07580 4211 5275 gene locus_tag LOCUS_07590 gene trpD 4211 5275 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546835.1 protein_id gnl|my_center|LOCUS_07590 5340 6347 gene locus_tag LOCUS_07600 gene trpC 5340 6347 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122620.1 protein_id gnl|my_center|LOCUS_07600 >Feature sequence081 2 406 gene locus_tag LOCUS_07610 2 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 890 414 gene locus_tag LOCUS_07620 890 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 950 2314 gene locus_tag LOCUS_07630 gene lysC 950 2314 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931789.1 protein_id gnl|my_center|LOCUS_07630 3546 2548 gene locus_tag LOCUS_07640 3546 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 3692 3841 gene locus_tag LOCUS_07650 3692 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 4217 5227 gene locus_tag LOCUS_07660 4217 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 >Feature sequence082 <1 1386 gene locus_tag LOCUS_07670 <1 1386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_147373220.1:glutamate--tRNA ligase 1383 1967 gene locus_tag LOCUS_07680 1383 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 1969 2328 gene locus_tag LOCUS_07690 1969 2328 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715480.1 protein_id gnl|my_center|LOCUS_07690 2469 4631 gene locus_tag LOCUS_07700 2469 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 4642 5916 gene locus_tag LOCUS_07710 gene purD 4642 5916 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_07710 >Feature sequence083 1458 136 gene locus_tag LOCUS_07720 gene dnaB 1458 136 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583712.1 protein_id gnl|my_center|LOCUS_07720 2052 1525 gene locus_tag LOCUS_07730 2052 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 2165 2599 gene locus_tag LOCUS_07740 2165 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 2602 3417 gene locus_tag LOCUS_07750 2602 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 3414 4496 gene locus_tag LOCUS_07760 3414 4496 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965395.1 protein_id gnl|my_center|LOCUS_07760 4523 5431 gene locus_tag LOCUS_07770 4523 5431 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_07770 5500 6228 gene locus_tag LOCUS_07780 5500 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 >Feature sequence084 4083 235 gene locus_tag LOCUS_07790 4083 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 4957 4208 gene locus_tag LOCUS_07800 4957 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 5858 5352 gene locus_tag LOCUS_07810 5858 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 <6342 5842 gene locus_tag LOCUS_07820 <6342 5842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583981.1:glucose-1-phosphate thymidylyltransferase >Feature sequence085 1043 2503 gene locus_tag LOCUS_07830 gene nadB 1043 2503 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957382.1 protein_id gnl|my_center|LOCUS_07830 2636 2902 gene locus_tag LOCUS_07840 2636 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 3269 2982 gene locus_tag LOCUS_07850 3269 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 3625 3293 gene locus_tag LOCUS_07860 3625 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 3790 5622 gene locus_tag LOCUS_07870 gene typA 3790 5622 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964991.1 protein_id gnl|my_center|LOCUS_07870 6150 5716 gene locus_tag LOCUS_07880 6150 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 >Feature sequence086 5 1771 gene locus_tag LOCUS_07890 5 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 2105 3748 gene locus_tag LOCUS_07900 2105 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 3921 6035 gene locus_tag LOCUS_07910 3921 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence087 745 122 gene locus_tag LOCUS_07920 745 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 992 4510 gene locus_tag LOCUS_07930 992 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 4503 5354 gene locus_tag LOCUS_07940 4503 5354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 5358 5975 gene locus_tag LOCUS_07950 5358 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 >Feature sequence088 <1 889 gene locus_tag LOCUS_07960 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681898.1:phosphoribosylaminoimidazolesuccinocarboxamide synthase 886 1995 gene locus_tag LOCUS_07970 gene purM 886 1995 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876828.1 protein_id gnl|my_center|LOCUS_07970 2155 4017 gene locus_tag LOCUS_07980 2155 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 4021 5976 gene locus_tag LOCUS_07990 4021 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 6030 6101 gene locus_tag LOCUS_t00280 6030 6101 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence089 155 721 gene locus_tag LOCUS_08000 155 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 988 1374 gene locus_tag LOCUS_08010 988 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 1371 1841 gene locus_tag LOCUS_08020 1371 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 3879 2365 gene locus_tag LOCUS_08030 3879 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 6057 3883 gene locus_tag LOCUS_08040 6057 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence090 1879 1133 gene locus_tag LOCUS_08050 1879 1133 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256931.1 protein_id gnl|my_center|LOCUS_08050 1962 2636 gene locus_tag LOCUS_08060 1962 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 3478 2642 gene locus_tag LOCUS_08070 3478 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 4059 3511 gene locus_tag LOCUS_08080 4059 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 4910 4119 gene locus_tag LOCUS_08090 4910 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 5634 4939 gene locus_tag LOCUS_08100 5634 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 >Feature sequence091 232 1947 gene locus_tag LOCUS_08110 232 1947 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460381.1 protein_id gnl|my_center|LOCUS_08110 2200 2856 gene locus_tag LOCUS_08120 2200 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 3074 4573 gene locus_tag LOCUS_08130 gene lysS 3074 4573 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878711.1 protein_id gnl|my_center|LOCUS_08130 4622 4885 gene locus_tag LOCUS_08140 4622 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 4888 5298 gene locus_tag LOCUS_08150 4888 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 5321 5932 gene locus_tag LOCUS_08160 5321 5932 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence092 390 3665 gene locus_tag LOCUS_08170 390 3665 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_08170 3689 4258 gene locus_tag LOCUS_08180 3689 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 4650 4964 gene locus_tag LOCUS_08190 4650 4964 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693271.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence093 650 916 gene locus_tag LOCUS_08200 650 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 919 1347 gene locus_tag LOCUS_08210 919 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 1910 1353 gene locus_tag LOCUS_08220 1910 1353 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017050.1 protein_id gnl|my_center|LOCUS_08220 3262 1976 gene locus_tag LOCUS_08230 gene secY 3262 1976 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_08230 3834 3349 gene locus_tag LOCUS_08240 gene rplO 3834 3349 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081797.1 protein_id gnl|my_center|LOCUS_08240 4363 3872 gene locus_tag LOCUS_08250 gene rpsE 4363 3872 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258248.1 protein_id gnl|my_center|LOCUS_08250 4725 4396 gene locus_tag LOCUS_08260 gene rplR 4725 4396 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623881.1 protein_id gnl|my_center|LOCUS_08260 5339 4785 gene locus_tag LOCUS_08270 gene rplF 5339 4785 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288677.1 protein_id gnl|my_center|LOCUS_08270 5799 5410 gene locus_tag LOCUS_08280 gene rpsH 5799 5410 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938612.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence094 560 183 gene locus_tag LOCUS_08290 560 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 1057 557 gene locus_tag LOCUS_08300 1057 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 1578 1126 gene locus_tag LOCUS_08310 gene greA 1578 1126 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475533.1 protein_id gnl|my_center|LOCUS_08310 1923 2192 gene locus_tag LOCUS_08320 1923 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 2262 3035 gene locus_tag LOCUS_08330 gene sufC 2262 3035 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831944.1 protein_id gnl|my_center|LOCUS_08330 3290 4549 gene locus_tag LOCUS_08340 gene sufB 3290 4549 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805064.1 protein_id gnl|my_center|LOCUS_08340 4662 5249 gene locus_tag LOCUS_08350 4662 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence095 124 1233 gene locus_tag LOCUS_08360 gene dnaN 124 1233 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_08360 2292 1360 gene locus_tag LOCUS_08370 2292 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 4605 2416 gene locus_tag LOCUS_08380 4605 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 5264 4608 gene locus_tag LOCUS_08390 5264 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 >Feature sequence096 2246 3232 gene locus_tag LOCUS_08400 2246 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 3278 3351 gene locus_tag LOCUS_t00290 3278 3351 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 3643 3882 gene locus_tag LOCUS_08410 3643 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 3990 4295 gene locus_tag LOCUS_08420 3990 4295 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932502.1 protein_id gnl|my_center|LOCUS_08420 4270 4530 gene locus_tag LOCUS_08430 4270 4530 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932501.1 protein_id gnl|my_center|LOCUS_08430 5414 4554 gene locus_tag LOCUS_08440 gene xerD 5414 4554 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083022.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence097 618 1298 gene locus_tag LOCUS_08450 618 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 1400 2482 gene locus_tag LOCUS_08460 1400 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 >Feature sequence098 1339 506 gene locus_tag LOCUS_08470 1339 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 2037 1507 gene locus_tag LOCUS_08480 2037 1507 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_08480 2504 2040 gene locus_tag LOCUS_08490 2504 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 3554 2556 gene locus_tag LOCUS_08500 gene rhuM 3554 2556 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957909.1 protein_id gnl|my_center|LOCUS_08500 4374 3760 gene locus_tag LOCUS_08510 4374 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105965.1 protein_id gnl|my_center|LOCUS_08510 5202 4624 gene locus_tag LOCUS_08520 5202 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08520 5682 5245 gene locus_tag LOCUS_08530 5682 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 >Feature sequence099 1399 689 gene locus_tag LOCUS_08540 gene pyrH 1399 689 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668261.1 protein_id gnl|my_center|LOCUS_08540 2158 1484 gene locus_tag LOCUS_08550 2158 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 2718 2152 gene locus_tag LOCUS_08560 2718 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 3547 2909 gene locus_tag LOCUS_08570 3547 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 4348 3641 gene locus_tag LOCUS_08580 4348 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 4922 4323 gene locus_tag LOCUS_08590 4922 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 <5751 5007 gene locus_tag LOCUS_08600 <5751 5007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583291.1:glycosyltransferase family 4 protein >Feature sequence100 1463 1038 gene locus_tag LOCUS_08610 1463 1038 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484774.1 protein_id gnl|my_center|LOCUS_08610 1758 1456 gene locus_tag LOCUS_08620 1758 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 3089 1815 gene locus_tag LOCUS_08630 3089 1815 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_08630 3868 3140 gene locus_tag LOCUS_08640 3868 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence101 197 727 gene locus_tag LOCUS_08650 197 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 1051 839 gene locus_tag LOCUS_08660 1051 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 1600 2067 gene locus_tag LOCUS_08670 1600 2067 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036432311.1 protein_id gnl|my_center|LOCUS_08670 2057 2491 gene locus_tag LOCUS_08680 2057 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 2609 3487 gene locus_tag LOCUS_08690 2609 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 4038 3781 gene locus_tag LOCUS_08700 4038 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 4484 4107 gene locus_tag LOCUS_08710 4484 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 4712 4903 gene locus_tag LOCUS_08720 4712 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 4900 5457 gene locus_tag LOCUS_08730 4900 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 >Feature sequence102 794 192 gene locus_tag LOCUS_08740 794 192 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755943.1 protein_id gnl|my_center|LOCUS_08740 2147 918 gene locus_tag LOCUS_08750 2147 918 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022791.1 protein_id gnl|my_center|LOCUS_08750 3259 2237 gene locus_tag LOCUS_08760 3259 2237 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072024.1 protein_id gnl|my_center|LOCUS_08760 3486 4592 gene locus_tag LOCUS_08770 3486 4592 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256386.1 protein_id gnl|my_center|LOCUS_08770 5178 4603 gene locus_tag LOCUS_08780 5178 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence103 213 935 gene locus_tag LOCUS_08790 213 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1497 4871 gene locus_tag LOCUS_08800 1497 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence104 274 591 gene locus_tag LOCUS_08810 274 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 817 1965 gene locus_tag LOCUS_08820 817 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 2101 1898 gene locus_tag LOCUS_08830 2101 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 3099 2287 gene locus_tag LOCUS_08840 3099 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 3481 4173 gene locus_tag LOCUS_08850 3481 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 4164 4239 gene locus_tag LOCUS_t00300 4164 4239 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence105 267 2204 gene locus_tag LOCUS_08860 267 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 4621 2246 gene locus_tag LOCUS_08870 4621 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 >Feature sequence106 1846 143 gene locus_tag LOCUS_08880 gene proS 1846 143 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814310.1 protein_id gnl|my_center|LOCUS_08880 2812 1868 gene locus_tag LOCUS_08890 gene gnd 2812 1868 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765995.1 protein_id gnl|my_center|LOCUS_08890 4388 2928 gene locus_tag LOCUS_08900 gene zwf 4388 2928 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_08900 5328 4480 gene locus_tag LOCUS_08910 5328 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence107 2178 1075 gene locus_tag LOCUS_08920 2178 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 2258 3241 gene locus_tag LOCUS_08930 2258 3241 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566703.1 protein_id gnl|my_center|LOCUS_08930 3646 5115 gene locus_tag LOCUS_08940 3646 5115 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021821.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence108 769 344 gene locus_tag LOCUS_08950 769 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 1028 771 gene locus_tag LOCUS_08960 1028 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 1314 1039 gene locus_tag LOCUS_08970 1314 1039 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391907.1 protein_id gnl|my_center|LOCUS_08970 1704 1348 gene locus_tag LOCUS_08980 1704 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 3953 2064 gene locus_tag LOCUS_08990 3953 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 4338 3961 gene locus_tag LOCUS_09000 4338 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 4448 5050 gene locus_tag LOCUS_09010 4448 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 5059 5322 gene locus_tag LOCUS_09020 5059 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 >Feature sequence109 834 1694 gene locus_tag LOCUS_09030 834 1694 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545968.1 protein_id gnl|my_center|LOCUS_09030 2086 1823 gene locus_tag LOCUS_09040 2086 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 2148 3812 gene locus_tag LOCUS_09050 gene murJ 2148 3812 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460880.1 protein_id gnl|my_center|LOCUS_09050 <5371 3818 gene locus_tag LOCUS_09060 <5371 3818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258594.1:chaperonin GroEL >Feature sequence110 1187 315 gene locus_tag LOCUS_09070 1187 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 4411 1367 gene locus_tag LOCUS_09080 4411 1367 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064497003.1 protein_id gnl|my_center|LOCUS_09080 >Feature sequence111 <1 616 gene locus_tag LOCUS_09090 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258794.1:histidine--tRNA ligase 701 1669 gene locus_tag LOCUS_09100 701 1669 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938246.1 protein_id gnl|my_center|LOCUS_09100 1686 1985 gene locus_tag LOCUS_09110 1686 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 2171 3040 gene locus_tag LOCUS_09120 gene prfA 2171 3040 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256395.1 protein_id gnl|my_center|LOCUS_09120 4792 3047 gene locus_tag LOCUS_09130 4792 3047 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404996.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence112 1390 1088 gene locus_tag LOCUS_09140 1390 1088 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943715.1 protein_id gnl|my_center|LOCUS_09140 1738 1394 gene locus_tag LOCUS_09150 gene hisI 1738 1394 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546303.1 protein_id gnl|my_center|LOCUS_09150 2528 1773 gene locus_tag LOCUS_09160 gene hisF 2528 1773 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_09160 3282 2566 gene locus_tag LOCUS_09170 gene hisA 3282 2566 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949114.1 protein_id gnl|my_center|LOCUS_09170 3932 3342 gene locus_tag LOCUS_09180 gene hisB 3932 3342 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325657.1 protein_id gnl|my_center|LOCUS_09180 5221 3929 gene locus_tag LOCUS_09190 5221 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence113 1085 297 gene locus_tag LOCUS_09200 gene proC 1085 297 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855505.1 protein_id gnl|my_center|LOCUS_09200 2256 1060 gene locus_tag LOCUS_09210 2256 1060 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932313.1 protein_id gnl|my_center|LOCUS_09210 2879 2253 gene locus_tag LOCUS_09220 2879 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 3419 3204 gene locus_tag LOCUS_09230 3419 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 3682 3419 gene locus_tag LOCUS_09240 3682 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 4778 3759 gene locus_tag LOCUS_09250 gene murB 4778 3759 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124176.1 protein_id gnl|my_center|LOCUS_09250 >Feature sequence114 1843 506 gene locus_tag LOCUS_09260 1843 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 2372 1845 gene locus_tag LOCUS_09270 2372 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 4331 2376 gene locus_tag LOCUS_09280 4331 2376 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_09280 4980 4333 gene locus_tag LOCUS_09290 gene lexA 4980 4333 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357566.1 protein_id gnl|my_center|LOCUS_09290 >Feature sequence115 162 1448 gene locus_tag LOCUS_09300 162 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 4520 2385 gene locus_tag LOCUS_09310 4520 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 >Feature sequence116 791 2632 gene locus_tag LOCUS_09320 791 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 3234 2605 gene locus_tag LOCUS_09330 gene rpe 3234 2605 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906199.1 protein_id gnl|my_center|LOCUS_09330 3796 3293 gene locus_tag LOCUS_09340 3796 3293 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859211.1 protein_id gnl|my_center|LOCUS_09340 4480 3899 gene locus_tag LOCUS_09350 4480 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 4579 5004 gene locus_tag LOCUS_09360 4579 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence117 1646 1182 gene locus_tag LOCUS_09370 1646 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 2232 1696 gene locus_tag LOCUS_09380 2232 1696 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174153.1 protein_id gnl|my_center|LOCUS_09380 2757 2431 gene locus_tag LOCUS_09390 2757 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 3185 3940 gene locus_tag LOCUS_09400 3185 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 3933 4133 gene locus_tag LOCUS_09410 3933 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 4143 4724 gene locus_tag LOCUS_09420 4143 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence118 443 45 gene locus_tag LOCUS_09430 443 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 2194 704 gene locus_tag LOCUS_09440 2194 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 4429 2606 gene locus_tag LOCUS_09450 4429 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 <5044 4532 gene locus_tag LOCUS_09460 <5044 4532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385334.1:50S ribosomal protein L1 >Feature sequence119 1941 961 gene locus_tag LOCUS_09470 1941 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 2519 1962 gene locus_tag LOCUS_09480 2519 1962 CDS product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140730.1 protein_id gnl|my_center|LOCUS_09480 2591 3523 gene locus_tag LOCUS_09490 2591 3523 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258875.1 protein_id gnl|my_center|LOCUS_09490 3530 4807 gene locus_tag LOCUS_09500 gene ahcY 3530 4807 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_09500 >Feature sequence120 2446 1532 gene locus_tag LOCUS_09510 2446 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 4563 3877 gene locus_tag LOCUS_09520 4563 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 >Feature sequence121 2452 311 gene locus_tag LOCUS_09530 2452 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 3295 2756 gene locus_tag LOCUS_09540 3295 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 3715 3338 gene locus_tag LOCUS_09550 3715 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 3778 4404 gene locus_tag LOCUS_09560 gene nth 3778 4404 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583053.1 protein_id gnl|my_center|LOCUS_09560 4774 4526 gene locus_tag LOCUS_09570 4774 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence122 336 671 gene locus_tag LOCUS_09580 336 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 705 1739 gene locus_tag LOCUS_09590 705 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 3141 1717 gene locus_tag LOCUS_09600 3141 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 4134 3241 gene locus_tag LOCUS_09610 4134 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 4620 4216 gene locus_tag LOCUS_09620 4620 4216 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975016.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence123 627 1718 gene locus_tag LOCUS_09630 627 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1825 2850 gene locus_tag LOCUS_09640 1825 2850 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681769.1 protein_id gnl|my_center|LOCUS_09640 3169 3801 gene locus_tag LOCUS_09650 3169 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence124 >Feature sequence125 <1 1003 gene locus_tag LOCUS_09660 <1 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011173542.1:ATP-dependent zinc metalloprotease FtsH 1089 1526 gene locus_tag LOCUS_09670 1089 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1582 2580 gene locus_tag LOCUS_09680 1582 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 2756 3187 gene locus_tag LOCUS_09690 2756 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 3189 3824 gene locus_tag LOCUS_09700 3189 3824 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311253.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence126 895 155 gene locus_tag LOCUS_09710 895 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 985 1275 gene locus_tag LOCUS_09720 985 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1288 1653 gene locus_tag LOCUS_09730 1288 1653 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384683.1 protein_id gnl|my_center|LOCUS_09730 2473 1700 gene locus_tag LOCUS_09740 2473 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 4512 2515 gene locus_tag LOCUS_09750 gene uvrB 4512 2515 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963824.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence127 1766 1449 gene locus_tag LOCUS_09760 1766 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 2016 1792 gene locus_tag LOCUS_09770 2016 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 4591 2321 gene locus_tag LOCUS_09780 gene pnp 4591 2321 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence128 68 141 gene locus_tag LOCUS_t00310 68 141 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1518 295 gene locus_tag LOCUS_09790 1518 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1903 1784 gene locus_tag LOCUS_09800 1903 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 2713 2552 gene locus_tag LOCUS_09810 2713 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 3417 2710 gene locus_tag LOCUS_09820 3417 2710 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263187.1 protein_id gnl|my_center|LOCUS_09820 3623 3910 gene locus_tag LOCUS_09830 3623 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 >Feature sequence129 1106 1501 gene locus_tag LOCUS_09840 1106 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1519 2571 gene locus_tag LOCUS_09850 1519 2571 CDS product SMEK domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964051.1 protein_id gnl|my_center|LOCUS_09850 2776 4488 gene locus_tag LOCUS_09860 2776 4488 CDS product DUF2326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964053.1 protein_id gnl|my_center|LOCUS_09860 >Feature sequence130 2204 3409 gene locus_tag LOCUS_09870 gene tyrS 2204 3409 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081488.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence131 1440 103 gene locus_tag LOCUS_09880 1440 103 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_09880 3390 1669 gene locus_tag LOCUS_09890 3390 1669 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124860.1 protein_id gnl|my_center|LOCUS_09890 3494 4642 gene locus_tag LOCUS_09900 3494 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence132 73 426 gene locus_tag LOCUS_09910 73 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 2364 3350 gene locus_tag LOCUS_09920 2364 3350 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072162.1 protein_id gnl|my_center|LOCUS_09920 4217 3426 gene locus_tag LOCUS_09930 4217 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 >Feature sequence133 149 1087 gene locus_tag LOCUS_09940 149 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1149 1385 gene locus_tag LOCUS_09950 1149 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 2320 1391 gene locus_tag LOCUS_09960 2320 1391 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841027.1 protein_id gnl|my_center|LOCUS_09960 2436 2903 gene locus_tag LOCUS_09970 2436 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 3130 3960 gene locus_tag LOCUS_09980 3130 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence134 2511 2164 gene locus_tag LOCUS_09990 2511 2164 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_09990 3724 2564 gene locus_tag LOCUS_10000 3724 2564 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 protein_id gnl|my_center|LOCUS_10000 <4601 3740 gene locus_tag LOCUS_10010 <4601 3740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272534.1:UDP-glucose 4-epimerase GalE >Feature sequence135 2861 1449 gene locus_tag LOCUS_10020 2861 1449 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016159.1 protein_id gnl|my_center|LOCUS_10020 4117 2927 gene locus_tag LOCUS_10030 4117 2927 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881134.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence136 <1 2587 gene locus_tag LOCUS_10040 <1 2587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392105.1:leucine--tRNA ligase 2614 3276 gene locus_tag LOCUS_10050 2614 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence137 801 310 gene locus_tag LOCUS_10060 801 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 3690 1219 gene locus_tag LOCUS_10070 gene ppsA 3690 1219 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence138 294 653 gene locus_tag LOCUS_10080 294 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 667 1110 gene locus_tag LOCUS_10090 667 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 1103 1561 gene locus_tag LOCUS_10100 1103 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 2126 1659 gene locus_tag LOCUS_10110 2126 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 2463 2209 gene locus_tag LOCUS_10120 2463 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 2666 2581 gene locus_tag LOCUS_t00320 2666 2581 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2935 2850 gene locus_tag LOCUS_t00330 2935 2850 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2987 3721 gene locus_tag LOCUS_10130 2987 3721 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970080.1 protein_id gnl|my_center|LOCUS_10130 3969 3727 gene locus_tag LOCUS_10140 3969 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence139 1397 831 gene locus_tag LOCUS_10150 gene efp 1397 831 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965394.1 protein_id gnl|my_center|LOCUS_10150 1543 1629 gene locus_tag LOCUS_t00340 1543 1629 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1681 2019 gene locus_tag LOCUS_10160 1681 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2024 2311 gene locus_tag LOCUS_10170 2024 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 2454 2708 gene locus_tag LOCUS_10180 2454 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 2705 3154 gene locus_tag LOCUS_10190 2705 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence140 223 1008 gene locus_tag LOCUS_10200 gene map 223 1008 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_10200 1089 1307 gene locus_tag LOCUS_10210 gene infA 1089 1307 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_10210 1379 1849 gene locus_tag LOCUS_10220 gene rpsM 1379 1849 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583368.1 protein_id gnl|my_center|LOCUS_10220 1898 2302 gene locus_tag LOCUS_10230 gene rpsK 1898 2302 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892910.1 protein_id gnl|my_center|LOCUS_10230 2386 2988 gene locus_tag LOCUS_10240 gene rpsD 2386 2988 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173699.1 protein_id gnl|my_center|LOCUS_10240 3013 3948 gene locus_tag LOCUS_10250 3013 3948 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567511.1 protein_id gnl|my_center|LOCUS_10250 3964 4410 gene locus_tag LOCUS_10260 gene rplQ 3964 4410 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545032.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence141 141 608 gene locus_tag LOCUS_10270 141 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 616 2091 gene locus_tag LOCUS_10280 616 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 2269 3525 gene locus_tag LOCUS_10290 2269 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 3745 3864 gene locus_tag LOCUS_10300 3745 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 3924 4280 gene locus_tag LOCUS_10310 3924 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence142 >Feature sequence143 1393 440 gene locus_tag LOCUS_10320 1393 440 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_10320 2793 1456 gene locus_tag LOCUS_10330 2793 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence144 542 1048 gene locus_tag LOCUS_10340 542 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1272 1756 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtaaagagataaagtccatcaa 2637 1945 gene locus_tag LOCUS_10350 2637 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 3095 2712 gene locus_tag LOCUS_10360 3095 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 4302 3103 gene locus_tag LOCUS_10370 4302 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence145 513 971 gene locus_tag LOCUS_10380 513 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1078 3870 gene locus_tag LOCUS_10390 1078 3870 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942970.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence146 <1 738 gene locus_tag LOCUS_10400 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000860115.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase 749 2035 gene locus_tag LOCUS_10410 gene eno 749 2035 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003339565.1 protein_id gnl|my_center|LOCUS_10410 2532 3152 gene locus_tag LOCUS_10420 2532 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 3973 3149 gene locus_tag LOCUS_10430 3973 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence147 415 951 gene locus_tag LOCUS_10440 415 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 958 2112 gene locus_tag LOCUS_10450 958 2112 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_10450 2213 2806 gene locus_tag LOCUS_10460 2213 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 3171 2932 gene locus_tag LOCUS_10470 3171 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence148 2 382 gene locus_tag LOCUS_10480 gene rpsI 2 382 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549989.1 protein_id gnl|my_center|LOCUS_10480 1480 488 gene locus_tag LOCUS_10490 1480 488 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809839.1 protein_id gnl|my_center|LOCUS_10490 2580 1477 gene locus_tag LOCUS_10500 2580 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809841.1 protein_id gnl|my_center|LOCUS_10500 3540 2680 gene locus_tag LOCUS_10510 3540 2680 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198966.1 protein_id gnl|my_center|LOCUS_10510 >Feature sequence149 238 1032 gene locus_tag LOCUS_10520 238 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 969 2300 gene locus_tag LOCUS_10530 969 2300 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733072.1 protein_id gnl|my_center|LOCUS_10530 2551 3090 gene locus_tag LOCUS_10540 2551 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 3140 3880 gene locus_tag LOCUS_10550 3140 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 >Feature sequence150 1292 633 gene locus_tag LOCUS_10560 1292 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1874 1383 gene locus_tag LOCUS_10570 1874 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 2950 1877 gene locus_tag LOCUS_10580 2950 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 3821 3081 gene locus_tag LOCUS_10590 3821 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence151 2438 2563 gene locus_tag LOCUS_10600 2438 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 2554 3837 gene locus_tag LOCUS_10610 2554 3837 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence152 572 192 gene locus_tag LOCUS_10620 572 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 1273 1824 gene locus_tag LOCUS_10630 1273 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 2192 1821 gene locus_tag LOCUS_10640 2192 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 2672 3373 gene locus_tag LOCUS_10650 2672 3373 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364318.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence153 1345 635 gene locus_tag LOCUS_10660 1345 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1425 1964 gene locus_tag LOCUS_10670 1425 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1961 2350 gene locus_tag LOCUS_10680 1961 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 2350 3054 gene locus_tag LOCUS_10690 2350 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 3828 3049 gene locus_tag LOCUS_10700 3828 3049 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903173.1 protein_id gnl|my_center|LOCUS_10700 >Feature sequence154 <1 2773 gene locus_tag LOCUS_10710 <1 2773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942279.1:phosphoribosylformylglycinamidine synthase subunit PurS 2777 3574 gene locus_tag LOCUS_10720 2777 3574 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922163.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence155 <1 2023 gene locus_tag LOCUS_10730 <1 2023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005629687.1:phosphoenolpyruvate synthase 2010 3269 gene locus_tag LOCUS_10740 gene eno 2010 3269 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080719.1 protein_id gnl|my_center|LOCUS_10740 3275 3901 gene locus_tag LOCUS_10750 3275 3901 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528615.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence156 308 460 gene locus_tag LOCUS_10760 308 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 741 475 gene locus_tag LOCUS_10770 741 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 2081 930 gene locus_tag LOCUS_10780 2081 930 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_10780 2339 2845 gene locus_tag LOCUS_10790 2339 2845 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence157 1080 199 gene locus_tag LOCUS_10800 gene rsmH 1080 199 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_10800 1628 1194 gene locus_tag LOCUS_10810 gene mraZ 1628 1194 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358778.1 protein_id gnl|my_center|LOCUS_10810 2275 1769 gene locus_tag LOCUS_10820 2275 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 3869 2406 gene locus_tag LOCUS_10830 3869 2406 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence158 334 624 gene locus_tag LOCUS_10840 334 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 736 3756 gene locus_tag LOCUS_10850 gene ileS 736 3756 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986028.1 protein_id gnl|my_center|LOCUS_10850 >Feature sequence159 2482 557 gene locus_tag LOCUS_10860 2482 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 3191 2526 gene locus_tag LOCUS_10870 3191 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 <4016 3194 gene locus_tag LOCUS_10880 <4016 3194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966353.1:mannose-1-phosphate guanylyltransferase >Feature sequence160 82 387 gene locus_tag LOCUS_10890 82 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 344 994 gene locus_tag LOCUS_10900 344 994 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890562.1 protein_id gnl|my_center|LOCUS_10900 1423 1004 gene locus_tag LOCUS_10910 1423 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1616 1425 gene locus_tag LOCUS_10920 1616 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 2899 1694 gene locus_tag LOCUS_10930 2899 1694 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228203.1 protein_id gnl|my_center|LOCUS_10930 <3958 2915 gene locus_tag LOCUS_10940 <3958 2915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583239.1:type IV pilus twitching motility protein PilT >Feature sequence161 2139 3572 gene locus_tag LOCUS_10950 2139 3572 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871161.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence162 1579 767 gene locus_tag LOCUS_10960 gene thiM 1579 767 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256281.1 protein_id gnl|my_center|LOCUS_10960 2261 1590 gene locus_tag LOCUS_10970 gene thiE 2261 1590 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_10970 3594 2269 gene locus_tag LOCUS_10980 gene cytX 3594 2269 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256688.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence163 142 2025 gene locus_tag LOCUS_10990 142 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 2044 2676 gene locus_tag LOCUS_11000 2044 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 2719 2982 gene locus_tag LOCUS_11010 2719 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 2939 3268 gene locus_tag LOCUS_11020 2939 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 3397 3699 gene locus_tag LOCUS_11030 3397 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence164 858 1214 gene locus_tag LOCUS_11040 858 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1502 2692 gene locus_tag LOCUS_11050 1502 2692 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930613.1 protein_id gnl|my_center|LOCUS_11050 >Feature sequence165 3419 3168 gene locus_tag LOCUS_11060 3419 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence166 <1 546 gene locus_tag LOCUS_11070 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004079967.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB >Feature sequence167 2970 3293 gene locus_tag LOCUS_11080 2970 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 >Feature sequence168 847 143 gene locus_tag LOCUS_11090 gene tmk 847 143 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880600.1 protein_id gnl|my_center|LOCUS_11090 1449 880 gene locus_tag LOCUS_11100 gene dcd 1449 880 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582476.1 protein_id gnl|my_center|LOCUS_11100 1550 2302 gene locus_tag LOCUS_11110 1550 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 >Feature sequence169 1408 620 gene locus_tag LOCUS_11120 gene trpA 1408 620 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966434.1 protein_id gnl|my_center|LOCUS_11120 2761 1553 gene locus_tag LOCUS_11130 gene trpB 2761 1553 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546381.1 protein_id gnl|my_center|LOCUS_11130 3527 2865 gene locus_tag LOCUS_11140 3527 2865 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903201.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence170 1202 153 gene locus_tag LOCUS_11150 gene mvaD 1202 153 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547574.1 protein_id gnl|my_center|LOCUS_11150 2206 1199 gene locus_tag LOCUS_11160 2206 1199 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250425.1 protein_id gnl|my_center|LOCUS_11160 3159 2203 gene locus_tag LOCUS_11170 3159 2203 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867665.1 protein_id gnl|my_center|LOCUS_11170 3469 3170 gene locus_tag LOCUS_11180 3469 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 >Feature sequence171 1786 1019 gene locus_tag LOCUS_11190 1786 1019 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890732.1 protein_id gnl|my_center|LOCUS_11190 3256 1895 gene locus_tag LOCUS_11200 3256 1895 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065247.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence172 1473 382 gene locus_tag LOCUS_11210 gene aroB 1473 382 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358508.1 protein_id gnl|my_center|LOCUS_11210 2143 1475 gene locus_tag LOCUS_11220 gene fabG 2143 1475 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881113.1 protein_id gnl|my_center|LOCUS_11220 3018 2140 gene locus_tag LOCUS_11230 3018 2140 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965478.1 protein_id gnl|my_center|LOCUS_11230 <3599 3008 gene locus_tag LOCUS_11240 <3599 3008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002182646.1:acetolactate synthase large subunit >Feature sequence173 >Feature sequence174 1489 2844 gene locus_tag LOCUS_11250 1489 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 2847 3452 gene locus_tag LOCUS_11260 gene def 2847 3452 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963863.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence175 433 1215 gene locus_tag LOCUS_11270 433 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 1731 1237 gene locus_tag LOCUS_11280 1731 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1827 2780 gene locus_tag LOCUS_11290 1827 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 >Feature sequence176 409 2046 gene locus_tag LOCUS_11300 409 2046 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_11300 2065 2976 gene locus_tag LOCUS_11310 2065 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 3049 3333 gene locus_tag LOCUS_11320 3049 3333 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958388.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence177 187 927 gene locus_tag LOCUS_11330 187 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 928 1323 gene locus_tag LOCUS_11340 928 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 1320 2018 gene locus_tag LOCUS_11350 1320 2018 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066430.1 protein_id gnl|my_center|LOCUS_11350 2023 3156 gene locus_tag LOCUS_11360 2023 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence178 1205 2671 gene locus_tag LOCUS_11370 1205 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 >Feature sequence179 543 875 gene locus_tag LOCUS_11380 543 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 872 1690 gene locus_tag LOCUS_11390 gene pyrF 872 1690 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808606.1 protein_id gnl|my_center|LOCUS_11390 1769 2419 gene locus_tag LOCUS_11400 gene pyrE 1769 2419 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962823.1 protein_id gnl|my_center|LOCUS_11400 3386 2454 gene locus_tag LOCUS_11410 gene xerD 3386 2454 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence180 250 1170 gene locus_tag LOCUS_11420 250 1170 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023287.1 protein_id gnl|my_center|LOCUS_11420 1167 1508 gene locus_tag LOCUS_11430 gene panD 1167 1508 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225586.1 protein_id gnl|my_center|LOCUS_11430 1633 2940 gene locus_tag LOCUS_11440 1633 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence181 895 266 gene locus_tag LOCUS_11450 895 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1522 911 gene locus_tag LOCUS_11460 1522 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence182 605 303 gene locus_tag LOCUS_11470 605 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 717 1967 gene locus_tag LOCUS_11480 717 1967 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_11480 2137 3321 gene locus_tag LOCUS_11490 2137 3321 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence183 350 490 gene locus_tag LOCUS_11500 350 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 580 978 gene locus_tag LOCUS_11510 580 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 2156 975 gene locus_tag LOCUS_11520 2156 975 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_11520 2263 2943 gene locus_tag LOCUS_11530 2263 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence184 927 679 gene locus_tag LOCUS_11540 927 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 951 1751 gene locus_tag LOCUS_11550 951 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 2796 2074 gene locus_tag LOCUS_11560 2796 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 2959 3294 gene locus_tag LOCUS_11570 2959 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence185 1566 700 gene locus_tag LOCUS_11580 1566 700 CDS product DUF6390 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894094.1 protein_id gnl|my_center|LOCUS_11580 1948 1607 gene locus_tag LOCUS_11590 1948 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 2136 3221 gene locus_tag LOCUS_11600 2136 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence186 1828 1061 gene locus_tag LOCUS_11610 gene yidA 1828 1061 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209641.1 protein_id gnl|my_center|LOCUS_11610 2452 1859 gene locus_tag LOCUS_11620 2452 1859 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583757.1 protein_id gnl|my_center|LOCUS_11620 <3351 2493 gene locus_tag LOCUS_11630 <3351 2493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462256.1:peptidoglycan bridge formation glycyltransferase FemA/FemB family protein >Feature sequence187 1177 80 gene locus_tag LOCUS_11640 1177 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 2010 1180 gene locus_tag LOCUS_11650 2010 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 3226 1997 gene locus_tag LOCUS_11660 3226 1997 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108520.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence188 1829 1167 gene locus_tag LOCUS_11670 gene tpiA 1829 1167 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583495.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence189 <1 926 gene locus_tag LOCUS_11680 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053240229.1:formate--phosphoribosylaminoimidazolecarboxamide ligase family protein 1111 2511 gene locus_tag LOCUS_11690 gene purB 1111 2511 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438353.1 protein_id gnl|my_center|LOCUS_11690 2560 3084 gene locus_tag LOCUS_11700 gene purE 2560 3084 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147124.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence190 1126 221 gene locus_tag LOCUS_11710 gene pdxS 1126 221 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258093.1 protein_id gnl|my_center|LOCUS_11710 1735 1250 gene locus_tag LOCUS_11720 1735 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 2213 1914 gene locus_tag LOCUS_11730 2213 1914 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946237.1 protein_id gnl|my_center|LOCUS_11730 <3292 2292 gene locus_tag LOCUS_11740 <3292 2292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000414323.1:glycosyltransferase >Feature sequence191 405 229 gene locus_tag LOCUS_11750 405 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 586 413 gene locus_tag LOCUS_11760 586 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1843 590 gene locus_tag LOCUS_11770 1843 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 2810 1899 gene locus_tag LOCUS_11780 2810 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence192 464 964 gene locus_tag LOCUS_11790 464 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 961 1443 gene locus_tag LOCUS_11800 961 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 1488 2093 gene locus_tag LOCUS_11810 1488 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 2222 3016 gene locus_tag LOCUS_11820 2222 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 >Feature sequence193 162 1595 gene locus_tag LOCUS_11830 162 1595 CDS product IS1634-like element IS1549 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726646.1 protein_id gnl|my_center|LOCUS_11830 2381 2452 gene locus_tag LOCUS_t00350 2381 2452 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence194 857 393 gene locus_tag LOCUS_11840 857 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1167 2843 gene locus_tag LOCUS_11850 gene pyrG 1167 2843 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867477.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence195 626 865 gene locus_tag LOCUS_11860 626 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 869 1102 gene locus_tag LOCUS_11870 869 1102 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755925.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence196 970 440 gene locus_tag LOCUS_11880 970 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1904 1050 gene locus_tag LOCUS_11890 gene purU 1904 1050 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881184.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence197 500 745 gene locus_tag LOCUS_11900 500 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1011 2435 gene locus_tag LOCUS_11910 1011 2435 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016159.1 protein_id gnl|my_center|LOCUS_11910 2813 2544 gene locus_tag LOCUS_11920 2813 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 >Feature sequence198 1211 471 gene locus_tag LOCUS_11930 1211 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence199 276 1151 gene locus_tag LOCUS_11940 gene hisG 276 1151 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963108.1 protein_id gnl|my_center|LOCUS_11940 1233 2630 gene locus_tag LOCUS_11950 gene hisD 1233 2630 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964255.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence200 <1 2008 gene locus_tag LOCUS_11960 <1 2008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545329.1:vitamin B12-dependent ribonucleotide reductase 2166 2549 gene locus_tag LOCUS_11970 2166 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence201 1362 46 gene locus_tag LOCUS_11980 gene aroA 1362 46 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262299.1 protein_id gnl|my_center|LOCUS_11980 2606 1527 gene locus_tag LOCUS_11990 gene aroB 2606 1527 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence202 >Feature sequence203 1689 571 gene locus_tag LOCUS_12000 gene ald 1689 571 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583412.1 protein_id gnl|my_center|LOCUS_12000 2867 1785 gene locus_tag LOCUS_12010 gene rpoD 2867 1785 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence204 358 233 gene locus_tag LOCUS_12020 358 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 568 2415 gene locus_tag LOCUS_12030 568 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 >Feature sequence205 1302 256 gene locus_tag LOCUS_12040 gene coxFIC1 1302 256 CDS product Dot/Icm type IV secretion system effector CoxFIC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769896.1 protein_id gnl|my_center|LOCUS_12040 1562 1398 gene locus_tag LOCUS_12050 1562 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1671 2015 gene locus_tag LOCUS_12060 1671 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 2043 2540 gene locus_tag LOCUS_12070 2043 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 2637 2930 gene locus_tag LOCUS_12080 2637 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 >Feature sequence206 213 788 gene locus_tag LOCUS_12090 213 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 2076 793 gene locus_tag LOCUS_12100 2076 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 <2973 2095 gene locus_tag LOCUS_12110 <2973 2095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357632.1:permease-like cell division protein FtsX >Feature sequence207 818 201 gene locus_tag LOCUS_12120 818 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1796 897 gene locus_tag LOCUS_12130 1796 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 2332 1847 gene locus_tag LOCUS_12140 2332 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 2667 2380 gene locus_tag LOCUS_12150 2667 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence208 1158 391 gene locus_tag LOCUS_12160 1158 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1625 1191 gene locus_tag LOCUS_12170 1625 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 >Feature sequence209 571 215 gene locus_tag LOCUS_12180 571 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 1128 817 gene locus_tag LOCUS_12190 1128 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 2603 1188 gene locus_tag LOCUS_12200 2603 1188 CDS product IS1634-like element IS1549 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726646.1 protein_id gnl|my_center|LOCUS_12200 >Feature sequence210 <1 573 gene locus_tag LOCUS_12210 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258902.1:L,D-transpeptidase 1318 578 gene locus_tag LOCUS_12220 1318 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1468 1395 gene locus_tag LOCUS_t00360 1468 1395 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1612 1538 gene locus_tag LOCUS_t00370 1612 1538 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1710 1626 gene locus_tag LOCUS_t00380 1710 1626 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2081 1800 gene locus_tag LOCUS_12230 2081 1800 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932501.1 protein_id gnl|my_center|LOCUS_12230 2364 2065 gene locus_tag LOCUS_12240 2364 2065 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679319.1 protein_id gnl|my_center|LOCUS_12240 2596 2511 gene locus_tag LOCUS_t00390 2596 2511 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence211 1070 663 gene locus_tag LOCUS_12250 1070 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1549 1067 gene locus_tag LOCUS_12260 1549 1067 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461601.1 protein_id gnl|my_center|LOCUS_12260 2375 1713 gene locus_tag LOCUS_12270 gene rlmB 2375 1713 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287441.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence212 688 969 gene locus_tag LOCUS_12280 688 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 941 1198 gene locus_tag LOCUS_12290 941 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1240 1941 gene locus_tag LOCUS_12300 1240 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 2452 2012 gene locus_tag LOCUS_12310 2452 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 2705 2445 gene locus_tag LOCUS_12320 2705 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence213 992 795 gene locus_tag LOCUS_12330 992 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 2083 2451 gene locus_tag LOCUS_12340 2083 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence214 86 961 gene locus_tag LOCUS_12350 86 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 1837 2490 gene locus_tag LOCUS_12360 1837 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence215 1192 716 gene locus_tag LOCUS_12370 1192 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1259 1822 gene locus_tag LOCUS_12380 1259 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 <2800 1819 gene locus_tag LOCUS_12390 <2800 1819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003432462.1:methionine adenosyltransferase >Feature sequence216 2183 543 gene locus_tag LOCUS_12400 2183 543 CDS product IS1634-like element IS1549 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726646.1 protein_id gnl|my_center|LOCUS_12400 2220 2507 gene locus_tag LOCUS_12410 2220 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 2651 2722 gene locus_tag LOCUS_t00400 2651 2722 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence217 <2759 1472 gene locus_tag LOCUS_12420 <2759 1472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048369.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase >Feature sequence218 424 738 gene locus_tag LOCUS_12430 424 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 784 1719 gene locus_tag LOCUS_12440 784 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1723 1989 gene locus_tag LOCUS_12450 1723 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 2011 2751 gene locus_tag LOCUS_12460 2011 2751 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023677.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence219 2375 1287 gene locus_tag LOCUS_12470 gene carA 2375 1287 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence220 637 1215 gene locus_tag LOCUS_12480 637 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1178 1639 gene locus_tag LOCUS_12490 1178 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 2444 1656 gene locus_tag LOCUS_12500 2444 1656 CDS product DUF6390 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894094.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence221 2484 1195 gene locus_tag LOCUS_12510 gene ftsA 2484 1195 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392368.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence222 244 1155 gene locus_tag LOCUS_12520 gene pdxS 244 1155 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258093.1 protein_id gnl|my_center|LOCUS_12520 1152 1763 gene locus_tag LOCUS_12530 gene pdxT 1152 1763 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391559.1 protein_id gnl|my_center|LOCUS_12530 1776 2378 gene locus_tag LOCUS_12540 1776 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 >Feature sequence223 <1 1351 gene locus_tag LOCUS_12550 <1 1351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761012.1:AAA family ATPase 1950 1414 gene locus_tag LOCUS_12560 1950 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 2169 2041 gene locus_tag LOCUS_12570 2169 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 2202 2381 gene locus_tag LOCUS_12580 2202 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence224 774 193 gene locus_tag LOCUS_12590 774 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1849 890 gene locus_tag LOCUS_12600 1849 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 <2702 1906 gene locus_tag LOCUS_12610 <2702 1906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012028050.1:DNA replication/repair protein RecF >Feature sequence225 1011 442 gene locus_tag LOCUS_12620 1011 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1168 974 gene locus_tag LOCUS_12630 1168 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 1739 2413 gene locus_tag LOCUS_12640 1739 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 >Feature sequence226 442 1479 gene locus_tag LOCUS_12650 442 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 2031 1546 gene locus_tag LOCUS_12660 2031 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence227 778 80 gene locus_tag LOCUS_12670 778 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1369 785 gene locus_tag LOCUS_12680 1369 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1894 1643 gene locus_tag LOCUS_12690 1894 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 2083 1907 gene locus_tag LOCUS_12700 2083 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence228 <1 520 gene locus_tag LOCUS_12710 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000010075.1:cysteine desulfurase 691 1059 gene locus_tag LOCUS_12720 691 1059 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_12720 1086 1361 gene locus_tag LOCUS_12730 1086 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 1362 1592 gene locus_tag LOCUS_12740 1362 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 1755 2450 gene locus_tag LOCUS_12750 1755 2450 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073550.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence229 922 1401 gene locus_tag LOCUS_12760 922 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1621 1881 gene locus_tag LOCUS_12770 1621 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1881 2279 gene locus_tag LOCUS_12780 1881 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 2624 2331 gene locus_tag LOCUS_12790 2624 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence230 1157 150 gene locus_tag LOCUS_12800 gene trxB 1157 150 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_12800 1582 1256 gene locus_tag LOCUS_12810 gene trxA 1582 1256 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939125.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence231 1035 217 gene locus_tag LOCUS_12820 1035 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1810 1406 gene locus_tag LOCUS_12830 1810 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence232 575 1258 gene locus_tag LOCUS_12840 575 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 1236 1805 gene locus_tag LOCUS_12850 1236 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 1798 2208 gene locus_tag LOCUS_12860 1798 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 2594 2289 gene locus_tag LOCUS_12870 2594 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence233 1685 1134 gene locus_tag LOCUS_12880 1685 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 <2588 1745 gene locus_tag LOCUS_12890 <2588 1745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257479.1:NAD(P)-dependent oxidoreductase >Feature sequence234 1841 540 gene locus_tag LOCUS_12900 gene rho 1841 540 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256183.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence235 1453 278 gene locus_tag LOCUS_12910 1453 278 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965529.1 protein_id gnl|my_center|LOCUS_12910 <2556 1504 gene locus_tag LOCUS_12920 <2556 1504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460697.1:stage V sporulation protein E >Feature sequence236 692 1876 gene locus_tag LOCUS_12930 692 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence237 50 934 gene locus_tag LOCUS_12940 gene fmt 50 934 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161291.1 protein_id gnl|my_center|LOCUS_12940 1208 1855 gene locus_tag LOCUS_12950 1208 1855 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946654.1 protein_id gnl|my_center|LOCUS_12950 2209 2281 gene locus_tag LOCUS_t00410 2209 2281 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2368 2452 gene locus_tag LOCUS_t00420 2368 2452 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence238 986 534 gene locus_tag LOCUS_12960 gene greA 986 534 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545525.1 protein_id gnl|my_center|LOCUS_12960 1091 1363 gene locus_tag LOCUS_12970 1091 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1465 2223 gene locus_tag LOCUS_12980 gene sufC 1465 2223 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831944.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence239 290 619 gene locus_tag LOCUS_12990 290 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 941 1852 gene locus_tag LOCUS_13000 gene fsa 941 1852 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699371.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence240 <2456 1232 gene locus_tag LOCUS_13010 <2456 1232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679355.1:alanine--tRNA ligase >Feature sequence241 >Feature sequence242 384 1787 gene locus_tag LOCUS_13020 gene leuC 384 1787 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763197.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence243 131 373 gene locus_tag LOCUS_13030 131 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 545 1282 gene locus_tag LOCUS_13040 545 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1294 2277 gene locus_tag LOCUS_13050 1294 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence244 739 80 gene locus_tag LOCUS_13060 739 80 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_13060 1796 1098 gene locus_tag LOCUS_13070 1796 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 <2418 1803 gene locus_tag LOCUS_13080 <2418 1803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941118.1:response regulator transcription factor >Feature sequence245 1554 1300 gene locus_tag LOCUS_13090 1554 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 2067 1660 gene locus_tag LOCUS_13100 2067 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 >Feature sequence246 621 385 gene locus_tag LOCUS_13110 621 385 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532600.1 protein_id gnl|my_center|LOCUS_13110 770 694 gene locus_tag LOCUS_t00430 770 694 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1420 755 gene locus_tag LOCUS_13120 1420 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1789 1717 gene locus_tag LOCUS_t00440 1789 1717 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1894 1810 gene locus_tag LOCUS_t00450 1894 1810 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2118 2044 gene locus_tag LOCUS_t00460 2118 2044 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence247 1398 976 gene locus_tag LOCUS_13130 1398 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1556 1852 gene locus_tag LOCUS_13140 1556 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence248 2308 551 gene locus_tag LOCUS_13150 2308 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence249 1754 1551 gene locus_tag LOCUS_13160 1754 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 >Feature sequence250 1543 749 gene locus_tag LOCUS_13170 1543 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 2048 1518 gene locus_tag LOCUS_13180 2048 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 >Feature sequence251 471 166 gene locus_tag LOCUS_13190 471 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 755 492 gene locus_tag LOCUS_13200 755 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 997 2145 gene locus_tag LOCUS_13210 997 2145 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence252 1451 2197 gene locus_tag LOCUS_13220 1451 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 >Feature sequence253 453 196 gene locus_tag LOCUS_13230 453 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 <2271 528 gene locus_tag LOCUS_13240 <2271 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583146.1:ATP-dependent DNA ligase >Feature sequence254 1021 1917 gene locus_tag LOCUS_13250 gene galU 1021 1917 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583975.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence255 227 469 gene locus_tag LOCUS_13260 227 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 631 1206 gene locus_tag LOCUS_13270 631 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 1214 1819 gene locus_tag LOCUS_13280 1214 1819 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166459.1 protein_id gnl|my_center|LOCUS_13280 >Feature sequence256 282 980 gene locus_tag LOCUS_13290 282 980 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405060.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence257 1719 274 gene locus_tag LOCUS_13300 gene dnaA 1719 274 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416782.1 protein_id gnl|my_center|LOCUS_13300 >Feature sequence258 690 1355 gene locus_tag LOCUS_13310 690 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 1365 1772 gene locus_tag LOCUS_13320 1365 1772 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276126.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence259 181 504 gene locus_tag LOCUS_13330 181 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 562 933 gene locus_tag LOCUS_13340 562 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 1552 920 gene locus_tag LOCUS_13350 1552 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence260 828 544 gene locus_tag LOCUS_13360 828 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1052 828 gene locus_tag LOCUS_13370 1052 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence261 187 804 gene locus_tag LOCUS_13380 187 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 <2181 1089 gene locus_tag LOCUS_13390 <2181 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256170.1:ATP-dependent DNA helicase RecG >Feature sequence262 145 432 gene locus_tag LOCUS_13400 145 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 559 1626 gene locus_tag LOCUS_13410 559 1626 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681769.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence263 <1 1450 gene locus_tag LOCUS_13420 <1 1450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258705.1:dihydroxy-acid dehydratase 1605 1982 gene locus_tag LOCUS_13430 1605 1982 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942875.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence264 >Feature sequence265 174 449 gene locus_tag LOCUS_13440 174 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 520 1065 gene locus_tag LOCUS_13450 520 1065 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767792.1 protein_id gnl|my_center|LOCUS_13450 1374 1805 gene locus_tag LOCUS_13460 1374 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence266 <1 795 gene locus_tag LOCUS_13470 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_020404386.1:glycosyltransferase >Feature sequence267 374 84 gene locus_tag LOCUS_13480 374 84 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946237.1 protein_id gnl|my_center|LOCUS_13480 651 382 gene locus_tag LOCUS_13490 651 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1210 683 gene locus_tag LOCUS_13500 1210 683 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941234.1 protein_id gnl|my_center|LOCUS_13500 <2139 1362 gene locus_tag LOCUS_13510 <2139 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002357569.1:thymidylate synthase >Feature sequence268 956 369 gene locus_tag LOCUS_13520 gene nusG 956 369 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258049.1 protein_id gnl|my_center|LOCUS_13520 1144 959 gene locus_tag LOCUS_13530 1144 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 <2108 1205 gene locus_tag LOCUS_13540 <2108 1205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249760.1:glutamine--fructose-6-phosphate transaminase (isomerizing) >Feature sequence269 263 853 gene locus_tag LOCUS_13550 263 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence270 <1 591 gene locus_tag LOCUS_13560 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250465.1:AAA family ATPase 588 1106 gene locus_tag LOCUS_13570 588 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 1334 1804 gene locus_tag LOCUS_13580 gene nrdR 1334 1804 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454958.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence271 382 1263 gene locus_tag LOCUS_13590 gene mraY 382 1263 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879963.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence272 1326 1610 gene locus_tag LOCUS_13600 1326 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1600 1863 gene locus_tag LOCUS_13610 1600 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 >Feature sequence273 1493 534 gene locus_tag LOCUS_13620 gene mltG 1493 534 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_13620 <2013 1490 gene locus_tag LOCUS_13630 <2013 1490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870172.1:AMP phosphorylase >Feature sequence274 <1 1248 gene locus_tag LOCUS_13640 <1 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005799108.1:carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit >Feature sequence275 603 133 gene locus_tag LOCUS_13650 603 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 1443 616 gene locus_tag LOCUS_13660 1443 616 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393998.1 protein_id gnl|my_center|LOCUS_13660