>Feature sequence001 1632 430 gene locus_tag LOCUS_00010 1632 430 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727109.1 protein_id gnl|my_center|LOCUS_00010 1715 2326 gene locus_tag LOCUS_00020 1715 2326 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972222.1 protein_id gnl|my_center|LOCUS_00020 2416 3885 gene locus_tag LOCUS_00030 2416 3885 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226084.1 protein_id gnl|my_center|LOCUS_00030 4289 3882 gene locus_tag LOCUS_00040 4289 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4958 4293 gene locus_tag LOCUS_00050 4958 4293 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 protein_id gnl|my_center|LOCUS_00050 5271 5660 gene locus_tag LOCUS_00060 5271 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5860 6132 gene locus_tag LOCUS_00070 5860 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6138 8456 gene locus_tag LOCUS_00080 6138 8456 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227744.1 protein_id gnl|my_center|LOCUS_00080 8453 9784 gene locus_tag LOCUS_00090 8453 9784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9781 10866 gene locus_tag LOCUS_00100 9781 10866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10869 11669 gene locus_tag LOCUS_00110 10869 11669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11676 13889 gene locus_tag LOCUS_00120 11676 13889 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_00120 13886 16369 gene locus_tag LOCUS_00130 13886 16369 CDS product NHLP bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458930.1 protein_id gnl|my_center|LOCUS_00130 18375 16366 gene locus_tag LOCUS_00140 18375 16366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18435 19118 gene locus_tag LOCUS_00150 18435 19118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 20920 19283 gene locus_tag LOCUS_00160 gene groL 20920 19283 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_00160 21149 22111 gene locus_tag LOCUS_00170 21149 22111 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974682.1 protein_id gnl|my_center|LOCUS_00170 22417 22115 gene locus_tag LOCUS_00180 22417 22115 CDS product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062316.1 protein_id gnl|my_center|LOCUS_00180 23394 22498 gene locus_tag LOCUS_00190 23394 22498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 24165 23407 gene locus_tag LOCUS_00200 24165 23407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 24202 24897 gene locus_tag LOCUS_00210 24202 24897 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975771.1 protein_id gnl|my_center|LOCUS_00210 27982 24890 gene locus_tag LOCUS_00220 27982 24890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 28153 29601 gene locus_tag LOCUS_00230 28153 29601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 30639 29605 gene locus_tag LOCUS_00240 30639 29605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 30663 31664 gene locus_tag LOCUS_00250 gene exoA 30663 31664 CDS product succinoglycan biosynthesis glycosyltransferase ExoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434899.1 protein_id gnl|my_center|LOCUS_00250 32452 31712 gene locus_tag LOCUS_00260 32452 31712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 33004 32606 gene locus_tag LOCUS_00270 33004 32606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 35285 33384 gene locus_tag LOCUS_00280 35285 33384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 36351 35290 gene locus_tag LOCUS_00290 36351 35290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 37048 36386 gene locus_tag LOCUS_00300 37048 36386 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222406.1 protein_id gnl|my_center|LOCUS_00300 37696 37163 gene locus_tag LOCUS_00310 37696 37163 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873063.1 protein_id gnl|my_center|LOCUS_00310 38867 37698 gene locus_tag LOCUS_00320 38867 37698 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080817.1 protein_id gnl|my_center|LOCUS_00320 38923 40224 gene locus_tag LOCUS_00330 38923 40224 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975759.1 protein_id gnl|my_center|LOCUS_00330 40652 40221 gene locus_tag LOCUS_00340 40652 40221 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027708.1 protein_id gnl|my_center|LOCUS_00340 41145 40645 gene locus_tag LOCUS_00350 gene purE 41145 40645 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 protein_id gnl|my_center|LOCUS_00350 42250 41138 gene locus_tag LOCUS_00360 42250 41138 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975751.1 protein_id gnl|my_center|LOCUS_00360 42384 42917 gene locus_tag LOCUS_00370 42384 42917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 43486 42914 gene locus_tag LOCUS_00380 43486 42914 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907897.1 protein_id gnl|my_center|LOCUS_00380 44247 43513 gene locus_tag LOCUS_00390 44247 43513 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 protein_id gnl|my_center|LOCUS_00390 44352 45941 gene locus_tag LOCUS_00400 44352 45941 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 protein_id gnl|my_center|LOCUS_00400 46195 47514 gene locus_tag LOCUS_00410 46195 47514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 48704 47577 gene locus_tag LOCUS_00420 48704 47577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 49189 48728 gene locus_tag LOCUS_00430 49189 48728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 49835 49230 gene locus_tag LOCUS_00440 49835 49230 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974050.1 protein_id gnl|my_center|LOCUS_00440 49890 51644 gene locus_tag LOCUS_00450 49890 51644 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029950.1 protein_id gnl|my_center|LOCUS_00450 51746 53062 gene locus_tag LOCUS_00460 51746 53062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973466.1 protein_id gnl|my_center|LOCUS_00460 54460 53066 gene locus_tag LOCUS_00470 54460 53066 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872192.1 protein_id gnl|my_center|LOCUS_00470 54516 54965 gene locus_tag LOCUS_00480 54516 54965 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222831.1 protein_id gnl|my_center|LOCUS_00480 54990 55799 gene locus_tag LOCUS_00490 54990 55799 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776134.1 protein_id gnl|my_center|LOCUS_00490 55801 56292 gene locus_tag LOCUS_00500 55801 56292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 56289 57230 gene locus_tag LOCUS_00510 gene deoC 56289 57230 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_00510 57238 58680 gene locus_tag LOCUS_00520 57238 58680 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029944.1 protein_id gnl|my_center|LOCUS_00520 58680 59549 gene locus_tag LOCUS_00530 58680 59549 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222792.1 protein_id gnl|my_center|LOCUS_00530 59569 60138 gene locus_tag LOCUS_00540 59569 60138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 60416 60135 gene locus_tag LOCUS_00550 60416 60135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 61505 60432 gene locus_tag LOCUS_00560 61505 60432 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_00560 66365 61515 gene locus_tag LOCUS_00570 66365 61515 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_00570 67364 66387 gene locus_tag LOCUS_00580 67364 66387 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730443.1 protein_id gnl|my_center|LOCUS_00580 68778 67369 gene locus_tag LOCUS_00590 68778 67369 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_00590 69470 68829 gene locus_tag LOCUS_00600 69470 68829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 70717 69491 gene locus_tag LOCUS_00610 70717 69491 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776070.1 protein_id gnl|my_center|LOCUS_00610 71394 70714 gene locus_tag LOCUS_00620 71394 70714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 71508 71795 gene locus_tag LOCUS_00630 71508 71795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 72123 71770 gene locus_tag LOCUS_00640 72123 71770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 72061 72315 gene locus_tag LOCUS_00650 72061 72315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 72457 72951 gene locus_tag LOCUS_00660 72457 72951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 72984 73217 gene locus_tag LOCUS_00670 72984 73217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 73199 73564 gene locus_tag LOCUS_00680 73199 73564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 73637 74419 gene locus_tag LOCUS_00690 73637 74419 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064405.1 protein_id gnl|my_center|LOCUS_00690 74416 75378 gene locus_tag LOCUS_00700 74416 75378 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730500.1 protein_id gnl|my_center|LOCUS_00700 75404 77086 gene locus_tag LOCUS_00710 75404 77086 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350815.1 protein_id gnl|my_center|LOCUS_00710 77129 77368 gene locus_tag LOCUS_00720 77129 77368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 77365 77808 gene locus_tag LOCUS_00730 77365 77808 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414624.1 protein_id gnl|my_center|LOCUS_00730 78969 77833 gene locus_tag LOCUS_00740 gene cax 78969 77833 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967349.1 protein_id gnl|my_center|LOCUS_00740 79101 79176 gene locus_tag LOCUS_t00010 79101 79176 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 79747 79253 gene locus_tag LOCUS_00750 79747 79253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 81467 79938 gene locus_tag LOCUS_00760 81467 79938 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031209.1 protein_id gnl|my_center|LOCUS_00760 81552 82763 gene locus_tag LOCUS_00770 81552 82763 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975556.1 protein_id gnl|my_center|LOCUS_00770 83683 82733 gene locus_tag LOCUS_00780 gene rlmB 83683 82733 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230407.1 protein_id gnl|my_center|LOCUS_00780 85083 83683 gene locus_tag LOCUS_00790 gene cysS 85083 83683 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_00790 85491 85087 gene locus_tag LOCUS_00800 85491 85087 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112247.1 protein_id gnl|my_center|LOCUS_00800 85983 85501 gene locus_tag LOCUS_00810 gene ispF 85983 85501 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029522.1 protein_id gnl|my_center|LOCUS_00810 86692 85973 gene locus_tag LOCUS_00820 gene ispD 86692 85973 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029521.1 protein_id gnl|my_center|LOCUS_00820 87202 86720 gene locus_tag LOCUS_00830 87202 86720 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003953493.1 protein_id gnl|my_center|LOCUS_00830 87331 87837 gene locus_tag LOCUS_00840 87331 87837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 88522 87842 gene locus_tag LOCUS_00850 88522 87842 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_00850 89667 88519 gene locus_tag LOCUS_00860 89667 88519 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_00860 89775 90437 gene locus_tag LOCUS_00870 gene phoU 89775 90437 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_00870 90566 91801 gene locus_tag LOCUS_00880 gene mshA 90566 91801 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742053.1 protein_id gnl|my_center|LOCUS_00880 91798 92298 gene locus_tag LOCUS_00890 91798 92298 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974766.1 protein_id gnl|my_center|LOCUS_00890 92319 93074 gene locus_tag LOCUS_00900 92319 93074 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974762.1 protein_id gnl|my_center|LOCUS_00900 93076 93795 gene locus_tag LOCUS_00910 93076 93795 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 protein_id gnl|my_center|LOCUS_00910 94086 93802 gene locus_tag LOCUS_00920 94086 93802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 94589 94146 gene locus_tag LOCUS_00930 94589 94146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 94993 94586 gene locus_tag LOCUS_00940 94993 94586 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029496.1 protein_id gnl|my_center|LOCUS_00940 96219 95062 gene locus_tag LOCUS_00950 96219 95062 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111120.1 protein_id gnl|my_center|LOCUS_00950 97166 96216 gene locus_tag LOCUS_00960 97166 96216 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_00960 97244 97645 gene locus_tag LOCUS_00970 gene dtd 97244 97645 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112231.1 protein_id gnl|my_center|LOCUS_00970 97843 97649 gene locus_tag LOCUS_00980 97843 97649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 97947 98414 gene locus_tag LOCUS_00990 97947 98414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 99453 98386 gene locus_tag LOCUS_01000 99453 98386 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974789.1 protein_id gnl|my_center|LOCUS_01000 99898 99461 gene locus_tag LOCUS_01010 99898 99461 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_01010 100418 99900 gene locus_tag LOCUS_01020 100418 99900 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974791.1 protein_id gnl|my_center|LOCUS_01020 101387 100602 gene locus_tag LOCUS_01030 101387 100602 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974811.1 protein_id gnl|my_center|LOCUS_01030 101425 102159 gene locus_tag LOCUS_01040 gene glnR 101425 102159 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_01040 102161 103129 gene locus_tag LOCUS_01050 gene mshD 102161 103129 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_01050 103193 105346 gene locus_tag LOCUS_01060 103193 105346 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_01060 105343 106872 gene locus_tag LOCUS_01070 105343 106872 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978319.1 protein_id gnl|my_center|LOCUS_01070 106908 107813 gene locus_tag LOCUS_01080 gene mutT1 106908 107813 CDS product 8-oxo-(d)GTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728311.1 protein_id gnl|my_center|LOCUS_01080 107933 108895 gene locus_tag LOCUS_01090 107933 108895 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920994.1 protein_id gnl|my_center|LOCUS_01090 108925 109863 gene locus_tag LOCUS_01100 gene pstC 108925 109863 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140013.1 protein_id gnl|my_center|LOCUS_01100 109860 110759 gene locus_tag LOCUS_01110 gene pstA 109860 110759 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405019.1 protein_id gnl|my_center|LOCUS_01110 110776 111672 gene locus_tag LOCUS_01120 gene pstB 110776 111672 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_01120 111879 111673 gene locus_tag LOCUS_01130 111879 111673 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225366.1 protein_id gnl|my_center|LOCUS_01130 111909 112112 gene locus_tag LOCUS_01140 111909 112112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 112827 112063 gene locus_tag LOCUS_01150 112827 112063 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229653.1 protein_id gnl|my_center|LOCUS_01150 114050 112827 gene locus_tag LOCUS_01160 gene glgC 114050 112827 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059650.1 protein_id gnl|my_center|LOCUS_01160 114105 115268 gene locus_tag LOCUS_01170 gene glgA 114105 115268 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226306.1 protein_id gnl|my_center|LOCUS_01170 115265 116221 gene locus_tag LOCUS_01180 115265 116221 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228081.1 protein_id gnl|my_center|LOCUS_01180 116218 117210 gene locus_tag LOCUS_01190 116218 117210 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228081.1 protein_id gnl|my_center|LOCUS_01190 117240 118649 gene locus_tag LOCUS_01200 117240 118649 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_01200 118694 119242 gene locus_tag LOCUS_01210 118694 119242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 120344 119247 gene locus_tag LOCUS_01220 120344 119247 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_01220 121921 120425 gene locus_tag LOCUS_01230 121921 120425 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384516.1 protein_id gnl|my_center|LOCUS_01230 >Feature sequence002 1563 1132 gene locus_tag LOCUS_01240 1563 1132 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612374.1 protein_id gnl|my_center|LOCUS_01240 2567 1551 gene locus_tag LOCUS_01250 2567 1551 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_01250 4235 2640 gene locus_tag LOCUS_01260 4235 2640 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726803.1 protein_id gnl|my_center|LOCUS_01260 4425 5723 gene locus_tag LOCUS_01270 4425 5723 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726802.1 protein_id gnl|my_center|LOCUS_01270 5720 7270 gene locus_tag LOCUS_01280 5720 7270 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726801.1 protein_id gnl|my_center|LOCUS_01280 7272 7874 gene locus_tag LOCUS_01290 7272 7874 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726800.1 protein_id gnl|my_center|LOCUS_01290 7874 8200 gene locus_tag LOCUS_01300 7874 8200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 8209 8457 gene locus_tag LOCUS_01310 8209 8457 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891626.1 protein_id gnl|my_center|LOCUS_01310 8494 8775 gene locus_tag LOCUS_01320 8494 8775 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891625.1 protein_id gnl|my_center|LOCUS_01320 8772 9431 gene locus_tag LOCUS_01330 8772 9431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891624.1 protein_id gnl|my_center|LOCUS_01330 9455 10432 gene locus_tag LOCUS_01340 9455 10432 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390764.1 protein_id gnl|my_center|LOCUS_01340 10441 11223 gene locus_tag LOCUS_01350 gene fabG 10441 11223 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390765.1 protein_id gnl|my_center|LOCUS_01350 11223 12020 gene locus_tag LOCUS_01360 11223 12020 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726796.1 protein_id gnl|my_center|LOCUS_01360 12492 12022 gene locus_tag LOCUS_01370 gene tadA 12492 12022 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974924.1 protein_id gnl|my_center|LOCUS_01370 12994 12500 gene locus_tag LOCUS_01380 12994 12500 CDS product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199198884.1 protein_id gnl|my_center|LOCUS_01380 13086 13760 gene locus_tag LOCUS_01390 gene upp 13086 13760 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 protein_id gnl|my_center|LOCUS_01390 15210 13768 gene locus_tag LOCUS_01400 15210 13768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 16672 15296 gene locus_tag LOCUS_01410 16672 15296 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_01410 16980 16672 gene locus_tag LOCUS_01420 16980 16672 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816822.1 protein_id gnl|my_center|LOCUS_01420 18116 16977 gene locus_tag LOCUS_01430 18116 16977 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223977.1 protein_id gnl|my_center|LOCUS_01430 18157 19158 gene locus_tag LOCUS_01440 18157 19158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 21134 19161 gene locus_tag LOCUS_01450 21134 19161 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224706.1 protein_id gnl|my_center|LOCUS_01450 22673 21195 gene locus_tag LOCUS_01460 22673 21195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 22845 23750 gene locus_tag LOCUS_01470 22845 23750 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228739.1 protein_id gnl|my_center|LOCUS_01470 25384 23747 gene locus_tag LOCUS_01480 25384 23747 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_01480 26125 25403 gene locus_tag LOCUS_01490 26125 25403 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893694.1 protein_id gnl|my_center|LOCUS_01490 27373 26144 gene locus_tag LOCUS_01500 27373 26144 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404937.1 protein_id gnl|my_center|LOCUS_01500 27834 27406 gene locus_tag LOCUS_01510 27834 27406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 27863 29422 gene locus_tag LOCUS_01520 27863 29422 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_01520 29451 29939 gene locus_tag LOCUS_01530 29451 29939 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_01530 32246 29943 gene locus_tag LOCUS_01540 32246 29943 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804687.1 protein_id gnl|my_center|LOCUS_01540 33400 32312 gene locus_tag LOCUS_01550 33400 32312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 33450 33962 gene locus_tag LOCUS_01560 33450 33962 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092399.1 protein_id gnl|my_center|LOCUS_01560 35019 33967 gene locus_tag LOCUS_01570 35019 33967 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528943.1 protein_id gnl|my_center|LOCUS_01570 35798 35016 gene locus_tag LOCUS_01580 35798 35016 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528944.1 protein_id gnl|my_center|LOCUS_01580 36676 35798 gene locus_tag LOCUS_01590 36676 35798 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528945.1 protein_id gnl|my_center|LOCUS_01590 37791 36673 gene locus_tag LOCUS_01600 37791 36673 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528946.1 protein_id gnl|my_center|LOCUS_01600 38681 37821 gene locus_tag LOCUS_01610 38681 37821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 38562 39731 gene locus_tag LOCUS_01620 38562 39731 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461406.1 protein_id gnl|my_center|LOCUS_01620 39745 41037 gene locus_tag LOCUS_01630 39745 41037 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528942.1 protein_id gnl|my_center|LOCUS_01630 41037 41984 gene locus_tag LOCUS_01640 41037 41984 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896728.1 protein_id gnl|my_center|LOCUS_01640 41981 43213 gene locus_tag LOCUS_01650 41981 43213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 44252 43215 gene locus_tag LOCUS_01660 44252 43215 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027566.1 protein_id gnl|my_center|LOCUS_01660 44928 44254 gene locus_tag LOCUS_01670 44928 44254 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325632.1 protein_id gnl|my_center|LOCUS_01670 47012 44925 gene locus_tag LOCUS_01680 47012 44925 CDS product DUF6421 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082817098.1 protein_id gnl|my_center|LOCUS_01680 47296 48537 gene locus_tag LOCUS_01690 gene aldO 47296 48537 CDS product alditol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030685.1 protein_id gnl|my_center|LOCUS_01690 48589 48993 gene locus_tag LOCUS_01700 48589 48993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 49066 49728 gene locus_tag LOCUS_01710 49066 49728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 51122 49725 gene locus_tag LOCUS_01720 51122 49725 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728400.1 protein_id gnl|my_center|LOCUS_01720 52026 51115 gene locus_tag LOCUS_01730 52026 51115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 52118 53509 gene locus_tag LOCUS_01740 52118 53509 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228708.1 protein_id gnl|my_center|LOCUS_01740 53729 54925 gene locus_tag LOCUS_01750 53729 54925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 55043 56077 gene locus_tag LOCUS_01760 55043 56077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 56074 57381 gene locus_tag LOCUS_01770 56074 57381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 57422 57613 gene locus_tag LOCUS_01780 57422 57613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 58148 58074 gene locus_tag LOCUS_t00020 58148 58074 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 58264 58713 gene locus_tag LOCUS_01790 58264 58713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 58847 58756 gene locus_tag LOCUS_t00030 58847 58756 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 58921 59691 gene locus_tag LOCUS_01800 58921 59691 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053237.1 protein_id gnl|my_center|LOCUS_01800 60533 59688 gene locus_tag LOCUS_01810 60533 59688 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 protein_id gnl|my_center|LOCUS_01810 61030 60560 gene locus_tag LOCUS_01820 61030 60560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 62531 61086 gene locus_tag LOCUS_01830 62531 61086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 62632 63810 gene locus_tag LOCUS_01840 62632 63810 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229643.1 protein_id gnl|my_center|LOCUS_01840 63900 63812 gene locus_tag LOCUS_t00040 63900 63812 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 65401 63974 gene locus_tag LOCUS_01850 65401 63974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 65942 65427 gene locus_tag LOCUS_01860 65942 65427 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224335.1 protein_id gnl|my_center|LOCUS_01860 66578 66006 gene locus_tag LOCUS_01870 66578 66006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 67342 66566 gene locus_tag LOCUS_01880 67342 66566 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228441.1 protein_id gnl|my_center|LOCUS_01880 68493 67339 gene locus_tag LOCUS_01890 68493 67339 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227132.1 protein_id gnl|my_center|LOCUS_01890 69103 68495 gene locus_tag LOCUS_01900 69103 68495 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405271.1 protein_id gnl|my_center|LOCUS_01900 70953 69100 gene locus_tag LOCUS_01910 70953 69100 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730568.1 protein_id gnl|my_center|LOCUS_01910 72941 70950 gene locus_tag LOCUS_01920 72941 70950 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224754.1 protein_id gnl|my_center|LOCUS_01920 74560 72947 gene locus_tag LOCUS_01930 74560 72947 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466887.1 protein_id gnl|my_center|LOCUS_01930 74749 75018 gene locus_tag LOCUS_01940 74749 75018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 75158 76396 gene locus_tag LOCUS_01950 75158 76396 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029253.1 protein_id gnl|my_center|LOCUS_01950 76420 77529 gene locus_tag LOCUS_01960 76420 77529 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975108.1 protein_id gnl|my_center|LOCUS_01960 77531 78520 gene locus_tag LOCUS_01970 77531 78520 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_01970 79457 78504 gene locus_tag LOCUS_01980 79457 78504 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974993.1 protein_id gnl|my_center|LOCUS_01980 79531 80898 gene locus_tag LOCUS_01990 79531 80898 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228765.1 protein_id gnl|my_center|LOCUS_01990 81825 80944 gene locus_tag LOCUS_02000 81825 80944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 83129 81825 gene locus_tag LOCUS_02010 gene serS 83129 81825 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974982.1 protein_id gnl|my_center|LOCUS_02010 83275 83775 gene locus_tag LOCUS_02020 83275 83775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 83790 84755 gene locus_tag LOCUS_02030 83790 84755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 85149 85754 gene locus_tag LOCUS_02040 85149 85754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 86299 85805 gene locus_tag LOCUS_02050 86299 85805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 86339 86962 gene locus_tag LOCUS_02060 86339 86962 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222112.1 protein_id gnl|my_center|LOCUS_02060 87873 86959 gene locus_tag LOCUS_02070 87873 86959 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974969.1 protein_id gnl|my_center|LOCUS_02070 89839 87866 gene locus_tag LOCUS_02080 89839 87866 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900811.1 protein_id gnl|my_center|LOCUS_02080 91250 89844 gene locus_tag LOCUS_02090 91250 89844 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219112755.1 protein_id gnl|my_center|LOCUS_02090 91431 92111 gene locus_tag LOCUS_02100 91431 92111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 92179 93435 gene locus_tag LOCUS_02110 92179 93435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 94916 93432 gene locus_tag LOCUS_02120 94916 93432 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975747.1 protein_id gnl|my_center|LOCUS_02120 95887 94913 gene locus_tag LOCUS_02130 gene rfbB 95887 94913 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222917.1 protein_id gnl|my_center|LOCUS_02130 97166 95940 gene locus_tag LOCUS_02140 97166 95940 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_02140 97544 97182 gene locus_tag LOCUS_02150 97544 97182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 98474 97554 gene locus_tag LOCUS_02160 98474 97554 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112346.1 protein_id gnl|my_center|LOCUS_02160 99790 98555 gene locus_tag LOCUS_02170 99790 98555 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727437.1 protein_id gnl|my_center|LOCUS_02170 100230 99892 gene locus_tag LOCUS_02180 100230 99892 CDS product CD225/dispanin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035741.1 protein_id gnl|my_center|LOCUS_02180 101180 100311 gene locus_tag LOCUS_02190 101180 100311 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200823401.1 protein_id gnl|my_center|LOCUS_02190 101279 101728 gene locus_tag LOCUS_02200 101279 101728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 102642 101725 gene locus_tag LOCUS_02210 102642 101725 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_02210 102907 102656 gene locus_tag LOCUS_02220 102907 102656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 103026 103973 gene locus_tag LOCUS_02230 103026 103973 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727136.1 protein_id gnl|my_center|LOCUS_02230 103970 104635 gene locus_tag LOCUS_02240 103970 104635 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109036339.1 protein_id gnl|my_center|LOCUS_02240 105114 104632 gene locus_tag LOCUS_02250 105114 104632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 106940 105144 gene locus_tag LOCUS_02260 106940 105144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 107805 106930 gene locus_tag LOCUS_02270 107805 106930 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226741.1 protein_id gnl|my_center|LOCUS_02270 107804 108214 gene locus_tag LOCUS_02280 107804 108214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 108225 108959 gene locus_tag LOCUS_02290 108225 108959 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113379.1 protein_id gnl|my_center|LOCUS_02290 109036 109764 gene locus_tag LOCUS_02300 109036 109764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 110699 109761 gene locus_tag LOCUS_02310 110699 109761 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223022.1 protein_id gnl|my_center|LOCUS_02310 >Feature sequence003 1499 594 gene locus_tag LOCUS_02320 1499 594 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242581.1 protein_id gnl|my_center|LOCUS_02320 1843 1496 gene locus_tag LOCUS_02330 1843 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412226.1 protein_id gnl|my_center|LOCUS_02330 3149 1833 gene locus_tag LOCUS_02340 3149 1833 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895866.1 protein_id gnl|my_center|LOCUS_02340 3619 3146 gene locus_tag LOCUS_02350 gene ybeY 3619 3146 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899292.1 protein_id gnl|my_center|LOCUS_02350 4584 3616 gene locus_tag LOCUS_02360 4584 3616 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_02360 5055 4711 gene locus_tag LOCUS_02370 5055 4711 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_02370 5811 5071 gene locus_tag LOCUS_02380 5811 5071 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976252.1 protein_id gnl|my_center|LOCUS_02380 6941 5811 gene locus_tag LOCUS_02390 gene dnaJ 6941 5811 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_02390 7957 6944 gene locus_tag LOCUS_02400 gene hrcA 7957 6944 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_02400 8055 8375 gene locus_tag LOCUS_02410 8055 8375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 9533 8331 gene locus_tag LOCUS_02420 gene hemW 9533 8331 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087641.1 protein_id gnl|my_center|LOCUS_02420 9619 9996 gene locus_tag LOCUS_02430 9619 9996 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037733.1 protein_id gnl|my_center|LOCUS_02430 9997 10422 gene locus_tag LOCUS_02440 9997 10422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 12258 10423 gene locus_tag LOCUS_02450 gene lepA 12258 10423 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976242.1 protein_id gnl|my_center|LOCUS_02450 12412 12669 gene locus_tag LOCUS_02460 gene rpsT 12412 12669 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 protein_id gnl|my_center|LOCUS_02460 12746 13747 gene locus_tag LOCUS_02470 gene holA 12746 13747 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165922484.1 protein_id gnl|my_center|LOCUS_02470 16014 13744 gene locus_tag LOCUS_02480 16014 13744 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228464.1 protein_id gnl|my_center|LOCUS_02480 16598 16029 gene locus_tag LOCUS_02490 16598 16029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 17529 16687 gene locus_tag LOCUS_02500 17529 16687 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_02500 18765 17539 gene locus_tag LOCUS_02510 18765 17539 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028712.1 protein_id gnl|my_center|LOCUS_02510 19343 18762 gene locus_tag LOCUS_02520 19343 18762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 21818 19347 gene locus_tag LOCUS_02530 gene leuS 21818 19347 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_02530 22888 21866 gene locus_tag LOCUS_02540 22888 21866 CDS product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263137.1 protein_id gnl|my_center|LOCUS_02540 23554 22922 gene locus_tag LOCUS_02550 23554 22922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 25316 23622 gene locus_tag LOCUS_02560 25316 23622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 25987 25313 gene locus_tag LOCUS_02570 25987 25313 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_02570 26759 26064 gene locus_tag LOCUS_02580 26759 26064 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228467.1 protein_id gnl|my_center|LOCUS_02580 26835 26762 gene locus_tag LOCUS_t00050 26835 26762 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 27544 26885 gene locus_tag LOCUS_02590 27544 26885 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976227.1 protein_id gnl|my_center|LOCUS_02590 27972 27541 gene locus_tag LOCUS_02600 27972 27541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 28816 27947 gene locus_tag LOCUS_02610 28816 27947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 29400 28813 gene locus_tag LOCUS_02620 gene nadD 29400 28813 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_02620 29563 29414 gene locus_tag LOCUS_02630 29563 29414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 30910 29639 gene locus_tag LOCUS_02640 30910 29639 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 protein_id gnl|my_center|LOCUS_02640 31297 30929 gene locus_tag LOCUS_02650 31297 30929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 32468 31323 gene locus_tag LOCUS_02660 gene proB 32468 31323 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_02660 33856 32465 gene locus_tag LOCUS_02670 gene obgE 33856 32465 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976206.1 protein_id gnl|my_center|LOCUS_02670 34131 33880 gene locus_tag LOCUS_02680 gene rpmA 34131 33880 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_02680 34448 34134 gene locus_tag LOCUS_02690 gene rplU 34448 34134 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775855.1 protein_id gnl|my_center|LOCUS_02690 36778 34544 gene locus_tag LOCUS_02700 36778 34544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02700 36429 36628 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gccttcttcggcttgtcgtc 37637 36864 gene locus_tag LOCUS_02710 37637 36864 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_02710 39571 37634 gene locus_tag LOCUS_02720 39571 37634 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_02720 40761 39592 gene locus_tag LOCUS_02730 gene rodA 40761 39592 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_02730 42920 40758 gene locus_tag LOCUS_02740 gene mrdA 42920 40758 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_02740 43534 43022 gene locus_tag LOCUS_02750 43534 43022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 44382 43534 gene locus_tag LOCUS_02760 gene mreC 44382 43534 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976189.1 protein_id gnl|my_center|LOCUS_02760 45480 44449 gene locus_tag LOCUS_02770 45480 44449 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_02770 46948 45578 gene locus_tag LOCUS_02780 46948 45578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 47362 46952 gene locus_tag LOCUS_02790 gene ndk 47362 46952 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228487.1 protein_id gnl|my_center|LOCUS_02790 47716 47396 gene locus_tag LOCUS_02800 47716 47396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 49101 47713 gene locus_tag LOCUS_02810 49101 47713 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_02810 49129 51684 gene locus_tag LOCUS_02820 gene valS 49129 51684 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224259.1 protein_id gnl|my_center|LOCUS_02820 53073 51775 gene locus_tag LOCUS_02830 gene clpX 53073 51775 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_02830 53834 53199 gene locus_tag LOCUS_02840 53834 53199 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930165.1 protein_id gnl|my_center|LOCUS_02840 54478 53864 gene locus_tag LOCUS_02850 54478 53864 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115412275.1 protein_id gnl|my_center|LOCUS_02850 55918 54605 gene locus_tag LOCUS_02860 gene tig 55918 54605 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976179.1 protein_id gnl|my_center|LOCUS_02860 56082 56006 gene locus_tag LOCUS_t00060 56082 56006 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 56217 56288 gene locus_tag LOCUS_t00070 56217 56288 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 56784 56347 gene locus_tag LOCUS_02870 56784 56347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 57178 56888 gene locus_tag LOCUS_02880 57178 56888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 57289 57732 gene locus_tag LOCUS_02890 57289 57732 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803676.1 protein_id gnl|my_center|LOCUS_02890 58274 57729 gene locus_tag LOCUS_02900 58274 57729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 58960 58271 gene locus_tag LOCUS_02910 58960 58271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 60356 59007 gene locus_tag LOCUS_02920 60356 59007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 61030 60353 gene locus_tag LOCUS_02930 61030 60353 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973245.1 protein_id gnl|my_center|LOCUS_02930 60938 61141 gene locus_tag LOCUS_02940 60938 61141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 61153 61623 gene locus_tag LOCUS_02950 61153 61623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 61610 62077 gene locus_tag LOCUS_02960 61610 62077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 62115 63014 gene locus_tag LOCUS_02970 62115 63014 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227736.1 protein_id gnl|my_center|LOCUS_02970 63007 63636 gene locus_tag LOCUS_02980 63007 63636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 64595 63633 gene locus_tag LOCUS_02990 64595 63633 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888889.1 protein_id gnl|my_center|LOCUS_02990 65822 64605 gene locus_tag LOCUS_03000 65822 64605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 65928 66329 gene locus_tag LOCUS_03010 65928 66329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 66355 66915 gene locus_tag LOCUS_03020 66355 66915 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530298.1 protein_id gnl|my_center|LOCUS_03020 66917 67216 gene locus_tag LOCUS_03030 66917 67216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 67647 67213 gene locus_tag LOCUS_03040 67647 67213 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404412.1 protein_id gnl|my_center|LOCUS_03040 67729 70179 gene locus_tag LOCUS_03050 67729 70179 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396873.1 protein_id gnl|my_center|LOCUS_03050 71243 70176 gene locus_tag LOCUS_03060 71243 70176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 71297 71971 gene locus_tag LOCUS_03070 71297 71971 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230310.1 protein_id gnl|my_center|LOCUS_03070 72761 71952 gene locus_tag LOCUS_03080 72761 71952 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228580.1 protein_id gnl|my_center|LOCUS_03080 72908 73675 gene locus_tag LOCUS_03090 72908 73675 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920789.1 protein_id gnl|my_center|LOCUS_03090 73683 75116 gene locus_tag LOCUS_03100 73683 75116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 75229 76254 gene locus_tag LOCUS_03110 75229 76254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 76256 76963 gene locus_tag LOCUS_03120 76256 76963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 77006 77668 gene locus_tag LOCUS_03130 77006 77668 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838222.1 protein_id gnl|my_center|LOCUS_03130 77665 77997 gene locus_tag LOCUS_03140 77665 77997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 78046 78495 gene locus_tag LOCUS_03150 78046 78495 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225955.1 protein_id gnl|my_center|LOCUS_03150 78522 80699 gene locus_tag LOCUS_03160 gene katG 78522 80699 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021009.1 protein_id gnl|my_center|LOCUS_03160 81599 80823 gene locus_tag LOCUS_03170 81599 80823 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_03170 81495 84053 gene locus_tag LOCUS_03180 gene pepN 81495 84053 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028475.1 protein_id gnl|my_center|LOCUS_03180 84454 84071 gene locus_tag LOCUS_03190 84454 84071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 84737 84441 gene locus_tag LOCUS_03200 84737 84441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 86852 84747 gene locus_tag LOCUS_03210 gene malQ 86852 84747 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729252.1 protein_id gnl|my_center|LOCUS_03210 88273 86849 gene locus_tag LOCUS_03220 88273 86849 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804864.1 protein_id gnl|my_center|LOCUS_03220 88328 90403 gene locus_tag LOCUS_03230 88328 90403 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922509.1 protein_id gnl|my_center|LOCUS_03230 90448 91935 gene locus_tag LOCUS_03240 90448 91935 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027383.1 protein_id gnl|my_center|LOCUS_03240 91951 93255 gene locus_tag LOCUS_03250 91951 93255 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030108.1 protein_id gnl|my_center|LOCUS_03250 93527 93252 gene locus_tag LOCUS_03260 93527 93252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 94289 93819 gene locus_tag LOCUS_03270 94289 93819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 94332 94724 gene locus_tag LOCUS_03280 94332 94724 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_03280 95396 94728 gene locus_tag LOCUS_03290 95396 94728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 95797 95393 gene locus_tag LOCUS_03300 95797 95393 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028505.1 protein_id gnl|my_center|LOCUS_03300 >Feature sequence004 2159 939 gene locus_tag LOCUS_03310 gene ilvA 2159 939 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 protein_id gnl|my_center|LOCUS_03310 2195 3688 gene locus_tag LOCUS_03320 2195 3688 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_03320 4497 3685 gene locus_tag LOCUS_03330 4497 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 5036 4494 gene locus_tag LOCUS_03340 5036 4494 CDS product TIGR04338 family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401120.1 protein_id gnl|my_center|LOCUS_03340 6368 5091 gene locus_tag LOCUS_03350 6368 5091 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403248.1 protein_id gnl|my_center|LOCUS_03350 6397 7833 gene locus_tag LOCUS_03360 6397 7833 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226764.1 protein_id gnl|my_center|LOCUS_03360 7830 9794 gene locus_tag LOCUS_03370 7830 9794 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_03370 9801 11054 gene locus_tag LOCUS_03380 9801 11054 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728183.1 protein_id gnl|my_center|LOCUS_03380 12424 11045 gene locus_tag LOCUS_03390 12424 11045 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406369.1 protein_id gnl|my_center|LOCUS_03390 13575 12421 gene locus_tag LOCUS_03400 13575 12421 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_03400 13593 14276 gene locus_tag LOCUS_03410 gene msrA 13593 14276 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929886.1 protein_id gnl|my_center|LOCUS_03410 14288 14632 gene locus_tag LOCUS_03420 14288 14632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 16004 14640 gene locus_tag LOCUS_03430 16004 14640 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730431.1 protein_id gnl|my_center|LOCUS_03430 16022 16753 gene locus_tag LOCUS_03440 16022 16753 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897698.1 protein_id gnl|my_center|LOCUS_03440 16801 17562 gene locus_tag LOCUS_03450 16801 17562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 17869 17552 gene locus_tag LOCUS_03460 17869 17552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 19000 17942 gene locus_tag LOCUS_03470 19000 17942 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084253.1 protein_id gnl|my_center|LOCUS_03470 19091 21004 gene locus_tag LOCUS_03480 19091 21004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 21139 21213 gene locus_tag LOCUS_t00080 21139 21213 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21855 21172 gene locus_tag LOCUS_03490 21855 21172 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_03490 22643 21948 gene locus_tag LOCUS_03500 22643 21948 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982129.1 protein_id gnl|my_center|LOCUS_03500 23686 22670 gene locus_tag LOCUS_03510 23686 22670 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969745.1 protein_id gnl|my_center|LOCUS_03510 24686 23772 gene locus_tag LOCUS_03520 24686 23772 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_03520 25156 24677 gene locus_tag LOCUS_03530 25156 24677 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 protein_id gnl|my_center|LOCUS_03530 25539 25153 gene locus_tag LOCUS_03540 25539 25153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 26838 25558 gene locus_tag LOCUS_03550 gene eno 26838 25558 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975715.1 protein_id gnl|my_center|LOCUS_03550 28532 26862 gene locus_tag LOCUS_03560 28532 26862 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037762.1 protein_id gnl|my_center|LOCUS_03560 29188 28529 gene locus_tag LOCUS_03570 29188 28529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 29842 29192 gene locus_tag LOCUS_03580 29842 29192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 33348 29839 gene locus_tag LOCUS_03590 gene mfd 33348 29839 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_03590 34169 33345 gene locus_tag LOCUS_03600 34169 33345 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_03600 34756 34166 gene locus_tag LOCUS_03610 gene pth 34756 34166 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229969.1 protein_id gnl|my_center|LOCUS_03610 35242 34763 gene locus_tag LOCUS_03620 35242 34763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 36386 35388 gene locus_tag LOCUS_03630 36386 35388 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_03630 37849 36383 gene locus_tag LOCUS_03640 gene glmU 37849 36383 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975692.1 protein_id gnl|my_center|LOCUS_03640 37993 37922 gene locus_tag LOCUS_t00090 37993 37922 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 38138 39130 gene locus_tag LOCUS_03650 38138 39130 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086857074.1 protein_id gnl|my_center|LOCUS_03650 39144 39734 gene locus_tag LOCUS_03660 39144 39734 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975684.1 protein_id gnl|my_center|LOCUS_03660 39805 40338 gene locus_tag LOCUS_03670 gene tamR 39805 40338 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_03670 41239 40328 gene locus_tag LOCUS_03680 41239 40328 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045756603.1 protein_id gnl|my_center|LOCUS_03680 42094 41249 gene locus_tag LOCUS_03690 gene rsmA 42094 41249 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_03690 42944 42099 gene locus_tag LOCUS_03700 42944 42099 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_03700 44524 42941 gene locus_tag LOCUS_03710 gene metG 44524 42941 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975149.1 protein_id gnl|my_center|LOCUS_03710 45162 44536 gene locus_tag LOCUS_03720 45162 44536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 45265 47010 gene locus_tag LOCUS_03730 45265 47010 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_03730 47518 47024 gene locus_tag LOCUS_03740 47518 47024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 47708 47634 gene locus_tag LOCUS_t00100 47708 47634 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 48266 47751 gene locus_tag LOCUS_03750 48266 47751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 48949 48341 gene locus_tag LOCUS_03760 48949 48341 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_03760 49422 48946 gene locus_tag LOCUS_03770 gene moaC 49422 48946 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_03770 50648 49434 gene locus_tag LOCUS_03780 50648 49434 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_03780 51544 50651 gene locus_tag LOCUS_03790 gene galU 51544 50651 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_03790 51570 52139 gene locus_tag LOCUS_03800 51570 52139 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028815.1 protein_id gnl|my_center|LOCUS_03800 52494 52129 gene locus_tag LOCUS_03810 gene crcB 52494 52129 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224558.1 protein_id gnl|my_center|LOCUS_03810 52907 52491 gene locus_tag LOCUS_03820 52907 52491 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224560.1 protein_id gnl|my_center|LOCUS_03820 53672 52911 gene locus_tag LOCUS_03830 53672 52911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 54574 53669 gene locus_tag LOCUS_03840 54574 53669 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015345.1 protein_id gnl|my_center|LOCUS_03840 54683 55006 gene locus_tag LOCUS_03850 54683 55006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 55060 55686 gene locus_tag LOCUS_03860 55060 55686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 55713 56117 gene locus_tag LOCUS_03870 gene mscL 55713 56117 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013943.1 protein_id gnl|my_center|LOCUS_03870 58916 56184 gene locus_tag LOCUS_03880 58916 56184 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088902.1 protein_id gnl|my_center|LOCUS_03880 59740 58916 gene locus_tag LOCUS_03890 59740 58916 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088901.1 protein_id gnl|my_center|LOCUS_03890 61209 59833 gene locus_tag LOCUS_03900 61209 59833 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229595.1 protein_id gnl|my_center|LOCUS_03900 61233 62366 gene locus_tag LOCUS_03910 61233 62366 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031138.1 protein_id gnl|my_center|LOCUS_03910 62363 63232 gene locus_tag LOCUS_03920 62363 63232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_03920 63229 63636 gene locus_tag LOCUS_03930 63229 63636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 64535 63624 gene locus_tag LOCUS_03940 64535 63624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 67324 64532 gene locus_tag LOCUS_03950 gene secA 67324 64532 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 protein_id gnl|my_center|LOCUS_03950 67990 67334 gene locus_tag LOCUS_03960 67990 67334 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_03960 68711 67992 gene locus_tag LOCUS_03970 68711 67992 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028713.1 protein_id gnl|my_center|LOCUS_03970 68876 70318 gene locus_tag LOCUS_03980 gene ahcY 68876 70318 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_03980 70338 71111 gene locus_tag LOCUS_03990 70338 71111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 71116 71802 gene locus_tag LOCUS_04000 gene mtrA 71116 71802 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_04000 71799 73445 gene locus_tag LOCUS_04010 71799 73445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 73442 75133 gene locus_tag LOCUS_04020 73442 75133 CDS product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028714.1 protein_id gnl|my_center|LOCUS_04020 76038 75118 gene locus_tag LOCUS_04030 76038 75118 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_04030 77117 76035 gene locus_tag LOCUS_04040 gene manA 77117 76035 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803907.1 protein_id gnl|my_center|LOCUS_04040 77313 77122 gene locus_tag LOCUS_04050 77313 77122 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229750.1 protein_id gnl|my_center|LOCUS_04050 78743 77310 gene locus_tag LOCUS_04060 78743 77310 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_04060 79081 78749 gene locus_tag LOCUS_04070 79081 78749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 80912 79218 gene locus_tag LOCUS_04080 80912 79218 CDS product DUF5719 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028724.1 protein_id gnl|my_center|LOCUS_04080 84049 80909 gene locus_tag LOCUS_04090 84049 80909 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028725.1 protein_id gnl|my_center|LOCUS_04090 84387 84130 gene locus_tag LOCUS_04100 84387 84130 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091761302.1 protein_id gnl|my_center|LOCUS_04100 86991 84523 gene locus_tag LOCUS_04110 86991 84523 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104130.1 protein_id gnl|my_center|LOCUS_04110 87069 88100 gene locus_tag LOCUS_04120 gene cofD 87069 88100 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975775.1 protein_id gnl|my_center|LOCUS_04120 88097 89446 gene locus_tag LOCUS_04130 88097 89446 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028727.1 protein_id gnl|my_center|LOCUS_04130 <90499 89475 gene locus_tag LOCUS_04140 <90499 89475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028729.1:NDP-sugar synthase >Feature sequence005 <1 1490 gene locus_tag LOCUS_04150 <1 1490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143420.1:sulfatase 1713 1931 gene locus_tag LOCUS_04160 1713 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 2071 2361 gene locus_tag LOCUS_04170 gene rpsF 2071 2361 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898321.1 protein_id gnl|my_center|LOCUS_04170 2363 2845 gene locus_tag LOCUS_04180 2363 2845 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231003.1 protein_id gnl|my_center|LOCUS_04180 2883 3152 gene locus_tag LOCUS_04190 gene rpsR 2883 3152 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949403.1 protein_id gnl|my_center|LOCUS_04190 3162 3605 gene locus_tag LOCUS_04200 gene rplI 3162 3605 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_04200 4172 3657 gene locus_tag LOCUS_04210 4172 3657 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975011.1 protein_id gnl|my_center|LOCUS_04210 4849 4169 gene locus_tag LOCUS_04220 4849 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 6095 4887 gene locus_tag LOCUS_04230 6095 4887 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719144.1 protein_id gnl|my_center|LOCUS_04230 6139 6936 gene locus_tag LOCUS_04240 6139 6936 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731108.1 protein_id gnl|my_center|LOCUS_04240 7216 9819 gene locus_tag LOCUS_04250 7216 9819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 11080 9854 gene locus_tag LOCUS_04260 11080 9854 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976662.1 protein_id gnl|my_center|LOCUS_04260 12583 11183 gene locus_tag LOCUS_04270 12583 11183 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229612.1 protein_id gnl|my_center|LOCUS_04270 13368 12616 gene locus_tag LOCUS_04280 13368 12616 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225769.1 protein_id gnl|my_center|LOCUS_04280 13607 14155 gene locus_tag LOCUS_04290 13607 14155 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_04290 15300 14203 gene locus_tag LOCUS_04300 15300 14203 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030570.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04300 15866 15492 gene locus_tag LOCUS_04310 15866 15492 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169809.1 protein_id gnl|my_center|LOCUS_04310 15986 17236 gene locus_tag LOCUS_04320 15986 17236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 17245 18606 gene locus_tag LOCUS_04330 17245 18606 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205737.1 protein_id gnl|my_center|LOCUS_04330 18603 19385 gene locus_tag LOCUS_04340 18603 19385 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099690.1 protein_id gnl|my_center|LOCUS_04340 19382 20116 gene locus_tag LOCUS_04350 19382 20116 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097046.1 protein_id gnl|my_center|LOCUS_04350 21135 20122 gene locus_tag LOCUS_04360 21135 20122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 22416 21157 gene locus_tag LOCUS_04370 22416 21157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 22531 23865 gene locus_tag LOCUS_04380 22531 23865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 23872 24303 gene locus_tag LOCUS_04390 23872 24303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 24297 24671 gene locus_tag LOCUS_04400 24297 24671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 25164 24676 gene locus_tag LOCUS_04410 25164 24676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 25685 25206 gene locus_tag LOCUS_04420 25685 25206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 26318 25821 gene locus_tag LOCUS_04430 26318 25821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 27340 26411 gene locus_tag LOCUS_04440 gene yedA 27340 26411 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212248.1 protein_id gnl|my_center|LOCUS_04440 27479 29233 gene locus_tag LOCUS_04450 27479 29233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04450 29233 31017 gene locus_tag LOCUS_04460 29233 31017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04460 31095 31355 gene locus_tag LOCUS_04470 31095 31355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 31880 31359 gene locus_tag LOCUS_04480 31880 31359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 31970 33037 gene locus_tag LOCUS_04490 31970 33037 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776525.1 protein_id gnl|my_center|LOCUS_04490 33034 34011 gene locus_tag LOCUS_04500 33034 34011 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_04500 34008 35285 gene locus_tag LOCUS_04510 34008 35285 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029246.1 protein_id gnl|my_center|LOCUS_04510 35379 35630 gene locus_tag LOCUS_04520 35379 35630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 35648 36487 gene locus_tag LOCUS_04530 35648 36487 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029242.1 protein_id gnl|my_center|LOCUS_04530 37260 36484 gene locus_tag LOCUS_04540 37260 36484 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975129.1 protein_id gnl|my_center|LOCUS_04540 39327 37270 gene locus_tag LOCUS_04550 39327 37270 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228600.1 protein_id gnl|my_center|LOCUS_04550 39898 39329 gene locus_tag LOCUS_04560 39898 39329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 41791 39947 gene locus_tag LOCUS_04570 41791 39947 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230903.1 protein_id gnl|my_center|LOCUS_04570 41921 42406 gene locus_tag LOCUS_04580 41921 42406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 42417 42902 gene locus_tag LOCUS_04590 42417 42902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 43837 42899 gene locus_tag LOCUS_04600 43837 42899 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110688.1 protein_id gnl|my_center|LOCUS_04600 44002 44667 gene locus_tag LOCUS_04610 44002 44667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 45674 44664 gene locus_tag LOCUS_04620 45674 44664 CDS product tyrosinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976100.1 protein_id gnl|my_center|LOCUS_04620 45862 46581 gene locus_tag LOCUS_04630 45862 46581 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267639.1 protein_id gnl|my_center|LOCUS_04630 46802 46731 gene locus_tag LOCUS_t00110 46802 46731 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 47380 46793 gene locus_tag LOCUS_04640 47380 46793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 49533 47383 gene locus_tag LOCUS_04650 49533 47383 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225396.1 protein_id gnl|my_center|LOCUS_04650 49568 50737 gene locus_tag LOCUS_04660 49568 50737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 50763 51344 gene locus_tag LOCUS_04670 gene dcd 50763 51344 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_04670 53580 51358 gene locus_tag LOCUS_04680 53580 51358 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401734.1 protein_id gnl|my_center|LOCUS_04680 53666 54664 gene locus_tag LOCUS_04690 gene yxeI 53666 54664 CDS product penicillin V amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243495.1 protein_id gnl|my_center|LOCUS_04690 54847 56688 gene locus_tag LOCUS_04700 gene dnaK 54847 56688 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_04700 56685 57245 gene locus_tag LOCUS_04710 gene grpE 56685 57245 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230873.1 protein_id gnl|my_center|LOCUS_04710 57276 58460 gene locus_tag LOCUS_04720 gene dnaJ 57276 58460 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975270.1 protein_id gnl|my_center|LOCUS_04720 58460 58795 gene locus_tag LOCUS_04730 58460 58795 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804833.1 protein_id gnl|my_center|LOCUS_04730 58819 61401 gene locus_tag LOCUS_04740 gene clpB 58819 61401 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975278.1 protein_id gnl|my_center|LOCUS_04740 61598 62983 gene locus_tag LOCUS_04750 61598 62983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 63015 64700 gene locus_tag LOCUS_04760 63015 64700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 65157 64684 gene locus_tag LOCUS_04770 65157 64684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 66338 65172 gene locus_tag LOCUS_04780 66338 65172 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_04780 66730 66353 gene locus_tag LOCUS_04790 gene rbsD 66730 66353 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080603.1 protein_id gnl|my_center|LOCUS_04790 67656 66727 gene locus_tag LOCUS_04800 gene rbsK 67656 66727 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246357.1 protein_id gnl|my_center|LOCUS_04800 67687 69108 gene locus_tag LOCUS_04810 67687 69108 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970040.1 protein_id gnl|my_center|LOCUS_04810 69105 69551 gene locus_tag LOCUS_04820 gene rpiB 69105 69551 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199035.1 protein_id gnl|my_center|LOCUS_04820 70516 69548 gene locus_tag LOCUS_04830 70516 69548 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226304.1 protein_id gnl|my_center|LOCUS_04830 72016 70553 gene locus_tag LOCUS_04840 72016 70553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 73571 72087 gene locus_tag LOCUS_04850 73571 72087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 73603 74379 gene locus_tag LOCUS_04860 73603 74379 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776564.1 protein_id gnl|my_center|LOCUS_04860 74805 74383 gene locus_tag LOCUS_04870 74805 74383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 74828 75364 gene locus_tag LOCUS_04880 gene pyrE 74828 75364 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029143.1 protein_id gnl|my_center|LOCUS_04880 76032 75361 gene locus_tag LOCUS_04890 76032 75361 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230830.1 protein_id gnl|my_center|LOCUS_04890 76084 76653 gene locus_tag LOCUS_04900 76084 76653 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085726.1 protein_id gnl|my_center|LOCUS_04900 77289 76723 gene locus_tag LOCUS_04910 77289 76723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 79078 77867 gene locus_tag LOCUS_04920 79078 77867 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421599.1 protein_id gnl|my_center|LOCUS_04920 79130 80371 gene locus_tag LOCUS_04930 79130 80371 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816310.1 protein_id gnl|my_center|LOCUS_04930 80452 81339 gene locus_tag LOCUS_04940 80452 81339 CDS product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 protein_id gnl|my_center|LOCUS_04940 81387 81803 gene locus_tag LOCUS_04950 81387 81803 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 protein_id gnl|my_center|LOCUS_04950 81805 82797 gene locus_tag LOCUS_04960 81805 82797 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114698.1 protein_id gnl|my_center|LOCUS_04960 83369 82794 gene locus_tag LOCUS_04970 83369 82794 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222431.1 protein_id gnl|my_center|LOCUS_04970 84241 83366 gene locus_tag LOCUS_04980 84241 83366 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383492.1 protein_id gnl|my_center|LOCUS_04980 84306 85004 gene locus_tag LOCUS_04990 84306 85004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 85004 85864 gene locus_tag LOCUS_05000 85004 85864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 >Feature sequence006 2201 1449 gene locus_tag LOCUS_05010 2201 1449 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974477.1 protein_id gnl|my_center|LOCUS_05010 2773 2198 gene locus_tag LOCUS_05020 2773 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 3437 2796 gene locus_tag LOCUS_05030 3437 2796 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974480.1 protein_id gnl|my_center|LOCUS_05030 5044 3443 gene locus_tag LOCUS_05040 5044 3443 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975519.1 protein_id gnl|my_center|LOCUS_05040 5805 5107 gene locus_tag LOCUS_05050 5805 5107 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_05050 6117 5884 gene locus_tag LOCUS_05060 6117 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 6208 7059 gene locus_tag LOCUS_05070 6208 7059 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666589.1 protein_id gnl|my_center|LOCUS_05070 7964 7056 gene locus_tag LOCUS_05080 7964 7056 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975511.1 protein_id gnl|my_center|LOCUS_05080 9036 7957 gene locus_tag LOCUS_05090 9036 7957 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_05090 9471 9265 gene locus_tag LOCUS_05100 9471 9265 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004984898.1 protein_id gnl|my_center|LOCUS_05100 10808 9612 gene locus_tag LOCUS_05110 10808 9612 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326515.1 protein_id gnl|my_center|LOCUS_05110 11611 10805 gene locus_tag LOCUS_05120 gene proC 11611 10805 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975496.1 protein_id gnl|my_center|LOCUS_05120 12228 11608 gene locus_tag LOCUS_05130 12228 11608 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 protein_id gnl|my_center|LOCUS_05130 13081 12230 gene locus_tag LOCUS_05140 13081 12230 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975487.1 protein_id gnl|my_center|LOCUS_05140 15473 13086 gene locus_tag LOCUS_05150 15473 13086 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029584.1 protein_id gnl|my_center|LOCUS_05150 16408 15470 gene locus_tag LOCUS_05160 16408 15470 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028926.1 protein_id gnl|my_center|LOCUS_05160 16440 17213 gene locus_tag LOCUS_05170 16440 17213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975485.1 protein_id gnl|my_center|LOCUS_05170 17246 18613 gene locus_tag LOCUS_05180 gene radA 17246 18613 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 protein_id gnl|my_center|LOCUS_05180 20541 18610 gene locus_tag LOCUS_05190 20541 18610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 20792 21877 gene locus_tag LOCUS_05200 gene disA 20792 21877 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_05200 22516 21881 gene locus_tag LOCUS_05210 22516 21881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 22682 23458 gene locus_tag LOCUS_05220 22682 23458 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05220 24009 23524 gene locus_tag LOCUS_05230 24009 23524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 26522 24021 gene locus_tag LOCUS_05240 26522 24021 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_05240 27482 26721 gene locus_tag LOCUS_05250 27482 26721 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312799.1 protein_id gnl|my_center|LOCUS_05250 27982 27482 gene locus_tag LOCUS_05260 27982 27482 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975457.1 protein_id gnl|my_center|LOCUS_05260 29487 27979 gene locus_tag LOCUS_05270 gene lysS 29487 27979 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230454.1 protein_id gnl|my_center|LOCUS_05270 30283 29522 gene locus_tag LOCUS_05280 30283 29522 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230456.1 protein_id gnl|my_center|LOCUS_05280 31179 30280 gene locus_tag LOCUS_05290 gene nadC 31179 30280 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975452.1 protein_id gnl|my_center|LOCUS_05290 32815 31169 gene locus_tag LOCUS_05300 32815 31169 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028946.1 protein_id gnl|my_center|LOCUS_05300 33705 32812 gene locus_tag LOCUS_05310 gene panC 33705 32812 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975450.1 protein_id gnl|my_center|LOCUS_05310 34616 33702 gene locus_tag LOCUS_05320 34616 33702 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230459.1 protein_id gnl|my_center|LOCUS_05320 35620 34613 gene locus_tag LOCUS_05330 35620 34613 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028950.1 protein_id gnl|my_center|LOCUS_05330 35664 36782 gene locus_tag LOCUS_05340 35664 36782 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_05340 37087 36785 gene locus_tag LOCUS_05350 37087 36785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 37615 37106 gene locus_tag LOCUS_05360 37615 37106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 38127 37612 gene locus_tag LOCUS_05370 gene folK 38127 37612 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975432.1 protein_id gnl|my_center|LOCUS_05370 38531 38127 gene locus_tag LOCUS_05380 gene folB 38531 38127 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028954.1 protein_id gnl|my_center|LOCUS_05380 39367 38513 gene locus_tag LOCUS_05390 gene folP 39367 38513 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467816.1 protein_id gnl|my_center|LOCUS_05390 40013 39369 gene locus_tag LOCUS_05400 gene folE 40013 39369 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_05400 42049 40010 gene locus_tag LOCUS_05410 gene ftsH 42049 40010 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_05410 42733 42179 gene locus_tag LOCUS_05420 gene hpt 42733 42179 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_05420 43767 42736 gene locus_tag LOCUS_05430 gene tilS 43767 42736 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230474.1 protein_id gnl|my_center|LOCUS_05430 44783 43764 gene locus_tag LOCUS_05440 44783 43764 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_05440 46131 44806 gene locus_tag LOCUS_05450 46131 44806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 46172 46675 gene locus_tag LOCUS_05460 46172 46675 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_05460 46675 47154 gene locus_tag LOCUS_05470 46675 47154 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876872.1 protein_id gnl|my_center|LOCUS_05470 48200 47151 gene locus_tag LOCUS_05480 48200 47151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 48759 48319 gene locus_tag LOCUS_05490 48759 48319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 49379 48834 gene locus_tag LOCUS_05500 49379 48834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521816.1 protein_id gnl|my_center|LOCUS_05500 50032 49376 gene locus_tag LOCUS_05510 50032 49376 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164275233.1 protein_id gnl|my_center|LOCUS_05510 52178 50016 gene locus_tag LOCUS_05520 52178 50016 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229635.1 protein_id gnl|my_center|LOCUS_05520 53401 52190 gene locus_tag LOCUS_05530 53401 52190 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229636.1 protein_id gnl|my_center|LOCUS_05530 53573 54097 gene locus_tag LOCUS_05540 53573 54097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 54094 55107 gene locus_tag LOCUS_05550 54094 55107 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730605.1 protein_id gnl|my_center|LOCUS_05550 56294 55116 gene locus_tag LOCUS_05560 gene hutI 56294 55116 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892542.1 protein_id gnl|my_center|LOCUS_05560 57610 56291 gene locus_tag LOCUS_05570 57610 56291 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727478.1 protein_id gnl|my_center|LOCUS_05570 58830 57607 gene locus_tag LOCUS_05580 58830 57607 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028750.1 protein_id gnl|my_center|LOCUS_05580 60539 58827 gene locus_tag LOCUS_05590 60539 58827 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727477.1 protein_id gnl|my_center|LOCUS_05590 62088 60541 gene locus_tag LOCUS_05600 gene hutH 62088 60541 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727479.1 protein_id gnl|my_center|LOCUS_05600 63482 62139 gene locus_tag LOCUS_05610 63482 62139 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 protein_id gnl|my_center|LOCUS_05610 63949 63533 gene locus_tag LOCUS_05620 63949 63533 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389967.1 protein_id gnl|my_center|LOCUS_05620 64215 63946 gene locus_tag LOCUS_05630 64215 63946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 65752 64301 gene locus_tag LOCUS_05640 65752 64301 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227765.1 protein_id gnl|my_center|LOCUS_05640 66690 65749 gene locus_tag LOCUS_05650 66690 65749 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 protein_id gnl|my_center|LOCUS_05650 66774 67457 gene locus_tag LOCUS_05660 66774 67457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 67454 67885 gene locus_tag LOCUS_05670 67454 67885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 69270 67882 gene locus_tag LOCUS_05680 69270 67882 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777125.1 protein_id gnl|my_center|LOCUS_05680 69571 69260 gene locus_tag LOCUS_05690 69571 69260 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225095.1 protein_id gnl|my_center|LOCUS_05690 <70288 69561 gene locus_tag LOCUS_05700 <70288 69561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030796.1:FAD-dependent oxidoreductase >Feature sequence007 192 974 gene locus_tag LOCUS_05710 192 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 974 3250 gene locus_tag LOCUS_05720 974 3250 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027333.1 protein_id gnl|my_center|LOCUS_05720 3247 5400 gene locus_tag LOCUS_05730 3247 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 5400 6263 gene locus_tag LOCUS_05740 5400 6263 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776693.1 protein_id gnl|my_center|LOCUS_05740 7551 6250 gene locus_tag LOCUS_05750 7551 6250 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901321.1 protein_id gnl|my_center|LOCUS_05750 7529 8746 gene locus_tag LOCUS_05760 7529 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 8759 10288 gene locus_tag LOCUS_05770 8759 10288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 10988 10275 gene locus_tag LOCUS_05780 10988 10275 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225289.1 protein_id gnl|my_center|LOCUS_05780 11624 11007 gene locus_tag LOCUS_05790 11624 11007 CDS product acVLRF1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224727.1 protein_id gnl|my_center|LOCUS_05790 11696 12088 gene locus_tag LOCUS_05800 11696 12088 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728346.1 protein_id gnl|my_center|LOCUS_05800 12217 13395 gene locus_tag LOCUS_05810 gene hemL 12217 13395 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224512.1 protein_id gnl|my_center|LOCUS_05810 14075 13392 gene locus_tag LOCUS_05820 14075 13392 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053184.1 protein_id gnl|my_center|LOCUS_05820 14131 15165 gene locus_tag LOCUS_05830 gene tdt 14131 15165 CDS product tellurite-resistance/dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250965.1 protein_id gnl|my_center|LOCUS_05830 15175 16296 gene locus_tag LOCUS_05840 gene cysS 15175 16296 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256641.1 protein_id gnl|my_center|LOCUS_05840 16299 16877 gene locus_tag LOCUS_05850 16299 16877 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283977.1 protein_id gnl|my_center|LOCUS_05850 16906 18504 gene locus_tag LOCUS_05860 16906 18504 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 protein_id gnl|my_center|LOCUS_05860 18510 20366 gene locus_tag LOCUS_05870 18510 20366 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028580.1 protein_id gnl|my_center|LOCUS_05870 20363 21301 gene locus_tag LOCUS_05880 20363 21301 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222886.1 protein_id gnl|my_center|LOCUS_05880 21303 22454 gene locus_tag LOCUS_05890 21303 22454 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976021.1 protein_id gnl|my_center|LOCUS_05890 23262 22447 gene locus_tag LOCUS_05900 23262 22447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 23865 23269 gene locus_tag LOCUS_05910 23865 23269 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469637.1 protein_id gnl|my_center|LOCUS_05910 24024 24563 gene locus_tag LOCUS_05920 24024 24563 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 protein_id gnl|my_center|LOCUS_05920 25683 24673 gene locus_tag LOCUS_05930 25683 24673 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727857.1 protein_id gnl|my_center|LOCUS_05930 26717 25836 gene locus_tag LOCUS_05940 26717 25836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 28210 26816 gene locus_tag LOCUS_05950 28210 26816 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060587.1 protein_id gnl|my_center|LOCUS_05950 29424 28210 gene locus_tag LOCUS_05960 29424 28210 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028323.1 protein_id gnl|my_center|LOCUS_05960 29667 29428 gene locus_tag LOCUS_05970 29667 29428 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976417.1 protein_id gnl|my_center|LOCUS_05970 30714 29710 gene locus_tag LOCUS_05980 30714 29710 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976418.1 protein_id gnl|my_center|LOCUS_05980 31907 30711 gene locus_tag LOCUS_05990 31907 30711 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028322.1 protein_id gnl|my_center|LOCUS_05990 33120 31957 gene locus_tag LOCUS_06000 33120 31957 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015009.1 protein_id gnl|my_center|LOCUS_06000 35861 33117 gene locus_tag LOCUS_06010 gene aceE 35861 33117 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110416.1 protein_id gnl|my_center|LOCUS_06010 36049 36516 gene locus_tag LOCUS_06020 36049 36516 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060606.1 protein_id gnl|my_center|LOCUS_06020 37460 36513 gene locus_tag LOCUS_06030 37460 36513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 37487 37936 gene locus_tag LOCUS_06040 37487 37936 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224001.1 protein_id gnl|my_center|LOCUS_06040 38870 38073 gene locus_tag LOCUS_06050 38870 38073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 38987 38914 gene locus_tag LOCUS_t00120 38987 38914 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 39029 39844 gene locus_tag LOCUS_06060 39029 39844 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223077.1 protein_id gnl|my_center|LOCUS_06060 39814 40584 gene locus_tag LOCUS_06070 39814 40584 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028262.1 protein_id gnl|my_center|LOCUS_06070 40581 41762 gene locus_tag LOCUS_06080 40581 41762 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729720.1 protein_id gnl|my_center|LOCUS_06080 42548 41769 gene locus_tag LOCUS_06090 gene yaaA 42548 41769 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 protein_id gnl|my_center|LOCUS_06090 43530 42523 gene locus_tag LOCUS_06100 43530 42523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 44896 44102 gene locus_tag LOCUS_06110 44896 44102 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228058.1 protein_id gnl|my_center|LOCUS_06110 45431 44952 gene locus_tag LOCUS_06120 45431 44952 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973592.1 protein_id gnl|my_center|LOCUS_06120 46204 45428 gene locus_tag LOCUS_06130 46204 45428 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_06130 47148 46225 gene locus_tag LOCUS_06140 gene map 47148 46225 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_06140 47520 47194 gene locus_tag LOCUS_06150 47520 47194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 48977 47691 gene locus_tag LOCUS_06160 48977 47691 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030908.1 protein_id gnl|my_center|LOCUS_06160 49023 49706 gene locus_tag LOCUS_06170 gene npdG 49023 49706 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_06170 50526 49711 gene locus_tag LOCUS_06180 gene panB 50526 49711 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223113.1 protein_id gnl|my_center|LOCUS_06180 50687 52381 gene locus_tag LOCUS_06190 50687 52381 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030040.1 protein_id gnl|my_center|LOCUS_06190 54100 52391 gene locus_tag LOCUS_06200 54100 52391 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208946.1 protein_id gnl|my_center|LOCUS_06200 54180 55514 gene locus_tag LOCUS_06210 gene glnA 54180 55514 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_06210 55536 58514 gene locus_tag LOCUS_06220 55536 58514 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_06220 58565 59992 gene locus_tag LOCUS_06230 58565 59992 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_06230 60002 60316 gene locus_tag LOCUS_06240 60002 60316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 61427 60249 gene locus_tag LOCUS_06250 61427 60249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 63024 61438 gene locus_tag LOCUS_06260 63024 61438 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189730977.1 protein_id gnl|my_center|LOCUS_06260 64540 63119 gene locus_tag LOCUS_06270 gene glnA 64540 63119 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775685.1 protein_id gnl|my_center|LOCUS_06270 64732 65154 gene locus_tag LOCUS_06280 64732 65154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 65864 65151 gene locus_tag LOCUS_06290 65864 65151 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223136.1 protein_id gnl|my_center|LOCUS_06290 66421 65885 gene locus_tag LOCUS_06300 66421 65885 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530927.1 protein_id gnl|my_center|LOCUS_06300 67377 66418 gene locus_tag LOCUS_06310 gene lipA 67377 66418 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729704.1 protein_id gnl|my_center|LOCUS_06310 68018 67374 gene locus_tag LOCUS_06320 gene lipB 68018 67374 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224047.1 protein_id gnl|my_center|LOCUS_06320 >Feature sequence008 1042 1473 gene locus_tag LOCUS_06330 gene mraZ 1042 1473 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467434.1 protein_id gnl|my_center|LOCUS_06330 1625 1789 gene locus_tag LOCUS_06340 1625 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 1796 2743 gene locus_tag LOCUS_06350 gene rsmH 1796 2743 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976723.1 protein_id gnl|my_center|LOCUS_06350 2740 3594 gene locus_tag LOCUS_06360 2740 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 3708 5348 gene locus_tag LOCUS_06370 3708 5348 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804696.1 protein_id gnl|my_center|LOCUS_06370 5358 6836 gene locus_tag LOCUS_06380 5358 6836 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 protein_id gnl|my_center|LOCUS_06380 6833 8212 gene locus_tag LOCUS_06390 6833 8212 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_06390 8209 9276 gene locus_tag LOCUS_06400 gene mraY 8209 9276 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804699.1 protein_id gnl|my_center|LOCUS_06400 9273 10709 gene locus_tag LOCUS_06410 gene murD 9273 10709 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 protein_id gnl|my_center|LOCUS_06410 10778 12025 gene locus_tag LOCUS_06420 gene ftsW 10778 12025 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976730.1 protein_id gnl|my_center|LOCUS_06420 12022 13131 gene locus_tag LOCUS_06430 gene murG 12022 13131 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 protein_id gnl|my_center|LOCUS_06430 13128 14537 gene locus_tag LOCUS_06440 gene murC 13128 14537 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 protein_id gnl|my_center|LOCUS_06440 14534 15244 gene locus_tag LOCUS_06450 14534 15244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 16367 15234 gene locus_tag LOCUS_06460 16367 15234 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080272.1 protein_id gnl|my_center|LOCUS_06460 16436 19348 gene locus_tag LOCUS_06470 16436 19348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 20138 19356 gene locus_tag LOCUS_06480 20138 19356 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202612.1 protein_id gnl|my_center|LOCUS_06480 21256 20135 gene locus_tag LOCUS_06490 21256 20135 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002373458.1 protein_id gnl|my_center|LOCUS_06490 22353 21256 gene locus_tag LOCUS_06500 22353 21256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 22425 23210 gene locus_tag LOCUS_06510 22425 23210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 23352 24536 gene locus_tag LOCUS_06520 gene ftsZ 23352 24536 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_06520 24544 25272 gene locus_tag LOCUS_06530 gene pgeF 24544 25272 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028130.1 protein_id gnl|my_center|LOCUS_06530 25265 25969 gene locus_tag LOCUS_06540 25265 25969 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028129.1 protein_id gnl|my_center|LOCUS_06540 26016 26579 gene locus_tag LOCUS_06550 gene sepF 26016 26579 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976736.1 protein_id gnl|my_center|LOCUS_06550 26628 26912 gene locus_tag LOCUS_06560 26628 26912 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976737.1 protein_id gnl|my_center|LOCUS_06560 26925 27725 gene locus_tag LOCUS_06570 26925 27725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 27786 28700 gene locus_tag LOCUS_06580 27786 28700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 29427 28711 gene locus_tag LOCUS_06590 29427 28711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 30106 29438 gene locus_tag LOCUS_06600 30106 29438 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869323.1 protein_id gnl|my_center|LOCUS_06600 33248 30117 gene locus_tag LOCUS_06610 gene ileS 33248 30117 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_06610 33564 33286 gene locus_tag LOCUS_06620 33564 33286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 33481 33993 gene locus_tag LOCUS_06630 33481 33993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 34013 35248 gene locus_tag LOCUS_06640 34013 35248 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_06640 36291 35236 gene locus_tag LOCUS_06650 36291 35236 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_06650 37082 36288 gene locus_tag LOCUS_06660 37082 36288 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_06660 37825 37079 gene locus_tag LOCUS_06670 gene modA 37825 37079 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029176.1 protein_id gnl|my_center|LOCUS_06670 38229 37822 gene locus_tag LOCUS_06680 38229 37822 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467790.1 protein_id gnl|my_center|LOCUS_06680 38405 39106 gene locus_tag LOCUS_06690 38405 39106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 39111 39677 gene locus_tag LOCUS_06700 gene lspA 39111 39677 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407722.1 protein_id gnl|my_center|LOCUS_06700 39680 40603 gene locus_tag LOCUS_06710 39680 40603 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976742.1 protein_id gnl|my_center|LOCUS_06710 40734 44282 gene locus_tag LOCUS_06720 gene dnaE 40734 44282 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976751.1 protein_id gnl|my_center|LOCUS_06720 44301 44828 gene locus_tag LOCUS_06730 44301 44828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 45394 44825 gene locus_tag LOCUS_06740 45394 44825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 45660 46199 gene locus_tag LOCUS_06750 45660 46199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 46709 46218 gene locus_tag LOCUS_06760 gene ybaK 46709 46218 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976757.1 protein_id gnl|my_center|LOCUS_06760 47368 46712 gene locus_tag LOCUS_06770 47368 46712 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028120.1 protein_id gnl|my_center|LOCUS_06770 47398 48705 gene locus_tag LOCUS_06780 gene hisD 47398 48705 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224127.1 protein_id gnl|my_center|LOCUS_06780 48707 49819 gene locus_tag LOCUS_06790 48707 49819 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929983.1 protein_id gnl|my_center|LOCUS_06790 49812 50441 gene locus_tag LOCUS_06800 gene hisB 49812 50441 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976763.1 protein_id gnl|my_center|LOCUS_06800 50444 50605 gene locus_tag LOCUS_06810 50444 50605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 50605 51246 gene locus_tag LOCUS_06820 gene hisH 50605 51246 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057924.1 protein_id gnl|my_center|LOCUS_06820 51247 51576 gene locus_tag LOCUS_06830 51247 51576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 51603 52802 gene locus_tag LOCUS_06840 51603 52802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 52812 53603 gene locus_tag LOCUS_06850 gene priA 52812 53603 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776203.1 protein_id gnl|my_center|LOCUS_06850 53600 54379 gene locus_tag LOCUS_06860 gene hisF 53600 54379 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466799.1 protein_id gnl|my_center|LOCUS_06860 54382 54699 gene locus_tag LOCUS_06870 54382 54699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 54702 56279 gene locus_tag LOCUS_06880 54702 56279 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224165.1 protein_id gnl|my_center|LOCUS_06880 56272 56856 gene locus_tag LOCUS_06890 56272 56856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 56900 57124 gene locus_tag LOCUS_06900 56900 57124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 57147 57854 gene locus_tag LOCUS_06910 57147 57854 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228141.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence009 <1 552 gene locus_tag LOCUS_06920 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003411632.1:MBL fold metallo-hydrolase 1151 549 gene locus_tag LOCUS_06930 1151 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 1990 1148 gene locus_tag LOCUS_06940 1990 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 2029 4728 gene locus_tag LOCUS_06950 gene ppc 2029 4728 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975687.1 protein_id gnl|my_center|LOCUS_06950 6160 4745 gene locus_tag LOCUS_06960 gene argG 6160 4745 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226260.1 protein_id gnl|my_center|LOCUS_06960 9113 6195 gene locus_tag LOCUS_06970 9113 6195 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_06970 10153 9143 gene locus_tag LOCUS_06980 10153 9143 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973773.1 protein_id gnl|my_center|LOCUS_06980 10612 11892 gene locus_tag LOCUS_06990 10612 11892 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_06990 11889 12455 gene locus_tag LOCUS_07000 11889 12455 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222931.1 protein_id gnl|my_center|LOCUS_07000 12841 13122 gene locus_tag LOCUS_07010 12841 13122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 13233 14405 gene locus_tag LOCUS_07020 13233 14405 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258492.1 protein_id gnl|my_center|LOCUS_07020 16473 14410 gene locus_tag LOCUS_07030 16473 14410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 16622 18010 gene locus_tag LOCUS_07040 16622 18010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 18075 19103 gene locus_tag LOCUS_07050 18075 19103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416809.1 protein_id gnl|my_center|LOCUS_07050 21106 19100 gene locus_tag LOCUS_07060 21106 19100 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 protein_id gnl|my_center|LOCUS_07060 20999 21457 gene locus_tag LOCUS_07070 20999 21457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 22386 21454 gene locus_tag LOCUS_07080 gene nudC 22386 21454 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 protein_id gnl|my_center|LOCUS_07080 22455 23696 gene locus_tag LOCUS_07090 22455 23696 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729107.1 protein_id gnl|my_center|LOCUS_07090 26838 23683 gene locus_tag LOCUS_07100 26838 23683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 30038 26835 gene locus_tag LOCUS_07110 30038 26835 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223038.1 protein_id gnl|my_center|LOCUS_07110 30142 32637 gene locus_tag LOCUS_07120 30142 32637 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030101.1 protein_id gnl|my_center|LOCUS_07120 32647 32844 gene locus_tag LOCUS_07130 32647 32844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 32852 33160 gene locus_tag LOCUS_07140 32852 33160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 34347 33157 gene locus_tag LOCUS_07150 gene moeZ 34347 33157 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 protein_id gnl|my_center|LOCUS_07150 34378 35139 gene locus_tag LOCUS_07160 34378 35139 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223702.1 protein_id gnl|my_center|LOCUS_07160 35155 35835 gene locus_tag LOCUS_07170 35155 35835 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230282.1 protein_id gnl|my_center|LOCUS_07170 36674 35895 gene locus_tag LOCUS_07180 36674 35895 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977216.1 protein_id gnl|my_center|LOCUS_07180 38040 36685 gene locus_tag LOCUS_07190 38040 36685 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223703.1 protein_id gnl|my_center|LOCUS_07190 39395 38037 gene locus_tag LOCUS_07200 gene glnA4 39395 38037 CDS product gamma-glutamylethanolamide synthetase GlnA4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027883.1 protein_id gnl|my_center|LOCUS_07200 40400 39444 gene locus_tag LOCUS_07210 40400 39444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 40438 41073 gene locus_tag LOCUS_07220 40438 41073 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_07220 41127 41351 gene locus_tag LOCUS_07230 41127 41351 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221492514.1 protein_id gnl|my_center|LOCUS_07230 42031 41348 gene locus_tag LOCUS_07240 42031 41348 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973811.1 protein_id gnl|my_center|LOCUS_07240 42103 43611 gene locus_tag LOCUS_07250 42103 43611 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223014.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07250 43608 44450 gene locus_tag LOCUS_07260 43608 44450 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030092.1 protein_id gnl|my_center|LOCUS_07260 45976 44543 gene locus_tag LOCUS_07270 45976 44543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 46047 46736 gene locus_tag LOCUS_07280 46047 46736 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229800.1 protein_id gnl|my_center|LOCUS_07280 47938 46733 gene locus_tag LOCUS_07290 47938 46733 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030944.1 protein_id gnl|my_center|LOCUS_07290 48559 47963 gene locus_tag LOCUS_07300 48559 47963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 49542 48565 gene locus_tag LOCUS_07310 49542 48565 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 protein_id gnl|my_center|LOCUS_07310 49579 50847 gene locus_tag LOCUS_07320 49579 50847 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_07320 50844 51386 gene locus_tag LOCUS_07330 50844 51386 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469672.1 protein_id gnl|my_center|LOCUS_07330 51383 52525 gene locus_tag LOCUS_07340 51383 52525 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_07340 52881 52522 gene locus_tag LOCUS_07350 52881 52522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 53975 52881 gene locus_tag LOCUS_07360 53975 52881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 54025 54690 gene locus_tag LOCUS_07370 54025 54690 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469700.1 protein_id gnl|my_center|LOCUS_07370 54911 54744 gene locus_tag LOCUS_07380 54911 54744 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222969.1 protein_id gnl|my_center|LOCUS_07380 55336 55013 gene locus_tag LOCUS_07390 55336 55013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 55451 56059 gene locus_tag LOCUS_07400 55451 56059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 56133 56684 gene locus_tag LOCUS_07410 56133 56684 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226185.1 protein_id gnl|my_center|LOCUS_07410 56710 57645 gene locus_tag LOCUS_07420 gene dapD 56710 57645 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976903.1 protein_id gnl|my_center|LOCUS_07420 <58412 57642 gene locus_tag LOCUS_07430 <58412 57642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531749.1:citrate synthase >Feature sequence010 885 196 gene locus_tag LOCUS_07440 885 196 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731174.1 protein_id gnl|my_center|LOCUS_07440 2051 873 gene locus_tag LOCUS_07450 2051 873 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977619.1 protein_id gnl|my_center|LOCUS_07450 2148 3740 gene locus_tag LOCUS_07460 2148 3740 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084106.1 protein_id gnl|my_center|LOCUS_07460 4328 3681 gene locus_tag LOCUS_07470 4328 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 4501 5220 gene locus_tag LOCUS_07480 4501 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 7364 5217 gene locus_tag LOCUS_07490 7364 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 9069 7357 gene locus_tag LOCUS_07500 9069 7357 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_07500 9866 9066 gene locus_tag LOCUS_07510 9866 9066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 9991 11910 gene locus_tag LOCUS_07520 9991 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 12917 11922 gene locus_tag LOCUS_07530 12917 11922 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403421.1 protein_id gnl|my_center|LOCUS_07530 13257 12973 gene locus_tag LOCUS_07540 13257 12973 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259328.1 protein_id gnl|my_center|LOCUS_07540 14381 13254 gene locus_tag LOCUS_07550 14381 13254 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484633.1 protein_id gnl|my_center|LOCUS_07550 14414 14674 gene locus_tag LOCUS_07560 14414 14674 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414620.1 protein_id gnl|my_center|LOCUS_07560 14661 15104 gene locus_tag LOCUS_07570 14661 15104 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414624.1 protein_id gnl|my_center|LOCUS_07570 15676 15146 gene locus_tag LOCUS_07580 15676 15146 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028212.1 protein_id gnl|my_center|LOCUS_07580 15773 15689 gene locus_tag LOCUS_t00130 15773 15689 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15857 16795 gene locus_tag LOCUS_07590 15857 16795 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230820.1 protein_id gnl|my_center|LOCUS_07590 16848 17090 gene locus_tag LOCUS_07600 16848 17090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 17087 17461 gene locus_tag LOCUS_07610 17087 17461 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212659.1 protein_id gnl|my_center|LOCUS_07610 17538 18065 gene locus_tag LOCUS_07620 17538 18065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 18101 18778 gene locus_tag LOCUS_07630 18101 18778 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068566.1 protein_id gnl|my_center|LOCUS_07630 18778 19275 gene locus_tag LOCUS_07640 gene fhaB 18778 19275 CDS product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_07640 19278 20603 gene locus_tag LOCUS_07650 19278 20603 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222007.1 protein_id gnl|my_center|LOCUS_07650 20600 21994 gene locus_tag LOCUS_07660 20600 21994 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029267.1 protein_id gnl|my_center|LOCUS_07660 21991 23451 gene locus_tag LOCUS_07670 21991 23451 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776672.1 protein_id gnl|my_center|LOCUS_07670 23549 25330 gene locus_tag LOCUS_07680 gene pknB 23549 25330 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029269.1 protein_id gnl|my_center|LOCUS_07680 25365 26147 gene locus_tag LOCUS_07690 25365 26147 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224644.1 protein_id gnl|my_center|LOCUS_07690 27571 26144 gene locus_tag LOCUS_07700 27571 26144 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 protein_id gnl|my_center|LOCUS_07700 28025 27579 gene locus_tag LOCUS_07710 28025 27579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083563.1 protein_id gnl|my_center|LOCUS_07710 30178 28097 gene locus_tag LOCUS_07720 30178 28097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 30807 30289 gene locus_tag LOCUS_07730 30807 30289 CDS product DUF5318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230992.1 protein_id gnl|my_center|LOCUS_07730 30985 31536 gene locus_tag LOCUS_07740 30985 31536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 31581 32660 gene locus_tag LOCUS_07750 31581 32660 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230990.1 protein_id gnl|my_center|LOCUS_07750 32898 32668 gene locus_tag LOCUS_07760 32898 32668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 32973 33803 gene locus_tag LOCUS_07770 32973 33803 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893773.1 protein_id gnl|my_center|LOCUS_07770 33853 35121 gene locus_tag LOCUS_07780 33853 35121 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029300.1 protein_id gnl|my_center|LOCUS_07780 35170 36414 gene locus_tag LOCUS_07790 35170 36414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 37847 36411 gene locus_tag LOCUS_07800 37847 36411 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_07800 37914 38483 gene locus_tag LOCUS_07810 37914 38483 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284381.1 protein_id gnl|my_center|LOCUS_07810 38480 40564 gene locus_tag LOCUS_07820 38480 40564 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029298.1 protein_id gnl|my_center|LOCUS_07820 40561 42366 gene locus_tag LOCUS_07830 40561 42366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 42435 44027 gene locus_tag LOCUS_07840 42435 44027 CDS product protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029296.1 protein_id gnl|my_center|LOCUS_07840 44051 44689 gene locus_tag LOCUS_07850 gene sigM 44051 44689 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284380.1 protein_id gnl|my_center|LOCUS_07850 44686 45525 gene locus_tag LOCUS_07860 44686 45525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 45585 46958 gene locus_tag LOCUS_07870 45585 46958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 47072 48016 gene locus_tag LOCUS_07880 gene trxB 47072 48016 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_07880 48087 48410 gene locus_tag LOCUS_07890 gene trxA 48087 48410 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_07890 48422 49492 gene locus_tag LOCUS_07900 48422 49492 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231059.1 protein_id gnl|my_center|LOCUS_07900 51018 49489 gene locus_tag LOCUS_07910 51018 49489 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877995.1 protein_id gnl|my_center|LOCUS_07910 51242 52549 gene locus_tag LOCUS_07920 51242 52549 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_07920 52562 53506 gene locus_tag LOCUS_07930 52562 53506 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_07930 55329 53503 gene locus_tag LOCUS_07940 55329 53503 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081393.1 protein_id gnl|my_center|LOCUS_07940 <56952 55375 gene locus_tag LOCUS_07950 <56952 55375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005112402.1:molybdopterin-dependent oxidoreductase >Feature sequence011 373 1818 gene locus_tag LOCUS_07960 373 1818 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225907.1 protein_id gnl|my_center|LOCUS_07960 3043 1808 gene locus_tag LOCUS_07970 3043 1808 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229291.1 protein_id gnl|my_center|LOCUS_07970 3055 4806 gene locus_tag LOCUS_07980 3055 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229290.1 protein_id gnl|my_center|LOCUS_07980 4826 4972 gene locus_tag LOCUS_07990 4826 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 6086 4977 gene locus_tag LOCUS_08000 6086 4977 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296766.1 protein_id gnl|my_center|LOCUS_08000 6163 6942 gene locus_tag LOCUS_08010 6163 6942 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229286.1 protein_id gnl|my_center|LOCUS_08010 6929 11113 gene locus_tag LOCUS_08020 6929 11113 CDS product alpha-(1->3)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229292.1 protein_id gnl|my_center|LOCUS_08020 12227 11040 gene locus_tag LOCUS_08030 12227 11040 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401260.1 protein_id gnl|my_center|LOCUS_08030 12338 13321 gene locus_tag LOCUS_08040 12338 13321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 13512 14969 gene locus_tag LOCUS_08050 gene rpsA 13512 14969 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976820.1 protein_id gnl|my_center|LOCUS_08050 15001 16782 gene locus_tag LOCUS_08060 15001 16782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191313987.1 protein_id gnl|my_center|LOCUS_08060 16785 17375 gene locus_tag LOCUS_08070 16785 17375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 17385 19433 gene locus_tag LOCUS_08080 gene uvrB 17385 19433 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 protein_id gnl|my_center|LOCUS_08080 19430 20488 gene locus_tag LOCUS_08090 19430 20488 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227898.1 protein_id gnl|my_center|LOCUS_08090 20519 21517 gene locus_tag LOCUS_08100 20519 21517 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227898.1 protein_id gnl|my_center|LOCUS_08100 22531 21536 gene locus_tag LOCUS_08110 22531 21536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 22658 23035 gene locus_tag LOCUS_08120 22658 23035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 23101 23568 gene locus_tag LOCUS_08130 23101 23568 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528996.1 protein_id gnl|my_center|LOCUS_08130 23890 24036 gene locus_tag LOCUS_08140 23890 24036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 24282 24413 gene locus_tag LOCUS_08150 24282 24413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 25282 24626 gene locus_tag LOCUS_08160 25282 24626 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_08160 25311 28220 gene locus_tag LOCUS_08170 gene uvrA 25311 28220 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_08170 28230 28670 gene locus_tag LOCUS_08180 28230 28670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 28691 30565 gene locus_tag LOCUS_08190 gene uvrC 28691 30565 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082304.1 protein_id gnl|my_center|LOCUS_08190 30565 31425 gene locus_tag LOCUS_08200 gene rapZ 30565 31425 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_08200 31436 32362 gene locus_tag LOCUS_08210 gene yvcK 31436 32362 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08210 32391 33371 gene locus_tag LOCUS_08220 gene whiA 32391 33371 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976869.1 protein_id gnl|my_center|LOCUS_08220 33506 34513 gene locus_tag LOCUS_08230 gene gap 33506 34513 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_08230 34510 35718 gene locus_tag LOCUS_08240 34510 35718 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930207.1 protein_id gnl|my_center|LOCUS_08240 35718 36518 gene locus_tag LOCUS_08250 gene tpiA 35718 36518 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_08250 36587 36835 gene locus_tag LOCUS_08260 gene secG 36587 36835 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325957.1 protein_id gnl|my_center|LOCUS_08260 36908 37192 gene locus_tag LOCUS_08270 36908 37192 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976875.1 protein_id gnl|my_center|LOCUS_08270 37932 37195 gene locus_tag LOCUS_08280 gene pgl 37932 37195 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224672.1 protein_id gnl|my_center|LOCUS_08280 38837 37929 gene locus_tag LOCUS_08290 gene opcA 38837 37929 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972335.1 protein_id gnl|my_center|LOCUS_08290 40354 38834 gene locus_tag LOCUS_08300 gene zwf 40354 38834 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031084.1 protein_id gnl|my_center|LOCUS_08300 41478 40351 gene locus_tag LOCUS_08310 gene tal 41478 40351 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224676.1 protein_id gnl|my_center|LOCUS_08310 43571 41487 gene locus_tag LOCUS_08320 gene tkt 43571 41487 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031086.1 protein_id gnl|my_center|LOCUS_08320 43675 44607 gene locus_tag LOCUS_08330 43675 44607 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976885.1 protein_id gnl|my_center|LOCUS_08330 45579 44608 gene locus_tag LOCUS_08340 45579 44608 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929933.1 protein_id gnl|my_center|LOCUS_08340 46337 45597 gene locus_tag LOCUS_08350 46337 45597 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805060.1 protein_id gnl|my_center|LOCUS_08350 47251 46334 gene locus_tag LOCUS_08360 47251 46334 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976891.1 protein_id gnl|my_center|LOCUS_08360 47886 47350 gene locus_tag LOCUS_08370 47886 47350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 47970 49382 gene locus_tag LOCUS_08380 gene sufB 47970 49382 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_08380 49382 50527 gene locus_tag LOCUS_08390 gene sufD 49382 50527 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 protein_id gnl|my_center|LOCUS_08390 50527 50874 gene locus_tag LOCUS_08400 50527 50874 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_08400 50893 51657 gene locus_tag LOCUS_08410 gene sufC 50893 51657 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976897.1 protein_id gnl|my_center|LOCUS_08410 51654 52964 gene locus_tag LOCUS_08420 51654 52964 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224700.1 protein_id gnl|my_center|LOCUS_08420 52961 53416 gene locus_tag LOCUS_08430 52961 53416 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894513.1 protein_id gnl|my_center|LOCUS_08430 53413 53727 gene locus_tag LOCUS_08440 53413 53727 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224702.1 protein_id gnl|my_center|LOCUS_08440 53745 55343 gene locus_tag LOCUS_08450 53745 55343 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_08450 55371 56183 gene locus_tag LOCUS_08460 55371 56183 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028003.1 protein_id gnl|my_center|LOCUS_08460 >Feature sequence012 490 864 gene locus_tag LOCUS_08470 gene rpsL 490 864 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_08470 864 1334 gene locus_tag LOCUS_08480 gene rpsG 864 1334 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776385.1 protein_id gnl|my_center|LOCUS_08480 1375 3474 gene locus_tag LOCUS_08490 gene fusA 1375 3474 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974302.1 protein_id gnl|my_center|LOCUS_08490 3560 4756 gene locus_tag LOCUS_08500 gene tuf 3560 4756 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029795.1 protein_id gnl|my_center|LOCUS_08500 4848 5156 gene locus_tag LOCUS_08510 gene rpsJ 4848 5156 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_08510 5167 5817 gene locus_tag LOCUS_08520 gene rplC 5167 5817 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_08520 5814 6488 gene locus_tag LOCUS_08530 gene rplD 5814 6488 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 protein_id gnl|my_center|LOCUS_08530 6485 6784 gene locus_tag LOCUS_08540 6485 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 6802 7638 gene locus_tag LOCUS_08550 gene rplB 6802 7638 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102084.1 protein_id gnl|my_center|LOCUS_08550 7648 7929 gene locus_tag LOCUS_08560 gene rpsS 7648 7929 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974263.1 protein_id gnl|my_center|LOCUS_08560 7952 8341 gene locus_tag LOCUS_08570 gene rplV 7952 8341 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974262.1 protein_id gnl|my_center|LOCUS_08570 8343 9149 gene locus_tag LOCUS_08580 gene rpsC 8343 9149 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776371.1 protein_id gnl|my_center|LOCUS_08580 9152 9574 gene locus_tag LOCUS_08590 gene rplP 9152 9574 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974260.1 protein_id gnl|my_center|LOCUS_08590 9574 9810 gene locus_tag LOCUS_08600 gene rpmC 9574 9810 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 protein_id gnl|my_center|LOCUS_08600 9807 10091 gene locus_tag LOCUS_08610 gene rpsQ 9807 10091 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_08610 10102 10470 gene locus_tag LOCUS_08620 gene rplN 10102 10470 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974257.1 protein_id gnl|my_center|LOCUS_08620 10472 10834 gene locus_tag LOCUS_08630 gene rplX 10472 10834 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222610.1 protein_id gnl|my_center|LOCUS_08630 10834 11403 gene locus_tag LOCUS_08640 gene rplE 10834 11403 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_08640 11405 11590 gene locus_tag LOCUS_08650 11405 11590 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010550318.1 protein_id gnl|my_center|LOCUS_08650 11640 12044 gene locus_tag LOCUS_08660 gene rpsH 11640 12044 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892856.1 protein_id gnl|my_center|LOCUS_08660 12054 12596 gene locus_tag LOCUS_08670 gene rplF 12054 12596 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222612.1 protein_id gnl|my_center|LOCUS_08670 12593 12976 gene locus_tag LOCUS_08680 gene rplR 12593 12976 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776361.1 protein_id gnl|my_center|LOCUS_08680 13000 13599 gene locus_tag LOCUS_08690 gene rpsE 13000 13599 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974251.1 protein_id gnl|my_center|LOCUS_08690 13596 13781 gene locus_tag LOCUS_08700 gene rpmD 13596 13781 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776359.1 protein_id gnl|my_center|LOCUS_08700 13783 14238 gene locus_tag LOCUS_08710 gene rplO 13783 14238 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974249.1 protein_id gnl|my_center|LOCUS_08710 14361 15659 gene locus_tag LOCUS_08720 gene secY 14361 15659 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_08720 15659 16222 gene locus_tag LOCUS_08730 15659 16222 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776356.1 protein_id gnl|my_center|LOCUS_08730 16226 17011 gene locus_tag LOCUS_08740 gene map 16226 17011 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222621.1 protein_id gnl|my_center|LOCUS_08740 17038 17811 gene locus_tag LOCUS_08750 17038 17811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 17935 18192 gene locus_tag LOCUS_08760 gene infA 17935 18192 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948620.1 protein_id gnl|my_center|LOCUS_08760 18499 18879 gene locus_tag LOCUS_08770 gene rpsM 18499 18879 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908646.1 protein_id gnl|my_center|LOCUS_08770 18944 19351 gene locus_tag LOCUS_08780 gene rpsK 18944 19351 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_08780 19371 19997 gene locus_tag LOCUS_08790 gene rpsD 19371 19997 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222624.1 protein_id gnl|my_center|LOCUS_08790 20055 21074 gene locus_tag LOCUS_08800 20055 21074 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_08800 21107 21739 gene locus_tag LOCUS_08810 21107 21739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 21815 22618 gene locus_tag LOCUS_08820 gene truA 21815 22618 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974242.1 protein_id gnl|my_center|LOCUS_08820 22618 24276 gene locus_tag LOCUS_08830 22618 24276 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114333.1 protein_id gnl|my_center|LOCUS_08830 24397 24840 gene locus_tag LOCUS_08840 gene rplM 24397 24840 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776324.1 protein_id gnl|my_center|LOCUS_08840 24863 25381 gene locus_tag LOCUS_08850 gene rpsI 24863 25381 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776323.1 protein_id gnl|my_center|LOCUS_08850 25386 26741 gene locus_tag LOCUS_08860 gene glmM 25386 26741 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_08860 27691 26753 gene locus_tag LOCUS_08870 27691 26753 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466857.1 protein_id gnl|my_center|LOCUS_08870 27793 29643 gene locus_tag LOCUS_08880 gene glmS 27793 29643 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 protein_id gnl|my_center|LOCUS_08880 29651 31183 gene locus_tag LOCUS_08890 29651 31183 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029833.1 protein_id gnl|my_center|LOCUS_08890 31180 32319 gene locus_tag LOCUS_08900 gene alr 31180 32319 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_08900 32358 33398 gene locus_tag LOCUS_08910 32358 33398 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327056.1 protein_id gnl|my_center|LOCUS_08910 33398 33868 gene locus_tag LOCUS_08920 33398 33868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 33858 34754 gene locus_tag LOCUS_08930 33858 34754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 34765 35484 gene locus_tag LOCUS_08940 gene tsaB 34765 35484 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_08940 35481 35930 gene locus_tag LOCUS_08950 gene rimI 35481 35930 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 protein_id gnl|my_center|LOCUS_08950 35927 36967 gene locus_tag LOCUS_08960 gene tsaD 35927 36967 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_08960 37055 37909 gene locus_tag LOCUS_08970 37055 37909 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222255.1 protein_id gnl|my_center|LOCUS_08970 38020 38802 gene locus_tag LOCUS_08980 gene mmuM 38020 38802 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909348.1 protein_id gnl|my_center|LOCUS_08980 39997 38792 gene locus_tag LOCUS_08990 39997 38792 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 protein_id gnl|my_center|LOCUS_08990 40191 40490 gene locus_tag LOCUS_09000 gene groES 40191 40490 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056050.1 protein_id gnl|my_center|LOCUS_09000 40631 42259 gene locus_tag LOCUS_09010 gene groL 40631 42259 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_09010 42277 43254 gene locus_tag LOCUS_09020 gene yedA 42277 43254 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212226.1 protein_id gnl|my_center|LOCUS_09020 43614 43321 gene locus_tag LOCUS_09030 43614 43321 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974205.1 protein_id gnl|my_center|LOCUS_09030 43782 44729 gene locus_tag LOCUS_09040 43782 44729 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222679.1 protein_id gnl|my_center|LOCUS_09040 44726 45496 gene locus_tag LOCUS_09050 44726 45496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 45506 47005 gene locus_tag LOCUS_09060 gene guaB 45506 47005 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222684.1 protein_id gnl|my_center|LOCUS_09060 47013 48128 gene locus_tag LOCUS_09070 47013 48128 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_09070 48155 49807 gene locus_tag LOCUS_09080 48155 49807 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_09080 49817 51367 gene locus_tag LOCUS_09090 49817 51367 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_09090 51388 53082 gene locus_tag LOCUS_09100 51388 53082 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222688.1 protein_id gnl|my_center|LOCUS_09100 53086 53274 gene locus_tag LOCUS_09110 53086 53274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence013 958 1335 gene locus_tag LOCUS_09120 958 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 2590 1310 gene locus_tag LOCUS_09130 gene murA 2590 1310 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084647.1 protein_id gnl|my_center|LOCUS_09130 2662 3240 gene locus_tag LOCUS_09140 2662 3240 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973616.1 protein_id gnl|my_center|LOCUS_09140 3623 3258 gene locus_tag LOCUS_09150 3623 3258 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730202.1 protein_id gnl|my_center|LOCUS_09150 5109 3658 gene locus_tag LOCUS_09160 gene atpD 5109 3658 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896328.1 protein_id gnl|my_center|LOCUS_09160 6059 5133 gene locus_tag LOCUS_09170 6059 5133 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896329.1 protein_id gnl|my_center|LOCUS_09170 7705 6059 gene locus_tag LOCUS_09180 gene atpA 7705 6059 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406699.1 protein_id gnl|my_center|LOCUS_09180 9088 7754 gene locus_tag LOCUS_09190 9088 7754 CDS product F0F1 ATP synthase subunit B/delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896331.1 protein_id gnl|my_center|LOCUS_09190 9610 9095 gene locus_tag LOCUS_09200 9610 9095 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896332.1 protein_id gnl|my_center|LOCUS_09200 9868 9617 gene locus_tag LOCUS_09210 9868 9617 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059842.1 protein_id gnl|my_center|LOCUS_09210 10703 9948 gene locus_tag LOCUS_09220 gene atpB 10703 9948 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908157.1 protein_id gnl|my_center|LOCUS_09220 11182 10709 gene locus_tag LOCUS_09230 11182 10709 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908156.1 protein_id gnl|my_center|LOCUS_09230 12413 11286 gene locus_tag LOCUS_09240 12413 11286 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775946.1 protein_id gnl|my_center|LOCUS_09240 13696 12422 gene locus_tag LOCUS_09250 13696 12422 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_09250 14418 13744 gene locus_tag LOCUS_09260 14418 13744 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973635.1 protein_id gnl|my_center|LOCUS_09260 15376 14420 gene locus_tag LOCUS_09270 gene prmC 15376 14420 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973636.1 protein_id gnl|my_center|LOCUS_09270 16449 15373 gene locus_tag LOCUS_09280 gene prfA 16449 15373 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973637.1 protein_id gnl|my_center|LOCUS_09280 16718 16479 gene locus_tag LOCUS_09290 gene rpmE 16718 16479 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229538.1 protein_id gnl|my_center|LOCUS_09290 18433 16808 gene locus_tag LOCUS_09300 18433 16808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 19563 18631 gene locus_tag LOCUS_09310 gene thrB 19563 18631 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_09310 20630 19566 gene locus_tag LOCUS_09320 gene thrC 20630 19566 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_09320 21931 20627 gene locus_tag LOCUS_09330 21931 20627 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_09330 23254 21998 gene locus_tag LOCUS_09340 gene lysA 23254 21998 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 protein_id gnl|my_center|LOCUS_09340 23528 24517 gene locus_tag LOCUS_09350 23528 24517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 26238 24526 gene locus_tag LOCUS_09360 gene argS 26238 24526 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730214.1 protein_id gnl|my_center|LOCUS_09360 26482 26685 gene locus_tag LOCUS_09370 26482 26685 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_09370 26869 27153 gene locus_tag LOCUS_09380 26869 27153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 27203 27277 gene locus_tag LOCUS_t00140 27203 27277 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 27324 28634 gene locus_tag LOCUS_09390 gene proP 27324 28634 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035341.1 protein_id gnl|my_center|LOCUS_09390 29297 28635 gene locus_tag LOCUS_09400 29297 28635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 29338 30303 gene locus_tag LOCUS_09410 29338 30303 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_09410 30305 31339 gene locus_tag LOCUS_09420 30305 31339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 31336 32769 gene locus_tag LOCUS_09430 31336 32769 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031372.1 protein_id gnl|my_center|LOCUS_09430 32766 34133 gene locus_tag LOCUS_09440 32766 34133 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031373.1 protein_id gnl|my_center|LOCUS_09440 34208 35347 gene locus_tag LOCUS_09450 34208 35347 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031374.1 protein_id gnl|my_center|LOCUS_09450 35376 37802 gene locus_tag LOCUS_09460 35376 37802 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975818.1 protein_id gnl|my_center|LOCUS_09460 39537 37861 gene locus_tag LOCUS_09470 39537 37861 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230797.1 protein_id gnl|my_center|LOCUS_09470 40602 39667 gene locus_tag LOCUS_09480 40602 39667 CDS product choline/ethanolamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336755.1 protein_id gnl|my_center|LOCUS_09480 40662 41609 gene locus_tag LOCUS_09490 40662 41609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 42659 41619 gene locus_tag LOCUS_09500 42659 41619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 43564 42656 gene locus_tag LOCUS_09510 43564 42656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 45032 44034 gene locus_tag LOCUS_09520 45032 44034 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775774.1 protein_id gnl|my_center|LOCUS_09520 47484 45025 gene locus_tag LOCUS_09530 47484 45025 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775775.1 protein_id gnl|my_center|LOCUS_09530 48618 47590 gene locus_tag LOCUS_09540 48618 47590 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775776.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence014 100 417 gene locus_tag LOCUS_09550 100 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 414 1364 gene locus_tag LOCUS_09560 414 1364 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030587.1 protein_id gnl|my_center|LOCUS_09560 1361 1990 gene locus_tag LOCUS_09570 1361 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 2034 3539 gene locus_tag LOCUS_09580 gene mmcO 2034 3539 CDS product multicopper oxidase MmcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404392.1 protein_id gnl|my_center|LOCUS_09580 3742 3581 gene locus_tag LOCUS_09590 3742 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 4907 3783 gene locus_tag LOCUS_09600 4907 3783 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015529.1 protein_id gnl|my_center|LOCUS_09600 5593 4904 gene locus_tag LOCUS_09610 5593 4904 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111761.1 protein_id gnl|my_center|LOCUS_09610 5905 5660 gene locus_tag LOCUS_09620 5905 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 6318 6091 gene locus_tag LOCUS_09630 6318 6091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 6260 6781 gene locus_tag LOCUS_09640 6260 6781 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486466.1 protein_id gnl|my_center|LOCUS_09640 6801 7019 gene locus_tag LOCUS_09650 6801 7019 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225366.1 protein_id gnl|my_center|LOCUS_09650 7019 7933 gene locus_tag LOCUS_09660 7019 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 8033 10543 gene locus_tag LOCUS_09670 8033 10543 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_09670 11047 10730 gene locus_tag LOCUS_09680 11047 10730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 11274 11053 gene locus_tag LOCUS_09690 11274 11053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 11662 11264 gene locus_tag LOCUS_09700 11662 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 12285 11743 gene locus_tag LOCUS_09710 12285 11743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 12380 14728 gene locus_tag LOCUS_09720 12380 14728 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730259.1 protein_id gnl|my_center|LOCUS_09720 14749 15417 gene locus_tag LOCUS_09730 14749 15417 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026862.1 protein_id gnl|my_center|LOCUS_09730 15417 17000 gene locus_tag LOCUS_09740 15417 17000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 17103 18833 gene locus_tag LOCUS_09750 17103 18833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 18859 19347 gene locus_tag LOCUS_09760 18859 19347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030585.1 protein_id gnl|my_center|LOCUS_09760 19403 20680 gene locus_tag LOCUS_09770 19403 20680 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072555.1 protein_id gnl|my_center|LOCUS_09770 21338 20697 gene locus_tag LOCUS_09780 21338 20697 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776421.1 protein_id gnl|my_center|LOCUS_09780 21543 22667 gene locus_tag LOCUS_09790 21543 22667 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029867.1 protein_id gnl|my_center|LOCUS_09790 22667 24112 gene locus_tag LOCUS_09800 22667 24112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 24122 25714 gene locus_tag LOCUS_09810 24122 25714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 26699 25695 gene locus_tag LOCUS_09820 26699 25695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 27865 27398 gene locus_tag LOCUS_09830 27865 27398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 29839 28043 gene locus_tag LOCUS_09840 29839 28043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 30040 31122 gene locus_tag LOCUS_09850 30040 31122 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391485.1 protein_id gnl|my_center|LOCUS_09850 31127 31450 gene locus_tag LOCUS_09860 31127 31450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 31447 33195 gene locus_tag LOCUS_09870 31447 33195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 34680 33229 gene locus_tag LOCUS_09880 34680 33229 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031263.1 protein_id gnl|my_center|LOCUS_09880 36158 34677 gene locus_tag LOCUS_09890 36158 34677 CDS product type VII secretion protein EccE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029051.1 protein_id gnl|my_center|LOCUS_09890 37020 36226 gene locus_tag LOCUS_09900 37020 36226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 37659 37042 gene locus_tag LOCUS_09910 37659 37042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 37958 37686 gene locus_tag LOCUS_09920 37958 37686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 38469 38053 gene locus_tag LOCUS_09930 38469 38053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 39934 38438 gene locus_tag LOCUS_09940 39934 38438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 41091 40174 gene locus_tag LOCUS_09950 41091 40174 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972246.1 protein_id gnl|my_center|LOCUS_09950 43025 41088 gene locus_tag LOCUS_09960 43025 41088 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112725.1 protein_id gnl|my_center|LOCUS_09960 43365 43018 gene locus_tag LOCUS_09970 43365 43018 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112726.1 protein_id gnl|my_center|LOCUS_09970 43582 43857 gene locus_tag LOCUS_09980 43582 43857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 43854 44636 gene locus_tag LOCUS_09990 43854 44636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 44671 45390 gene locus_tag LOCUS_10000 44671 45390 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111761.1 protein_id gnl|my_center|LOCUS_10000 45387 46496 gene locus_tag LOCUS_10010 45387 46496 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091654.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence015 644 309 gene locus_tag LOCUS_10020 644 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 859 647 gene locus_tag LOCUS_10030 859 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 1018 2052 gene locus_tag LOCUS_10040 1018 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 2771 2049 gene locus_tag LOCUS_10050 2771 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 3457 2768 gene locus_tag LOCUS_10060 3457 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 4631 3450 gene locus_tag LOCUS_10070 4631 3450 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 protein_id gnl|my_center|LOCUS_10070 5644 4628 gene locus_tag LOCUS_10080 5644 4628 CDS product septum formation initiator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029084.1 protein_id gnl|my_center|LOCUS_10080 5794 6579 gene locus_tag LOCUS_10090 5794 6579 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270110.1 protein_id gnl|my_center|LOCUS_10090 6576 7493 gene locus_tag LOCUS_10100 6576 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 8213 7479 gene locus_tag LOCUS_10110 8213 7479 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975377.1 protein_id gnl|my_center|LOCUS_10110 9499 8249 gene locus_tag LOCUS_10120 9499 8249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029086.1 protein_id gnl|my_center|LOCUS_10120 9645 11612 gene locus_tag LOCUS_10130 gene acs 9645 11612 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230537.1 protein_id gnl|my_center|LOCUS_10130 11681 12994 gene locus_tag LOCUS_10140 gene nhaA 11681 12994 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029088.1 protein_id gnl|my_center|LOCUS_10140 13030 13494 gene locus_tag LOCUS_10150 13030 13494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 13497 14417 gene locus_tag LOCUS_10160 13497 14417 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029089.1 protein_id gnl|my_center|LOCUS_10160 14414 14806 gene locus_tag LOCUS_10170 14414 14806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 16060 14876 gene locus_tag LOCUS_10180 gene marP 16060 14876 CDS product acid resistance serine protease MarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083527.1 protein_id gnl|my_center|LOCUS_10180 16743 16057 gene locus_tag LOCUS_10190 16743 16057 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_10190 17468 16743 gene locus_tag LOCUS_10200 17468 16743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 17573 18247 gene locus_tag LOCUS_10210 17573 18247 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_10210 19051 18251 gene locus_tag LOCUS_10220 19051 18251 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_10220 19917 19048 gene locus_tag LOCUS_10230 19917 19048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 protein_id gnl|my_center|LOCUS_10230 20393 19929 gene locus_tag LOCUS_10240 20393 19929 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897586.1 protein_id gnl|my_center|LOCUS_10240 20559 20404 gene locus_tag LOCUS_10250 20559 20404 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776605.1 protein_id gnl|my_center|LOCUS_10250 20613 21602 gene locus_tag LOCUS_10260 20613 21602 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029095.1 protein_id gnl|my_center|LOCUS_10260 21599 22732 gene locus_tag LOCUS_10270 21599 22732 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_10270 23040 22729 gene locus_tag LOCUS_10280 gene wblA 23040 22729 CDS product transcriptional regulator WblA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029097.1 protein_id gnl|my_center|LOCUS_10280 23288 25594 gene locus_tag LOCUS_10290 23288 25594 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_10290 26056 25595 gene locus_tag LOCUS_10300 26056 25595 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_10300 26119 27042 gene locus_tag LOCUS_10310 26119 27042 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467832.1 protein_id gnl|my_center|LOCUS_10310 27058 27132 gene locus_tag LOCUS_t00150 27058 27132 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 28229 27189 gene locus_tag LOCUS_10320 28229 27189 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230597.1 protein_id gnl|my_center|LOCUS_10320 29518 28226 gene locus_tag LOCUS_10330 29518 28226 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_10330 30219 29620 gene locus_tag LOCUS_10340 gene recR 30219 29620 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_10340 31979 30222 gene locus_tag LOCUS_10350 31979 30222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 32266 32181 gene locus_tag LOCUS_t00160 32266 32181 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 32366 32689 gene locus_tag LOCUS_10360 32366 32689 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895874.1 protein_id gnl|my_center|LOCUS_10360 32686 33348 gene locus_tag LOCUS_10370 32686 33348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 35226 33352 gene locus_tag LOCUS_10380 35226 33352 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550348.1 protein_id gnl|my_center|LOCUS_10380 35326 36747 gene locus_tag LOCUS_10390 35326 36747 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112993.1 protein_id gnl|my_center|LOCUS_10390 36747 37748 gene locus_tag LOCUS_10400 36747 37748 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583478.1 protein_id gnl|my_center|LOCUS_10400 37752 38786 gene locus_tag LOCUS_10410 37752 38786 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092074.1 protein_id gnl|my_center|LOCUS_10410 39903 38770 gene locus_tag LOCUS_10420 gene nagA 39903 38770 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230828.1 protein_id gnl|my_center|LOCUS_10420 39896 40990 gene locus_tag LOCUS_10430 39896 40990 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227851.1 protein_id gnl|my_center|LOCUS_10430 41001 41429 gene locus_tag LOCUS_10440 41001 41429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 42830 41430 gene locus_tag LOCUS_10450 42830 41430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 42965 43306 gene locus_tag LOCUS_10460 42965 43306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 43681 43310 gene locus_tag LOCUS_10470 43681 43310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 44656 43730 gene locus_tag LOCUS_10480 44656 43730 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225136.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence016 2290 578 gene locus_tag LOCUS_10490 2290 578 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978031.1 protein_id gnl|my_center|LOCUS_10490 2358 3008 gene locus_tag LOCUS_10500 2358 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 3163 2987 gene locus_tag LOCUS_10510 3163 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 3134 4207 gene locus_tag LOCUS_10520 3134 4207 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_10520 4204 4413 gene locus_tag LOCUS_10530 4204 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 4498 4572 gene locus_tag LOCUS_t00170 4498 4572 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4785 6203 gene locus_tag LOCUS_10540 4785 6203 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104378.1 protein_id gnl|my_center|LOCUS_10540 8725 6281 gene locus_tag LOCUS_10550 8725 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 9366 8722 gene locus_tag LOCUS_10560 9366 8722 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336871.1 protein_id gnl|my_center|LOCUS_10560 9534 10085 gene locus_tag LOCUS_10570 9534 10085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 10153 11142 gene locus_tag LOCUS_10580 10153 11142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 11256 11429 gene locus_tag LOCUS_10590 11256 11429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 12415 11462 gene locus_tag LOCUS_10600 12415 11462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 13450 12467 gene locus_tag LOCUS_10610 gene gmd 13450 12467 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_10610 14812 13505 gene locus_tag LOCUS_10620 14812 13505 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978004.1 protein_id gnl|my_center|LOCUS_10620 16276 14948 gene locus_tag LOCUS_10630 16276 14948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 16632 16294 gene locus_tag LOCUS_10640 16632 16294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 16516 17253 gene locus_tag LOCUS_10650 16516 17253 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_10650 17241 18050 gene locus_tag LOCUS_10660 17241 18050 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_10660 18047 19957 gene locus_tag LOCUS_10670 18047 19957 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039705.1 protein_id gnl|my_center|LOCUS_10670 19959 20855 gene locus_tag LOCUS_10680 19959 20855 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256971.1 protein_id gnl|my_center|LOCUS_10680 20852 21997 gene locus_tag LOCUS_10690 20852 21997 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039704.1 protein_id gnl|my_center|LOCUS_10690 22779 21991 gene locus_tag LOCUS_10700 22779 21991 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973483.1 protein_id gnl|my_center|LOCUS_10700 22832 23671 gene locus_tag LOCUS_10710 gene aroE 22832 23671 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973723.1 protein_id gnl|my_center|LOCUS_10710 24822 23668 gene locus_tag LOCUS_10720 24822 23668 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085907.1 protein_id gnl|my_center|LOCUS_10720 26147 24819 gene locus_tag LOCUS_10730 26147 24819 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728106.1 protein_id gnl|my_center|LOCUS_10730 26182 26652 gene locus_tag LOCUS_10740 26182 26652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 26680 27012 gene locus_tag LOCUS_10750 26680 27012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 28805 27009 gene locus_tag LOCUS_10760 28805 27009 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444518.1 protein_id gnl|my_center|LOCUS_10760 28874 29713 gene locus_tag LOCUS_10770 28874 29713 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027715.1 protein_id gnl|my_center|LOCUS_10770 30831 29710 gene locus_tag LOCUS_10780 gene ltaE 30831 29710 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258446.1 protein_id gnl|my_center|LOCUS_10780 32250 30841 gene locus_tag LOCUS_10790 32250 30841 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776491.1 protein_id gnl|my_center|LOCUS_10790 32402 33265 gene locus_tag LOCUS_10800 32402 33265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 34443 33262 gene locus_tag LOCUS_10810 34443 33262 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975394.1 protein_id gnl|my_center|LOCUS_10810 35078 34443 gene locus_tag LOCUS_10820 35078 34443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 37944 35203 gene locus_tag LOCUS_10830 gene topA 37944 35203 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029075.1 protein_id gnl|my_center|LOCUS_10830 40423 38093 gene locus_tag LOCUS_10840 40423 38093 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029076.1 protein_id gnl|my_center|LOCUS_10840 40532 42817 gene locus_tag LOCUS_10850 40532 42817 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485160.1 protein_id gnl|my_center|LOCUS_10850 >Feature sequence017 501 118 gene locus_tag LOCUS_10860 501 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1127 498 gene locus_tag LOCUS_10870 1127 498 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_10870 1269 1135 gene locus_tag LOCUS_10880 1269 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1887 1483 gene locus_tag LOCUS_10890 1887 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 3284 1860 gene locus_tag LOCUS_10900 gene argH 3284 1860 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027854.1 protein_id gnl|my_center|LOCUS_10900 3784 3281 gene locus_tag LOCUS_10910 3784 3281 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_10910 4977 3781 gene locus_tag LOCUS_10920 4977 3781 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408163.1 protein_id gnl|my_center|LOCUS_10920 5813 4974 gene locus_tag LOCUS_10930 gene argB 5813 4974 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 protein_id gnl|my_center|LOCUS_10930 6976 5810 gene locus_tag LOCUS_10940 gene argJ 6976 5810 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 protein_id gnl|my_center|LOCUS_10940 8001 6973 gene locus_tag LOCUS_10950 gene argC 8001 6973 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977244.1 protein_id gnl|my_center|LOCUS_10950 10529 8034 gene locus_tag LOCUS_10960 gene pheT 10529 8034 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027870.1 protein_id gnl|my_center|LOCUS_10960 11638 10529 gene locus_tag LOCUS_10970 gene pheS 11638 10529 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977229.1 protein_id gnl|my_center|LOCUS_10970 13528 11639 gene locus_tag LOCUS_10980 gene cysN 13528 11639 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994000.1 protein_id gnl|my_center|LOCUS_10980 14454 13528 gene locus_tag LOCUS_10990 gene cysD 14454 13528 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389944.1 protein_id gnl|my_center|LOCUS_10990 15295 14534 gene locus_tag LOCUS_11000 15295 14534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 16236 15418 gene locus_tag LOCUS_11010 16236 15418 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_11010 16608 16240 gene locus_tag LOCUS_11020 gene rplT 16608 16240 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 protein_id gnl|my_center|LOCUS_11020 16830 16636 gene locus_tag LOCUS_11030 gene rpmI 16830 16636 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776198.1 protein_id gnl|my_center|LOCUS_11030 17411 16875 gene locus_tag LOCUS_11040 gene infC 17411 16875 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11040 18157 17705 gene locus_tag LOCUS_11050 18157 17705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 19005 18160 gene locus_tag LOCUS_11060 gene hisG 19005 18160 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_11060 19272 19009 gene locus_tag LOCUS_11070 19272 19009 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027788.1 protein_id gnl|my_center|LOCUS_11070 19758 19282 gene locus_tag LOCUS_11080 gene ribH 19758 19282 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977385.1 protein_id gnl|my_center|LOCUS_11080 20987 19755 gene locus_tag LOCUS_11090 20987 19755 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323693.1 protein_id gnl|my_center|LOCUS_11090 21598 20984 gene locus_tag LOCUS_11100 21598 20984 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_11100 22630 21608 gene locus_tag LOCUS_11110 gene ribD 22630 21608 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907793.1 protein_id gnl|my_center|LOCUS_11110 23307 22630 gene locus_tag LOCUS_11120 gene rpe 23307 22630 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977361.1 protein_id gnl|my_center|LOCUS_11120 24706 23333 gene locus_tag LOCUS_11130 24706 23333 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 protein_id gnl|my_center|LOCUS_11130 25623 24703 gene locus_tag LOCUS_11140 gene fmt 25623 24703 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_11140 26172 25627 gene locus_tag LOCUS_11150 gene def 26172 25627 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_11150 28129 26213 gene locus_tag LOCUS_11160 28129 26213 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224627.1 protein_id gnl|my_center|LOCUS_11160 29374 28178 gene locus_tag LOCUS_11170 gene metK 29374 28178 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_11170 30687 29551 gene locus_tag LOCUS_11180 gene coaBC 30687 29551 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_11180 31070 30756 gene locus_tag LOCUS_11190 gene rpoZ 31070 30756 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_11190 31688 31140 gene locus_tag LOCUS_11200 gene gmk 31688 31140 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466863.1 protein_id gnl|my_center|LOCUS_11200 32014 31685 gene locus_tag LOCUS_11210 32014 31685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 32753 32004 gene locus_tag LOCUS_11220 gene pyrF 32753 32004 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391171.1 protein_id gnl|my_center|LOCUS_11220 33781 32750 gene locus_tag LOCUS_11230 33781 32750 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_11230 34635 33778 gene locus_tag LOCUS_11240 34635 33778 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_11240 37925 34635 gene locus_tag LOCUS_11250 gene carB 37925 34635 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 protein_id gnl|my_center|LOCUS_11250 39087 37942 gene locus_tag LOCUS_11260 gene carA 39087 37942 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_11260 39635 39087 gene locus_tag LOCUS_11270 39635 39087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977341.1 protein_id gnl|my_center|LOCUS_11270 40057 39632 gene locus_tag LOCUS_11280 40057 39632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence018 312 37 gene locus_tag LOCUS_11290 312 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 738 328 gene locus_tag LOCUS_11300 738 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1154 744 gene locus_tag LOCUS_11310 1154 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1239 1715 gene locus_tag LOCUS_11320 1239 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1799 3184 gene locus_tag LOCUS_11330 1799 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 3237 4325 gene locus_tag LOCUS_11340 3237 4325 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_11340 4336 5193 gene locus_tag LOCUS_11350 4336 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 6246 5206 gene locus_tag LOCUS_11360 6246 5206 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296404.1 protein_id gnl|my_center|LOCUS_11360 6245 7390 gene locus_tag LOCUS_11370 gene xseA 6245 7390 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030027.1 protein_id gnl|my_center|LOCUS_11370 7392 7619 gene locus_tag LOCUS_11380 7392 7619 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030026.1 protein_id gnl|my_center|LOCUS_11380 8148 7591 gene locus_tag LOCUS_11390 8148 7591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 8218 9225 gene locus_tag LOCUS_11400 gene glpX 8218 9225 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973930.1 protein_id gnl|my_center|LOCUS_11400 10227 9232 gene locus_tag LOCUS_11410 10227 9232 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091889128.1 protein_id gnl|my_center|LOCUS_11410 10244 11911 gene locus_tag LOCUS_11420 10244 11911 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_11420 12961 11915 gene locus_tag LOCUS_11430 12961 11915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 14446 13070 gene locus_tag LOCUS_11440 14446 13070 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973949.1 protein_id gnl|my_center|LOCUS_11440 15349 14588 gene locus_tag LOCUS_11450 15349 14588 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_11450 17367 15340 gene locus_tag LOCUS_11460 17367 15340 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_11460 17881 17435 gene locus_tag LOCUS_11470 17881 17435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 17832 18305 gene locus_tag LOCUS_11480 17832 18305 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927167.1 protein_id gnl|my_center|LOCUS_11480 18316 19179 gene locus_tag LOCUS_11490 18316 19179 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970653.1 protein_id gnl|my_center|LOCUS_11490 19504 19181 gene locus_tag LOCUS_11500 19504 19181 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941369.1 protein_id gnl|my_center|LOCUS_11500 20892 19504 gene locus_tag LOCUS_11510 20892 19504 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803973.1 protein_id gnl|my_center|LOCUS_11510 21001 21447 gene locus_tag LOCUS_11520 21001 21447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 21501 22751 gene locus_tag LOCUS_11530 21501 22751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 24622 22748 gene locus_tag LOCUS_11540 24622 22748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 24663 25865 gene locus_tag LOCUS_11550 24663 25865 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226315.1 protein_id gnl|my_center|LOCUS_11550 26878 25862 gene locus_tag LOCUS_11560 gene cydB 26878 25862 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029331.1 protein_id gnl|my_center|LOCUS_11560 28284 26875 gene locus_tag LOCUS_11570 28284 26875 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227294.1 protein_id gnl|my_center|LOCUS_11570 28226 28864 gene locus_tag LOCUS_11580 28226 28864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 28955 29209 gene locus_tag LOCUS_11590 28955 29209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 29216 30106 gene locus_tag LOCUS_11600 29216 30106 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043688023.1 protein_id gnl|my_center|LOCUS_11600 30470 30120 gene locus_tag LOCUS_11610 30470 30120 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666291.1 protein_id gnl|my_center|LOCUS_11610 31207 30467 gene locus_tag LOCUS_11620 31207 30467 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995706.1 protein_id gnl|my_center|LOCUS_11620 31525 31211 gene locus_tag LOCUS_11630 31525 31211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 32403 31534 gene locus_tag LOCUS_11640 gene mca 32403 31534 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 protein_id gnl|my_center|LOCUS_11640 32445 32927 gene locus_tag LOCUS_11650 32445 32927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 32949 33437 gene locus_tag LOCUS_11660 gene greA 32949 33437 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974011.1 protein_id gnl|my_center|LOCUS_11660 34285 33434 gene locus_tag LOCUS_11670 34285 33434 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974012.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence019 2339 531 gene locus_tag LOCUS_11680 2339 531 CDS product PEP-utilizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013724.1 protein_id gnl|my_center|LOCUS_11680 3448 2369 gene locus_tag LOCUS_11690 3448 2369 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013725.1 protein_id gnl|my_center|LOCUS_11690 4548 3445 gene locus_tag LOCUS_11700 4548 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 5470 4559 gene locus_tag LOCUS_11710 gene hpaD 5470 4559 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978715.1 protein_id gnl|my_center|LOCUS_11710 6378 5470 gene locus_tag LOCUS_11720 gene hpaD 6378 5470 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228330.1 protein_id gnl|my_center|LOCUS_11720 6515 7156 gene locus_tag LOCUS_11730 6515 7156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 7156 7983 gene locus_tag LOCUS_11740 7156 7983 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_11740 7980 8771 gene locus_tag LOCUS_11750 7980 8771 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_11750 8786 9697 gene locus_tag LOCUS_11760 8786 9697 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878495.1 protein_id gnl|my_center|LOCUS_11760 9694 10728 gene locus_tag LOCUS_11770 gene dmpG 9694 10728 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393276.1 protein_id gnl|my_center|LOCUS_11770 10725 11507 gene locus_tag LOCUS_11780 10725 11507 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113175.1 protein_id gnl|my_center|LOCUS_11780 11514 11888 gene locus_tag LOCUS_11790 11514 11888 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892846.1 protein_id gnl|my_center|LOCUS_11790 11881 12402 gene locus_tag LOCUS_11800 11881 12402 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214742.1 protein_id gnl|my_center|LOCUS_11800 12721 12404 gene locus_tag LOCUS_11810 12721 12404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227996.1 protein_id gnl|my_center|LOCUS_11810 13712 12735 gene locus_tag LOCUS_11820 13712 12735 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_11820 15782 13722 gene locus_tag LOCUS_11830 15782 13722 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973199.1 protein_id gnl|my_center|LOCUS_11830 16019 16240 gene locus_tag LOCUS_11840 16019 16240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 17740 16250 gene locus_tag LOCUS_11850 17740 16250 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948035.1 protein_id gnl|my_center|LOCUS_11850 18231 17965 gene locus_tag LOCUS_11860 18231 17965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 19958 18246 gene locus_tag LOCUS_11870 19958 18246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 20794 19997 gene locus_tag LOCUS_11880 20794 19997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 22045 20870 gene locus_tag LOCUS_11890 22045 20870 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229667.1 protein_id gnl|my_center|LOCUS_11890 23369 22053 gene locus_tag LOCUS_11900 23369 22053 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893059.1 protein_id gnl|my_center|LOCUS_11900 24638 23670 gene locus_tag LOCUS_11910 24638 23670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 25229 24726 gene locus_tag LOCUS_11920 25229 24726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 26145 25360 gene locus_tag LOCUS_11930 26145 25360 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230311.1 protein_id gnl|my_center|LOCUS_11930 27284 26151 gene locus_tag LOCUS_11940 27284 26151 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929894.1 protein_id gnl|my_center|LOCUS_11940 27393 28016 gene locus_tag LOCUS_11950 27393 28016 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338485.1 protein_id gnl|my_center|LOCUS_11950 28278 28027 gene locus_tag LOCUS_11960 28278 28027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 28163 29206 gene locus_tag LOCUS_11970 28163 29206 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079826.1 protein_id gnl|my_center|LOCUS_11970 30566 29175 gene locus_tag LOCUS_11980 30566 29175 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730270.1 protein_id gnl|my_center|LOCUS_11980 31777 30557 gene locus_tag LOCUS_11990 gene dacB 31777 30557 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972790.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence020 351 1190 gene locus_tag LOCUS_12000 351 1190 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975359.1 protein_id gnl|my_center|LOCUS_12000 1187 2317 gene locus_tag LOCUS_12010 1187 2317 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013443.1 protein_id gnl|my_center|LOCUS_12010 2380 3279 gene locus_tag LOCUS_12020 gene ppk2 2380 3279 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013972.1 protein_id gnl|my_center|LOCUS_12020 4165 3290 gene locus_tag LOCUS_12030 4165 3290 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388189.1 protein_id gnl|my_center|LOCUS_12030 4459 4169 gene locus_tag LOCUS_12040 4459 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 5263 4469 gene locus_tag LOCUS_12050 5263 4469 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229662.1 protein_id gnl|my_center|LOCUS_12050 5327 6346 gene locus_tag LOCUS_12060 gene ligD 5327 6346 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_12060 7789 6353 gene locus_tag LOCUS_12070 7789 6353 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_12070 8610 7930 gene locus_tag LOCUS_12080 8610 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 8859 9125 gene locus_tag LOCUS_12090 8859 9125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 9502 9122 gene locus_tag LOCUS_12100 9502 9122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 9566 10054 gene locus_tag LOCUS_12110 9566 10054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 10143 10068 gene locus_tag LOCUS_t00180 10143 10068 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10229 10158 gene locus_tag LOCUS_t00190 10229 10158 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 10327 10254 gene locus_tag LOCUS_t00200 10327 10254 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10413 11480 gene locus_tag LOCUS_12120 10413 11480 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027841.1 protein_id gnl|my_center|LOCUS_12120 11477 12310 gene locus_tag LOCUS_12130 11477 12310 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_12130 12351 12857 gene locus_tag LOCUS_12140 12351 12857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 12908 12980 gene locus_tag LOCUS_t00210 12908 12980 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13141 13007 gene locus_tag LOCUS_12150 13141 13007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 13944 13216 gene locus_tag LOCUS_12160 13944 13216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 13999 16017 gene locus_tag LOCUS_12170 gene thrS 13999 16017 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977296.1 protein_id gnl|my_center|LOCUS_12170 16014 16562 gene locus_tag LOCUS_12180 16014 16562 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027833.1 protein_id gnl|my_center|LOCUS_12180 16564 17001 gene locus_tag LOCUS_12190 16564 17001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 19152 17008 gene locus_tag LOCUS_12200 19152 17008 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027831.1 protein_id gnl|my_center|LOCUS_12200 19420 19169 gene locus_tag LOCUS_12210 19420 19169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 19302 19961 gene locus_tag LOCUS_12220 19302 19961 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 protein_id gnl|my_center|LOCUS_12220 19958 20869 gene locus_tag LOCUS_12230 19958 20869 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_12230 20926 22038 gene locus_tag LOCUS_12240 20926 22038 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_12240 22035 22586 gene locus_tag LOCUS_12250 22035 22586 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027827.1 protein_id gnl|my_center|LOCUS_12250 22640 23674 gene locus_tag LOCUS_12260 22640 23674 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031120.1 protein_id gnl|my_center|LOCUS_12260 23761 24660 gene locus_tag LOCUS_12270 gene pdxS 23761 24660 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_12270 24657 25265 gene locus_tag LOCUS_12280 gene pdxT 24657 25265 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 protein_id gnl|my_center|LOCUS_12280 25262 26017 gene locus_tag LOCUS_12290 25262 26017 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413464.1 protein_id gnl|my_center|LOCUS_12290 26031 27512 gene locus_tag LOCUS_12300 26031 27512 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296672.1 protein_id gnl|my_center|LOCUS_12300 27573 28076 gene locus_tag LOCUS_12310 gene ruvC 27573 28076 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977307.1 protein_id gnl|my_center|LOCUS_12310 28076 28666 gene locus_tag LOCUS_12320 gene ruvA 28076 28666 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_12320 28663 29796 gene locus_tag LOCUS_12330 gene ruvB 28663 29796 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_12330 29887 30201 gene locus_tag LOCUS_12340 gene yajC 29887 30201 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence021 <1 1207 gene locus_tag LOCUS_12350 <1 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_040688119.1:primary-amine oxidase 3110 1218 gene locus_tag LOCUS_12360 3110 1218 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 protein_id gnl|my_center|LOCUS_12360 3398 3177 gene locus_tag LOCUS_12370 3398 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 3470 4324 gene locus_tag LOCUS_12380 3470 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 4986 4306 gene locus_tag LOCUS_12390 4986 4306 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064102.1 protein_id gnl|my_center|LOCUS_12390 5751 5035 gene locus_tag LOCUS_12400 5751 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 5883 8078 gene locus_tag LOCUS_12410 5883 8078 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225368.1 protein_id gnl|my_center|LOCUS_12410 8215 10038 gene locus_tag LOCUS_12420 8215 10038 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_12420 11042 10053 gene locus_tag LOCUS_12430 gene argF 11042 10053 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030578.1 protein_id gnl|my_center|LOCUS_12430 11434 11066 gene locus_tag LOCUS_12440 11434 11066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 11551 12171 gene locus_tag LOCUS_12450 11551 12171 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_12450 14123 12168 gene locus_tag LOCUS_12460 14123 12168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 14236 14514 gene locus_tag LOCUS_12470 14236 14514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 14565 15878 gene locus_tag LOCUS_12480 14565 15878 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054423.1 protein_id gnl|my_center|LOCUS_12480 15924 16856 gene locus_tag LOCUS_12490 15924 16856 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116998.1 protein_id gnl|my_center|LOCUS_12490 16853 17737 gene locus_tag LOCUS_12500 16853 17737 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053659.1 protein_id gnl|my_center|LOCUS_12500 17734 18468 gene locus_tag LOCUS_12510 17734 18468 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_12510 18540 19130 gene locus_tag LOCUS_12520 18540 19130 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066367.1 protein_id gnl|my_center|LOCUS_12520 19136 19774 gene locus_tag LOCUS_12530 19136 19774 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975875.1 protein_id gnl|my_center|LOCUS_12530 19887 21743 gene locus_tag LOCUS_12540 19887 21743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 21768 22058 gene locus_tag LOCUS_12550 gene clpS 21768 22058 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180153.1 protein_id gnl|my_center|LOCUS_12550 22060 22605 gene locus_tag LOCUS_12560 22060 22605 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975896.1 protein_id gnl|my_center|LOCUS_12560 23493 22660 gene locus_tag LOCUS_12570 23493 22660 CDS product bacteriorhodopsin-like inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_12570 23604 24086 gene locus_tag LOCUS_12580 23604 24086 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028660.1 protein_id gnl|my_center|LOCUS_12580 24119 24391 gene locus_tag LOCUS_12590 24119 24391 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975899.1 protein_id gnl|my_center|LOCUS_12590 24402 25349 gene locus_tag LOCUS_12600 24402 25349 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229459.1 protein_id gnl|my_center|LOCUS_12600 25361 26176 gene locus_tag LOCUS_12610 gene murI 25361 26176 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467674.1 protein_id gnl|my_center|LOCUS_12610 26431 26201 gene locus_tag LOCUS_12620 26431 26201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 26366 27394 gene locus_tag LOCUS_12630 26366 27394 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742121.1 protein_id gnl|my_center|LOCUS_12630 27613 28530 gene locus_tag LOCUS_12640 27613 28530 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222448.1 protein_id gnl|my_center|LOCUS_12640 28534 29292 gene locus_tag LOCUS_12650 28534 29292 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224573.1 protein_id gnl|my_center|LOCUS_12650 29329 30051 gene locus_tag LOCUS_12660 gene rph 29329 30051 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 protein_id gnl|my_center|LOCUS_12660 30048 30647 gene locus_tag LOCUS_12670 gene rdgB 30048 30647 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_12670 30686 31102 gene locus_tag LOCUS_12680 30686 31102 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977025.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence022 <1 543 gene locus_tag LOCUS_12690 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027519.1:apolipoprotein N-acyltransferase 554 1300 gene locus_tag LOCUS_12700 554 1300 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_12700 1303 1758 gene locus_tag LOCUS_12710 1303 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 2090 1746 gene locus_tag LOCUS_12720 2090 1746 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805194.1 protein_id gnl|my_center|LOCUS_12720 2926 2135 gene locus_tag LOCUS_12730 2926 2135 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_12730 3012 4436 gene locus_tag LOCUS_12740 3012 4436 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727104.1 protein_id gnl|my_center|LOCUS_12740 4495 5040 gene locus_tag LOCUS_12750 4495 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977943.1 protein_id gnl|my_center|LOCUS_12750 6600 5026 gene locus_tag LOCUS_12760 6600 5026 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085748.1 protein_id gnl|my_center|LOCUS_12760 9467 6621 gene locus_tag LOCUS_12770 gene gcvP 9467 6621 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_12770 10375 9770 gene locus_tag LOCUS_12780 10375 9770 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805153.1 protein_id gnl|my_center|LOCUS_12780 10927 10457 gene locus_tag LOCUS_12790 10927 10457 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_12790 11583 10951 gene locus_tag LOCUS_12800 11583 10951 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066949941.1 protein_id gnl|my_center|LOCUS_12800 12065 11580 gene locus_tag LOCUS_12810 12065 11580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 12442 12065 gene locus_tag LOCUS_12820 gene gcvH 12442 12065 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223709.1 protein_id gnl|my_center|LOCUS_12820 15020 12513 gene locus_tag LOCUS_12830 15020 12513 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027759.1 protein_id gnl|my_center|LOCUS_12830 15583 15023 gene locus_tag LOCUS_12840 15583 15023 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877775.1 protein_id gnl|my_center|LOCUS_12840 16350 15607 gene locus_tag LOCUS_12850 16350 15607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 17555 16347 gene locus_tag LOCUS_12860 17555 16347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 18174 17584 gene locus_tag LOCUS_12870 18174 17584 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229706.1 protein_id gnl|my_center|LOCUS_12870 18872 18171 gene locus_tag LOCUS_12880 18872 18171 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067135926.1 protein_id gnl|my_center|LOCUS_12880 20500 18977 gene locus_tag LOCUS_12890 20500 18977 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484182.1 protein_id gnl|my_center|LOCUS_12890 21264 20476 gene locus_tag LOCUS_12900 21264 20476 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_12900 21335 22540 gene locus_tag LOCUS_12910 gene serB 21335 22540 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 protein_id gnl|my_center|LOCUS_12910 23078 22542 gene locus_tag LOCUS_12920 23078 22542 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013395.1 protein_id gnl|my_center|LOCUS_12920 23811 23044 gene locus_tag LOCUS_12930 gene fabI 23811 23044 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977009.1 protein_id gnl|my_center|LOCUS_12930 24527 23823 gene locus_tag LOCUS_12940 gene fabG 24527 23823 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_12940 24605 25273 gene locus_tag LOCUS_12950 24605 25273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 25270 26757 gene locus_tag LOCUS_12960 25270 26757 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110223.1 protein_id gnl|my_center|LOCUS_12960 26754 28163 gene locus_tag LOCUS_12970 26754 28163 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027992.1 protein_id gnl|my_center|LOCUS_12970 28168 28539 gene locus_tag LOCUS_12980 28168 28539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 28553 29305 gene locus_tag LOCUS_12990 28553 29305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223073.1 protein_id gnl|my_center|LOCUS_12990 29290 30036 gene locus_tag LOCUS_13000 29290 30036 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976991.1 protein_id gnl|my_center|LOCUS_13000 31512 30286 gene locus_tag LOCUS_13010 31512 30286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence023 <1 1254 gene locus_tag LOCUS_13020 <1 1254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028167.1:cytochrome bc complex cytochrome b subunit 1538 1338 gene locus_tag LOCUS_13030 1538 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1608 2171 gene locus_tag LOCUS_13040 1608 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 2624 2229 gene locus_tag LOCUS_13050 2624 2229 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976661.1 protein_id gnl|my_center|LOCUS_13050 4357 2621 gene locus_tag LOCUS_13060 gene ctaD 4357 2621 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_13060 5139 4354 gene locus_tag LOCUS_13070 gene coxB 5139 4354 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805014.1 protein_id gnl|my_center|LOCUS_13070 5243 6391 gene locus_tag LOCUS_13080 5243 6391 CDS product cysteine desulfurase/sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028169.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13080 6393 6611 gene locus_tag LOCUS_13090 6393 6611 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391974.1 protein_id gnl|my_center|LOCUS_13090 7349 6666 gene locus_tag LOCUS_13100 gene aat 7349 6666 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072572.1 protein_id gnl|my_center|LOCUS_13100 8339 7353 gene locus_tag LOCUS_13110 8339 7353 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 protein_id gnl|my_center|LOCUS_13110 8984 8361 gene locus_tag LOCUS_13120 8984 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 9515 9168 gene locus_tag LOCUS_13130 9515 9168 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_13130 9645 10820 gene locus_tag LOCUS_13140 gene nadA 9645 10820 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 protein_id gnl|my_center|LOCUS_13140 11389 10817 gene locus_tag LOCUS_13150 11389 10817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028194.1 protein_id gnl|my_center|LOCUS_13150 12300 11389 gene locus_tag LOCUS_13160 gene htpX 12300 11389 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976613.1 protein_id gnl|my_center|LOCUS_13160 13106 12369 gene locus_tag LOCUS_13170 13106 12369 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739112.1 protein_id gnl|my_center|LOCUS_13170 13196 13786 gene locus_tag LOCUS_13180 13196 13786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 13998 13783 gene locus_tag LOCUS_13190 13998 13783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976644.1 protein_id gnl|my_center|LOCUS_13190 14305 14970 gene locus_tag LOCUS_13200 14305 14970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 14967 16070 gene locus_tag LOCUS_13210 14967 16070 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028280.1 protein_id gnl|my_center|LOCUS_13210 16067 17686 gene locus_tag LOCUS_13220 16067 17686 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230735.1 protein_id gnl|my_center|LOCUS_13220 17683 18519 gene locus_tag LOCUS_13230 17683 18519 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028282.1 protein_id gnl|my_center|LOCUS_13230 18519 19916 gene locus_tag LOCUS_13240 18519 19916 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869456.1 protein_id gnl|my_center|LOCUS_13240 19913 21019 gene locus_tag LOCUS_13250 gene cobT 19913 21019 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729694.1 protein_id gnl|my_center|LOCUS_13250 21016 21816 gene locus_tag LOCUS_13260 21016 21816 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228811.1 protein_id gnl|my_center|LOCUS_13260 21813 22892 gene locus_tag LOCUS_13270 gene gcvT 21813 22892 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085318.1 protein_id gnl|my_center|LOCUS_13270 22935 24428 gene locus_tag LOCUS_13280 22935 24428 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 protein_id gnl|my_center|LOCUS_13280 24501 25871 gene locus_tag LOCUS_13290 gene lpdA 24501 25871 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224051.1 protein_id gnl|my_center|LOCUS_13290 25895 27559 gene locus_tag LOCUS_13300 gene sucB 25895 27559 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224050.1 protein_id gnl|my_center|LOCUS_13300 27559 28455 gene locus_tag LOCUS_13310 27559 28455 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_13310 29281 28397 gene locus_tag LOCUS_13320 29281 28397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 >Feature sequence024 1616 324 gene locus_tag LOCUS_13330 1616 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1982 3073 gene locus_tag LOCUS_13340 gene purD 1982 3073 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_13340 3165 4583 gene locus_tag LOCUS_13350 gene purB 3165 4583 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_13350 4654 6621 gene locus_tag LOCUS_13360 4654 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 6700 7584 gene locus_tag LOCUS_13370 6700 7584 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974901.1 protein_id gnl|my_center|LOCUS_13370 7581 8546 gene locus_tag LOCUS_13380 gene galE 7581 8546 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975823.1 protein_id gnl|my_center|LOCUS_13380 8591 9463 gene locus_tag LOCUS_13390 8591 9463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 9960 9460 gene locus_tag LOCUS_13400 9960 9460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 9970 10386 gene locus_tag LOCUS_13410 9970 10386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 13158 10387 gene locus_tag LOCUS_13420 13158 10387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 13286 14524 gene locus_tag LOCUS_13430 13286 14524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 14589 14834 gene locus_tag LOCUS_13440 gene purS 14589 14834 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974895.1 protein_id gnl|my_center|LOCUS_13440 14831 15508 gene locus_tag LOCUS_13450 gene purQ 14831 15508 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974894.1 protein_id gnl|my_center|LOCUS_13450 15505 17808 gene locus_tag LOCUS_13460 gene purL 15505 17808 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974893.1 protein_id gnl|my_center|LOCUS_13460 18020 17805 gene locus_tag LOCUS_13470 18020 17805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 18141 19493 gene locus_tag LOCUS_13480 18141 19493 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198286.1 protein_id gnl|my_center|LOCUS_13480 19490 20329 gene locus_tag LOCUS_13490 19490 20329 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388317.1 protein_id gnl|my_center|LOCUS_13490 20316 20675 gene locus_tag LOCUS_13500 20316 20675 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284386.1 protein_id gnl|my_center|LOCUS_13500 21997 20657 gene locus_tag LOCUS_13510 21997 20657 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226840.1 protein_id gnl|my_center|LOCUS_13510 22136 23161 gene locus_tag LOCUS_13520 22136 23161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286312.1 protein_id gnl|my_center|LOCUS_13520 23220 24404 gene locus_tag LOCUS_13530 23220 24404 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223107.1 protein_id gnl|my_center|LOCUS_13530 24444 25319 gene locus_tag LOCUS_13540 24444 25319 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223108.1 protein_id gnl|my_center|LOCUS_13540 25316 26122 gene locus_tag LOCUS_13550 25316 26122 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223109.1 protein_id gnl|my_center|LOCUS_13550 28139 26115 gene locus_tag LOCUS_13560 28139 26115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 28621 28139 gene locus_tag LOCUS_13570 28621 28139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 29298 28636 gene locus_tag LOCUS_13580 29298 28636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence025 384 548 gene locus_tag LOCUS_13590 384 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 989 1621 gene locus_tag LOCUS_13600 989 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1686 1862 gene locus_tag LOCUS_13610 1686 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1870 2388 gene locus_tag LOCUS_13620 gene rimM 1870 2388 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973400.1 protein_id gnl|my_center|LOCUS_13620 2484 3083 gene locus_tag LOCUS_13630 2484 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 3088 4491 gene locus_tag LOCUS_13640 3088 4491 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528010.1 protein_id gnl|my_center|LOCUS_13640 4720 5085 gene locus_tag LOCUS_13650 gene rplS 4720 5085 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973398.1 protein_id gnl|my_center|LOCUS_13650 5195 5899 gene locus_tag LOCUS_13660 5195 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13660 5902 6663 gene locus_tag LOCUS_13670 5902 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 6660 7331 gene locus_tag LOCUS_13680 6660 7331 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030471.1 protein_id gnl|my_center|LOCUS_13680 7478 7834 gene locus_tag LOCUS_13690 7478 7834 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872622.1 protein_id gnl|my_center|LOCUS_13690 7834 9348 gene locus_tag LOCUS_13700 7834 9348 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111670.1 protein_id gnl|my_center|LOCUS_13700 9345 10496 gene locus_tag LOCUS_13710 gene dprA 9345 10496 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487183.1 protein_id gnl|my_center|LOCUS_13710 10493 11428 gene locus_tag LOCUS_13720 10493 11428 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223859.1 protein_id gnl|my_center|LOCUS_13720 12009 11425 gene locus_tag LOCUS_13730 12009 11425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 12155 12985 gene locus_tag LOCUS_13740 gene rpsB 12155 12985 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899528.1 protein_id gnl|my_center|LOCUS_13740 13070 13894 gene locus_tag LOCUS_13750 gene tsf 13070 13894 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081606.1 protein_id gnl|my_center|LOCUS_13750 13954 14796 gene locus_tag LOCUS_13760 gene pyrH 13954 14796 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973384.1 protein_id gnl|my_center|LOCUS_13760 14793 15359 gene locus_tag LOCUS_13770 gene frr 14793 15359 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_13770 15362 16237 gene locus_tag LOCUS_13780 15362 16237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13780 16241 17353 gene locus_tag LOCUS_13790 gene rlmN 16241 17353 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973380.1 protein_id gnl|my_center|LOCUS_13790 17424 17948 gene locus_tag LOCUS_13800 17424 17948 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030831.1 protein_id gnl|my_center|LOCUS_13800 17966 19852 gene locus_tag LOCUS_13810 17966 19852 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229993.1 protein_id gnl|my_center|LOCUS_13810 19849 20946 gene locus_tag LOCUS_13820 19849 20946 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898087.1 protein_id gnl|my_center|LOCUS_13820 22118 20943 gene locus_tag LOCUS_13830 22118 20943 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731461.1 protein_id gnl|my_center|LOCUS_13830 22219 24258 gene locus_tag LOCUS_13840 22219 24258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 25629 24262 gene locus_tag LOCUS_13850 25629 24262 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 protein_id gnl|my_center|LOCUS_13850 26297 25626 gene locus_tag LOCUS_13860 26297 25626 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201153.1 protein_id gnl|my_center|LOCUS_13860 27697 26294 gene locus_tag LOCUS_13870 27697 26294 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093964.1 protein_id gnl|my_center|LOCUS_13870 27825 29267 gene locus_tag LOCUS_13880 27825 29267 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence026 <1 1383 gene locus_tag LOCUS_13890 <1 1383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_144591055.1:S53 family peptidase 3216 1390 gene locus_tag LOCUS_13900 3216 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 3412 3744 gene locus_tag LOCUS_13910 3412 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 3754 4056 gene locus_tag LOCUS_13920 3754 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 4988 4134 gene locus_tag LOCUS_13930 4988 4134 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891968.1 protein_id gnl|my_center|LOCUS_13930 5106 6212 gene locus_tag LOCUS_13940 5106 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 6492 6271 gene locus_tag LOCUS_13950 6492 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 6419 6778 gene locus_tag LOCUS_13960 6419 6778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 8894 6780 gene locus_tag LOCUS_13970 8894 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 9649 8900 gene locus_tag LOCUS_13980 9649 8900 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230125.1 protein_id gnl|my_center|LOCUS_13980 11232 9676 gene locus_tag LOCUS_13990 11232 9676 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975395.1 protein_id gnl|my_center|LOCUS_13990 11267 11575 gene locus_tag LOCUS_14000 11267 11575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 11589 12590 gene locus_tag LOCUS_14010 gene glpQ 11589 12590 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706146.1 protein_id gnl|my_center|LOCUS_14010 12638 12877 gene locus_tag LOCUS_14020 12638 12877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 14467 12884 gene locus_tag LOCUS_14030 14467 12884 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_14030 15669 14464 gene locus_tag LOCUS_14040 15669 14464 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529879.1 protein_id gnl|my_center|LOCUS_14040 15786 16412 gene locus_tag LOCUS_14050 15786 16412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 16476 17501 gene locus_tag LOCUS_14060 16476 17501 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887570.1 protein_id gnl|my_center|LOCUS_14060 17498 18133 gene locus_tag LOCUS_14070 17498 18133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 18433 18149 gene locus_tag LOCUS_14080 18433 18149 CDS product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974664.1 protein_id gnl|my_center|LOCUS_14080 19282 18443 gene locus_tag LOCUS_14090 19282 18443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 19289 20245 gene locus_tag LOCUS_14100 19289 20245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 20279 20509 gene locus_tag LOCUS_14110 20279 20509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 21081 20506 gene locus_tag LOCUS_14120 21081 20506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 21767 21096 gene locus_tag LOCUS_14130 21767 21096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 22303 21776 gene locus_tag LOCUS_14140 22303 21776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 22554 23813 gene locus_tag LOCUS_14150 22554 23813 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817124.1 protein_id gnl|my_center|LOCUS_14150 24152 24394 gene locus_tag LOCUS_14160 24152 24394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 24980 24351 gene locus_tag LOCUS_14170 24980 24351 CDS product DM13 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978724.1 protein_id gnl|my_center|LOCUS_14170 25279 25204 gene locus_tag LOCUS_t00220 25279 25204 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 26522 25335 gene locus_tag LOCUS_14180 gene efeB 26522 25335 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229935.1 protein_id gnl|my_center|LOCUS_14180 26992 26916 gene locus_tag LOCUS_t00230 26992 26916 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 27084 27011 gene locus_tag LOCUS_t00240 27084 27011 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence027 <1 523 gene locus_tag LOCUS_14190 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228445.1:zinc-binding dehydrogenase 529 1278 gene locus_tag LOCUS_14200 529 1278 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222589.1 protein_id gnl|my_center|LOCUS_14200 1857 1282 gene locus_tag LOCUS_14210 1857 1282 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973834.1 protein_id gnl|my_center|LOCUS_14210 3120 1861 gene locus_tag LOCUS_14220 3120 1861 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222038.1 protein_id gnl|my_center|LOCUS_14220 4508 3117 gene locus_tag LOCUS_14230 4508 3117 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027550.1 protein_id gnl|my_center|LOCUS_14230 5240 4590 gene locus_tag LOCUS_14240 5240 4590 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142086.1 protein_id gnl|my_center|LOCUS_14240 6415 5285 gene locus_tag LOCUS_14250 6415 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 9352 6503 gene locus_tag LOCUS_14260 9352 6503 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_14260 10903 9362 gene locus_tag LOCUS_14270 gene nrfD 10903 9362 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_14270 11140 10910 gene locus_tag LOCUS_14280 11140 10910 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391974.1 protein_id gnl|my_center|LOCUS_14280 11673 11173 gene locus_tag LOCUS_14290 11673 11173 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437747.1 protein_id gnl|my_center|LOCUS_14290 11852 12982 gene locus_tag LOCUS_14300 11852 12982 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101329.1 protein_id gnl|my_center|LOCUS_14300 13037 13951 gene locus_tag LOCUS_14310 13037 13951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 13971 14330 gene locus_tag LOCUS_14320 13971 14330 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785422.1 protein_id gnl|my_center|LOCUS_14320 14983 14327 gene locus_tag LOCUS_14330 14983 14327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 16542 14980 gene locus_tag LOCUS_14340 16542 14980 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229775.1 protein_id gnl|my_center|LOCUS_14340 17603 16539 gene locus_tag LOCUS_14350 17603 16539 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487181.1 protein_id gnl|my_center|LOCUS_14350 17760 18455 gene locus_tag LOCUS_14360 17760 18455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 22261 18452 gene locus_tag LOCUS_14370 gene hrpA 22261 18452 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 protein_id gnl|my_center|LOCUS_14370 22492 22286 gene locus_tag LOCUS_14380 22492 22286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 22599 23420 gene locus_tag LOCUS_14390 22599 23420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 23453 24925 gene locus_tag LOCUS_14400 23453 24925 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_14400 24947 26071 gene locus_tag LOCUS_14410 24947 26071 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027320.1 protein_id gnl|my_center|LOCUS_14410 26068 26898 gene locus_tag LOCUS_14420 26068 26898 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034360134.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence028 492 1316 gene locus_tag LOCUS_14430 492 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1375 1704 gene locus_tag LOCUS_14440 1375 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1778 2692 gene locus_tag LOCUS_14450 1778 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 2849 3643 gene locus_tag LOCUS_14460 2849 3643 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532951.1 protein_id gnl|my_center|LOCUS_14460 3640 4536 gene locus_tag LOCUS_14470 3640 4536 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532950.1 protein_id gnl|my_center|LOCUS_14470 4591 4830 gene locus_tag LOCUS_14480 4591 4830 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389965.1 protein_id gnl|my_center|LOCUS_14480 4827 5240 gene locus_tag LOCUS_14490 4827 5240 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141677.1 protein_id gnl|my_center|LOCUS_14490 6913 5237 gene locus_tag LOCUS_14500 6913 5237 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258936.1 protein_id gnl|my_center|LOCUS_14500 7402 7022 gene locus_tag LOCUS_14510 gene vapc11 7402 7022 CDS product type II toxin-antitoxin system toxin ribonuclease VapC11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407786.1 protein_id gnl|my_center|LOCUS_14510 7608 7399 gene locus_tag LOCUS_14520 7608 7399 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407785.1 protein_id gnl|my_center|LOCUS_14520 7917 7618 gene locus_tag LOCUS_14530 7917 7618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 9568 8180 gene locus_tag LOCUS_14540 9568 8180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 10708 9635 gene locus_tag LOCUS_14550 gene msiK 10708 9635 CDS product diacetylchitobiose ABC transporter ATP-binding protein MsiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029527.1 protein_id gnl|my_center|LOCUS_14550 11814 10708 gene locus_tag LOCUS_14560 11814 10708 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111830427.1 protein_id gnl|my_center|LOCUS_14560 12647 11826 gene locus_tag LOCUS_14570 12647 11826 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726998.1 protein_id gnl|my_center|LOCUS_14570 13573 12644 gene locus_tag LOCUS_14580 13573 12644 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803743.1 protein_id gnl|my_center|LOCUS_14580 14955 13579 gene locus_tag LOCUS_14590 14955 13579 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803742.1 protein_id gnl|my_center|LOCUS_14590 15857 15015 gene locus_tag LOCUS_14600 gene nagB 15857 15015 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804961.1 protein_id gnl|my_center|LOCUS_14600 16750 15854 gene locus_tag LOCUS_14610 16750 15854 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729986.1 protein_id gnl|my_center|LOCUS_14610 17883 16747 gene locus_tag LOCUS_14620 17883 16747 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530504.1 protein_id gnl|my_center|LOCUS_14620 17981 18721 gene locus_tag LOCUS_14630 17981 18721 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213089169.1 protein_id gnl|my_center|LOCUS_14630 18738 19583 gene locus_tag LOCUS_14640 18738 19583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 19576 20445 gene locus_tag LOCUS_14650 19576 20445 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_14650 20462 20800 gene locus_tag LOCUS_14660 20462 20800 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234816983.1 protein_id gnl|my_center|LOCUS_14660 21582 20797 gene locus_tag LOCUS_14670 21582 20797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 21624 24281 gene locus_tag LOCUS_14680 21624 24281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 24284 25270 gene locus_tag LOCUS_14690 24284 25270 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence029 1069 2361 gene locus_tag LOCUS_14700 1069 2361 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727103.1 protein_id gnl|my_center|LOCUS_14700 2363 3259 gene locus_tag LOCUS_14710 2363 3259 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727102.1 protein_id gnl|my_center|LOCUS_14710 3256 4179 gene locus_tag LOCUS_14720 3256 4179 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727101.1 protein_id gnl|my_center|LOCUS_14720 4192 6639 gene locus_tag LOCUS_14730 4192 6639 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969822.1 protein_id gnl|my_center|LOCUS_14730 6670 7152 gene locus_tag LOCUS_14740 6670 7152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 7666 7154 gene locus_tag LOCUS_14750 7666 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 8844 7663 gene locus_tag LOCUS_14760 8844 7663 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225315.1 protein_id gnl|my_center|LOCUS_14760 8843 9730 gene locus_tag LOCUS_14770 8843 9730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225316.1 protein_id gnl|my_center|LOCUS_14770 9727 10851 gene locus_tag LOCUS_14780 gene menC 9727 10851 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225317.1 protein_id gnl|my_center|LOCUS_14780 10861 11463 gene locus_tag LOCUS_14790 10861 11463 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029580.1 protein_id gnl|my_center|LOCUS_14790 11635 12018 gene locus_tag LOCUS_14800 11635 12018 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812533.1 protein_id gnl|my_center|LOCUS_14800 12028 12591 gene locus_tag LOCUS_14810 12028 12591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 12591 13334 gene locus_tag LOCUS_14820 12591 13334 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974645.1 protein_id gnl|my_center|LOCUS_14820 13573 13331 gene locus_tag LOCUS_14830 13573 13331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 14952 13753 gene locus_tag LOCUS_14840 14952 13753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 16079 14949 gene locus_tag LOCUS_14850 gene serC 16079 14949 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230187.1 protein_id gnl|my_center|LOCUS_14850 17257 16100 gene locus_tag LOCUS_14860 17257 16100 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029624.1 protein_id gnl|my_center|LOCUS_14860 17322 17990 gene locus_tag LOCUS_14870 gene pdxH 17322 17990 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029623.1 protein_id gnl|my_center|LOCUS_14870 17992 19245 gene locus_tag LOCUS_14880 17992 19245 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742199.1 protein_id gnl|my_center|LOCUS_14880 19347 19955 gene locus_tag LOCUS_14890 19347 19955 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 protein_id gnl|my_center|LOCUS_14890 19955 20962 gene locus_tag LOCUS_14900 19955 20962 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226128.1 protein_id gnl|my_center|LOCUS_14900 20964 21305 gene locus_tag LOCUS_14910 20964 21305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 21590 21249 gene locus_tag LOCUS_14920 21590 21249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 22415 21603 gene locus_tag LOCUS_14930 22415 21603 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228058.1 protein_id gnl|my_center|LOCUS_14930 23810 22455 gene locus_tag LOCUS_14940 23810 22455 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230152.1 protein_id gnl|my_center|LOCUS_14940 23836 24558 gene locus_tag LOCUS_14950 23836 24558 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029385.1 protein_id gnl|my_center|LOCUS_14950 24611 25417 gene locus_tag LOCUS_14960 24611 25417 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895546.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence030 1137 2162 gene locus_tag LOCUS_14970 1137 2162 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_14970 2155 3516 gene locus_tag LOCUS_14980 2155 3516 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976701.1 protein_id gnl|my_center|LOCUS_14980 3586 3915 gene locus_tag LOCUS_14990 3586 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 3912 4421 gene locus_tag LOCUS_15000 3912 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 6376 4424 gene locus_tag LOCUS_15010 gene pknB 6376 4424 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486214.1 protein_id gnl|my_center|LOCUS_15010 6469 6930 gene locus_tag LOCUS_15020 6469 6930 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225733.1 protein_id gnl|my_center|LOCUS_15020 6938 7273 gene locus_tag LOCUS_15030 6938 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 7270 7728 gene locus_tag LOCUS_15040 7270 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 8568 7645 gene locus_tag LOCUS_15050 8568 7645 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224196.1 protein_id gnl|my_center|LOCUS_15050 10118 8565 gene locus_tag LOCUS_15060 gene mptB 10118 8565 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224695.1 protein_id gnl|my_center|LOCUS_15060 11679 10165 gene locus_tag LOCUS_15070 gene crtI 11679 10165 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728283.1 protein_id gnl|my_center|LOCUS_15070 12743 11679 gene locus_tag LOCUS_15080 12743 11679 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_15080 14195 12759 gene locus_tag LOCUS_15090 gene crtI 14195 12759 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225928.1 protein_id gnl|my_center|LOCUS_15090 15124 14243 gene locus_tag LOCUS_15100 15124 14243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 16257 15121 gene locus_tag LOCUS_15110 16257 15121 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225927.1 protein_id gnl|my_center|LOCUS_15110 17048 16254 gene locus_tag LOCUS_15120 17048 16254 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225926.1 protein_id gnl|my_center|LOCUS_15120 17842 17045 gene locus_tag LOCUS_15130 17842 17045 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484721.1 protein_id gnl|my_center|LOCUS_15130 17899 18843 gene locus_tag LOCUS_15140 17899 18843 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804404.1 protein_id gnl|my_center|LOCUS_15140 18928 19554 gene locus_tag LOCUS_15150 18928 19554 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_15150 20753 19557 gene locus_tag LOCUS_15160 20753 19557 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005118518.1 protein_id gnl|my_center|LOCUS_15160 20808 21500 gene locus_tag LOCUS_15170 20808 21500 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069213.1 protein_id gnl|my_center|LOCUS_15170 21493 21795 gene locus_tag LOCUS_15180 21493 21795 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908374.1 protein_id gnl|my_center|LOCUS_15180 21891 22328 gene locus_tag LOCUS_15190 21891 22328 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583226.1 protein_id gnl|my_center|LOCUS_15190 23428 22325 gene locus_tag LOCUS_15200 23428 22325 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030441.1 protein_id gnl|my_center|LOCUS_15200 23328 23924 gene locus_tag LOCUS_15210 23328 23924 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031562.1 protein_id gnl|my_center|LOCUS_15210 23921 24298 gene locus_tag LOCUS_15220 23921 24298 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223357.1 protein_id gnl|my_center|LOCUS_15220 24310 24735 gene locus_tag LOCUS_15230 24310 24735 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222676.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence031 1545 2336 gene locus_tag LOCUS_15240 1545 2336 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921388.1 protein_id gnl|my_center|LOCUS_15240 3010 2342 gene locus_tag LOCUS_15250 3010 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 4767 3070 gene locus_tag LOCUS_15260 gene ilvD 4767 3070 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900824.1 protein_id gnl|my_center|LOCUS_15260 5652 4777 gene locus_tag LOCUS_15270 5652 4777 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030286.1 protein_id gnl|my_center|LOCUS_15270 7164 5656 gene locus_tag LOCUS_15280 gene gatB 7164 5656 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030281.1 protein_id gnl|my_center|LOCUS_15280 8666 7161 gene locus_tag LOCUS_15290 gene gatA 8666 7161 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973499.1 protein_id gnl|my_center|LOCUS_15290 8965 8669 gene locus_tag LOCUS_15300 gene gatC 8965 8669 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223569.1 protein_id gnl|my_center|LOCUS_15300 9275 9646 gene locus_tag LOCUS_15310 9275 9646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 11878 9707 gene locus_tag LOCUS_15320 gene ligA 11878 9707 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415263.1 protein_id gnl|my_center|LOCUS_15320 12909 11875 gene locus_tag LOCUS_15330 12909 11875 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030277.1 protein_id gnl|my_center|LOCUS_15330 13988 12906 gene locus_tag LOCUS_15340 gene mnmA 13988 12906 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_15340 15159 13990 gene locus_tag LOCUS_15350 15159 13990 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223557.1 protein_id gnl|my_center|LOCUS_15350 16141 15185 gene locus_tag LOCUS_15360 16141 15185 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_15360 16934 16155 gene locus_tag LOCUS_15370 16934 16155 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_15370 17072 17854 gene locus_tag LOCUS_15380 17072 17854 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893717.1 protein_id gnl|my_center|LOCUS_15380 17851 19377 gene locus_tag LOCUS_15390 17851 19377 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223546.1 protein_id gnl|my_center|LOCUS_15390 19374 20639 gene locus_tag LOCUS_15400 19374 20639 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223543.1 protein_id gnl|my_center|LOCUS_15400 21354 20614 gene locus_tag LOCUS_15410 21354 20614 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223530.1 protein_id gnl|my_center|LOCUS_15410 22271 21351 gene locus_tag LOCUS_15420 22271 21351 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727373.1 protein_id gnl|my_center|LOCUS_15420 23050 22268 gene locus_tag LOCUS_15430 23050 22268 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence032 98 277 gene locus_tag LOCUS_15440 98 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 621 547 gene locus_tag LOCUS_t00250 621 547 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2188 701 gene locus_tag LOCUS_15450 gene der 2188 701 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_15450 2862 2185 gene locus_tag LOCUS_15460 2862 2185 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977065.1 protein_id gnl|my_center|LOCUS_15460 3548 2862 gene locus_tag LOCUS_15470 gene cmk 3548 2862 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027958.1 protein_id gnl|my_center|LOCUS_15470 4635 3565 gene locus_tag LOCUS_15480 4635 3565 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027959.1 protein_id gnl|my_center|LOCUS_15480 4994 4632 gene locus_tag LOCUS_15490 gene aroH 4994 4632 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_15490 5760 5014 gene locus_tag LOCUS_15500 5760 5014 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908299.1 protein_id gnl|my_center|LOCUS_15500 6377 5760 gene locus_tag LOCUS_15510 gene scpB 6377 5760 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_15510 7266 6370 gene locus_tag LOCUS_15520 7266 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15520 8120 7263 gene locus_tag LOCUS_15530 8120 7263 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977053.1 protein_id gnl|my_center|LOCUS_15530 9078 8206 gene locus_tag LOCUS_15540 gene xerD 9078 8206 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 protein_id gnl|my_center|LOCUS_15540 10244 9129 gene locus_tag LOCUS_15550 gene ald 10244 9129 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_15550 10946 10299 gene locus_tag LOCUS_15560 10946 10299 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_15560 12616 10946 gene locus_tag LOCUS_15570 12616 10946 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027968.1 protein_id gnl|my_center|LOCUS_15570 14424 12631 gene locus_tag LOCUS_15580 gene recN 14424 12631 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_15580 15317 14406 gene locus_tag LOCUS_15590 15317 14406 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_15590 16108 15314 gene locus_tag LOCUS_15600 16108 15314 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027974.1 protein_id gnl|my_center|LOCUS_15600 16389 16105 gene locus_tag LOCUS_15610 16389 16105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 16823 16386 gene locus_tag LOCUS_15620 16823 16386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 17664 16852 gene locus_tag LOCUS_15630 17664 16852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 18694 17738 gene locus_tag LOCUS_15640 18694 17738 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027978.1 protein_id gnl|my_center|LOCUS_15640 19188 18745 gene locus_tag LOCUS_15650 19188 18745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 19547 19203 gene locus_tag LOCUS_15660 19547 19203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 19658 20620 gene locus_tag LOCUS_15670 19658 20620 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257011.1 protein_id gnl|my_center|LOCUS_15670 21599 20610 gene locus_tag LOCUS_15680 21599 20610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 21122 21035 gene locus_tag LOCUS_t00260 21122 21035 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 23251 21599 gene locus_tag LOCUS_15690 23251 21599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence033 905 102 gene locus_tag LOCUS_15700 905 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 3831 1159 gene locus_tag LOCUS_15710 3831 1159 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_15710 3962 4681 gene locus_tag LOCUS_15720 3962 4681 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029915.1 protein_id gnl|my_center|LOCUS_15720 4706 5779 gene locus_tag LOCUS_15730 4706 5779 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975953.1 protein_id gnl|my_center|LOCUS_15730 6489 5776 gene locus_tag LOCUS_15740 6489 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 7924 6536 gene locus_tag LOCUS_15750 gene xylB 7924 6536 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222654.1 protein_id gnl|my_center|LOCUS_15750 8781 7921 gene locus_tag LOCUS_15760 8781 7921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 8896 12255 gene locus_tag LOCUS_15770 8896 12255 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466704.1 protein_id gnl|my_center|LOCUS_15770 13686 12259 gene locus_tag LOCUS_15780 13686 12259 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408473.1 protein_id gnl|my_center|LOCUS_15780 14835 13759 gene locus_tag LOCUS_15790 14835 13759 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312247.1 protein_id gnl|my_center|LOCUS_15790 15146 14886 gene locus_tag LOCUS_15800 15146 14886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 15036 16346 gene locus_tag LOCUS_15810 15036 16346 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226072.1 protein_id gnl|my_center|LOCUS_15810 16358 17263 gene locus_tag LOCUS_15820 16358 17263 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908749.1 protein_id gnl|my_center|LOCUS_15820 17263 19002 gene locus_tag LOCUS_15830 17263 19002 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_15830 19626 19141 gene locus_tag LOCUS_15840 19626 19141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 19749 20975 gene locus_tag LOCUS_15850 19749 20975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 21052 20980 gene locus_tag LOCUS_t00270 21052 20980 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 21668 21243 gene locus_tag LOCUS_15860 21668 21243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 22584 22087 gene locus_tag LOCUS_15870 22584 22087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 22646 23098 gene locus_tag LOCUS_15880 22646 23098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence034 2284 2697 gene locus_tag LOCUS_15890 2284 2697 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227928.1 protein_id gnl|my_center|LOCUS_15890 2837 4135 gene locus_tag LOCUS_15900 2837 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 4137 5162 gene locus_tag LOCUS_15910 4137 5162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 5152 6036 gene locus_tag LOCUS_15920 5152 6036 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_15920 6033 6890 gene locus_tag LOCUS_15930 6033 6890 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_15930 7345 6896 gene locus_tag LOCUS_15940 7345 6896 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028365.1 protein_id gnl|my_center|LOCUS_15940 7369 7821 gene locus_tag LOCUS_15950 7369 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 9274 7922 gene locus_tag LOCUS_15960 9274 7922 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537683.1 protein_id gnl|my_center|LOCUS_15960 10047 9433 gene locus_tag LOCUS_15970 10047 9433 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057960.1 protein_id gnl|my_center|LOCUS_15970 10085 10160 gene locus_tag LOCUS_t00280 10085 10160 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10906 10169 gene locus_tag LOCUS_15980 10906 10169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 11384 10959 gene locus_tag LOCUS_15990 gene nusB 11384 10959 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977336.1 protein_id gnl|my_center|LOCUS_15990 11947 11387 gene locus_tag LOCUS_16000 gene efp 11947 11387 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224610.1 protein_id gnl|my_center|LOCUS_16000 13054 11960 gene locus_tag LOCUS_16010 13054 11960 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224609.1 protein_id gnl|my_center|LOCUS_16010 13488 13051 gene locus_tag LOCUS_16020 gene aroQ 13488 13051 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224605.1 protein_id gnl|my_center|LOCUS_16020 14579 13485 gene locus_tag LOCUS_16030 gene aroB 14579 13485 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027813.1 protein_id gnl|my_center|LOCUS_16030 15103 14576 gene locus_tag LOCUS_16040 15103 14576 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027814.1 protein_id gnl|my_center|LOCUS_16040 16278 15100 gene locus_tag LOCUS_16050 gene aroC 16278 15100 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_16050 17016 16348 gene locus_tag LOCUS_16060 17016 16348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 17825 17013 gene locus_tag LOCUS_16070 17825 17013 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_16070 18960 17848 gene locus_tag LOCUS_16080 18960 17848 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413196.1 protein_id gnl|my_center|LOCUS_16080 19397 18957 gene locus_tag LOCUS_16090 gene ruvX 19397 18957 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 protein_id gnl|my_center|LOCUS_16090 <21872 19440 gene locus_tag LOCUS_16100 <21872 19440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977325.1:alanine--tRNA ligase >Feature sequence035 <1 588 gene locus_tag LOCUS_16110 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003971803.1:glycogen debranching protein GlgX 3197 585 gene locus_tag LOCUS_16120 3197 585 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486976.1 protein_id gnl|my_center|LOCUS_16120 3335 5368 gene locus_tag LOCUS_16130 3335 5368 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031595.1 protein_id gnl|my_center|LOCUS_16130 5365 7584 gene locus_tag LOCUS_16140 gene glgB 5365 7584 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_16140 8479 7586 gene locus_tag LOCUS_16150 8479 7586 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973580.1 protein_id gnl|my_center|LOCUS_16150 9435 8476 gene locus_tag LOCUS_16160 gene meaB 9435 8476 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_16160 10613 9432 gene locus_tag LOCUS_16170 10613 9432 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030221.1 protein_id gnl|my_center|LOCUS_16170 10680 11126 gene locus_tag LOCUS_16180 gene mce 10680 11126 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223476.1 protein_id gnl|my_center|LOCUS_16180 11183 12520 gene locus_tag LOCUS_16190 gene ccrA 11183 12520 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283587.1 protein_id gnl|my_center|LOCUS_16190 12610 14526 gene locus_tag LOCUS_16200 gene oatA 12610 14526 CDS product peptidoglycan O-acetyltransferase OatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932001.1 protein_id gnl|my_center|LOCUS_16200 15284 14523 gene locus_tag LOCUS_16210 15284 14523 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970992.1 protein_id gnl|my_center|LOCUS_16210 16045 15281 gene locus_tag LOCUS_16220 16045 15281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 17967 16318 gene locus_tag LOCUS_16230 17967 16318 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229492.1 protein_id gnl|my_center|LOCUS_16230 18146 19621 gene locus_tag LOCUS_16240 18146 19621 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_16240 20302 19628 gene locus_tag LOCUS_16250 gene nucS 20302 19628 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007387684.1 protein_id gnl|my_center|LOCUS_16250 <21383 20313 gene locus_tag LOCUS_16260 <21383 20313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030947.1:protein meaA >Feature sequence036 3147 2479 gene locus_tag LOCUS_16270 3147 2479 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229311.1 protein_id gnl|my_center|LOCUS_16270 3911 3198 gene locus_tag LOCUS_16280 3911 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 4612 4010 gene locus_tag LOCUS_16290 4612 4010 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975915.1 protein_id gnl|my_center|LOCUS_16290 6431 4590 gene locus_tag LOCUS_16300 6431 4590 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460092.1 protein_id gnl|my_center|LOCUS_16300 7312 6428 gene locus_tag LOCUS_16310 7312 6428 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719921.1 protein_id gnl|my_center|LOCUS_16310 8269 7322 gene locus_tag LOCUS_16320 8269 7322 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530674.1 protein_id gnl|my_center|LOCUS_16320 8715 8266 gene locus_tag LOCUS_16330 8715 8266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 9374 8718 gene locus_tag LOCUS_16340 9374 8718 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531175.1 protein_id gnl|my_center|LOCUS_16340 10150 9371 gene locus_tag LOCUS_16350 10150 9371 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775990.1 protein_id gnl|my_center|LOCUS_16350 10247 11686 gene locus_tag LOCUS_16360 10247 11686 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975913.1 protein_id gnl|my_center|LOCUS_16360 11711 12208 gene locus_tag LOCUS_16370 11711 12208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 12257 13933 gene locus_tag LOCUS_16380 gene betA 12257 13933 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229316.1 protein_id gnl|my_center|LOCUS_16380 13926 15419 gene locus_tag LOCUS_16390 13926 15419 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224487.1 protein_id gnl|my_center|LOCUS_16390 15421 16482 gene locus_tag LOCUS_16400 15421 16482 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029893.1 protein_id gnl|my_center|LOCUS_16400 16486 18441 gene locus_tag LOCUS_16410 16486 18441 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029894.1 protein_id gnl|my_center|LOCUS_16410 18537 19562 gene locus_tag LOCUS_16420 18537 19562 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029895.1 protein_id gnl|my_center|LOCUS_16420 19660 20736 gene locus_tag LOCUS_16430 19660 20736 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028729.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence037 344 1915 gene locus_tag LOCUS_16440 gene guaA 344 1915 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893015.1 protein_id gnl|my_center|LOCUS_16440 2348 1995 gene locus_tag LOCUS_16450 2348 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327076.1 protein_id gnl|my_center|LOCUS_16450 3098 2370 gene locus_tag LOCUS_16460 3098 2370 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141632568.1 protein_id gnl|my_center|LOCUS_16460 3200 5191 gene locus_tag LOCUS_16470 3200 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 5192 5869 gene locus_tag LOCUS_16480 5192 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 5908 8115 gene locus_tag LOCUS_16490 gene pcrA 5908 8115 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_16490 8875 8117 gene locus_tag LOCUS_16500 8875 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 9817 8975 gene locus_tag LOCUS_16510 9817 8975 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029872.1 protein_id gnl|my_center|LOCUS_16510 9924 10331 gene locus_tag LOCUS_16520 9924 10331 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_16520 10401 11582 gene locus_tag LOCUS_16530 gene sucC 10401 11582 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222715.1 protein_id gnl|my_center|LOCUS_16530 11579 12448 gene locus_tag LOCUS_16540 gene sucD 11579 12448 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974163.1 protein_id gnl|my_center|LOCUS_16540 12649 13776 gene locus_tag LOCUS_16550 12649 13776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 13853 14350 gene locus_tag LOCUS_16560 13853 14350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 14390 14986 gene locus_tag LOCUS_16570 gene purN 14390 14986 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776406.1 protein_id gnl|my_center|LOCUS_16570 14983 16557 gene locus_tag LOCUS_16580 gene purH 14983 16557 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029883.1 protein_id gnl|my_center|LOCUS_16580 16632 17573 gene locus_tag LOCUS_16590 16632 17573 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114440.1 protein_id gnl|my_center|LOCUS_16590 17583 18425 gene locus_tag LOCUS_16600 17583 18425 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974148.1 protein_id gnl|my_center|LOCUS_16600 18422 18733 gene locus_tag LOCUS_16610 18422 18733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 18901 19890 gene locus_tag LOCUS_16620 18901 19890 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence038 1449 679 gene locus_tag LOCUS_16630 1449 679 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028380.1 protein_id gnl|my_center|LOCUS_16630 2162 1446 gene locus_tag LOCUS_16640 2162 1446 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887985.1 protein_id gnl|my_center|LOCUS_16640 3938 2166 gene locus_tag LOCUS_16650 3938 2166 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223963.1 protein_id gnl|my_center|LOCUS_16650 4814 3987 gene locus_tag LOCUS_16660 4814 3987 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873433.1 protein_id gnl|my_center|LOCUS_16660 6014 4815 gene locus_tag LOCUS_16670 gene ispG 6014 4815 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031167.1 protein_id gnl|my_center|LOCUS_16670 7343 6024 gene locus_tag LOCUS_16680 7343 6024 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804643.1 protein_id gnl|my_center|LOCUS_16680 8452 7343 gene locus_tag LOCUS_16690 gene dxr 8452 7343 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728448.1 protein_id gnl|my_center|LOCUS_16690 8433 9821 gene locus_tag LOCUS_16700 gene gabT 8433 9821 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973349.1 protein_id gnl|my_center|LOCUS_16700 11039 9825 gene locus_tag LOCUS_16710 11039 9825 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731196.1 protein_id gnl|my_center|LOCUS_16710 12061 11036 gene locus_tag LOCUS_16720 gene speB 12061 11036 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894987.1 protein_id gnl|my_center|LOCUS_16720 13503 12091 gene locus_tag LOCUS_16730 13503 12091 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_16730 14312 13509 gene locus_tag LOCUS_16740 14312 13509 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973355.1 protein_id gnl|my_center|LOCUS_16740 15208 14312 gene locus_tag LOCUS_16750 15208 14312 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030376.1 protein_id gnl|my_center|LOCUS_16750 16316 15210 gene locus_tag LOCUS_16760 16316 15210 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973357.1 protein_id gnl|my_center|LOCUS_16760 17598 16366 gene locus_tag LOCUS_16770 17598 16366 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973358.1 protein_id gnl|my_center|LOCUS_16770 19120 17621 gene locus_tag LOCUS_16780 19120 17621 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030374.1 protein_id gnl|my_center|LOCUS_16780 19305 20141 gene locus_tag LOCUS_16790 19305 20141 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972565.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence039 410 898 gene locus_tag LOCUS_16800 410 898 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259066.1 protein_id gnl|my_center|LOCUS_16800 997 1896 gene locus_tag LOCUS_16810 997 1896 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729296.1 protein_id gnl|my_center|LOCUS_16810 2166 1900 gene locus_tag LOCUS_16820 2166 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 2694 2209 gene locus_tag LOCUS_16830 2694 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 3302 2691 gene locus_tag LOCUS_16840 gene pgsA 3302 2691 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228068.1 protein_id gnl|my_center|LOCUS_16840 4654 3299 gene locus_tag LOCUS_16850 gene rimO 4654 3299 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228069.1 protein_id gnl|my_center|LOCUS_16850 7213 4658 gene locus_tag LOCUS_16860 7213 4658 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113701643.1 protein_id gnl|my_center|LOCUS_16860 8962 7277 gene locus_tag LOCUS_16870 8962 7277 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_16870 9864 8959 gene locus_tag LOCUS_16880 gene dapA 9864 8959 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_16880 10622 9897 gene locus_tag LOCUS_16890 gene thyX 10622 9897 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030430.1 protein_id gnl|my_center|LOCUS_16890 10603 11253 gene locus_tag LOCUS_16900 10603 11253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 12853 11222 gene locus_tag LOCUS_16910 12853 11222 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296700.1 protein_id gnl|my_center|LOCUS_16910 13000 14463 gene locus_tag LOCUS_16920 13000 14463 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230146.1 protein_id gnl|my_center|LOCUS_16920 14460 15176 gene locus_tag LOCUS_16930 14460 15176 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804665.1 protein_id gnl|my_center|LOCUS_16930 15173 15484 gene locus_tag LOCUS_16940 15173 15484 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804664.1 protein_id gnl|my_center|LOCUS_16940 15481 16029 gene locus_tag LOCUS_16950 15481 16029 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030429.1 protein_id gnl|my_center|LOCUS_16950 16471 16031 gene locus_tag LOCUS_16960 16471 16031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973287.1 protein_id gnl|my_center|LOCUS_16960 17253 16468 gene locus_tag LOCUS_16970 gene dapB 17253 16468 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728512.1 protein_id gnl|my_center|LOCUS_16970 17283 18815 gene locus_tag LOCUS_16980 17283 18815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 20099 18843 gene locus_tag LOCUS_16990 20099 18843 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence040 <1 657 gene locus_tag LOCUS_17000 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775799.1:sulfite exporter TauE/SafE family protein 1319 654 gene locus_tag LOCUS_17010 gene rsmG 1319 654 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029291.1 protein_id gnl|my_center|LOCUS_17010 1841 1323 gene locus_tag LOCUS_17020 1841 1323 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029290.1 protein_id gnl|my_center|LOCUS_17020 2845 1838 gene locus_tag LOCUS_17030 2845 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 3559 2894 gene locus_tag LOCUS_17040 3559 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 3809 3672 gene locus_tag LOCUS_17050 gene rpmH 3809 3672 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975051.1 protein_id gnl|my_center|LOCUS_17050 4134 5567 gene locus_tag LOCUS_17060 4134 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 5972 7096 gene locus_tag LOCUS_17070 gene dnaN 5972 7096 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_17070 7102 8238 gene locus_tag LOCUS_17080 gene recF 7102 8238 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_17080 8231 8740 gene locus_tag LOCUS_17090 8231 8740 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975057.1 protein_id gnl|my_center|LOCUS_17090 8948 10903 gene locus_tag LOCUS_17100 gene gyrB 8948 10903 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116174448.1 protein_id gnl|my_center|LOCUS_17100 10922 13465 gene locus_tag LOCUS_17110 gene gyrA 10922 13465 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326690.1 protein_id gnl|my_center|LOCUS_17110 13499 14065 gene locus_tag LOCUS_17120 13499 14065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 14090 16150 gene locus_tag LOCUS_17130 14090 16150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 16191 16266 gene locus_tag LOCUS_t00290 16191 16266 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 16267 16392 gene locus_tag LOCUS_17140 16267 16392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 16410 17783 gene locus_tag LOCUS_17150 16410 17783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 17774 17847 gene locus_tag LOCUS_t00300 17774 17847 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 19045 17837 gene locus_tag LOCUS_17160 19045 17837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17160 >Feature sequence041 1357 458 gene locus_tag LOCUS_17170 1357 458 CDS product bifunctional succinyldiaminopimelate transaminase/glutamate-prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_17170 1932 1537 gene locus_tag LOCUS_17180 1932 1537 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015524.1 protein_id gnl|my_center|LOCUS_17180 1957 2772 gene locus_tag LOCUS_17190 1957 2772 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030075.1 protein_id gnl|my_center|LOCUS_17190 4617 2776 gene locus_tag LOCUS_17200 4617 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 5101 4718 gene locus_tag LOCUS_17210 5101 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 5982 5098 gene locus_tag LOCUS_17220 gene mshB 5982 5098 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089212260.1 protein_id gnl|my_center|LOCUS_17220 6014 8125 gene locus_tag LOCUS_17230 6014 8125 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030068.1 protein_id gnl|my_center|LOCUS_17230 9270 8122 gene locus_tag LOCUS_17240 9270 8122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 10277 9267 gene locus_tag LOCUS_17250 10277 9267 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973519.1 protein_id gnl|my_center|LOCUS_17250 11263 10274 gene locus_tag LOCUS_17260 11263 10274 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 protein_id gnl|my_center|LOCUS_17260 13061 11349 gene locus_tag LOCUS_17270 13061 11349 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994617.1 protein_id gnl|my_center|LOCUS_17270 14136 13165 gene locus_tag LOCUS_17280 14136 13165 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_17280 16134 14260 gene locus_tag LOCUS_17290 gene typA 16134 14260 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_17290 16527 16144 gene locus_tag LOCUS_17300 16527 16144 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973876.1 protein_id gnl|my_center|LOCUS_17300 16910 16524 gene locus_tag LOCUS_17310 16910 16524 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888350.1 protein_id gnl|my_center|LOCUS_17310 16935 17558 gene locus_tag LOCUS_17320 16935 17558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730838.1 protein_id gnl|my_center|LOCUS_17320 18011 17544 gene locus_tag LOCUS_17330 18011 17544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 19093 18020 gene locus_tag LOCUS_17340 gene ychF 19093 18020 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973917.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence042 <1 2242 gene locus_tag LOCUS_17350 <1 2242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193486200.1:DUF3488 and transglutaminase-like domain-containing protein 2660 2187 gene locus_tag LOCUS_17360 2660 2187 CDS product spore wall synthesis complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028137.1 protein_id gnl|my_center|LOCUS_17360 3172 3023 gene locus_tag LOCUS_17370 3172 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 3368 4045 gene locus_tag LOCUS_17380 3368 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 5294 4056 gene locus_tag LOCUS_17390 gene dinB 5294 4056 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_17390 8837 5337 gene locus_tag LOCUS_17400 gene dnaE 8837 5337 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027948.1 protein_id gnl|my_center|LOCUS_17400 9297 8905 gene locus_tag LOCUS_17410 9297 8905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 9537 9316 gene locus_tag LOCUS_17420 9537 9316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 10505 9612 gene locus_tag LOCUS_17430 10505 9612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 11296 10574 gene locus_tag LOCUS_17440 11296 10574 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897336.1 protein_id gnl|my_center|LOCUS_17440 11328 12107 gene locus_tag LOCUS_17450 11328 12107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 12547 12104 gene locus_tag LOCUS_17460 12547 12104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 12685 13506 gene locus_tag LOCUS_17470 12685 13506 CDS product DUF4397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026918.1 protein_id gnl|my_center|LOCUS_17470 13539 14273 gene locus_tag LOCUS_17480 13539 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 14270 14908 gene locus_tag LOCUS_17490 14270 14908 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026917.1 protein_id gnl|my_center|LOCUS_17490 14895 15563 gene locus_tag LOCUS_17500 14895 15563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 15624 17063 gene locus_tag LOCUS_17510 15624 17063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 17090 18391 gene locus_tag LOCUS_17520 17090 18391 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876838.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence043 <1 534 gene locus_tag LOCUS_17530 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030306.1:3-isopropylmalate dehydratase small subunit 699 1118 gene locus_tag LOCUS_17540 699 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 1372 1178 gene locus_tag LOCUS_17550 1372 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 1971 1369 gene locus_tag LOCUS_17560 gene cofC 1971 1369 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973437.1 protein_id gnl|my_center|LOCUS_17560 2073 2759 gene locus_tag LOCUS_17570 2073 2759 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_17570 2756 3763 gene locus_tag LOCUS_17580 2756 3763 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_17580 4869 3760 gene locus_tag LOCUS_17590 4869 3760 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015376.1 protein_id gnl|my_center|LOCUS_17590 4939 6033 gene locus_tag LOCUS_17600 4939 6033 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728314.1 protein_id gnl|my_center|LOCUS_17600 6498 6037 gene locus_tag LOCUS_17610 6498 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 6571 7545 gene locus_tag LOCUS_17620 6571 7545 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 protein_id gnl|my_center|LOCUS_17620 7730 7542 gene locus_tag LOCUS_17630 gene rpmB 7730 7542 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_17630 7896 9545 gene locus_tag LOCUS_17640 7896 9545 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030309.1 protein_id gnl|my_center|LOCUS_17640 9551 11758 gene locus_tag LOCUS_17650 gene recG 9551 11758 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223647.1 protein_id gnl|my_center|LOCUS_17650 11760 12332 gene locus_tag LOCUS_17660 gene rsmD 11760 12332 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030310.1 protein_id gnl|my_center|LOCUS_17660 12348 12836 gene locus_tag LOCUS_17670 gene coaD 12348 12836 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_17670 12860 13345 gene locus_tag LOCUS_17680 12860 13345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 13422 14012 gene locus_tag LOCUS_17690 13422 14012 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_17690 14014 14187 gene locus_tag LOCUS_17700 gene rpmF 14014 14187 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006139588.1 protein_id gnl|my_center|LOCUS_17700 14191 14439 gene locus_tag LOCUS_17710 14191 14439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 14436 15128 gene locus_tag LOCUS_17720 14436 15128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 15121 15990 gene locus_tag LOCUS_17730 gene mutM 15121 15990 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973422.1 protein_id gnl|my_center|LOCUS_17730 16040 16222 gene locus_tag LOCUS_17740 16040 16222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 16433 16212 gene locus_tag LOCUS_17750 16433 16212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 >Feature sequence044 1823 135 gene locus_tag LOCUS_17760 1823 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 3121 1850 gene locus_tag LOCUS_17770 3121 1850 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_17770 3245 3934 gene locus_tag LOCUS_17780 3245 3934 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_17780 4008 4367 gene locus_tag LOCUS_17790 4008 4367 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_17790 4371 4925 gene locus_tag LOCUS_17800 4371 4925 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416420.1 protein_id gnl|my_center|LOCUS_17800 4922 5665 gene locus_tag LOCUS_17810 4922 5665 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029733.1 protein_id gnl|my_center|LOCUS_17810 5665 7038 gene locus_tag LOCUS_17820 gene nuoD 5665 7038 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728123.1 protein_id gnl|my_center|LOCUS_17820 7035 7697 gene locus_tag LOCUS_17830 7035 7697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 7694 9004 gene locus_tag LOCUS_17840 gene nuoF 7694 9004 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893427.1 protein_id gnl|my_center|LOCUS_17840 9001 11424 gene locus_tag LOCUS_17850 9001 11424 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728121.1 protein_id gnl|my_center|LOCUS_17850 11421 12767 gene locus_tag LOCUS_17860 gene nuoH 11421 12767 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029736.1 protein_id gnl|my_center|LOCUS_17860 12760 13338 gene locus_tag LOCUS_17870 gene nuoI 12760 13338 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086544.1 protein_id gnl|my_center|LOCUS_17870 13335 14174 gene locus_tag LOCUS_17880 13335 14174 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416449.1 protein_id gnl|my_center|LOCUS_17880 14171 14470 gene locus_tag LOCUS_17890 gene nuoK 14171 14470 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061219.1 protein_id gnl|my_center|LOCUS_17890 14529 16466 gene locus_tag LOCUS_17900 gene nuoL 14529 16466 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110664.1 protein_id gnl|my_center|LOCUS_17900 16466 18010 gene locus_tag LOCUS_17910 16466 18010 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728119.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence045 1738 281 gene locus_tag LOCUS_17920 gene hpaE 1738 281 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528544.1 protein_id gnl|my_center|LOCUS_17920 2312 1851 gene locus_tag LOCUS_17930 2312 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 2386 2622 gene locus_tag LOCUS_17940 2386 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 2616 3020 gene locus_tag LOCUS_17950 2616 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 3030 3713 gene locus_tag LOCUS_17960 3030 3713 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731464.1 protein_id gnl|my_center|LOCUS_17960 4900 3710 gene locus_tag LOCUS_17970 gene lhgO 4900 3710 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546485.1 protein_id gnl|my_center|LOCUS_17970 5037 7241 gene locus_tag LOCUS_17980 5037 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 7258 12327 gene locus_tag LOCUS_17990 7258 12327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence046 <1 1426 gene locus_tag LOCUS_18000 <1 1426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030294.1:urease subunit alpha 1417 1488 gene locus_tag LOCUS_t00310 1417 1488 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1637 1509 gene locus_tag LOCUS_18010 1637 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 3364 1889 gene locus_tag LOCUS_18020 3364 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 5057 3507 gene locus_tag LOCUS_18030 5057 3507 CDS product 4-coumarate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728294.1 protein_id gnl|my_center|LOCUS_18030 6496 5081 gene locus_tag LOCUS_18040 6496 5081 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226839.1 protein_id gnl|my_center|LOCUS_18040 7572 6493 gene locus_tag LOCUS_18050 7572 6493 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223998.1 protein_id gnl|my_center|LOCUS_18050 8395 7697 gene locus_tag LOCUS_18060 8395 7697 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222689.1 protein_id gnl|my_center|LOCUS_18060 9003 8392 gene locus_tag LOCUS_18070 9003 8392 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742094.1 protein_id gnl|my_center|LOCUS_18070 9052 9444 gene locus_tag LOCUS_18080 9052 9444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 10353 9448 gene locus_tag LOCUS_18090 10353 9448 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083235.1 protein_id gnl|my_center|LOCUS_18090 10388 11161 gene locus_tag LOCUS_18100 10388 11161 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027118.1 protein_id gnl|my_center|LOCUS_18100 11158 12663 gene locus_tag LOCUS_18110 11158 12663 CDS product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266442.1 protein_id gnl|my_center|LOCUS_18110 12680 12753 gene locus_tag LOCUS_t00320 12680 12753 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 13606 12848 gene locus_tag LOCUS_18120 13606 12848 CDS product HAD family acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017204.1 protein_id gnl|my_center|LOCUS_18120 13717 14226 gene locus_tag LOCUS_18130 13717 14226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 15639 14227 gene locus_tag LOCUS_18140 15639 14227 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898735.1 protein_id gnl|my_center|LOCUS_18140 16009 15650 gene locus_tag LOCUS_18150 16009 15650 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975911.1 protein_id gnl|my_center|LOCUS_18150 16298 16020 gene locus_tag LOCUS_18160 16298 16020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 16392 17405 gene locus_tag LOCUS_18170 16392 17405 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228054.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence047 280 1242 gene locus_tag LOCUS_18180 280 1242 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977155.1 protein_id gnl|my_center|LOCUS_18180 1255 1443 gene locus_tag LOCUS_18190 1255 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 2771 1446 gene locus_tag LOCUS_18200 2771 1446 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_18200 2875 2959 gene locus_tag LOCUS_t00330 2875 2959 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4124 3069 gene locus_tag LOCUS_18210 4124 3069 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892758.1 protein_id gnl|my_center|LOCUS_18210 4203 5024 gene locus_tag LOCUS_18220 4203 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 5211 6683 gene locus_tag LOCUS_18230 5211 6683 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230209.1 protein_id gnl|my_center|LOCUS_18230 6707 7444 gene locus_tag LOCUS_18240 gene gluQRS 6707 7444 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115557.1 protein_id gnl|my_center|LOCUS_18240 7441 8268 gene locus_tag LOCUS_18250 7441 8268 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257237.1 protein_id gnl|my_center|LOCUS_18250 9021 8272 gene locus_tag LOCUS_18260 9021 8272 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_18260 9087 9389 gene locus_tag LOCUS_18270 9087 9389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 9391 9858 gene locus_tag LOCUS_18280 9391 9858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 11105 9855 gene locus_tag LOCUS_18290 11105 9855 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226215.1 protein_id gnl|my_center|LOCUS_18290 11812 11102 gene locus_tag LOCUS_18300 11812 11102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 11973 11821 gene locus_tag LOCUS_18310 11973 11821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 12068 13474 gene locus_tag LOCUS_18320 12068 13474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 13471 14439 gene locus_tag LOCUS_18330 13471 14439 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067692.1 protein_id gnl|my_center|LOCUS_18330 14436 15209 gene locus_tag LOCUS_18340 14436 15209 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893601.1 protein_id gnl|my_center|LOCUS_18340 15749 15213 gene locus_tag LOCUS_18350 15749 15213 CDS product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870383.1 protein_id gnl|my_center|LOCUS_18350 15844 16242 gene locus_tag LOCUS_18360 gene msrB 15844 16242 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972860.1 protein_id gnl|my_center|LOCUS_18360 16302 16865 gene locus_tag LOCUS_18370 16302 16865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 >Feature sequence048 161 289 gene locus_tag LOCUS_18380 161 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 540 370 gene locus_tag LOCUS_18390 540 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 944 546 gene locus_tag LOCUS_18400 944 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1411 974 gene locus_tag LOCUS_18410 1411 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 1758 1411 gene locus_tag LOCUS_18420 1758 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 1979 1785 gene locus_tag LOCUS_18430 1979 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 2913 2005 gene locus_tag LOCUS_18440 2913 2005 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776056.1 protein_id gnl|my_center|LOCUS_18440 3758 2910 gene locus_tag LOCUS_18450 3758 2910 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776057.1 protein_id gnl|my_center|LOCUS_18450 4990 3758 gene locus_tag LOCUS_18460 4990 3758 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776058.1 protein_id gnl|my_center|LOCUS_18460 6714 5188 gene locus_tag LOCUS_18470 6714 5188 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944194.1 protein_id gnl|my_center|LOCUS_18470 7697 6714 gene locus_tag LOCUS_18480 7697 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 8800 7685 gene locus_tag LOCUS_18490 8800 7685 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256434.1 protein_id gnl|my_center|LOCUS_18490 9955 8891 gene locus_tag LOCUS_18500 9955 8891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 10847 10146 gene locus_tag LOCUS_18510 10847 10146 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974911.1 protein_id gnl|my_center|LOCUS_18510 11298 10840 gene locus_tag LOCUS_18520 11298 10840 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227124.1 protein_id gnl|my_center|LOCUS_18520 12590 11295 gene locus_tag LOCUS_18530 12590 11295 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903671.1 protein_id gnl|my_center|LOCUS_18530 13336 12587 gene locus_tag LOCUS_18540 gene mtnP 13336 12587 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868192.1 protein_id gnl|my_center|LOCUS_18540 13734 13333 gene locus_tag LOCUS_18550 13734 13333 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877157.1 protein_id gnl|my_center|LOCUS_18550 14309 13731 gene locus_tag LOCUS_18560 14309 13731 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087656.1 protein_id gnl|my_center|LOCUS_18560 14932 14306 gene locus_tag LOCUS_18570 14932 14306 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405783.1 protein_id gnl|my_center|LOCUS_18570 14947 15663 gene locus_tag LOCUS_18580 gene mtnC 14947 15663 CDS product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267285.1 protein_id gnl|my_center|LOCUS_18580 15756 16841 gene locus_tag LOCUS_18590 15756 16841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence049 253 1092 gene locus_tag LOCUS_18600 253 1092 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456342.1 protein_id gnl|my_center|LOCUS_18600 1116 2399 gene locus_tag LOCUS_18610 1116 2399 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113973.1 protein_id gnl|my_center|LOCUS_18610 2404 3435 gene locus_tag LOCUS_18620 gene trpS 2404 3435 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222753.1 protein_id gnl|my_center|LOCUS_18620 3432 3941 gene locus_tag LOCUS_18630 3432 3941 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029900.1 protein_id gnl|my_center|LOCUS_18630 5164 3938 gene locus_tag LOCUS_18640 5164 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 5977 5228 gene locus_tag LOCUS_18650 5977 5228 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974116.1 protein_id gnl|my_center|LOCUS_18650 7731 5977 gene locus_tag LOCUS_18660 gene sdhA 7731 5977 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974115.1 protein_id gnl|my_center|LOCUS_18660 8156 7740 gene locus_tag LOCUS_18670 8156 7740 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222764.1 protein_id gnl|my_center|LOCUS_18670 8548 8153 gene locus_tag LOCUS_18680 gene sdhC 8548 8153 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222765.1 protein_id gnl|my_center|LOCUS_18680 8768 9580 gene locus_tag LOCUS_18690 8768 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_18690 9596 11509 gene locus_tag LOCUS_18700 9596 11509 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030061.1 protein_id gnl|my_center|LOCUS_18700 11512 12270 gene locus_tag LOCUS_18710 11512 12270 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726931.1 protein_id gnl|my_center|LOCUS_18710 12260 13855 gene locus_tag LOCUS_18720 12260 13855 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031217.1 protein_id gnl|my_center|LOCUS_18720 13858 14892 gene locus_tag LOCUS_18730 gene mtnA 13858 14892 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228779.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence050 306 782 gene locus_tag LOCUS_18740 306 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 839 1648 gene locus_tag LOCUS_18750 gene trpC 839 1648 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_18750 1641 2858 gene locus_tag LOCUS_18760 gene trpB 1641 2858 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284348.1 protein_id gnl|my_center|LOCUS_18760 2855 3658 gene locus_tag LOCUS_18770 gene trpA 2855 3658 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075867.1 protein_id gnl|my_center|LOCUS_18770 3710 4522 gene locus_tag LOCUS_18780 3710 4522 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715374.1 protein_id gnl|my_center|LOCUS_18780 4541 5506 gene locus_tag LOCUS_18790 gene lgt 4541 5506 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976782.1 protein_id gnl|my_center|LOCUS_18790 5609 10147 gene locus_tag LOCUS_18800 gene gltB 5609 10147 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 protein_id gnl|my_center|LOCUS_18800 10140 11591 gene locus_tag LOCUS_18810 10140 11591 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228800.1 protein_id gnl|my_center|LOCUS_18810 11617 13050 gene locus_tag LOCUS_18820 gene pyk 11617 13050 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028096.1 protein_id gnl|my_center|LOCUS_18820 13060 13896 gene locus_tag LOCUS_18830 13060 13896 CDS product ZIP family zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225190.1 protein_id gnl|my_center|LOCUS_18830 14005 14574 gene locus_tag LOCUS_18840 gene pyrR 14005 14574 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 protein_id gnl|my_center|LOCUS_18840 14574 15530 gene locus_tag LOCUS_18850 14574 15530 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence051 1321 245 gene locus_tag LOCUS_18860 1321 245 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112954.1 protein_id gnl|my_center|LOCUS_18860 2910 1444 gene locus_tag LOCUS_18870 gene speA 2910 1444 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084899.1 protein_id gnl|my_center|LOCUS_18870 3041 3991 gene locus_tag LOCUS_18880 3041 3991 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525194.1 protein_id gnl|my_center|LOCUS_18880 3998 4882 gene locus_tag LOCUS_18890 3998 4882 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970316.1 protein_id gnl|my_center|LOCUS_18890 4879 5634 gene locus_tag LOCUS_18900 4879 5634 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815569.1 protein_id gnl|my_center|LOCUS_18900 5709 8243 gene locus_tag LOCUS_18910 5709 8243 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_18910 8286 8933 gene locus_tag LOCUS_18920 8286 8933 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112337.1 protein_id gnl|my_center|LOCUS_18920 10006 8930 gene locus_tag LOCUS_18930 10006 8930 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726928.1 protein_id gnl|my_center|LOCUS_18930 10119 11501 gene locus_tag LOCUS_18940 10119 11501 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228182.1 protein_id gnl|my_center|LOCUS_18940 11501 12094 gene locus_tag LOCUS_18950 11501 12094 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228181.1 protein_id gnl|my_center|LOCUS_18950 13269 12091 gene locus_tag LOCUS_18960 13269 12091 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402920.1 protein_id gnl|my_center|LOCUS_18960 14363 13266 gene locus_tag LOCUS_18970 14363 13266 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336759.1 protein_id gnl|my_center|LOCUS_18970 15202 14360 gene locus_tag LOCUS_18980 gene alsD 15202 14360 CDS product alpha-acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215019.1 protein_id gnl|my_center|LOCUS_18980 15816 15229 gene locus_tag LOCUS_18990 15816 15229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 >Feature sequence052 512 273 gene locus_tag LOCUS_19000 512 273 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 protein_id gnl|my_center|LOCUS_19000 1564 548 gene locus_tag LOCUS_19010 1564 548 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977752.1 protein_id gnl|my_center|LOCUS_19010 1769 2944 gene locus_tag LOCUS_19020 1769 2944 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309888.1 protein_id gnl|my_center|LOCUS_19020 3053 4126 gene locus_tag LOCUS_19030 3053 4126 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531509.1 protein_id gnl|my_center|LOCUS_19030 4123 4929 gene locus_tag LOCUS_19040 4123 4929 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309890.1 protein_id gnl|my_center|LOCUS_19040 6097 5084 gene locus_tag LOCUS_19050 6097 5084 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031545.1 protein_id gnl|my_center|LOCUS_19050 6155 7294 gene locus_tag LOCUS_19060 6155 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 7338 8831 gene locus_tag LOCUS_19070 7338 8831 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973724.1 protein_id gnl|my_center|LOCUS_19070 8862 9155 gene locus_tag LOCUS_19080 8862 9155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 10121 9162 gene locus_tag LOCUS_19090 10121 9162 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208036286.1 protein_id gnl|my_center|LOCUS_19090 10214 11335 gene locus_tag LOCUS_19100 10214 11335 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031356.1 protein_id gnl|my_center|LOCUS_19100 11332 12318 gene locus_tag LOCUS_19110 gene iolG 11332 12318 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973498.1 protein_id gnl|my_center|LOCUS_19110 12468 13424 gene locus_tag LOCUS_19120 12468 13424 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_19120 15294 13453 gene locus_tag LOCUS_19130 gene iolD 15294 13453 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223774.1 protein_id gnl|my_center|LOCUS_19130 <15920 15297 gene locus_tag LOCUS_19140 <15920 15297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031359.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence053 1822 947 gene locus_tag LOCUS_19150 gene iolB 1822 947 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223775.1 protein_id gnl|my_center|LOCUS_19150 2753 1860 gene locus_tag LOCUS_19160 2753 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223776.1 protein_id gnl|my_center|LOCUS_19160 3741 2797 gene locus_tag LOCUS_19170 gene iolC 3741 2797 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223777.1 protein_id gnl|my_center|LOCUS_19170 4766 3798 gene locus_tag LOCUS_19180 4766 3798 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729986.1 protein_id gnl|my_center|LOCUS_19180 4864 5874 gene locus_tag LOCUS_19190 4864 5874 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972671.1 protein_id gnl|my_center|LOCUS_19190 6024 6953 gene locus_tag LOCUS_19200 6024 6953 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223782.1 protein_id gnl|my_center|LOCUS_19200 8468 7044 gene locus_tag LOCUS_19210 8468 7044 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729358.1 protein_id gnl|my_center|LOCUS_19210 8501 9283 gene locus_tag LOCUS_19220 8501 9283 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222170.1 protein_id gnl|my_center|LOCUS_19220 9447 10919 gene locus_tag LOCUS_19230 9447 10919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 10998 11603 gene locus_tag LOCUS_19240 10998 11603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 11856 13190 gene locus_tag LOCUS_19250 11856 13190 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285284.1 protein_id gnl|my_center|LOCUS_19250 13323 13646 gene locus_tag LOCUS_19260 13323 13646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466777.1 protein_id gnl|my_center|LOCUS_19260 15623 13725 gene locus_tag LOCUS_19270 15623 13725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence054 412 894 gene locus_tag LOCUS_19280 412 894 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969725.1 protein_id gnl|my_center|LOCUS_19280 936 2318 gene locus_tag LOCUS_19290 936 2318 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976298.1 protein_id gnl|my_center|LOCUS_19290 2447 3610 gene locus_tag LOCUS_19300 2447 3610 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328990.1 protein_id gnl|my_center|LOCUS_19300 3659 4510 gene locus_tag LOCUS_19310 3659 4510 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328991.1 protein_id gnl|my_center|LOCUS_19310 4495 5307 gene locus_tag LOCUS_19320 4495 5307 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897936.1 protein_id gnl|my_center|LOCUS_19320 5307 6335 gene locus_tag LOCUS_19330 5307 6335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897935.1 protein_id gnl|my_center|LOCUS_19330 6338 7804 gene locus_tag LOCUS_19340 6338 7804 CDS product TIGR03767 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230137.1 protein_id gnl|my_center|LOCUS_19340 7979 9457 gene locus_tag LOCUS_19350 7979 9457 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971945.1 protein_id gnl|my_center|LOCUS_19350 9454 10443 gene locus_tag LOCUS_19360 9454 10443 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529215.1 protein_id gnl|my_center|LOCUS_19360 10443 11249 gene locus_tag LOCUS_19370 10443 11249 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971943.1 protein_id gnl|my_center|LOCUS_19370 11246 12178 gene locus_tag LOCUS_19380 11246 12178 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314007.1 protein_id gnl|my_center|LOCUS_19380 12179 13138 gene locus_tag LOCUS_19390 12179 13138 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367784.1 protein_id gnl|my_center|LOCUS_19390 14770 13160 gene locus_tag LOCUS_19400 14770 13160 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777012.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence055 999 1742 gene locus_tag LOCUS_19410 999 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 6130 1739 gene locus_tag LOCUS_19420 6130 1739 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109508967.1 protein_id gnl|my_center|LOCUS_19420 6155 6379 gene locus_tag LOCUS_19430 6155 6379 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973258.1 protein_id gnl|my_center|LOCUS_19430 6392 7690 gene locus_tag LOCUS_19440 6392 7690 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234253.1 protein_id gnl|my_center|LOCUS_19440 8047 7661 gene locus_tag LOCUS_19450 gene vapc11 8047 7661 CDS product type II toxin-antitoxin system toxin ribonuclease VapC11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407786.1 protein_id gnl|my_center|LOCUS_19450 8249 8028 gene locus_tag LOCUS_19460 8249 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 8468 9556 gene locus_tag LOCUS_19470 gene recA 8468 9556 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224217.1 protein_id gnl|my_center|LOCUS_19470 9571 10095 gene locus_tag LOCUS_19480 gene recX 9571 10095 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894108.1 protein_id gnl|my_center|LOCUS_19480 10604 10056 gene locus_tag LOCUS_19490 10604 10056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 10652 12997 gene locus_tag LOCUS_19500 10652 12997 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_19500 13026 14456 gene locus_tag LOCUS_19510 gene miaB 13026 14456 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence056 1354 122 gene locus_tag LOCUS_19520 1354 122 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486197.1 protein_id gnl|my_center|LOCUS_19520 2346 1351 gene locus_tag LOCUS_19530 2346 1351 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_19530 2388 2924 gene locus_tag LOCUS_19540 gene ripB 2388 2924 CDS product (R)-specific enoyl-CoA hydratase RipB/Ich inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212069.1 protein_id gnl|my_center|LOCUS_19540 4183 2921 gene locus_tag LOCUS_19550 4183 2921 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230815.1 protein_id gnl|my_center|LOCUS_19550 4755 4276 gene locus_tag LOCUS_19560 4755 4276 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742062.1 protein_id gnl|my_center|LOCUS_19560 5062 4757 gene locus_tag LOCUS_19570 5062 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 5715 5101 gene locus_tag LOCUS_19580 5715 5101 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966671.1 protein_id gnl|my_center|LOCUS_19580 6801 5725 gene locus_tag LOCUS_19590 6801 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 6883 7719 gene locus_tag LOCUS_19600 6883 7719 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705953.1 protein_id gnl|my_center|LOCUS_19600 9074 7869 gene locus_tag LOCUS_19610 9074 7869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19610 9160 9354 gene locus_tag LOCUS_19620 9160 9354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 9381 9761 gene locus_tag LOCUS_19630 9381 9761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 10398 9742 gene locus_tag LOCUS_19640 10398 9742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 10960 10472 gene locus_tag LOCUS_19650 10960 10472 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983897.1 protein_id gnl|my_center|LOCUS_19650 11025 11456 gene locus_tag LOCUS_19660 11025 11456 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888560.1 protein_id gnl|my_center|LOCUS_19660 11463 11957 gene locus_tag LOCUS_19670 11463 11957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 11954 14107 gene locus_tag LOCUS_19680 11954 14107 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_19680 14624 14109 gene locus_tag LOCUS_19690 14624 14109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 >Feature sequence057 <1 1951 gene locus_tag LOCUS_19700 <1 1951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030402.1:translation initiation factor IF-2 1968 2273 gene locus_tag LOCUS_19710 1968 2273 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228120.1 protein_id gnl|my_center|LOCUS_19710 2273 2749 gene locus_tag LOCUS_19720 gene rbfA 2273 2749 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973318.1 protein_id gnl|my_center|LOCUS_19720 2758 3642 gene locus_tag LOCUS_19730 gene truB 2758 3642 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296636.1 protein_id gnl|my_center|LOCUS_19730 5868 3655 gene locus_tag LOCUS_19740 5868 3655 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930053.1 protein_id gnl|my_center|LOCUS_19740 7469 5865 gene locus_tag LOCUS_19750 7469 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 8551 7466 gene locus_tag LOCUS_19760 gene wecB 8551 7466 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_19760 8627 10294 gene locus_tag LOCUS_19770 8627 10294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 10350 11609 gene locus_tag LOCUS_19780 10350 11609 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974201.1 protein_id gnl|my_center|LOCUS_19780 11645 12493 gene locus_tag LOCUS_19790 11645 12493 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975816.1 protein_id gnl|my_center|LOCUS_19790 12480 13415 gene locus_tag LOCUS_19800 12480 13415 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972238.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence058 1238 45 gene locus_tag LOCUS_19810 1238 45 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029925.1 protein_id gnl|my_center|LOCUS_19810 2386 1235 gene locus_tag LOCUS_19820 2386 1235 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224327.1 protein_id gnl|my_center|LOCUS_19820 2369 3913 gene locus_tag LOCUS_19830 2369 3913 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_19830 5287 3917 gene locus_tag LOCUS_19840 5287 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 5629 5480 gene locus_tag LOCUS_19850 5629 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 5850 7232 gene locus_tag LOCUS_19860 5850 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 7229 8266 gene locus_tag LOCUS_19870 7229 8266 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188980.1 protein_id gnl|my_center|LOCUS_19870 8343 9002 gene locus_tag LOCUS_19880 8343 9002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 10380 8986 gene locus_tag LOCUS_19890 10380 8986 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223436.1 protein_id gnl|my_center|LOCUS_19890 10779 10429 gene locus_tag LOCUS_19900 10779 10429 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878637.1 protein_id gnl|my_center|LOCUS_19900 11881 10802 gene locus_tag LOCUS_19910 11881 10802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 13280 11910 gene locus_tag LOCUS_19920 13280 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 >Feature sequence059 6905 3447 gene locus_tag LOCUS_19930 gene rpoB 6905 3447 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 protein_id gnl|my_center|LOCUS_19930 7658 7266 gene locus_tag LOCUS_19940 gene rplL 7658 7266 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403353.1 protein_id gnl|my_center|LOCUS_19940 8467 7712 gene locus_tag LOCUS_19950 8467 7712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 9482 8772 gene locus_tag LOCUS_19960 gene rplA 9482 8772 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974314.1 protein_id gnl|my_center|LOCUS_19960 10012 9584 gene locus_tag LOCUS_19970 gene rplK 10012 9584 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892734.1 protein_id gnl|my_center|LOCUS_19970 10934 10029 gene locus_tag LOCUS_19980 10934 10029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 11178 10960 gene locus_tag LOCUS_19990 11178 10960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 11289 11216 gene locus_tag LOCUS_t00340 11289 11216 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 11442 12641 gene locus_tag LOCUS_20000 11442 12641 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_20000 <13706 12723 gene locus_tag LOCUS_20010 <13706 12723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222386.1:UDP-N-acetylmuramate dehydrogenase >Feature sequence060 <1 1305 gene locus_tag LOCUS_20020 <1 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974371.1:NADH-quinone oxidoreductase subunit NuoN 1316 2314 gene locus_tag LOCUS_20030 1316 2314 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_20030 3505 2318 gene locus_tag LOCUS_20040 3505 2318 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110594.1 protein_id gnl|my_center|LOCUS_20040 3792 4607 gene locus_tag LOCUS_20050 3792 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 5395 4604 gene locus_tag LOCUS_20060 5395 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 6588 5530 gene locus_tag LOCUS_20070 6588 5530 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_20070 8452 6596 gene locus_tag LOCUS_20080 8452 6596 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_20080 8572 8970 gene locus_tag LOCUS_20090 8572 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20090 8967 9458 gene locus_tag LOCUS_20100 8967 9458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 9455 9802 gene locus_tag LOCUS_20110 9455 9802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 10284 9793 gene locus_tag LOCUS_20120 10284 9793 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402987.1 protein_id gnl|my_center|LOCUS_20120 10898 10311 gene locus_tag LOCUS_20130 10898 10311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 11070 11702 gene locus_tag LOCUS_20140 11070 11702 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061633.1 protein_id gnl|my_center|LOCUS_20140 11768 11851 gene locus_tag LOCUS_t00350 11768 11851 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 12699 11839 gene locus_tag LOCUS_20150 12699 11839 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388147.1 protein_id gnl|my_center|LOCUS_20150 <13447 12735 gene locus_tag LOCUS_20160 <13447 12735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028067.1:maleylpyruvate isomerase family mycothiol-dependent enzyme >Feature sequence061 623 63 gene locus_tag LOCUS_20170 623 63 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728791.1 protein_id gnl|my_center|LOCUS_20170 1158 739 gene locus_tag LOCUS_20180 1158 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 1322 2614 gene locus_tag LOCUS_20190 gene kynU 1322 2614 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057429.1 protein_id gnl|my_center|LOCUS_20190 2616 3392 gene locus_tag LOCUS_20200 2616 3392 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927833.1 protein_id gnl|my_center|LOCUS_20200 3389 3817 gene locus_tag LOCUS_20210 3389 3817 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762169.1 protein_id gnl|my_center|LOCUS_20210 3819 4343 gene locus_tag LOCUS_20220 3819 4343 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 protein_id gnl|my_center|LOCUS_20220 4348 5370 gene locus_tag LOCUS_20230 4348 5370 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_20230 5367 6680 gene locus_tag LOCUS_20240 5367 6680 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036736.1 protein_id gnl|my_center|LOCUS_20240 7214 6681 gene locus_tag LOCUS_20250 7214 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 9429 7411 gene locus_tag LOCUS_20260 9429 7411 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968769.1 protein_id gnl|my_center|LOCUS_20260 9510 11012 gene locus_tag LOCUS_20270 9510 11012 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706123.1 protein_id gnl|my_center|LOCUS_20270 11009 11425 gene locus_tag LOCUS_20280 11009 11425 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199254442.1 protein_id gnl|my_center|LOCUS_20280 11435 12154 gene locus_tag LOCUS_20290 11435 12154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 <13133 12151 gene locus_tag LOCUS_20300 <13133 12151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522101.1:oxygenase MpaB family protein >Feature sequence062 <1 798 gene locus_tag LOCUS_20310 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003892759.1:class I mannose-6-phosphate isomerase 795 2144 gene locus_tag LOCUS_20320 795 2144 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727632.1 protein_id gnl|my_center|LOCUS_20320 2210 2458 gene locus_tag LOCUS_20330 2210 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2464 3336 gene locus_tag LOCUS_20340 2464 3336 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_20340 3323 4474 gene locus_tag LOCUS_20350 3323 4474 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_20350 4477 4764 gene locus_tag LOCUS_20360 4477 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 4766 5194 gene locus_tag LOCUS_20370 4766 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 5587 5225 gene locus_tag LOCUS_20380 5587 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 5859 5584 gene locus_tag LOCUS_20390 5859 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 6115 5861 gene locus_tag LOCUS_20400 6115 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 6351 6124 gene locus_tag LOCUS_20410 6351 6124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 6615 6361 gene locus_tag LOCUS_20420 6615 6361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 7220 6630 gene locus_tag LOCUS_20430 7220 6630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 9644 7224 gene locus_tag LOCUS_20440 9644 7224 CDS product aerobic carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 protein_id gnl|my_center|LOCUS_20440 10135 9608 gene locus_tag LOCUS_20450 10135 9608 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_20450 11012 10137 gene locus_tag LOCUS_20460 11012 10137 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892164.1 protein_id gnl|my_center|LOCUS_20460 11260 11030 gene locus_tag LOCUS_20470 11260 11030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 12234 11353 gene locus_tag LOCUS_20480 12234 11353 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727161.1 protein_id gnl|my_center|LOCUS_20480 12752 12264 gene locus_tag LOCUS_20490 12752 12264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence063 881 2107 gene locus_tag LOCUS_20500 881 2107 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529298.1 protein_id gnl|my_center|LOCUS_20500 2824 2108 gene locus_tag LOCUS_20510 gene aqpS 2824 2108 CDS product aquaglyceroporin AqpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969025.1 protein_id gnl|my_center|LOCUS_20510 3225 2821 gene locus_tag LOCUS_20520 3225 2821 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_20520 3330 3758 gene locus_tag LOCUS_20530 3330 3758 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229707.1 protein_id gnl|my_center|LOCUS_20530 4193 3741 gene locus_tag LOCUS_20540 4193 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 4620 4198 gene locus_tag LOCUS_20550 4620 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 5051 4641 gene locus_tag LOCUS_20560 5051 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 5074 6030 gene locus_tag LOCUS_20570 5074 6030 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 protein_id gnl|my_center|LOCUS_20570 6242 6496 gene locus_tag LOCUS_20580 6242 6496 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_20580 7952 6501 gene locus_tag LOCUS_20590 7952 6501 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_20590 8119 9786 gene locus_tag LOCUS_20600 8119 9786 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908709.1 protein_id gnl|my_center|LOCUS_20600 10625 9867 gene locus_tag LOCUS_20610 10625 9867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 11751 10906 gene locus_tag LOCUS_20620 11751 10906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 11954 11757 gene locus_tag LOCUS_20630 11954 11757 CDS product biotin/lipoyl-binding carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056341.1 protein_id gnl|my_center|LOCUS_20630 12375 12106 gene locus_tag LOCUS_20640 12375 12106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 <12876 12372 gene locus_tag LOCUS_20650 <12876 12372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973756.1:RNA polymerase sigma factor SigR >Feature sequence064 <1 765 gene locus_tag LOCUS_20660 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948031.1:phytanoyl-CoA dioxygenase family protein 1607 840 gene locus_tag LOCUS_20670 1607 840 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028243.1 protein_id gnl|my_center|LOCUS_20670 2575 1607 gene locus_tag LOCUS_20680 2575 1607 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028242.1 protein_id gnl|my_center|LOCUS_20680 3444 2572 gene locus_tag LOCUS_20690 3444 2572 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486763.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20690 3757 4302 gene locus_tag LOCUS_20700 3757 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 4347 5120 gene locus_tag LOCUS_20710 4347 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 5721 5140 gene locus_tag LOCUS_20720 5721 5140 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973388.1 protein_id gnl|my_center|LOCUS_20720 6806 5817 gene locus_tag LOCUS_20730 6806 5817 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 protein_id gnl|my_center|LOCUS_20730 6894 7709 gene locus_tag LOCUS_20740 6894 7709 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231012.1 protein_id gnl|my_center|LOCUS_20740 7800 8300 gene locus_tag LOCUS_20750 7800 8300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 8995 8306 gene locus_tag LOCUS_20760 8995 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 9138 11225 gene locus_tag LOCUS_20770 9138 11225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 11324 12307 gene locus_tag LOCUS_20780 11324 12307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 >Feature sequence065 76 1182 gene locus_tag LOCUS_20790 gene secF 76 1182 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_20790 1257 3524 gene locus_tag LOCUS_20800 gene relA 1257 3524 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_20800 5153 3528 gene locus_tag LOCUS_20810 5153 3528 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 protein_id gnl|my_center|LOCUS_20810 6091 5195 gene locus_tag LOCUS_20820 6091 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 6204 6923 gene locus_tag LOCUS_20830 6204 6923 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_20830 6923 8242 gene locus_tag LOCUS_20840 gene hisS 6923 8242 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805006.1 protein_id gnl|my_center|LOCUS_20840 8239 9993 gene locus_tag LOCUS_20850 gene aspS 8239 9993 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224570.1 protein_id gnl|my_center|LOCUS_20850 10130 10714 gene locus_tag LOCUS_20860 10130 10714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 10726 12069 gene locus_tag LOCUS_20870 10726 12069 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977320.1 protein_id gnl|my_center|LOCUS_20870 12108 12392 gene locus_tag LOCUS_20880 12108 12392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 >Feature sequence066 1277 636 gene locus_tag LOCUS_20890 1277 636 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087440.1 protein_id gnl|my_center|LOCUS_20890 2881 1274 gene locus_tag LOCUS_20900 2881 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 4674 2878 gene locus_tag LOCUS_20910 4674 2878 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028155.1 protein_id gnl|my_center|LOCUS_20910 4799 5209 gene locus_tag LOCUS_20920 4799 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224319.1 protein_id gnl|my_center|LOCUS_20920 5220 5660 gene locus_tag LOCUS_20930 5220 5660 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976686.1 protein_id gnl|my_center|LOCUS_20930 6379 5663 gene locus_tag LOCUS_20940 6379 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 7132 6389 gene locus_tag LOCUS_20950 7132 6389 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_20950 7185 7901 gene locus_tag LOCUS_20960 7185 7901 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224330.1 protein_id gnl|my_center|LOCUS_20960 8659 7904 gene locus_tag LOCUS_20970 8659 7904 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086453.1 protein_id gnl|my_center|LOCUS_20970 9932 8652 gene locus_tag LOCUS_20980 9932 8652 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213326.1 protein_id gnl|my_center|LOCUS_20980 10677 9940 gene locus_tag LOCUS_20990 10677 9940 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227810.1 protein_id gnl|my_center|LOCUS_20990 11369 10674 gene locus_tag LOCUS_21000 gene ucpA 11369 10674 CDS product SDR family oxidoreductase UcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517423.1 protein_id gnl|my_center|LOCUS_21000 <11929 11420 gene locus_tag LOCUS_21010 <11929 11420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940392.1:glycerol kinase GlpK >Feature sequence067 870 28 gene locus_tag LOCUS_21020 870 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 1632 880 gene locus_tag LOCUS_21030 1632 880 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188202.1 protein_id gnl|my_center|LOCUS_21030 1657 4917 gene locus_tag LOCUS_21040 1657 4917 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265956.1 protein_id gnl|my_center|LOCUS_21040 6101 4914 gene locus_tag LOCUS_21050 6101 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 6596 6189 gene locus_tag LOCUS_21060 6596 6189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 8107 6593 gene locus_tag LOCUS_21070 8107 6593 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081393.1 protein_id gnl|my_center|LOCUS_21070 8182 9216 gene locus_tag LOCUS_21080 8182 9216 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531254.1 protein_id gnl|my_center|LOCUS_21080 10649 9213 gene locus_tag LOCUS_21090 10649 9213 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730023.1 protein_id gnl|my_center|LOCUS_21090 <11863 10652 gene locus_tag LOCUS_21100 <11863 10652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003407762.1:lysophospholipid acyltransferase >Feature sequence068 103 303 gene locus_tag LOCUS_21110 103 303 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027899.1 protein_id gnl|my_center|LOCUS_21110 300 1148 gene locus_tag LOCUS_21120 gene prcB 300 1148 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_21120 1145 1882 gene locus_tag LOCUS_21130 gene prcA 1145 1882 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226723.1 protein_id gnl|my_center|LOCUS_21130 1879 3255 gene locus_tag LOCUS_21140 gene pafA 1879 3255 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_21140 3288 3872 gene locus_tag LOCUS_21150 3288 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 3887 4246 gene locus_tag LOCUS_21160 gene fkpA 3887 4246 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase FkpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858324.1 protein_id gnl|my_center|LOCUS_21160 4264 5220 gene locus_tag LOCUS_21170 4264 5220 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080096.1 protein_id gnl|my_center|LOCUS_21170 5217 6143 gene locus_tag LOCUS_21180 5217 6143 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_21180 6233 6532 gene locus_tag LOCUS_21190 6233 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 6536 7408 gene locus_tag LOCUS_21200 gene tatC 6536 7408 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977194.1 protein_id gnl|my_center|LOCUS_21200 7412 8311 gene locus_tag LOCUS_21210 7412 8311 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729742.1 protein_id gnl|my_center|LOCUS_21210 8321 11023 gene locus_tag LOCUS_21220 8321 11023 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_21220 <11798 11016 gene locus_tag LOCUS_21230 <11798 11016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027889.1:5'-3' exonuclease >Feature sequence069 <1 780 gene locus_tag LOCUS_21240 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226472.1:LLM class F420-dependent oxidoreductase 777 1595 gene locus_tag LOCUS_21250 777 1595 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977503.1 protein_id gnl|my_center|LOCUS_21250 2618 1608 gene locus_tag LOCUS_21260 gene corA 2618 1608 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027906.1 protein_id gnl|my_center|LOCUS_21260 2664 3377 gene locus_tag LOCUS_21270 2664 3377 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977159.1 protein_id gnl|my_center|LOCUS_21270 3391 3924 gene locus_tag LOCUS_21280 3391 3924 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_21280 3921 4709 gene locus_tag LOCUS_21290 3921 4709 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270002.1 protein_id gnl|my_center|LOCUS_21290 4728 5957 gene locus_tag LOCUS_21300 gene mshC 4728 5957 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_21300 6958 5954 gene locus_tag LOCUS_21310 gene gnd 6958 5954 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405880.1 protein_id gnl|my_center|LOCUS_21310 7085 8722 gene locus_tag LOCUS_21320 gene pgi 7085 8722 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888377.1 protein_id gnl|my_center|LOCUS_21320 9575 8724 gene locus_tag LOCUS_21330 gene parJ 9575 8724 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_21330 9639 10313 gene locus_tag LOCUS_21340 9639 10313 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977169.1 protein_id gnl|my_center|LOCUS_21340 <11532 10314 gene locus_tag LOCUS_21350 <11532 10314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028773.1:FtsX-like permease family protein >Feature sequence070 1004 519 gene locus_tag LOCUS_21360 1004 519 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091943.1 protein_id gnl|my_center|LOCUS_21360 1105 2355 gene locus_tag LOCUS_21370 1105 2355 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223916.1 protein_id gnl|my_center|LOCUS_21370 2385 2630 gene locus_tag LOCUS_21380 2385 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 2630 3016 gene locus_tag LOCUS_21390 2630 3016 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898500.1 protein_id gnl|my_center|LOCUS_21390 3709 3020 gene locus_tag LOCUS_21400 3709 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 4524 3817 gene locus_tag LOCUS_21410 4524 3817 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729647.1 protein_id gnl|my_center|LOCUS_21410 4577 5935 gene locus_tag LOCUS_21420 gene glnA 4577 5935 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877179.1 protein_id gnl|my_center|LOCUS_21420 6835 5942 gene locus_tag LOCUS_21430 6835 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 7666 6869 gene locus_tag LOCUS_21440 7666 6869 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943037.1 protein_id gnl|my_center|LOCUS_21440 7806 9329 gene locus_tag LOCUS_21450 7806 9329 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392306.1 protein_id gnl|my_center|LOCUS_21450 9334 10542 gene locus_tag LOCUS_21460 9334 10542 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728836.1 protein_id gnl|my_center|LOCUS_21460 10947 11480 gene locus_tag LOCUS_21470 10947 11480 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104932.1 protein_id gnl|my_center|LOCUS_21470 >Feature sequence071 <1 1132 gene locus_tag LOCUS_21480 <1 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728577.1:ribonuclease D 3066 1129 gene locus_tag LOCUS_21490 gene dxs 3066 1129 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972908.1 protein_id gnl|my_center|LOCUS_21490 3455 3096 gene locus_tag LOCUS_21500 3455 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 6123 3457 gene locus_tag LOCUS_21510 gene acnA 6123 3457 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_21510 6237 8132 gene locus_tag LOCUS_21520 gene asnB 6237 8132 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930749.1 protein_id gnl|my_center|LOCUS_21520 <10021 8129 gene locus_tag LOCUS_21530 <10021 8129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899433.1:APC family permease >Feature sequence072 <1 722 gene locus_tag LOCUS_21540 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029424.1:Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein 1666 719 gene locus_tag LOCUS_21550 1666 719 CDS product YHYH protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112220.1 protein_id gnl|my_center|LOCUS_21550 4041 1672 gene locus_tag LOCUS_21560 4041 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 4229 4453 gene locus_tag LOCUS_21570 4229 4453 CDS product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908765.1 protein_id gnl|my_center|LOCUS_21570 4821 4450 gene locus_tag LOCUS_21580 4821 4450 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727560.1 protein_id gnl|my_center|LOCUS_21580 5027 4824 gene locus_tag LOCUS_21590 5027 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 6156 5056 gene locus_tag LOCUS_21600 gene purM 6156 5056 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974885.1 protein_id gnl|my_center|LOCUS_21600 6195 7370 gene locus_tag LOCUS_21610 6195 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 8906 7374 gene locus_tag LOCUS_21620 gene purF 8906 7374 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872463.1 protein_id gnl|my_center|LOCUS_21620 9328 8951 gene locus_tag LOCUS_21630 9328 8951 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413174.1 protein_id gnl|my_center|LOCUS_21630 9579 9325 gene locus_tag LOCUS_21640 9579 9325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 >Feature sequence073 1133 225 gene locus_tag LOCUS_21650 1133 225 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030405.1 protein_id gnl|my_center|LOCUS_21650 2068 1130 gene locus_tag LOCUS_21660 2068 1130 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030406.1 protein_id gnl|my_center|LOCUS_21660 2946 2065 gene locus_tag LOCUS_21670 2946 2065 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973312.1 protein_id gnl|my_center|LOCUS_21670 3994 2960 gene locus_tag LOCUS_21680 3994 2960 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226493.1 protein_id gnl|my_center|LOCUS_21680 5886 3991 gene locus_tag LOCUS_21690 5886 3991 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226492.1 protein_id gnl|my_center|LOCUS_21690 5907 7907 gene locus_tag LOCUS_21700 5907 7907 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803998.1 protein_id gnl|my_center|LOCUS_21700 7904 8839 gene locus_tag LOCUS_21710 7904 8839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 >Feature sequence074 1045 2457 gene locus_tag LOCUS_21720 1045 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 3257 2442 gene locus_tag LOCUS_21730 3257 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 3465 5837 gene locus_tag LOCUS_21740 3465 5837 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528147.1 protein_id gnl|my_center|LOCUS_21740 6652 5834 gene locus_tag LOCUS_21750 gene pcaD 6652 5834 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532964.1 protein_id gnl|my_center|LOCUS_21750 8538 6649 gene locus_tag LOCUS_21760 8538 6649 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226492.1 protein_id gnl|my_center|LOCUS_21760 8644 9396 gene locus_tag LOCUS_21770 8644 9396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence075 2494 839 gene locus_tag LOCUS_21780 gene pgm 2494 839 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971701.1 protein_id gnl|my_center|LOCUS_21780 2572 3960 gene locus_tag LOCUS_21790 2572 3960 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_21790 3973 4482 gene locus_tag LOCUS_21800 3973 4482 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764623.1 protein_id gnl|my_center|LOCUS_21800 5326 4544 gene locus_tag LOCUS_21810 gene hisN 5326 4544 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917127.1 protein_id gnl|my_center|LOCUS_21810 5369 5866 gene locus_tag LOCUS_21820 5369 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 5925 6551 gene locus_tag LOCUS_21830 5925 6551 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883952.1 protein_id gnl|my_center|LOCUS_21830 6548 8233 gene locus_tag LOCUS_21840 6548 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 8354 8563 gene locus_tag LOCUS_21850 8354 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 >Feature sequence076 806 1639 gene locus_tag LOCUS_21860 806 1639 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_21860 1694 3256 gene locus_tag LOCUS_21870 1694 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 3267 3587 gene locus_tag LOCUS_21880 3267 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 3634 4587 gene locus_tag LOCUS_21890 gene trxB 3634 4587 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405370.1 protein_id gnl|my_center|LOCUS_21890 4657 4986 gene locus_tag LOCUS_21900 gene trxA 4657 4986 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393175.1 protein_id gnl|my_center|LOCUS_21900 5151 5921 gene locus_tag LOCUS_21910 5151 5921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 6861 5971 gene locus_tag LOCUS_21920 6861 5971 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082835.1 protein_id gnl|my_center|LOCUS_21920 7594 6848 gene locus_tag LOCUS_21930 gene soj 7594 6848 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_21930 8345 7809 gene locus_tag LOCUS_21940 8345 7809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 >Feature sequence077 <1 747 gene locus_tag LOCUS_21950 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051618804.1:N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA 757 1602 gene locus_tag LOCUS_21960 gene dapF 757 1602 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030458.1 protein_id gnl|my_center|LOCUS_21960 1593 2984 gene locus_tag LOCUS_21970 gene hflX 1593 2984 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_21970 2981 4927 gene locus_tag LOCUS_21980 2981 4927 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030465.1 protein_id gnl|my_center|LOCUS_21980 5594 4911 gene locus_tag LOCUS_21990 gene lexA 5594 4911 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 protein_id gnl|my_center|LOCUS_21990 5826 6182 gene locus_tag LOCUS_22000 5826 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 6462 6977 gene locus_tag LOCUS_22010 gene nrdR 6462 6977 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057199.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence078 1658 27 gene locus_tag LOCUS_22020 gene menD 1658 27 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466562.1 protein_id gnl|my_center|LOCUS_22020 2823 1804 gene locus_tag LOCUS_22030 2823 1804 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727412.1 protein_id gnl|my_center|LOCUS_22030 3774 2827 gene locus_tag LOCUS_22040 gene menB 3774 2827 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963885.1 protein_id gnl|my_center|LOCUS_22040 3799 5013 gene locus_tag LOCUS_22050 gene menE 3799 5013 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216843435.1 protein_id gnl|my_center|LOCUS_22050 5031 5909 gene locus_tag LOCUS_22060 5031 5909 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776415.1 protein_id gnl|my_center|LOCUS_22060 6203 5805 gene locus_tag LOCUS_22070 6203 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 6242 6568 gene locus_tag LOCUS_22080 6242 6568 CDS product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776417.1 protein_id gnl|my_center|LOCUS_22080 7625 6660 gene locus_tag LOCUS_22090 gene ccsB 7625 6660 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029680.1 protein_id gnl|my_center|LOCUS_22090 >Feature sequence079 2 487 gene locus_tag LOCUS_22100 2 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 490 711 gene locus_tag LOCUS_22110 490 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 806 1057 gene locus_tag LOCUS_22120 806 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 1413 1060 gene locus_tag LOCUS_22130 1413 1060 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530464.1 protein_id gnl|my_center|LOCUS_22130 1467 2228 gene locus_tag LOCUS_22140 1467 2228 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087125.1 protein_id gnl|my_center|LOCUS_22140 2264 2336 gene locus_tag LOCUS_t00360 2264 2336 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2793 2338 gene locus_tag LOCUS_22150 2793 2338 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931873.1 protein_id gnl|my_center|LOCUS_22150 4233 2953 gene locus_tag LOCUS_22160 4233 2953 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029637.1 protein_id gnl|my_center|LOCUS_22160 5902 4235 gene locus_tag LOCUS_22170 5902 4235 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720843.1 protein_id gnl|my_center|LOCUS_22170 6869 5910 gene locus_tag LOCUS_22180 6869 5910 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443441.1 protein_id gnl|my_center|LOCUS_22180 >Feature sequence080 1088 219 gene locus_tag LOCUS_22190 1088 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 1312 1497 gene locus_tag LOCUS_22200 1312 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 1494 2279 gene locus_tag LOCUS_22210 1494 2279 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029292.1 protein_id gnl|my_center|LOCUS_22210 2396 3247 gene locus_tag LOCUS_22220 2396 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 3370 4647 gene locus_tag LOCUS_22230 3370 4647 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037710.1 protein_id gnl|my_center|LOCUS_22230 4659 5555 gene locus_tag LOCUS_22240 gene dapA 4659 5555 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_22240 5552 6601 gene locus_tag LOCUS_22250 5552 6601 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252895.1 protein_id gnl|my_center|LOCUS_22250 6699 7121 gene locus_tag LOCUS_22260 6699 7121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence081 <1 800 gene locus_tag LOCUS_22270 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003894937.1:alkaline phosphatase family protein 802 1449 gene locus_tag LOCUS_22280 802 1449 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973175.1 protein_id gnl|my_center|LOCUS_22280 2030 1446 gene locus_tag LOCUS_22290 2030 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 3470 2205 gene locus_tag LOCUS_22300 3470 2205 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973162.1 protein_id gnl|my_center|LOCUS_22300 3485 4294 gene locus_tag LOCUS_22310 3485 4294 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153505920.1 protein_id gnl|my_center|LOCUS_22310 4795 4277 gene locus_tag LOCUS_22320 4795 4277 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223643.1 protein_id gnl|my_center|LOCUS_22320 4946 5242 gene locus_tag LOCUS_22330 4946 5242 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993510.1 protein_id gnl|my_center|LOCUS_22330 5525 5253 gene locus_tag LOCUS_22340 5525 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 6070 5552 gene locus_tag LOCUS_22350 6070 5552 CDS product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224477.1 protein_id gnl|my_center|LOCUS_22350 6124 6732 gene locus_tag LOCUS_22360 6124 6732 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030506.1 protein_id gnl|my_center|LOCUS_22360 6729 7214 gene locus_tag LOCUS_22370 gene dut 6729 7214 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_22370 >Feature sequence082 337 2 gene locus_tag LOCUS_22380 337 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 1452 514 gene locus_tag LOCUS_22390 1452 514 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229588.1 protein_id gnl|my_center|LOCUS_22390 2193 1630 gene locus_tag LOCUS_22400 2193 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 3449 2265 gene locus_tag LOCUS_22410 3449 2265 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837503.1 protein_id gnl|my_center|LOCUS_22410 3518 4918 gene locus_tag LOCUS_22420 3518 4918 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730024.1 protein_id gnl|my_center|LOCUS_22420 4111 4196 gene locus_tag LOCUS_t00370 4111 4196 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4989 5540 gene locus_tag LOCUS_22430 4989 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 6454 5537 gene locus_tag LOCUS_22440 6454 5537 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730964.1 protein_id gnl|my_center|LOCUS_22440 6531 7028 gene locus_tag LOCUS_22450 6531 7028 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072772321.1 protein_id gnl|my_center|LOCUS_22450 >Feature sequence083 189 425 gene locus_tag LOCUS_22460 189 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 422 838 gene locus_tag LOCUS_22470 422 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 1224 1358 gene locus_tag LOCUS_22480 1224 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 1826 1416 gene locus_tag LOCUS_22490 gene sodN 1826 1416 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_22490 1921 2244 gene locus_tag LOCUS_22500 1921 2244 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003656.1 protein_id gnl|my_center|LOCUS_22500 2237 3424 gene locus_tag LOCUS_22510 2237 3424 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973709.1 protein_id gnl|my_center|LOCUS_22510 3608 3429 gene locus_tag LOCUS_22520 3608 3429 CDS product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 protein_id gnl|my_center|LOCUS_22520 <7186 3612 gene locus_tag LOCUS_22530 <7186 3612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030150.1:multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit >Feature sequence084 641 219 gene locus_tag LOCUS_22540 641 219 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_22540 1096 638 gene locus_tag LOCUS_22550 1096 638 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029784.1 protein_id gnl|my_center|LOCUS_22550 1278 1108 gene locus_tag LOCUS_22560 gene rpmG 1278 1108 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776157.1 protein_id gnl|my_center|LOCUS_22560 1404 1330 gene locus_tag LOCUS_t00380 1404 1330 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1509 1436 gene locus_tag LOCUS_t00390 1509 1436 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3260 1578 gene locus_tag LOCUS_22570 3260 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 3863 3306 gene locus_tag LOCUS_22580 3863 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 3966 4916 gene locus_tag LOCUS_22590 3966 4916 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902312.1 protein_id gnl|my_center|LOCUS_22590 5334 4897 gene locus_tag LOCUS_22600 5334 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 6510 5350 gene locus_tag LOCUS_22610 6510 5350 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037244312.1 protein_id gnl|my_center|LOCUS_22610 <7123 6528 gene locus_tag LOCUS_22620 <7123 6528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005111761.1:response regulator transcription factor >Feature sequence085 1288 212 gene locus_tag LOCUS_22630 1288 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 2262 1291 gene locus_tag LOCUS_22640 2262 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 3375 2272 gene locus_tag LOCUS_22650 3375 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 3461 4360 gene locus_tag LOCUS_22660 3461 4360 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_22660 4466 4735 gene locus_tag LOCUS_22670 gene rpsO 4466 4735 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973291.1 protein_id gnl|my_center|LOCUS_22670 >Feature sequence086 2577 745 gene locus_tag LOCUS_22680 2577 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 3912 2659 gene locus_tag LOCUS_22690 3912 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 4636 3974 gene locus_tag LOCUS_22700 gene pyrE 4636 3974 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_22700 6105 4657 gene locus_tag LOCUS_22710 6105 4657 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838082.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence087 <1 1092 gene locus_tag LOCUS_22720 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164278219.1:signal recognition particle-docking protein FtsY 1244 2575 gene locus_tag LOCUS_22730 1244 2575 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831524.1 protein_id gnl|my_center|LOCUS_22730 2576 2914 gene locus_tag LOCUS_22740 2576 2914 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893792.1 protein_id gnl|my_center|LOCUS_22740 2917 5250 gene locus_tag LOCUS_22750 2917 5250 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487177.1 protein_id gnl|my_center|LOCUS_22750 >Feature sequence088 908 390 gene locus_tag LOCUS_22760 908 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 1042 1581 gene locus_tag LOCUS_22770 1042 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 1783 2472 gene locus_tag LOCUS_22780 1783 2472 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230061.1 protein_id gnl|my_center|LOCUS_22780 2476 3819 gene locus_tag LOCUS_22790 2476 3819 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230060.1 protein_id gnl|my_center|LOCUS_22790 3908 4846 gene locus_tag LOCUS_22800 3908 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 <5807 4854 gene locus_tag LOCUS_22810 <5807 4854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029104282.1:HNH endonuclease signature motif containing protein >Feature sequence089 3919 4812 gene locus_tag LOCUS_22820 3919 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence090 3681 1006 gene locus_tag LOCUS_22830 3681 1006 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229784.1 protein_id gnl|my_center|LOCUS_22830 4829 3678 gene locus_tag LOCUS_22840 4829 3678 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977530.1 protein_id gnl|my_center|LOCUS_22840 >Feature sequence091 194 1354 gene locus_tag LOCUS_22850 gene xylA 194 1354 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228546.1 protein_id gnl|my_center|LOCUS_22850 1439 2605 gene locus_tag LOCUS_22860 1439 2605 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897421.1 protein_id gnl|my_center|LOCUS_22860 2728 3516 gene locus_tag LOCUS_22870 2728 3516 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224454.1 protein_id gnl|my_center|LOCUS_22870 3513 4769 gene locus_tag LOCUS_22880 3513 4769 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878529.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence092 365 658 gene locus_tag LOCUS_22890 365 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 688 1296 gene locus_tag LOCUS_22900 688 1296 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392298.1 protein_id gnl|my_center|LOCUS_22900 1306 2655 gene locus_tag LOCUS_22910 1306 2655 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479549.1 protein_id gnl|my_center|LOCUS_22910 3470 2652 gene locus_tag LOCUS_22920 3470 2652 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030485.1 protein_id gnl|my_center|LOCUS_22920 <5383 3485 gene locus_tag LOCUS_22930 <5383 3485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929932.1:DNA topoisomerase IV subunit A >Feature sequence093 763 1923 gene locus_tag LOCUS_22940 763 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 3249 1987 gene locus_tag LOCUS_22950 3249 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 3313 3238 gene locus_tag LOCUS_t00400 3313 3238 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3832 3344 gene locus_tag LOCUS_22960 3832 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 <5382 3833 gene locus_tag LOCUS_22970 <5382 3833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228362.1:DNA primase >Feature sequence094 1156 326 gene locus_tag LOCUS_22980 1156 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224460.1 protein_id gnl|my_center|LOCUS_22980 1284 2174 gene locus_tag LOCUS_22990 1284 2174 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530319.1 protein_id gnl|my_center|LOCUS_22990 2177 5089 gene locus_tag LOCUS_23000 2177 5089 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975932.1 protein_id gnl|my_center|LOCUS_23000 >Feature sequence095 <1 1158 gene locus_tag LOCUS_23010 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014877890.1:dihydropyrimidinase 1192 2679 gene locus_tag LOCUS_23020 gene mmsA 1192 2679 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028544.1 protein_id gnl|my_center|LOCUS_23020 2694 3710 gene locus_tag LOCUS_23030 2694 3710 CDS product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895005.1 protein_id gnl|my_center|LOCUS_23030 3733 4593 gene locus_tag LOCUS_23040 3733 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 >Feature sequence096 3778 2228 gene locus_tag LOCUS_23050 3778 2228 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726708.1 protein_id gnl|my_center|LOCUS_23050 4245 3775 gene locus_tag LOCUS_23060 4245 3775 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726707.1 protein_id gnl|my_center|LOCUS_23060 >Feature sequence097 <1 2594 gene locus_tag LOCUS_23070 <1 2594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003105494.1:ATP-dependent RNA helicase HrpA 2635 4053 gene locus_tag LOCUS_23080 2635 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 4111 4695 gene locus_tag LOCUS_23090 4111 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 >Feature sequence098 1548 805 gene locus_tag LOCUS_23100 1548 805 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918195.1 protein_id gnl|my_center|LOCUS_23100 1628 1704 gene locus_tag LOCUS_t00410 1628 1704 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence099 2379 3089 gene locus_tag LOCUS_23110 2379 3089 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089900.1 protein_id gnl|my_center|LOCUS_23110 3082 4569 gene locus_tag LOCUS_23120 3082 4569 CDS product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815118.1 protein_id gnl|my_center|LOCUS_23120 >Feature sequence100 3 1784 gene locus_tag LOCUS_23130 3 1784 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728790.1 protein_id gnl|my_center|LOCUS_23130 2032 2988 gene locus_tag LOCUS_23140 2032 2988 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229986.1 protein_id gnl|my_center|LOCUS_23140 3282 2989 gene locus_tag LOCUS_23150 3282 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 3328 4395 gene locus_tag LOCUS_23160 3328 4395 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_23160 >Feature sequence101 13 324 gene locus_tag LOCUS_23170 13 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 374 889 gene locus_tag LOCUS_23180 374 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899730.1 protein_id gnl|my_center|LOCUS_23180 1503 886 gene locus_tag LOCUS_23190 1503 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 1538 2953 gene locus_tag LOCUS_23200 1538 2953 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226360.1 protein_id gnl|my_center|LOCUS_23200 2967 4226 gene locus_tag LOCUS_23210 2967 4226 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226359.1 protein_id gnl|my_center|LOCUS_23210 4269 4643 gene locus_tag LOCUS_23220 4269 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 >Feature sequence102 1002 298 gene locus_tag LOCUS_23230 1002 298 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 protein_id gnl|my_center|LOCUS_23230 1090 2379 gene locus_tag LOCUS_23240 gene aroA 1090 2379 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 protein_id gnl|my_center|LOCUS_23240 2379 3395 gene locus_tag LOCUS_23250 gene rsgA 2379 3395 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973761.1 protein_id gnl|my_center|LOCUS_23250 4539 3397 gene locus_tag LOCUS_23260 4539 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 >Feature sequence103 309 1040 gene locus_tag LOCUS_23270 309 1040 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228386.1 protein_id gnl|my_center|LOCUS_23270 1437 1042 gene locus_tag LOCUS_23280 gene zur 1437 1042 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899290.1 protein_id gnl|my_center|LOCUS_23280 2287 1430 gene locus_tag LOCUS_23290 2287 1430 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 protein_id gnl|my_center|LOCUS_23290 3038 2289 gene locus_tag LOCUS_23300 3038 2289 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028392.1 protein_id gnl|my_center|LOCUS_23300 3955 3065 gene locus_tag LOCUS_23310 3955 3065 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 protein_id gnl|my_center|LOCUS_23310 4398 4003 gene locus_tag LOCUS_23320 4398 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 >Feature sequence104 1654 866 gene locus_tag LOCUS_23330 1654 866 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976665.1 protein_id gnl|my_center|LOCUS_23330 2395 1685 gene locus_tag LOCUS_23340 2395 1685 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_23340 2355 2792 gene locus_tag LOCUS_23350 2355 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976663.1 protein_id gnl|my_center|LOCUS_23350 2796 3896 gene locus_tag LOCUS_23360 gene trpD 2796 3896 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224077.1 protein_id gnl|my_center|LOCUS_23360 <4418 3882 gene locus_tag LOCUS_23370 <4418 3882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727578.1:guanine deaminase >Feature sequence105 1612 545 gene locus_tag LOCUS_23380 1612 545 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533060.1 protein_id gnl|my_center|LOCUS_23380 2457 1609 gene locus_tag LOCUS_23390 2457 1609 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820280.1 protein_id gnl|my_center|LOCUS_23390 >Feature sequence106 1626 853 gene locus_tag LOCUS_23400 1626 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 3415 1808 gene locus_tag LOCUS_23410 3415 1808 CDS product cisplatin damage response ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921437.1 protein_id gnl|my_center|LOCUS_23410 <4174 3419 gene locus_tag LOCUS_23420 <4174 3419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013527947.1:ligase-associated DNA damage response exonuclease >Feature sequence107 1964 579 gene locus_tag LOCUS_23430 1964 579 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939710.1 protein_id gnl|my_center|LOCUS_23430 3578 2712 gene locus_tag LOCUS_23440 3578 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 >Feature sequence108 881 24 gene locus_tag LOCUS_23450 881 24 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 protein_id gnl|my_center|LOCUS_23450 3280 878 gene locus_tag LOCUS_23460 3280 878 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223764.1 protein_id gnl|my_center|LOCUS_23460 3759 3277 gene locus_tag LOCUS_23470 3759 3277 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223763.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence109 <1 1485 gene locus_tag LOCUS_23480 <1 1485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976751.1:DNA polymerase III subunit alpha 1596 2252 gene locus_tag LOCUS_23490 1596 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 2288 2851 gene locus_tag LOCUS_23500 2288 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 2897 3292 gene locus_tag LOCUS_23510 2897 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 >Feature sequence110 908 531 gene locus_tag LOCUS_23520 908 531 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903023.1 protein_id gnl|my_center|LOCUS_23520 980 2158 gene locus_tag LOCUS_23530 980 2158 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040103.1 protein_id gnl|my_center|LOCUS_23530 2220 2296 gene locus_tag LOCUS_t00420 2220 2296 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2361 3536 gene locus_tag LOCUS_23540 2361 3536 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence111 107 18 gene locus_tag LOCUS_t00430 107 18 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1687 131 gene locus_tag LOCUS_23550 1687 131 CDS product diol dehydratase reactivase ATPase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731201.1 protein_id gnl|my_center|LOCUS_23550 2040 1684 gene locus_tag LOCUS_23560 2040 1684 CDS product diol dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726994.1 protein_id gnl|my_center|LOCUS_23560 <3629 2037 gene locus_tag LOCUS_23570 <3629 2037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726995.1:propanediol/glycerol family dehydratase large subunit >Feature sequence112 2316 115 gene locus_tag LOCUS_23580 2316 115 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_23580 2338 2949 gene locus_tag LOCUS_23590 2338 2949 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225458.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence113 268 1932 gene locus_tag LOCUS_23600 gene arc 268 1932 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_23600 >Feature sequence114 >Feature sequence115 <1 1157 gene locus_tag LOCUS_23610 <1 1157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230144.1:FAD-binding oxidoreductase >Feature sequence116 <1 1743 gene locus_tag LOCUS_23620 <1 1743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925439.1:acetate--CoA ligase family protein 1756 2982 gene locus_tag LOCUS_23630 1756 2982 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876827.1 protein_id gnl|my_center|LOCUS_23630 >Feature sequence117 2290 1154 gene locus_tag LOCUS_23640 2290 1154 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901000.1 protein_id gnl|my_center|LOCUS_23640 2482 2294 gene locus_tag LOCUS_23650 2482 2294 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898093.1 protein_id gnl|my_center|LOCUS_23650 <3084 2479 gene locus_tag LOCUS_23660 <3084 2479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009485356.1:fumarylacetoacetate hydrolase family protein >Feature sequence118 1324 128 gene locus_tag LOCUS_23670 1324 128 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_23670 2249 1365 gene locus_tag LOCUS_23680 2249 1365 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_23680 >Feature sequence119 1483 587 gene locus_tag LOCUS_23690 1483 587 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401865.1 protein_id gnl|my_center|LOCUS_23690 2134 1502 gene locus_tag LOCUS_23700 2134 1502 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730864.1 protein_id gnl|my_center|LOCUS_23700 2212 2466 gene locus_tag LOCUS_23710 gene moaD2 2212 2466 CDS product molybdopterin synthase subunit MoaD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404559.1 protein_id gnl|my_center|LOCUS_23710 2891 2463 gene locus_tag LOCUS_23720 2891 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 >Feature sequence120 191 1720 gene locus_tag LOCUS_23730 191 1720 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978319.1 protein_id gnl|my_center|LOCUS_23730 1756 2661 gene locus_tag LOCUS_23740 gene mutT1 1756 2661 CDS product 8-oxo-(d)GTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728311.1 protein_id gnl|my_center|LOCUS_23740 >Feature sequence121 <1 1089 gene locus_tag LOCUS_23750 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975373.1:acetate--CoA ligase 1847 1125 gene locus_tag LOCUS_23760 1847 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 2378 1914 gene locus_tag LOCUS_23770 2378 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence122 3 76 gene locus_tag LOCUS_t00440 3 76 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 104 631 gene locus_tag LOCUS_23780 104 631 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878080.1 protein_id gnl|my_center|LOCUS_23780 628 1509 gene locus_tag LOCUS_23790 628 1509 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495744.1 protein_id gnl|my_center|LOCUS_23790 1719 1994 gene locus_tag LOCUS_23800 gene crgA 1719 1994 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975080.1 protein_id gnl|my_center|LOCUS_23800 >Feature sequence123 <1 1020 gene locus_tag LOCUS_23810 <1 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016327355.1:signal recognition particle protein <2226 1149 gene locus_tag LOCUS_23820 <2226 1149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167127769.1:Calx-beta domain-containing protein >Feature sequence124 458 1846 gene locus_tag LOCUS_23830 458 1846 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157579517.1 protein_id gnl|my_center|LOCUS_23830 >Feature sequence125 8 1258 gene locus_tag LOCUS_23840 8 1258 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223916.1 protein_id gnl|my_center|LOCUS_23840 <1976 1440 gene locus_tag LOCUS_23850 <1976 1440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729647.1:type 1 glutamine amidotransferase >Feature sequence126 115 1431 gene locus_tag LOCUS_23860 115 1431 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727104.1 protein_id gnl|my_center|LOCUS_23860 1812 1504 gene locus_tag LOCUS_23870 1812 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence127 686 1249 gene locus_tag LOCUS_23880 686 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 >Feature sequence128 607 1362 gene locus_tag LOCUS_23890 607 1362 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467152.1 protein_id gnl|my_center|LOCUS_23890 >Feature sequence129 659 378 gene locus_tag LOCUS_23900 659 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 1203 775 gene locus_tag LOCUS_23910 1203 775 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084076.1 protein_id gnl|my_center|LOCUS_23910 1754 1251 gene locus_tag LOCUS_23920 1754 1251 CDS product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530198.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence130 1431 352 gene locus_tag LOCUS_23930 1431 352 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456408.1 protein_id gnl|my_center|LOCUS_23930 1682 1428 gene locus_tag LOCUS_23940 1682 1428 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083634.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence131 <1 724 gene locus_tag LOCUS_23950 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742232.1:NAD(P)/FAD-dependent oxidoreductase 721 1455 gene locus_tag LOCUS_23960 721 1455 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031666.1 protein_id gnl|my_center|LOCUS_23960 >Feature sequence132 <1 1122 gene locus_tag LOCUS_23970 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975149.1:methionine--tRNA ligase 1422 1054 gene locus_tag LOCUS_23980 1422 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 >Feature sequence133 <1593 491 gene locus_tag LOCUS_23990 <1593 491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003893069.1:aspartate aminotransferase family protein >Feature sequence134 3 353 gene locus_tag LOCUS_24000 3 353 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143513.1 protein_id gnl|my_center|LOCUS_24000 350 712 gene locus_tag LOCUS_24010 350 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010