>Feature sequence001 377 643 gene locus_tag LOCUS_00010 377 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 754 2145 gene locus_tag LOCUS_00020 754 2145 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930267.1 protein_id gnl|my_center|LOCUS_00020 2216 3172 gene locus_tag LOCUS_00030 2216 3172 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 protein_id gnl|my_center|LOCUS_00030 5378 3396 gene locus_tag LOCUS_00040 5378 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6986 5730 gene locus_tag LOCUS_00050 6986 5730 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 protein_id gnl|my_center|LOCUS_00050 7217 7528 gene locus_tag LOCUS_00060 gene groES 7217 7528 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974211.1 protein_id gnl|my_center|LOCUS_00060 7640 9238 gene locus_tag LOCUS_00070 gene groL 7640 9238 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_00070 9514 10068 gene locus_tag LOCUS_00080 9514 10068 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974204.1 protein_id gnl|my_center|LOCUS_00080 10337 11827 gene locus_tag LOCUS_00090 gene guaB 10337 11827 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222684.1 protein_id gnl|my_center|LOCUS_00090 11980 13194 gene locus_tag LOCUS_00100 11980 13194 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229166.1 protein_id gnl|my_center|LOCUS_00100 13311 14426 gene locus_tag LOCUS_00110 13311 14426 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_00110 14646 14410 gene locus_tag LOCUS_00120 14646 14410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14528 15367 gene locus_tag LOCUS_00130 14528 15367 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224356.1 protein_id gnl|my_center|LOCUS_00130 15478 17217 gene locus_tag LOCUS_00140 15478 17217 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_00140 17269 18300 gene locus_tag LOCUS_00150 17269 18300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18419 19912 gene locus_tag LOCUS_00160 18419 19912 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042159660.1 protein_id gnl|my_center|LOCUS_00160 19909 22497 gene locus_tag LOCUS_00170 19909 22497 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229822.1 protein_id gnl|my_center|LOCUS_00170 23285 22539 gene locus_tag LOCUS_00180 23285 22539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 24046 23282 gene locus_tag LOCUS_00190 24046 23282 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272457.1 protein_id gnl|my_center|LOCUS_00190 24945 24046 gene locus_tag LOCUS_00200 24945 24046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860908.1 protein_id gnl|my_center|LOCUS_00200 25734 25039 gene locus_tag LOCUS_00210 25734 25039 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776062.1 protein_id gnl|my_center|LOCUS_00210 26963 25731 gene locus_tag LOCUS_00220 26963 25731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 27389 28066 gene locus_tag LOCUS_00230 27389 28066 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029799.1 protein_id gnl|my_center|LOCUS_00230 28063 30627 gene locus_tag LOCUS_00240 28063 30627 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167338154.1 protein_id gnl|my_center|LOCUS_00240 30758 31771 gene locus_tag LOCUS_00250 gene galE 30758 31771 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527590.1 protein_id gnl|my_center|LOCUS_00250 31878 33458 gene locus_tag LOCUS_00260 gene guaA 31878 33458 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974187.1 protein_id gnl|my_center|LOCUS_00260 >Feature sequence002 176 661 gene locus_tag LOCUS_00270 176 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 1198 713 gene locus_tag LOCUS_00280 1198 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 2342 1431 gene locus_tag LOCUS_00290 2342 1431 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059671.1 protein_id gnl|my_center|LOCUS_00290 3259 2339 gene locus_tag LOCUS_00300 3259 2339 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061335.1 protein_id gnl|my_center|LOCUS_00300 4525 3266 gene locus_tag LOCUS_00310 4525 3266 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013850.1 protein_id gnl|my_center|LOCUS_00310 4824 5813 gene locus_tag LOCUS_00320 4824 5813 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054086.1 protein_id gnl|my_center|LOCUS_00320 5839 7467 gene locus_tag LOCUS_00330 5839 7467 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975161.1 protein_id gnl|my_center|LOCUS_00330 7836 7763 gene locus_tag LOCUS_t00010 7836 7763 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8595 7972 gene locus_tag LOCUS_00340 8595 7972 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976227.1 protein_id gnl|my_center|LOCUS_00340 9016 8618 gene locus_tag LOCUS_00350 gene rsfS 9016 8618 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_00350 9603 9034 gene locus_tag LOCUS_00360 gene nadD 9603 9034 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_00360 9972 11033 gene locus_tag LOCUS_00370 9972 11033 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028434.1 protein_id gnl|my_center|LOCUS_00370 12128 11160 gene locus_tag LOCUS_00380 12128 11160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 13654 12380 gene locus_tag LOCUS_00390 13654 12380 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 protein_id gnl|my_center|LOCUS_00390 13996 14745 gene locus_tag LOCUS_00400 13996 14745 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087938.1 protein_id gnl|my_center|LOCUS_00400 15953 14796 gene locus_tag LOCUS_00410 gene proB 15953 14796 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_00410 17417 16053 gene locus_tag LOCUS_00420 gene obgE 17417 16053 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976206.1 protein_id gnl|my_center|LOCUS_00420 17802 17545 gene locus_tag LOCUS_00430 gene rpmA 17802 17545 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_00430 18387 17815 gene locus_tag LOCUS_00440 18387 17815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 21253 18500 gene locus_tag LOCUS_00450 21253 18500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00450 21972 21412 gene locus_tag LOCUS_00460 21972 21412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 23925 22744 gene locus_tag LOCUS_00470 gene rodA 23925 22744 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_00470 26057 23925 gene locus_tag LOCUS_00480 gene mrdA 26057 23925 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_00480 26612 26061 gene locus_tag LOCUS_00490 26612 26061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 27511 26609 gene locus_tag LOCUS_00500 gene mreC 27511 26609 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976189.1 protein_id gnl|my_center|LOCUS_00500 28547 27513 gene locus_tag LOCUS_00510 28547 27513 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_00510 29167 28763 gene locus_tag LOCUS_00520 gene ndk 29167 28763 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228487.1 protein_id gnl|my_center|LOCUS_00520 29715 29335 gene locus_tag LOCUS_00530 29715 29335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 31099 29747 gene locus_tag LOCUS_00540 31099 29747 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_00540 31210 32460 gene locus_tag LOCUS_00550 31210 32460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 33775 32495 gene locus_tag LOCUS_00560 gene clpX 33775 32495 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_00560 >Feature sequence003 155 913 gene locus_tag LOCUS_00570 155 913 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223166.1 protein_id gnl|my_center|LOCUS_00570 1462 905 gene locus_tag LOCUS_00580 1462 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 1461 1724 gene locus_tag LOCUS_00590 1461 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 1721 1978 gene locus_tag LOCUS_00600 1721 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 2665 2294 gene locus_tag LOCUS_00610 2665 2294 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976875.1 protein_id gnl|my_center|LOCUS_00610 3140 2763 gene locus_tag LOCUS_00620 3140 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 4071 3292 gene locus_tag LOCUS_00630 gene tpiA 4071 3292 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_00630 5321 4137 gene locus_tag LOCUS_00640 5321 4137 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028057.1 protein_id gnl|my_center|LOCUS_00640 6497 5493 gene locus_tag LOCUS_00650 gene gap 6497 5493 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 protein_id gnl|my_center|LOCUS_00650 7821 6841 gene locus_tag LOCUS_00660 gene whiA 7821 6841 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976869.1 protein_id gnl|my_center|LOCUS_00660 8407 8021 gene locus_tag LOCUS_00670 8407 8021 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013900.1 protein_id gnl|my_center|LOCUS_00670 9335 8427 gene locus_tag LOCUS_00680 gene yvcK 9335 8427 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00680 10403 9519 gene locus_tag LOCUS_00690 gene rapZ 10403 9519 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_00690 12412 10400 gene locus_tag LOCUS_00700 gene uvrC 12412 10400 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831611.1 protein_id gnl|my_center|LOCUS_00700 12633 13784 gene locus_tag LOCUS_00710 12633 13784 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462640.1 protein_id gnl|my_center|LOCUS_00710 14237 13848 gene locus_tag LOCUS_00720 14237 13848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 17316 14482 gene locus_tag LOCUS_00730 gene uvrA 17316 14482 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_00730 18534 17521 gene locus_tag LOCUS_00740 18534 17521 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027421.1 protein_id gnl|my_center|LOCUS_00740 19915 18833 gene locus_tag LOCUS_00750 19915 18833 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666770.1 protein_id gnl|my_center|LOCUS_00750 21540 19912 gene locus_tag LOCUS_00760 21540 19912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 22387 21551 gene locus_tag LOCUS_00770 22387 21551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804978.1 protein_id gnl|my_center|LOCUS_00770 23442 22387 gene locus_tag LOCUS_00780 23442 22387 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227815.1 protein_id gnl|my_center|LOCUS_00780 24644 23439 gene locus_tag LOCUS_00790 gene steA 24644 23439 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804976.1 protein_id gnl|my_center|LOCUS_00790 26441 24732 gene locus_tag LOCUS_00800 gene recN 26441 24732 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_00800 27437 26511 gene locus_tag LOCUS_00810 27437 26511 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_00810 28355 27546 gene locus_tag LOCUS_00820 28355 27546 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027974.1 protein_id gnl|my_center|LOCUS_00820 28580 28368 gene locus_tag LOCUS_00830 28580 28368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 29199 28582 gene locus_tag LOCUS_00840 29199 28582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 29393 29743 gene locus_tag LOCUS_00850 29393 29743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 29779 31023 gene locus_tag LOCUS_00860 29779 31023 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027979.1 protein_id gnl|my_center|LOCUS_00860 31039 31848 gene locus_tag LOCUS_00870 31039 31848 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976892.1 protein_id gnl|my_center|LOCUS_00870 31870 32895 gene locus_tag LOCUS_00880 31870 32895 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027978.1 protein_id gnl|my_center|LOCUS_00880 >Feature sequence004 2302 1361 gene locus_tag LOCUS_00890 2302 1361 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075506.1 protein_id gnl|my_center|LOCUS_00890 2607 2308 gene locus_tag LOCUS_00900 2607 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 2841 3371 gene locus_tag LOCUS_00910 2841 3371 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030929.1 protein_id gnl|my_center|LOCUS_00910 3653 4951 gene locus_tag LOCUS_00920 gene mshA 3653 4951 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742053.1 protein_id gnl|my_center|LOCUS_00920 4974 5501 gene locus_tag LOCUS_00930 4974 5501 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974766.1 protein_id gnl|my_center|LOCUS_00930 5494 6258 gene locus_tag LOCUS_00940 5494 6258 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974762.1 protein_id gnl|my_center|LOCUS_00940 7030 6395 gene locus_tag LOCUS_00950 7030 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 7373 7936 gene locus_tag LOCUS_00960 7373 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 8471 9340 gene locus_tag LOCUS_00970 8471 9340 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974789.1 protein_id gnl|my_center|LOCUS_00970 10261 9545 gene locus_tag LOCUS_00980 10261 9545 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977618.1 protein_id gnl|my_center|LOCUS_00980 11531 10275 gene locus_tag LOCUS_00990 11531 10275 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977619.1 protein_id gnl|my_center|LOCUS_00990 13784 11622 gene locus_tag LOCUS_01000 13784 11622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 14274 13969 gene locus_tag LOCUS_01010 14274 13969 CDS product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974805.1 protein_id gnl|my_center|LOCUS_01010 15116 14271 gene locus_tag LOCUS_01020 15116 14271 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974806.1 protein_id gnl|my_center|LOCUS_01020 15953 15639 gene locus_tag LOCUS_01030 15953 15639 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977746.1 protein_id gnl|my_center|LOCUS_01030 16678 15980 gene locus_tag LOCUS_01040 16678 15980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 18114 16918 gene locus_tag LOCUS_01050 18114 16918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 18405 18208 gene locus_tag LOCUS_01060 18405 18208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 18359 19141 gene locus_tag LOCUS_01070 18359 19141 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878084.1 protein_id gnl|my_center|LOCUS_01070 20176 19187 gene locus_tag LOCUS_01080 20176 19187 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_01080 21224 20589 gene locus_tag LOCUS_01090 21224 20589 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222430.1 protein_id gnl|my_center|LOCUS_01090 22550 21252 gene locus_tag LOCUS_01100 gene hemL 22550 21252 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029675.1 protein_id gnl|my_center|LOCUS_01100 23200 22631 gene locus_tag LOCUS_01110 23200 22631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 24525 23197 gene locus_tag LOCUS_01120 24525 23197 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_01120 25328 24672 gene locus_tag LOCUS_01130 25328 24672 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030853.1 protein_id gnl|my_center|LOCUS_01130 25623 26105 gene locus_tag LOCUS_01140 gene rraA 25623 26105 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731282.1 protein_id gnl|my_center|LOCUS_01140 26787 26137 gene locus_tag LOCUS_01150 26787 26137 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976534.1 protein_id gnl|my_center|LOCUS_01150 27882 26884 gene locus_tag LOCUS_01160 gene hemB 27882 26884 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028903.1 protein_id gnl|my_center|LOCUS_01160 29612 27930 gene locus_tag LOCUS_01170 29612 27930 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975519.1 protein_id gnl|my_center|LOCUS_01170 30665 29709 gene locus_tag LOCUS_01180 gene hemC 30665 29709 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975518.1 protein_id gnl|my_center|LOCUS_01180 <32026 30662 gene locus_tag LOCUS_01190 <32026 30662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011265556.1:glutamyl-tRNA reductase >Feature sequence005 1161 3755 gene locus_tag LOCUS_01200 1161 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 3893 5614 gene locus_tag LOCUS_01210 3893 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 5648 6211 gene locus_tag LOCUS_01220 5648 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 6646 9198 gene locus_tag LOCUS_01230 6646 9198 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224745.1 protein_id gnl|my_center|LOCUS_01230 9284 10369 gene locus_tag LOCUS_01240 9284 10369 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224744.1 protein_id gnl|my_center|LOCUS_01240 10636 12219 gene locus_tag LOCUS_01250 gene putP 10636 12219 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103073.1 protein_id gnl|my_center|LOCUS_01250 12312 13187 gene locus_tag LOCUS_01260 gene nadE 12312 13187 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027169.1 protein_id gnl|my_center|LOCUS_01260 13540 14823 gene locus_tag LOCUS_01270 13540 14823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 14886 15713 gene locus_tag LOCUS_01280 14886 15713 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484721.1 protein_id gnl|my_center|LOCUS_01280 15920 17194 gene locus_tag LOCUS_01290 15920 17194 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227011.1 protein_id gnl|my_center|LOCUS_01290 17191 18201 gene locus_tag LOCUS_01300 17191 18201 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230154.1 protein_id gnl|my_center|LOCUS_01300 18434 21319 gene locus_tag LOCUS_01310 18434 21319 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977982.1 protein_id gnl|my_center|LOCUS_01310 21438 22250 gene locus_tag LOCUS_01320 21438 22250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223279.1 protein_id gnl|my_center|LOCUS_01320 22247 22966 gene locus_tag LOCUS_01330 22247 22966 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223280.1 protein_id gnl|my_center|LOCUS_01330 22976 23827 gene locus_tag LOCUS_01340 22976 23827 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223281.1 protein_id gnl|my_center|LOCUS_01340 23834 24931 gene locus_tag LOCUS_01350 23834 24931 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223282.1 protein_id gnl|my_center|LOCUS_01350 24948 26276 gene locus_tag LOCUS_01360 24948 26276 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223283.1 protein_id gnl|my_center|LOCUS_01360 27368 26406 gene locus_tag LOCUS_01370 27368 26406 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229249.1 protein_id gnl|my_center|LOCUS_01370 28523 27669 gene locus_tag LOCUS_01380 28523 27669 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727900.1 protein_id gnl|my_center|LOCUS_01380 29979 28606 gene locus_tag LOCUS_01390 29979 28606 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223336.1 protein_id gnl|my_center|LOCUS_01390 30461 31525 gene locus_tag LOCUS_01400 30461 31525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 >Feature sequence006 3 293 gene locus_tag LOCUS_01410 3 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 585 1067 gene locus_tag LOCUS_01420 gene carD 585 1067 CDS product RNA polymerase-binding transcription factor CarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419482.1 protein_id gnl|my_center|LOCUS_01420 1176 1637 gene locus_tag LOCUS_01430 gene ispF 1176 1637 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731018.1 protein_id gnl|my_center|LOCUS_01430 3225 1714 gene locus_tag LOCUS_01440 3225 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 3515 4912 gene locus_tag LOCUS_01450 gene cysS 3515 4912 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_01450 5018 5983 gene locus_tag LOCUS_01460 gene rlmB 5018 5983 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731016.1 protein_id gnl|my_center|LOCUS_01460 6164 6237 gene locus_tag LOCUS_t00020 6164 6237 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6887 6489 gene locus_tag LOCUS_01470 6887 6489 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030668.1 protein_id gnl|my_center|LOCUS_01470 7234 9687 gene locus_tag LOCUS_01480 7234 9687 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086676679.1 protein_id gnl|my_center|LOCUS_01480 9684 10151 gene locus_tag LOCUS_01490 9684 10151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228336.1 protein_id gnl|my_center|LOCUS_01490 11008 10343 gene locus_tag LOCUS_01500 11008 10343 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222618.1 protein_id gnl|my_center|LOCUS_01500 11731 11075 gene locus_tag LOCUS_01510 11731 11075 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775821.1 protein_id gnl|my_center|LOCUS_01510 11785 12771 gene locus_tag LOCUS_01520 11785 12771 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775822.1 protein_id gnl|my_center|LOCUS_01520 15390 12856 gene locus_tag LOCUS_01530 15390 12856 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179552221.1 protein_id gnl|my_center|LOCUS_01530 16139 15447 gene locus_tag LOCUS_01540 16139 15447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 16692 16198 gene locus_tag LOCUS_01550 16692 16198 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730836.1 protein_id gnl|my_center|LOCUS_01550 16888 17094 gene locus_tag LOCUS_01560 16888 17094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 17196 18167 gene locus_tag LOCUS_01570 17196 18167 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978080.1 protein_id gnl|my_center|LOCUS_01570 18408 18214 gene locus_tag LOCUS_01580 18408 18214 CDS product DUF1918 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285998.1 protein_id gnl|my_center|LOCUS_01580 18635 19462 gene locus_tag LOCUS_01590 18635 19462 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109967.1 protein_id gnl|my_center|LOCUS_01590 22029 19507 gene locus_tag LOCUS_01600 22029 19507 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258185.1 protein_id gnl|my_center|LOCUS_01600 22991 22104 gene locus_tag LOCUS_01610 22991 22104 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028612.1 protein_id gnl|my_center|LOCUS_01610 23278 24384 gene locus_tag LOCUS_01620 23278 24384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413610.1 protein_id gnl|my_center|LOCUS_01620 24690 24418 gene locus_tag LOCUS_01630 24690 24418 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973180.1 protein_id gnl|my_center|LOCUS_01630 24920 26635 gene locus_tag LOCUS_01640 24920 26635 CDS product phosphoenolpyruvate-utilizing N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104530.1 protein_id gnl|my_center|LOCUS_01640 27783 26623 gene locus_tag LOCUS_01650 gene argJ 27783 26623 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123874.1 protein_id gnl|my_center|LOCUS_01650 27961 28989 gene locus_tag LOCUS_01660 27961 28989 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_01660 29816 28995 gene locus_tag LOCUS_01670 gene otsB 29816 28995 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029558.1 protein_id gnl|my_center|LOCUS_01670 30211 29927 gene locus_tag LOCUS_01680 30211 29927 CDS product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230291.1 protein_id gnl|my_center|LOCUS_01680 >Feature sequence007 <1 1614 gene locus_tag LOCUS_01690 <1 1614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026995.1:glycoside hydrolase family 3 N-terminal domain-containing protein 1615 2775 gene locus_tag LOCUS_01700 1615 2775 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027544.1 protein_id gnl|my_center|LOCUS_01700 2810 3811 gene locus_tag LOCUS_01710 2810 3811 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970413.1 protein_id gnl|my_center|LOCUS_01710 3814 4971 gene locus_tag LOCUS_01720 3814 4971 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316066.1 protein_id gnl|my_center|LOCUS_01720 4983 6089 gene locus_tag LOCUS_01730 4983 6089 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584052.1 protein_id gnl|my_center|LOCUS_01730 6079 7170 gene locus_tag LOCUS_01740 6079 7170 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_01740 7243 9129 gene locus_tag LOCUS_01750 7243 9129 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973626.1 protein_id gnl|my_center|LOCUS_01750 9201 10205 gene locus_tag LOCUS_01760 9201 10205 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978441.1 protein_id gnl|my_center|LOCUS_01760 10202 10945 gene locus_tag LOCUS_01770 10202 10945 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223575.1 protein_id gnl|my_center|LOCUS_01770 11185 11100 gene locus_tag LOCUS_t00030 11185 11100 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11412 12179 gene locus_tag LOCUS_01780 gene fhaA 11412 12179 CDS product antibiotic biosynthesis regulator FhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975091.1 protein_id gnl|my_center|LOCUS_01780 12474 12965 gene locus_tag LOCUS_01790 gene fhaB 12474 12965 CDS product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_01790 12962 14314 gene locus_tag LOCUS_01800 12962 14314 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029266.1 protein_id gnl|my_center|LOCUS_01800 14319 15746 gene locus_tag LOCUS_01810 14319 15746 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029267.1 protein_id gnl|my_center|LOCUS_01810 15743 17212 gene locus_tag LOCUS_01820 15743 17212 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776672.1 protein_id gnl|my_center|LOCUS_01820 17212 18666 gene locus_tag LOCUS_01830 17212 18666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 18753 20564 gene locus_tag LOCUS_01840 gene pknB 18753 20564 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891355.1 protein_id gnl|my_center|LOCUS_01840 20737 20991 gene locus_tag LOCUS_01850 gene crgA 20737 20991 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975080.1 protein_id gnl|my_center|LOCUS_01850 22016 21108 gene locus_tag LOCUS_01860 22016 21108 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495744.1 protein_id gnl|my_center|LOCUS_01860 22579 22055 gene locus_tag LOCUS_01870 22579 22055 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005116126.1 protein_id gnl|my_center|LOCUS_01870 22836 23426 gene locus_tag LOCUS_01880 22836 23426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 24122 23487 gene locus_tag LOCUS_01890 24122 23487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 24668 24339 gene locus_tag LOCUS_01900 gene wblA 24668 24339 CDS product transcriptional regulator WblA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029097.1 protein_id gnl|my_center|LOCUS_01900 25925 25850 gene locus_tag LOCUS_t00040 25925 25850 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 26283 26161 gene locus_tag LOCUS_01910 26283 26161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 27289 26456 gene locus_tag LOCUS_01920 27289 26456 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976840.1 protein_id gnl|my_center|LOCUS_01920 27573 27737 gene locus_tag LOCUS_01930 27573 27737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 27721 28029 gene locus_tag LOCUS_01940 27721 28029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 >Feature sequence008 <1 869 gene locus_tag LOCUS_01950 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812086.1:sulfatase-like hydrolase/transferase 1734 937 gene locus_tag LOCUS_01960 1734 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 2758 1727 gene locus_tag LOCUS_01970 2758 1727 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085654.1 protein_id gnl|my_center|LOCUS_01970 3635 2751 gene locus_tag LOCUS_01980 3635 2751 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537951.1 protein_id gnl|my_center|LOCUS_01980 4591 3632 gene locus_tag LOCUS_01990 4591 3632 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810637.1 protein_id gnl|my_center|LOCUS_01990 6116 4608 gene locus_tag LOCUS_02000 6116 4608 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015037.1 protein_id gnl|my_center|LOCUS_02000 7355 6441 gene locus_tag LOCUS_02010 7355 6441 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918355.1 protein_id gnl|my_center|LOCUS_02010 8186 7410 gene locus_tag LOCUS_02020 8186 7410 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891557.1 protein_id gnl|my_center|LOCUS_02020 9006 8236 gene locus_tag LOCUS_02030 9006 8236 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973042.1 protein_id gnl|my_center|LOCUS_02030 10172 9003 gene locus_tag LOCUS_02040 10172 9003 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896599.1 protein_id gnl|my_center|LOCUS_02040 10942 10193 gene locus_tag LOCUS_02050 10942 10193 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_02050 12150 10939 gene locus_tag LOCUS_02060 12150 10939 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081124.1 protein_id gnl|my_center|LOCUS_02060 13363 12227 gene locus_tag LOCUS_02070 13363 12227 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462348.1 protein_id gnl|my_center|LOCUS_02070 14913 13360 gene locus_tag LOCUS_02080 14913 13360 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 protein_id gnl|my_center|LOCUS_02080 16076 14895 gene locus_tag LOCUS_02090 16076 14895 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728131.1 protein_id gnl|my_center|LOCUS_02090 17185 16076 gene locus_tag LOCUS_02100 17185 16076 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728132.1 protein_id gnl|my_center|LOCUS_02100 18447 17218 gene locus_tag LOCUS_02110 18447 17218 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225726.1 protein_id gnl|my_center|LOCUS_02110 19839 18457 gene locus_tag LOCUS_02120 19839 18457 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846143.1 protein_id gnl|my_center|LOCUS_02120 20036 20665 gene locus_tag LOCUS_02130 20036 20665 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087056.1 protein_id gnl|my_center|LOCUS_02130 20705 21874 gene locus_tag LOCUS_02140 20705 21874 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258129.1 protein_id gnl|my_center|LOCUS_02140 22025 22882 gene locus_tag LOCUS_02150 22025 22882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 23720 22890 gene locus_tag LOCUS_02160 23720 22890 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030982.1 protein_id gnl|my_center|LOCUS_02160 24989 24006 gene locus_tag LOCUS_02170 24989 24006 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226116.1 protein_id gnl|my_center|LOCUS_02170 25157 26821 gene locus_tag LOCUS_02180 25157 26821 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226120.1 protein_id gnl|my_center|LOCUS_02180 >Feature sequence009 <1 2293 gene locus_tag LOCUS_02190 <1 2293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_113701643.1:DNA translocase FtsK 2423 3496 gene locus_tag LOCUS_02200 2423 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 3592 3813 gene locus_tag LOCUS_02210 3592 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 3764 5215 gene locus_tag LOCUS_02220 gene rimO 3764 5215 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973272.1 protein_id gnl|my_center|LOCUS_02220 5212 5799 gene locus_tag LOCUS_02230 gene pgsA 5212 5799 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894077.1 protein_id gnl|my_center|LOCUS_02230 5792 6316 gene locus_tag LOCUS_02240 5792 6316 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030436.1 protein_id gnl|my_center|LOCUS_02240 6475 6831 gene locus_tag LOCUS_02250 6475 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 7453 6989 gene locus_tag LOCUS_02260 7453 6989 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259066.1 protein_id gnl|my_center|LOCUS_02260 9125 7653 gene locus_tag LOCUS_02270 9125 7653 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030127.1 protein_id gnl|my_center|LOCUS_02270 10105 9224 gene locus_tag LOCUS_02280 10105 9224 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776528.1 protein_id gnl|my_center|LOCUS_02280 11088 10102 gene locus_tag LOCUS_02290 11088 10102 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973738.1 protein_id gnl|my_center|LOCUS_02290 12461 11175 gene locus_tag LOCUS_02300 12461 11175 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776530.1 protein_id gnl|my_center|LOCUS_02300 12716 13930 gene locus_tag LOCUS_02310 12716 13930 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013003532.1 protein_id gnl|my_center|LOCUS_02310 14592 14095 gene locus_tag LOCUS_02320 14592 14095 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229593.1 protein_id gnl|my_center|LOCUS_02320 14773 14940 gene locus_tag LOCUS_02330 14773 14940 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224216.1 protein_id gnl|my_center|LOCUS_02330 15105 18617 gene locus_tag LOCUS_02340 15105 18617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 18610 19167 gene locus_tag LOCUS_02350 18610 19167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 19941 19204 gene locus_tag LOCUS_02360 19941 19204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 22067 19938 gene locus_tag LOCUS_02370 22067 19938 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972490.1 protein_id gnl|my_center|LOCUS_02370 22333 23376 gene locus_tag LOCUS_02380 22333 23376 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_02380 23448 23684 gene locus_tag LOCUS_02390 23448 23684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 23635 26628 gene locus_tag LOCUS_02400 23635 26628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 >Feature sequence010 723 130 gene locus_tag LOCUS_02410 723 130 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896727.1 protein_id gnl|my_center|LOCUS_02410 2131 1043 gene locus_tag LOCUS_02420 2131 1043 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_02420 2578 2150 gene locus_tag LOCUS_02430 2578 2150 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_02430 3039 2596 gene locus_tag LOCUS_02440 3039 2596 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029784.1 protein_id gnl|my_center|LOCUS_02440 3370 3206 gene locus_tag LOCUS_02450 gene rpmG 3370 3206 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005152047.1 protein_id gnl|my_center|LOCUS_02450 3554 3481 gene locus_tag LOCUS_t00050 3554 3481 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3731 3656 gene locus_tag LOCUS_t00060 3731 3656 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6081 3988 gene locus_tag LOCUS_02460 6081 3988 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073950391.1 protein_id gnl|my_center|LOCUS_02460 10721 6174 gene locus_tag LOCUS_02470 10721 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 12054 10675 gene locus_tag LOCUS_02480 12054 10675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 12884 12054 gene locus_tag LOCUS_02490 12884 12054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 13500 13036 gene locus_tag LOCUS_02500 13500 13036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 13886 13641 gene locus_tag LOCUS_02510 13886 13641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 14185 13946 gene locus_tag LOCUS_02520 14185 13946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 14791 14709 gene locus_tag LOCUS_t00070 14791 14709 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 14995 15522 gene locus_tag LOCUS_02530 14995 15522 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077736.1 protein_id gnl|my_center|LOCUS_02530 16425 15565 gene locus_tag LOCUS_02540 gene htpX 16425 15565 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974338.1 protein_id gnl|my_center|LOCUS_02540 16815 16633 gene locus_tag LOCUS_02550 16815 16633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 16914 18764 gene locus_tag LOCUS_02560 16914 18764 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_02560 18757 19827 gene locus_tag LOCUS_02570 18757 19827 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_02570 19857 20594 gene locus_tag LOCUS_02580 19857 20594 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222032.1 protein_id gnl|my_center|LOCUS_02580 20777 21286 gene locus_tag LOCUS_02590 20777 21286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 21905 21375 gene locus_tag LOCUS_02600 21905 21375 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870827.1 protein_id gnl|my_center|LOCUS_02600 22247 25258 gene locus_tag LOCUS_02610 22247 25258 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873412.1 protein_id gnl|my_center|LOCUS_02610 26336 25332 gene locus_tag LOCUS_02620 26336 25332 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813114.1 protein_id gnl|my_center|LOCUS_02620 >Feature sequence011 <1 662 gene locus_tag LOCUS_02630 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227897.1:S9 family peptidase 1106 2164 gene locus_tag LOCUS_02640 1106 2164 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029867.1 protein_id gnl|my_center|LOCUS_02640 2218 2391 gene locus_tag LOCUS_02650 2218 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 3826 2675 gene locus_tag LOCUS_02660 gene pstS 3826 2675 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776547.1 protein_id gnl|my_center|LOCUS_02660 3997 6492 gene locus_tag LOCUS_02670 gene treY 3997 6492 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224464.1 protein_id gnl|my_center|LOCUS_02670 6540 7394 gene locus_tag LOCUS_02680 6540 7394 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804543.1 protein_id gnl|my_center|LOCUS_02680 7561 9213 gene locus_tag LOCUS_02690 gene treZ 7561 9213 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224465.1 protein_id gnl|my_center|LOCUS_02690 9552 10091 gene locus_tag LOCUS_02700 9552 10091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 10212 10814 gene locus_tag LOCUS_02710 10212 10814 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974978.1 protein_id gnl|my_center|LOCUS_02710 10811 12073 gene locus_tag LOCUS_02720 gene efeB 10811 12073 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029343.1 protein_id gnl|my_center|LOCUS_02720 12138 12701 gene locus_tag LOCUS_02730 12138 12701 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777063.1 protein_id gnl|my_center|LOCUS_02730 12768 13469 gene locus_tag LOCUS_02740 12768 13469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 14250 13486 gene locus_tag LOCUS_02750 14250 13486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 16679 14436 gene locus_tag LOCUS_02760 16679 14436 CDS product DUF6351 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 protein_id gnl|my_center|LOCUS_02760 17567 17001 gene locus_tag LOCUS_02770 17567 17001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 17924 18580 gene locus_tag LOCUS_02780 17924 18580 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_02780 20394 18616 gene locus_tag LOCUS_02790 20394 18616 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026923.1 protein_id gnl|my_center|LOCUS_02790 22235 21012 gene locus_tag LOCUS_02800 22235 21012 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227533.1 protein_id gnl|my_center|LOCUS_02800 22849 22232 gene locus_tag LOCUS_02810 22849 22232 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227534.1 protein_id gnl|my_center|LOCUS_02810 23568 22918 gene locus_tag LOCUS_02820 23568 22918 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804238.1 protein_id gnl|my_center|LOCUS_02820 23567 23884 gene locus_tag LOCUS_02830 23567 23884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 23830 24243 gene locus_tag LOCUS_02840 23830 24243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 <26056 24290 gene locus_tag LOCUS_02850 <26056 24290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229590.1:PH domain-containing protein >Feature sequence012 280 759 gene locus_tag LOCUS_02860 280 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 872 1819 gene locus_tag LOCUS_02870 872 1819 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976689.1 protein_id gnl|my_center|LOCUS_02870 2659 1835 gene locus_tag LOCUS_02880 2659 1835 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469516.1 protein_id gnl|my_center|LOCUS_02880 3013 3810 gene locus_tag LOCUS_02890 3013 3810 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_02890 3807 4718 gene locus_tag LOCUS_02900 3807 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 4851 5882 gene locus_tag LOCUS_02910 4851 5882 CDS product DUF5931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976694.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02910 6169 7215 gene locus_tag LOCUS_02920 gene aroF 6169 7215 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393889.1 protein_id gnl|my_center|LOCUS_02920 8660 7374 gene locus_tag LOCUS_02930 gene thiI 8660 7374 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_02930 9885 8860 gene locus_tag LOCUS_02940 9885 8860 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224333.1 protein_id gnl|my_center|LOCUS_02940 10749 10078 gene locus_tag LOCUS_02950 10749 10078 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976695.1 protein_id gnl|my_center|LOCUS_02950 12758 10803 gene locus_tag LOCUS_02960 gene pknB 12758 10803 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224192.1 protein_id gnl|my_center|LOCUS_02960 13843 13082 gene locus_tag LOCUS_02970 13843 13082 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976707.1 protein_id gnl|my_center|LOCUS_02970 14061 13846 gene locus_tag LOCUS_02980 gene thiS 14061 13846 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976708.1 protein_id gnl|my_center|LOCUS_02980 15203 14061 gene locus_tag LOCUS_02990 gene thiO 15203 14061 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_02990 15357 15728 gene locus_tag LOCUS_03000 15357 15728 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805032.1 protein_id gnl|my_center|LOCUS_03000 15921 16595 gene locus_tag LOCUS_03010 gene thiE 15921 16595 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230303.1 protein_id gnl|my_center|LOCUS_03010 17496 16603 gene locus_tag LOCUS_03020 17496 16603 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261950.1 protein_id gnl|my_center|LOCUS_03020 18693 17617 gene locus_tag LOCUS_03030 18693 17617 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171512886.1 protein_id gnl|my_center|LOCUS_03030 18809 19753 gene locus_tag LOCUS_03040 gene metF 18809 19753 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028143.1 protein_id gnl|my_center|LOCUS_03040 20300 19731 gene locus_tag LOCUS_03050 20300 19731 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224203.1 protein_id gnl|my_center|LOCUS_03050 21019 20525 gene locus_tag LOCUS_03060 gene bldD 21019 20525 CDS product transcriptional regulator BldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 protein_id gnl|my_center|LOCUS_03060 21520 22146 gene locus_tag LOCUS_03070 gene pyrR 21520 22146 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 protein_id gnl|my_center|LOCUS_03070 22143 23054 gene locus_tag LOCUS_03080 22143 23054 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_03080 23139 24443 gene locus_tag LOCUS_03090 23139 24443 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_03090 24479 25639 gene locus_tag LOCUS_03100 gene carA 24479 25639 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_03100 >Feature sequence013 1511 327 gene locus_tag LOCUS_03110 1511 327 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814767.1 protein_id gnl|my_center|LOCUS_03110 2819 1893 gene locus_tag LOCUS_03120 2819 1893 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 protein_id gnl|my_center|LOCUS_03120 3054 4505 gene locus_tag LOCUS_03130 3054 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 5176 4574 gene locus_tag LOCUS_03140 5176 4574 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013405.1 protein_id gnl|my_center|LOCUS_03140 6107 5121 gene locus_tag LOCUS_03150 6107 5121 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230075.1 protein_id gnl|my_center|LOCUS_03150 6925 6134 gene locus_tag LOCUS_03160 6925 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 7974 6922 gene locus_tag LOCUS_03170 7974 6922 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230077.1 protein_id gnl|my_center|LOCUS_03170 8357 7971 gene locus_tag LOCUS_03180 8357 7971 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230078.1 protein_id gnl|my_center|LOCUS_03180 9349 8369 gene locus_tag LOCUS_03190 9349 8369 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485699.1 protein_id gnl|my_center|LOCUS_03190 10142 9417 gene locus_tag LOCUS_03200 10142 9417 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031073.1 protein_id gnl|my_center|LOCUS_03200 10371 11420 gene locus_tag LOCUS_03210 10371 11420 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 protein_id gnl|my_center|LOCUS_03210 12553 11495 gene locus_tag LOCUS_03220 12553 11495 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229172.1 protein_id gnl|my_center|LOCUS_03220 12863 14383 gene locus_tag LOCUS_03230 12863 14383 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226378.1 protein_id gnl|my_center|LOCUS_03230 14380 15435 gene locus_tag LOCUS_03240 14380 15435 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226379.1 protein_id gnl|my_center|LOCUS_03240 15425 16504 gene locus_tag LOCUS_03250 15425 16504 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226380.1 protein_id gnl|my_center|LOCUS_03250 16501 17565 gene locus_tag LOCUS_03260 gene rhaS 16501 17565 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226381.1 protein_id gnl|my_center|LOCUS_03260 17574 17930 gene locus_tag LOCUS_03270 17574 17930 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978053.1 protein_id gnl|my_center|LOCUS_03270 19130 18132 gene locus_tag LOCUS_03280 19130 18132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 19306 19896 gene locus_tag LOCUS_03290 19306 19896 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229278.1 protein_id gnl|my_center|LOCUS_03290 20869 19988 gene locus_tag LOCUS_03300 20869 19988 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907735.1 protein_id gnl|my_center|LOCUS_03300 21938 21027 gene locus_tag LOCUS_03310 21938 21027 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531451.1 protein_id gnl|my_center|LOCUS_03310 23833 21935 gene locus_tag LOCUS_03320 23833 21935 CDS product sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226206.1 protein_id gnl|my_center|LOCUS_03320 24915 23920 gene locus_tag LOCUS_03330 24915 23920 CDS product sialic acid TRAP transporter substrate-binding protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392308.1 protein_id gnl|my_center|LOCUS_03330 >Feature sequence014 776 306 gene locus_tag LOCUS_03340 776 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 3440 990 gene locus_tag LOCUS_03350 3440 990 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029076.1 protein_id gnl|my_center|LOCUS_03350 4418 3918 gene locus_tag LOCUS_03360 4418 3918 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730327.1 protein_id gnl|my_center|LOCUS_03360 5358 4426 gene locus_tag LOCUS_03370 5358 4426 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029089.1 protein_id gnl|my_center|LOCUS_03370 5866 5369 gene locus_tag LOCUS_03380 5866 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 8039 6072 gene locus_tag LOCUS_03390 gene acs 8039 6072 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_03390 8238 9050 gene locus_tag LOCUS_03400 8238 9050 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975377.1 protein_id gnl|my_center|LOCUS_03400 9409 9597 gene locus_tag LOCUS_03410 9409 9597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 9806 10867 gene locus_tag LOCUS_03420 9806 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 10864 12000 gene locus_tag LOCUS_03430 10864 12000 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 protein_id gnl|my_center|LOCUS_03430 11997 12659 gene locus_tag LOCUS_03440 11997 12659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 12674 13369 gene locus_tag LOCUS_03450 12674 13369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 14129 13692 gene locus_tag LOCUS_03460 14129 13692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 14645 14184 gene locus_tag LOCUS_03470 14645 14184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 15013 14642 gene locus_tag LOCUS_03480 15013 14642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 15371 15018 gene locus_tag LOCUS_03490 15371 15018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 15648 15388 gene locus_tag LOCUS_03500 15648 15388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 18148 15848 gene locus_tag LOCUS_03510 18148 15848 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485160.1 protein_id gnl|my_center|LOCUS_03510 18385 18732 gene locus_tag LOCUS_03520 gene bldG 18385 18732 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_03520 18746 19288 gene locus_tag LOCUS_03530 18746 19288 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975387.1 protein_id gnl|my_center|LOCUS_03530 20534 19356 gene locus_tag LOCUS_03540 20534 19356 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209493.1 protein_id gnl|my_center|LOCUS_03540 21209 20556 gene locus_tag LOCUS_03550 21209 20556 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_03550 22043 21309 gene locus_tag LOCUS_03560 22043 21309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 22310 22993 gene locus_tag LOCUS_03570 22310 22993 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_03570 23852 23046 gene locus_tag LOCUS_03580 23852 23046 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_03580 24774 23938 gene locus_tag LOCUS_03590 24774 23938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 protein_id gnl|my_center|LOCUS_03590 >Feature sequence015 <1 506 gene locus_tag LOCUS_03600 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920258.1:AMP-binding protein 532 987 gene locus_tag LOCUS_03610 532 987 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863309.1 protein_id gnl|my_center|LOCUS_03610 1082 1783 gene locus_tag LOCUS_03620 1082 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 2943 1819 gene locus_tag LOCUS_03630 2943 1819 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975925.1 protein_id gnl|my_center|LOCUS_03630 4331 2913 gene locus_tag LOCUS_03640 4331 2913 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972616.1 protein_id gnl|my_center|LOCUS_03640 4898 5596 gene locus_tag LOCUS_03650 4898 5596 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073799.1 protein_id gnl|my_center|LOCUS_03650 6808 5687 gene locus_tag LOCUS_03660 6808 5687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 7440 8306 gene locus_tag LOCUS_03670 7440 8306 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971569.1 protein_id gnl|my_center|LOCUS_03670 8581 9063 gene locus_tag LOCUS_03680 8581 9063 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092530.1 protein_id gnl|my_center|LOCUS_03680 9429 11051 gene locus_tag LOCUS_03690 9429 11051 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193073.1 protein_id gnl|my_center|LOCUS_03690 11943 11335 gene locus_tag LOCUS_03700 11943 11335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 12208 12843 gene locus_tag LOCUS_03710 12208 12843 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228740.1 protein_id gnl|my_center|LOCUS_03710 13308 12850 gene locus_tag LOCUS_03720 gene aroQ 13308 12850 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393049.1 protein_id gnl|my_center|LOCUS_03720 13450 15246 gene locus_tag LOCUS_03730 13450 15246 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114561.1 protein_id gnl|my_center|LOCUS_03730 15805 15275 gene locus_tag LOCUS_03740 15805 15275 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223545.1 protein_id gnl|my_center|LOCUS_03740 18267 15865 gene locus_tag LOCUS_03750 18267 15865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 20145 18373 gene locus_tag LOCUS_03760 20145 18373 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804472.1 protein_id gnl|my_center|LOCUS_03760 21328 20294 gene locus_tag LOCUS_03770 21328 20294 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 protein_id gnl|my_center|LOCUS_03770 23146 21398 gene locus_tag LOCUS_03780 23146 21398 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973521.1 protein_id gnl|my_center|LOCUS_03780 24302 23250 gene locus_tag LOCUS_03790 24302 23250 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_03790 24371 24601 gene locus_tag LOCUS_03800 24371 24601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 >Feature sequence016 2089 287 gene locus_tag LOCUS_03810 2089 287 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327729.1 protein_id gnl|my_center|LOCUS_03810 2589 3482 gene locus_tag LOCUS_03820 2589 3482 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028071.1 protein_id gnl|my_center|LOCUS_03820 3603 4838 gene locus_tag LOCUS_03830 3603 4838 CDS product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973990.1 protein_id gnl|my_center|LOCUS_03830 6430 4856 gene locus_tag LOCUS_03840 6430 4856 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028675.1 protein_id gnl|my_center|LOCUS_03840 6655 6978 gene locus_tag LOCUS_03850 6655 6978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 8012 7065 gene locus_tag LOCUS_03860 8012 7065 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028565.1 protein_id gnl|my_center|LOCUS_03860 8145 9473 gene locus_tag LOCUS_03870 8145 9473 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485736.1 protein_id gnl|my_center|LOCUS_03870 9813 10067 gene locus_tag LOCUS_03880 9813 10067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 10386 10135 gene locus_tag LOCUS_03890 10386 10135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 10267 11667 gene locus_tag LOCUS_03900 10267 11667 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836461.1 protein_id gnl|my_center|LOCUS_03900 12626 11748 gene locus_tag LOCUS_03910 gene thiD 12626 11748 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822280.1 protein_id gnl|my_center|LOCUS_03910 13633 12704 gene locus_tag LOCUS_03920 13633 12704 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776432.1 protein_id gnl|my_center|LOCUS_03920 15614 13953 gene locus_tag LOCUS_03930 15614 13953 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742163.1 protein_id gnl|my_center|LOCUS_03930 15984 17255 gene locus_tag LOCUS_03940 gene rocD 15984 17255 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727654.1 protein_id gnl|my_center|LOCUS_03940 18722 17370 gene locus_tag LOCUS_03950 18722 17370 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128367847.1 protein_id gnl|my_center|LOCUS_03950 19853 19239 gene locus_tag LOCUS_03960 19853 19239 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775980.1 protein_id gnl|my_center|LOCUS_03960 20348 22399 gene locus_tag LOCUS_03970 20348 22399 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111245.1 protein_id gnl|my_center|LOCUS_03970 22566 23603 gene locus_tag LOCUS_03980 22566 23603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 24162 23707 gene locus_tag LOCUS_03990 24162 23707 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893575.1 protein_id gnl|my_center|LOCUS_03990 <24822 24222 gene locus_tag LOCUS_04000 <24822 24222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398737.1:o-succinylbenzoate synthase >Feature sequence017 1281 268 gene locus_tag LOCUS_04010 1281 268 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027977.1 protein_id gnl|my_center|LOCUS_04010 2317 1286 gene locus_tag LOCUS_04020 2317 1286 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211882.1 protein_id gnl|my_center|LOCUS_04020 3691 2531 gene locus_tag LOCUS_04030 3691 2531 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091709.1 protein_id gnl|my_center|LOCUS_04030 4421 3819 gene locus_tag LOCUS_04040 4421 3819 CDS product CueP family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015531.1 protein_id gnl|my_center|LOCUS_04040 4752 5228 gene locus_tag LOCUS_04050 4752 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 5261 5186 gene locus_tag LOCUS_t00080 5261 5186 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5791 5327 gene locus_tag LOCUS_04060 5791 5327 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224001.1 protein_id gnl|my_center|LOCUS_04060 6324 5899 gene locus_tag LOCUS_04070 6324 5899 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202437260.1 protein_id gnl|my_center|LOCUS_04070 6913 6506 gene locus_tag LOCUS_04080 6913 6506 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 protein_id gnl|my_center|LOCUS_04080 7053 8705 gene locus_tag LOCUS_04090 7053 8705 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143814.1 protein_id gnl|my_center|LOCUS_04090 9811 8867 gene locus_tag LOCUS_04100 9811 8867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 11381 10140 gene locus_tag LOCUS_04110 gene fasR 11381 10140 CDS product fatty acid biosynthesis transcriptional regulator FasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028321.1 protein_id gnl|my_center|LOCUS_04110 11629 12609 gene locus_tag LOCUS_04120 11629 12609 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028322.1 protein_id gnl|my_center|LOCUS_04120 12612 13568 gene locus_tag LOCUS_04130 12612 13568 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031009.1 protein_id gnl|my_center|LOCUS_04130 13679 13918 gene locus_tag LOCUS_04140 13679 13918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 14035 15273 gene locus_tag LOCUS_04150 14035 15273 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028323.1 protein_id gnl|my_center|LOCUS_04150 16465 15503 gene locus_tag LOCUS_04160 16465 15503 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230311.1 protein_id gnl|my_center|LOCUS_04160 17083 19293 gene locus_tag LOCUS_04170 17083 19293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 19894 19517 gene locus_tag LOCUS_04180 19894 19517 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057839.1 protein_id gnl|my_center|LOCUS_04180 20367 19894 gene locus_tag LOCUS_04190 20367 19894 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224701.1 protein_id gnl|my_center|LOCUS_04190 21669 20383 gene locus_tag LOCUS_04200 21669 20383 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224700.1 protein_id gnl|my_center|LOCUS_04200 22434 21673 gene locus_tag LOCUS_04210 gene sufC 22434 21673 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057836.1 protein_id gnl|my_center|LOCUS_04210 22783 22442 gene locus_tag LOCUS_04220 22783 22442 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_04220 23936 22776 gene locus_tag LOCUS_04230 gene sufD 23936 22776 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 protein_id gnl|my_center|LOCUS_04230 <24705 23938 gene locus_tag LOCUS_04240 <24705 23938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976894.1:Fe-S cluster assembly protein SufB >Feature sequence018 577 1482 gene locus_tag LOCUS_04250 577 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 2347 1586 gene locus_tag LOCUS_04260 2347 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 3075 2344 gene locus_tag LOCUS_04270 3075 2344 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068426.1 protein_id gnl|my_center|LOCUS_04270 3469 4302 gene locus_tag LOCUS_04280 3469 4302 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112141.1 protein_id gnl|my_center|LOCUS_04280 4302 5192 gene locus_tag LOCUS_04290 4302 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 5428 6216 gene locus_tag LOCUS_04300 5428 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 6290 6922 gene locus_tag LOCUS_04310 6290 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 6939 7670 gene locus_tag LOCUS_04320 6939 7670 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031156.1 protein_id gnl|my_center|LOCUS_04320 7658 8725 gene locus_tag LOCUS_04330 7658 8725 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976203.1 protein_id gnl|my_center|LOCUS_04330 8691 9473 gene locus_tag LOCUS_04340 8691 9473 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270333.1 protein_id gnl|my_center|LOCUS_04340 9724 10590 gene locus_tag LOCUS_04350 9724 10590 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031159.1 protein_id gnl|my_center|LOCUS_04350 11249 10644 gene locus_tag LOCUS_04360 11249 10644 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973928.1 protein_id gnl|my_center|LOCUS_04360 12515 11337 gene locus_tag LOCUS_04370 12515 11337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 14106 12739 gene locus_tag LOCUS_04380 14106 12739 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974201.1 protein_id gnl|my_center|LOCUS_04380 15955 14207 gene locus_tag LOCUS_04390 15955 14207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 16221 17291 gene locus_tag LOCUS_04400 gene wecB 16221 17291 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 protein_id gnl|my_center|LOCUS_04400 17376 19112 gene locus_tag LOCUS_04410 17376 19112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 19202 21379 gene locus_tag LOCUS_04420 19202 21379 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930053.1 protein_id gnl|my_center|LOCUS_04420 22696 21410 gene locus_tag LOCUS_04430 gene draK 22696 21410 CDS product two-component system sensor histidine kinase DraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028744.1 protein_id gnl|my_center|LOCUS_04430 23420 22764 gene locus_tag LOCUS_04440 23420 22764 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975748.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence019 607 1011 gene locus_tag LOCUS_04450 607 1011 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398984.1 protein_id gnl|my_center|LOCUS_04450 1809 1030 gene locus_tag LOCUS_04460 gene pcaD 1809 1030 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449960.1 protein_id gnl|my_center|LOCUS_04460 1983 2171 gene locus_tag LOCUS_04470 1983 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 2585 3409 gene locus_tag LOCUS_04480 2585 3409 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805192.1 protein_id gnl|my_center|LOCUS_04480 3744 3385 gene locus_tag LOCUS_04490 3744 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 5442 3925 gene locus_tag LOCUS_04500 5442 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 5771 6502 gene locus_tag LOCUS_04510 5771 6502 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064741.1 protein_id gnl|my_center|LOCUS_04510 6614 7327 gene locus_tag LOCUS_04520 6614 7327 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975612.1 protein_id gnl|my_center|LOCUS_04520 7399 8382 gene locus_tag LOCUS_04530 7399 8382 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037025.1 protein_id gnl|my_center|LOCUS_04530 8856 8485 gene locus_tag LOCUS_04540 8856 8485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 9215 8853 gene locus_tag LOCUS_04550 9215 8853 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977138.1 protein_id gnl|my_center|LOCUS_04550 9327 9764 gene locus_tag LOCUS_04560 9327 9764 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532695.1 protein_id gnl|my_center|LOCUS_04560 9861 10190 gene locus_tag LOCUS_04570 9861 10190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 10187 10672 gene locus_tag LOCUS_04580 10187 10672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 10951 11322 gene locus_tag LOCUS_04590 gene trxA 10951 11322 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224532.1 protein_id gnl|my_center|LOCUS_04590 11612 12478 gene locus_tag LOCUS_04600 gene pstB 11612 12478 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_04600 12922 14046 gene locus_tag LOCUS_04610 gene pstS 12922 14046 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140448.1 protein_id gnl|my_center|LOCUS_04610 14151 15164 gene locus_tag LOCUS_04620 gene pstC 14151 15164 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656744.1 protein_id gnl|my_center|LOCUS_04620 15161 16072 gene locus_tag LOCUS_04630 gene pstA 15161 16072 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 protein_id gnl|my_center|LOCUS_04630 16189 16407 gene locus_tag LOCUS_04640 16189 16407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 16404 17021 gene locus_tag LOCUS_04650 16404 17021 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775785.1 protein_id gnl|my_center|LOCUS_04650 17765 17034 gene locus_tag LOCUS_04660 17765 17034 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030151.1 protein_id gnl|my_center|LOCUS_04660 18731 17877 gene locus_tag LOCUS_04670 gene hisG 18731 17877 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_04670 19086 18823 gene locus_tag LOCUS_04680 19086 18823 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226745.1 protein_id gnl|my_center|LOCUS_04680 20009 19185 gene locus_tag LOCUS_04690 20009 19185 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085720.1 protein_id gnl|my_center|LOCUS_04690 20187 20900 gene locus_tag LOCUS_04700 20187 20900 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921582.1 protein_id gnl|my_center|LOCUS_04700 21351 20980 gene locus_tag LOCUS_04710 21351 20980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 21815 21348 gene locus_tag LOCUS_04720 21815 21348 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030759.1 protein_id gnl|my_center|LOCUS_04720 22216 21908 gene locus_tag LOCUS_04730 22216 21908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 22448 22251 gene locus_tag LOCUS_04740 22448 22251 CDS product BldC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804527.1 protein_id gnl|my_center|LOCUS_04740 22890 22465 gene locus_tag LOCUS_04750 22890 22465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 23228 22887 gene locus_tag LOCUS_04760 23228 22887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 >Feature sequence020 868 50 gene locus_tag LOCUS_04770 gene proC 868 50 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975496.1 protein_id gnl|my_center|LOCUS_04770 1860 913 gene locus_tag LOCUS_04780 1860 913 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975487.1 protein_id gnl|my_center|LOCUS_04780 2589 2011 gene locus_tag LOCUS_04790 2589 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 3752 2826 gene locus_tag LOCUS_04800 3752 2826 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222519.1 protein_id gnl|my_center|LOCUS_04800 4054 5289 gene locus_tag LOCUS_04810 gene radA 4054 5289 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 protein_id gnl|my_center|LOCUS_04810 5767 5357 gene locus_tag LOCUS_04820 5767 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 6537 5845 gene locus_tag LOCUS_04830 6537 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 6667 7542 gene locus_tag LOCUS_04840 6667 7542 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 protein_id gnl|my_center|LOCUS_04840 10080 7633 gene locus_tag LOCUS_04850 10080 7633 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_04850 11155 10823 gene locus_tag LOCUS_04860 11155 10823 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975458.1 protein_id gnl|my_center|LOCUS_04860 11719 11366 gene locus_tag LOCUS_04870 11719 11366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 12583 12029 gene locus_tag LOCUS_04880 12583 12029 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975457.1 protein_id gnl|my_center|LOCUS_04880 13096 12773 gene locus_tag LOCUS_04890 13096 12773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 13083 13454 gene locus_tag LOCUS_04900 13083 13454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 15231 13738 gene locus_tag LOCUS_04910 15231 13738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 16093 15311 gene locus_tag LOCUS_04920 16093 15311 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975453.1 protein_id gnl|my_center|LOCUS_04920 17130 16159 gene locus_tag LOCUS_04930 gene nadC 17130 16159 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975452.1 protein_id gnl|my_center|LOCUS_04930 18104 17223 gene locus_tag LOCUS_04940 gene panC 18104 17223 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869216.1 protein_id gnl|my_center|LOCUS_04940 19073 18189 gene locus_tag LOCUS_04950 19073 18189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04950 19489 19253 gene locus_tag LOCUS_04960 19489 19253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 21220 19805 gene locus_tag LOCUS_04970 21220 19805 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013786.1 protein_id gnl|my_center|LOCUS_04970 21966 21439 gene locus_tag LOCUS_04980 21966 21439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 22552 22061 gene locus_tag LOCUS_04990 22552 22061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 >Feature sequence021 157 1299 gene locus_tag LOCUS_05000 157 1299 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 protein_id gnl|my_center|LOCUS_05000 3354 1417 gene locus_tag LOCUS_05010 3354 1417 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030396.1 protein_id gnl|my_center|LOCUS_05010 3951 4790 gene locus_tag LOCUS_05020 3951 4790 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078040.1 protein_id gnl|my_center|LOCUS_05020 4787 5686 gene locus_tag LOCUS_05030 gene rbsK 4787 5686 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526901.1 protein_id gnl|my_center|LOCUS_05030 7577 5826 gene locus_tag LOCUS_05040 gene argS 7577 5826 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804295.1 protein_id gnl|my_center|LOCUS_05040 8714 7620 gene locus_tag LOCUS_05050 gene plsX 8714 7620 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_05050 9132 10496 gene locus_tag LOCUS_05060 9132 10496 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_05060 10827 10594 gene locus_tag LOCUS_05070 10827 10594 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230745.1 protein_id gnl|my_center|LOCUS_05070 12152 11244 gene locus_tag LOCUS_05080 12152 11244 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_05080 12447 12998 gene locus_tag LOCUS_05090 12447 12998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 13167 13553 gene locus_tag LOCUS_05100 13167 13553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 14840 13599 gene locus_tag LOCUS_05110 14840 13599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 15206 16150 gene locus_tag LOCUS_05120 gene coaA 15206 16150 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974235.1 protein_id gnl|my_center|LOCUS_05120 16592 16203 gene locus_tag LOCUS_05130 16592 16203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 17866 16589 gene locus_tag LOCUS_05140 17866 16589 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_05140 18698 17892 gene locus_tag LOCUS_05150 18698 17892 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902971.1 protein_id gnl|my_center|LOCUS_05150 18991 19899 gene locus_tag LOCUS_05160 18991 19899 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 protein_id gnl|my_center|LOCUS_05160 20211 22031 gene locus_tag LOCUS_05170 20211 22031 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence022 2558 222 gene locus_tag LOCUS_05180 2558 222 CDS product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030395.1 protein_id gnl|my_center|LOCUS_05180 2714 3874 gene locus_tag LOCUS_05190 gene xylA 2714 3874 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_05190 4104 4964 gene locus_tag LOCUS_05200 4104 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 7122 5146 gene locus_tag LOCUS_05210 7122 5146 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226188.1 protein_id gnl|my_center|LOCUS_05210 8273 7230 gene locus_tag LOCUS_05220 8273 7230 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973334.1 protein_id gnl|my_center|LOCUS_05220 8794 8423 gene locus_tag LOCUS_05230 gene spoIIAA 8794 8423 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059135.1 protein_id gnl|my_center|LOCUS_05230 10159 9104 gene locus_tag LOCUS_05240 gene meaB 10159 9104 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222827.1 protein_id gnl|my_center|LOCUS_05240 12426 10210 gene locus_tag LOCUS_05250 gene scpA 12426 10210 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_05250 14405 12423 gene locus_tag LOCUS_05260 14405 12423 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742071.1 protein_id gnl|my_center|LOCUS_05260 15975 14539 gene locus_tag LOCUS_05270 15975 14539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 16709 16089 gene locus_tag LOCUS_05280 16709 16089 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 protein_id gnl|my_center|LOCUS_05280 16962 17621 gene locus_tag LOCUS_05290 16962 17621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 18370 17618 gene locus_tag LOCUS_05300 18370 17618 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028619.1 protein_id gnl|my_center|LOCUS_05300 18783 18490 gene locus_tag LOCUS_05310 18783 18490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 18954 19337 gene locus_tag LOCUS_05320 18954 19337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 20940 19327 gene locus_tag LOCUS_05330 20940 19327 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029987.1 protein_id gnl|my_center|LOCUS_05330 21058 21438 gene locus_tag LOCUS_05340 21058 21438 CDS product Rid family detoxifying hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804105.1 protein_id gnl|my_center|LOCUS_05340 21644 21973 gene locus_tag LOCUS_05350 21644 21973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587853.1 protein_id gnl|my_center|LOCUS_05350 >Feature sequence023 297 1346 gene locus_tag LOCUS_05360 297 1346 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_05360 2572 1598 gene locus_tag LOCUS_05370 2572 1598 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079794.1 protein_id gnl|my_center|LOCUS_05370 2792 2670 gene locus_tag LOCUS_05380 2792 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 3051 3986 gene locus_tag LOCUS_05390 3051 3986 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222332.1 protein_id gnl|my_center|LOCUS_05390 4159 4770 gene locus_tag LOCUS_05400 4159 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 4767 6017 gene locus_tag LOCUS_05410 4767 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 6836 6060 gene locus_tag LOCUS_05420 6836 6060 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030623.1 protein_id gnl|my_center|LOCUS_05420 7516 6824 gene locus_tag LOCUS_05430 7516 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228968.1 protein_id gnl|my_center|LOCUS_05430 8405 7545 gene locus_tag LOCUS_05440 gene folP 8405 7545 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327205.1 protein_id gnl|my_center|LOCUS_05440 9367 8399 gene locus_tag LOCUS_05450 9367 8399 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974682.1 protein_id gnl|my_center|LOCUS_05450 9585 10634 gene locus_tag LOCUS_05460 9585 10634 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902656.1 protein_id gnl|my_center|LOCUS_05460 11663 10644 gene locus_tag LOCUS_05470 11663 10644 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978084.1 protein_id gnl|my_center|LOCUS_05470 11791 13023 gene locus_tag LOCUS_05480 11791 13023 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408560.1 protein_id gnl|my_center|LOCUS_05480 13053 14258 gene locus_tag LOCUS_05490 13053 14258 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573847.1 protein_id gnl|my_center|LOCUS_05490 14616 14227 gene locus_tag LOCUS_05500 14616 14227 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831429.1 protein_id gnl|my_center|LOCUS_05500 14564 14743 gene locus_tag LOCUS_05510 14564 14743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 14808 15197 gene locus_tag LOCUS_05520 14808 15197 CDS product DUF2267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977706.1 protein_id gnl|my_center|LOCUS_05520 15892 15266 gene locus_tag LOCUS_05530 15892 15266 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226101.1 protein_id gnl|my_center|LOCUS_05530 16604 15957 gene locus_tag LOCUS_05540 16604 15957 CDS product DNA polymerase ligase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031607.1 protein_id gnl|my_center|LOCUS_05540 16871 18250 gene locus_tag LOCUS_05550 16871 18250 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086774.1 protein_id gnl|my_center|LOCUS_05550 18741 18361 gene locus_tag LOCUS_05560 18741 18361 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029513.1 protein_id gnl|my_center|LOCUS_05560 18887 19129 gene locus_tag LOCUS_05570 18887 19129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 19176 19364 gene locus_tag LOCUS_05580 19176 19364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 19401 19652 gene locus_tag LOCUS_05590 19401 19652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 19682 20938 gene locus_tag LOCUS_05600 19682 20938 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770220.1 protein_id gnl|my_center|LOCUS_05600 21161 20979 gene locus_tag LOCUS_05610 21161 20979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 >Feature sequence024 1196 438 gene locus_tag LOCUS_05620 gene nucS 1196 438 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007387684.1 protein_id gnl|my_center|LOCUS_05620 1385 2602 gene locus_tag LOCUS_05630 1385 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 2775 3020 gene locus_tag LOCUS_05640 2775 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 3063 3803 gene locus_tag LOCUS_05650 3063 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 5224 3923 gene locus_tag LOCUS_05660 5224 3923 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068425.1 protein_id gnl|my_center|LOCUS_05660 6043 5585 gene locus_tag LOCUS_05670 gene mce 6043 5585 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973598.1 protein_id gnl|my_center|LOCUS_05670 6145 7332 gene locus_tag LOCUS_05680 6145 7332 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030221.1 protein_id gnl|my_center|LOCUS_05680 7420 8394 gene locus_tag LOCUS_05690 gene meaB 7420 8394 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_05690 10433 8772 gene locus_tag LOCUS_05700 10433 8772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 10711 11160 gene locus_tag LOCUS_05710 10711 11160 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973586.1 protein_id gnl|my_center|LOCUS_05710 11190 12974 gene locus_tag LOCUS_05720 11190 12974 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030230.1 protein_id gnl|my_center|LOCUS_05720 13153 12950 gene locus_tag LOCUS_05730 13153 12950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 13295 14248 gene locus_tag LOCUS_05740 13295 14248 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973580.1 protein_id gnl|my_center|LOCUS_05740 14591 15988 gene locus_tag LOCUS_05750 14591 15988 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975860.1 protein_id gnl|my_center|LOCUS_05750 16054 16644 gene locus_tag LOCUS_05760 16054 16644 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_05760 16710 16958 gene locus_tag LOCUS_05770 16710 16958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 17322 18116 gene locus_tag LOCUS_05780 17322 18116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 18113 18379 gene locus_tag LOCUS_05790 18113 18379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 18471 20198 gene locus_tag LOCUS_05800 18471 20198 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975874.1 protein_id gnl|my_center|LOCUS_05800 >Feature sequence025 158 1255 gene locus_tag LOCUS_05810 158 1255 CDS product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229285.1 protein_id gnl|my_center|LOCUS_05810 1283 2134 gene locus_tag LOCUS_05820 1283 2134 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 protein_id gnl|my_center|LOCUS_05820 2350 4017 gene locus_tag LOCUS_05830 gene thiC 2350 4017 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230295.1 protein_id gnl|my_center|LOCUS_05830 4924 4109 gene locus_tag LOCUS_05840 4924 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 5150 5944 gene locus_tag LOCUS_05850 gene sigR 5150 5944 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_05850 5944 6252 gene locus_tag LOCUS_05860 gene rsrA 5944 6252 CDS product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973755.1 protein_id gnl|my_center|LOCUS_05860 6719 6937 gene locus_tag LOCUS_05870 6719 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 6994 8469 gene locus_tag LOCUS_05880 6994 8469 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030117.1 protein_id gnl|my_center|LOCUS_05880 8473 9822 gene locus_tag LOCUS_05890 8473 9822 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495247.1 protein_id gnl|my_center|LOCUS_05890 10638 9898 gene locus_tag LOCUS_05900 10638 9898 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973740.1 protein_id gnl|my_center|LOCUS_05900 10870 12363 gene locus_tag LOCUS_05910 10870 12363 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_05910 12757 12500 gene locus_tag LOCUS_05920 12757 12500 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_05920 13984 13052 gene locus_tag LOCUS_05930 13984 13052 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 protein_id gnl|my_center|LOCUS_05930 14029 14439 gene locus_tag LOCUS_05940 14029 14439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 15325 14522 gene locus_tag LOCUS_05950 15325 14522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 15747 15322 gene locus_tag LOCUS_05960 15747 15322 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973726.1 protein_id gnl|my_center|LOCUS_05960 16602 15958 gene locus_tag LOCUS_05970 16602 15958 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225120.1 protein_id gnl|my_center|LOCUS_05970 17448 16639 gene locus_tag LOCUS_05980 17448 16639 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 protein_id gnl|my_center|LOCUS_05980 18386 17448 gene locus_tag LOCUS_05990 18386 17448 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894625.1 protein_id gnl|my_center|LOCUS_05990 19370 18450 gene locus_tag LOCUS_06000 19370 18450 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025221252.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence026 2037 322 gene locus_tag LOCUS_06010 gene gcl 2037 322 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125316584.1 protein_id gnl|my_center|LOCUS_06010 3116 2229 gene locus_tag LOCUS_06020 3116 2229 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804444.1 protein_id gnl|my_center|LOCUS_06020 3967 3170 gene locus_tag LOCUS_06030 3967 3170 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804445.1 protein_id gnl|my_center|LOCUS_06030 4357 4911 gene locus_tag LOCUS_06040 gene uraD 4357 4911 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223820.1 protein_id gnl|my_center|LOCUS_06040 4908 5252 gene locus_tag LOCUS_06050 gene uraH 4908 5252 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223819.1 protein_id gnl|my_center|LOCUS_06050 5501 6397 gene locus_tag LOCUS_06060 gene pucL 5501 6397 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223818.1 protein_id gnl|my_center|LOCUS_06060 6654 8144 gene locus_tag LOCUS_06070 6654 8144 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972715.1 protein_id gnl|my_center|LOCUS_06070 8260 9195 gene locus_tag LOCUS_06080 8260 9195 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028476.1 protein_id gnl|my_center|LOCUS_06080 9285 10412 gene locus_tag LOCUS_06090 gene alc 9285 10412 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030765.1 protein_id gnl|my_center|LOCUS_06090 11853 10489 gene locus_tag LOCUS_06100 gene allB 11853 10489 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223822.1 protein_id gnl|my_center|LOCUS_06100 13219 11945 gene locus_tag LOCUS_06110 13219 11945 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_06110 13548 14249 gene locus_tag LOCUS_06120 gene allR 13548 14249 CDS product allantoin degradation transcriptional regulator AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972681.1 protein_id gnl|my_center|LOCUS_06120 15208 14246 gene locus_tag LOCUS_06130 gene era 15208 14246 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326176.1 protein_id gnl|my_center|LOCUS_06130 15562 15218 gene locus_tag LOCUS_06140 15562 15218 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456125.1 protein_id gnl|my_center|LOCUS_06140 16929 15559 gene locus_tag LOCUS_06150 16929 15559 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_06150 17405 16926 gene locus_tag LOCUS_06160 gene ybeY 17405 16926 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895867.1 protein_id gnl|my_center|LOCUS_06160 19594 17402 gene locus_tag LOCUS_06170 19594 17402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 >Feature sequence027 410 3436 gene locus_tag LOCUS_06180 410 3436 CDS product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153164114.1 protein_id gnl|my_center|LOCUS_06180 4092 3484 gene locus_tag LOCUS_06190 4092 3484 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083597.1 protein_id gnl|my_center|LOCUS_06190 4237 4575 gene locus_tag LOCUS_06200 4237 4575 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112726.1 protein_id gnl|my_center|LOCUS_06200 4652 6535 gene locus_tag LOCUS_06210 4652 6535 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112725.1 protein_id gnl|my_center|LOCUS_06210 7279 6635 gene locus_tag LOCUS_06220 7279 6635 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036809.1 protein_id gnl|my_center|LOCUS_06220 7754 7464 gene locus_tag LOCUS_06230 7754 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 7950 7768 gene locus_tag LOCUS_06240 7950 7768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 8807 8121 gene locus_tag LOCUS_06250 8807 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 8942 9925 gene locus_tag LOCUS_06260 8942 9925 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223005.1 protein_id gnl|my_center|LOCUS_06260 10563 9940 gene locus_tag LOCUS_06270 10563 9940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 11495 10560 gene locus_tag LOCUS_06280 11495 10560 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228449.1 protein_id gnl|my_center|LOCUS_06280 12040 11585 gene locus_tag LOCUS_06290 12040 11585 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027346.1 protein_id gnl|my_center|LOCUS_06290 12218 13135 gene locus_tag LOCUS_06300 12218 13135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 13218 14180 gene locus_tag LOCUS_06310 13218 14180 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228234.1 protein_id gnl|my_center|LOCUS_06310 14228 15172 gene locus_tag LOCUS_06320 14228 15172 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229477.1 protein_id gnl|my_center|LOCUS_06320 16136 15210 gene locus_tag LOCUS_06330 16136 15210 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223370.1 protein_id gnl|my_center|LOCUS_06330 16677 16192 gene locus_tag LOCUS_06340 16677 16192 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143400.1 protein_id gnl|my_center|LOCUS_06340 16751 16912 gene locus_tag LOCUS_06350 16751 16912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 17631 17035 gene locus_tag LOCUS_06360 17631 17035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 >Feature sequence028 983 624 gene locus_tag LOCUS_06370 983 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 2146 1025 gene locus_tag LOCUS_06380 gene dprA 2146 1025 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487183.1 protein_id gnl|my_center|LOCUS_06380 3666 2143 gene locus_tag LOCUS_06390 3666 2143 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223857.1 protein_id gnl|my_center|LOCUS_06390 4031 3663 gene locus_tag LOCUS_06400 4031 3663 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081582.1 protein_id gnl|my_center|LOCUS_06400 4590 4198 gene locus_tag LOCUS_06410 4590 4198 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003965949.1 protein_id gnl|my_center|LOCUS_06410 5574 4696 gene locus_tag LOCUS_06420 gene lepB 5574 4696 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973395.1 protein_id gnl|my_center|LOCUS_06420 5995 5636 gene locus_tag LOCUS_06430 gene rplS 5995 5636 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014838.1 protein_id gnl|my_center|LOCUS_06430 6970 6218 gene locus_tag LOCUS_06440 gene trmD 6970 6218 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973399.1 protein_id gnl|my_center|LOCUS_06440 7513 6992 gene locus_tag LOCUS_06450 gene rimM 7513 6992 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111677.1 protein_id gnl|my_center|LOCUS_06450 7890 7648 gene locus_tag LOCUS_06460 7890 7648 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_06460 8380 7892 gene locus_tag LOCUS_06470 8380 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 10248 8632 gene locus_tag LOCUS_06480 gene ffh 10248 8632 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327355.1 protein_id gnl|my_center|LOCUS_06480 11621 10467 gene locus_tag LOCUS_06490 11621 10467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 13255 12068 gene locus_tag LOCUS_06500 gene ftsY 13255 12068 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_06500 14361 13327 gene locus_tag LOCUS_06510 14361 13327 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014890.1 protein_id gnl|my_center|LOCUS_06510 15357 14362 gene locus_tag LOCUS_06520 15357 14362 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265874.1 protein_id gnl|my_center|LOCUS_06520 15982 18618 gene locus_tag LOCUS_06530 15982 18618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 >Feature sequence029 561 55 gene locus_tag LOCUS_06540 561 55 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229589.1 protein_id gnl|my_center|LOCUS_06540 666 1586 gene locus_tag LOCUS_06550 666 1586 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_06550 1599 1844 gene locus_tag LOCUS_06560 1599 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 2211 3044 gene locus_tag LOCUS_06570 2211 3044 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182367.1 protein_id gnl|my_center|LOCUS_06570 4955 3291 gene locus_tag LOCUS_06580 4955 3291 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083948.1 protein_id gnl|my_center|LOCUS_06580 6310 5216 gene locus_tag LOCUS_06590 6310 5216 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027929.1 protein_id gnl|my_center|LOCUS_06590 6586 7422 gene locus_tag LOCUS_06600 6586 7422 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222475.1 protein_id gnl|my_center|LOCUS_06600 8423 7470 gene locus_tag LOCUS_06610 gene speB 8423 7470 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224492.1 protein_id gnl|my_center|LOCUS_06610 9020 10339 gene locus_tag LOCUS_06620 9020 10339 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222293.1 protein_id gnl|my_center|LOCUS_06620 11187 10627 gene locus_tag LOCUS_06630 11187 10627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 11653 12975 gene locus_tag LOCUS_06640 11653 12975 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_06640 13032 13982 gene locus_tag LOCUS_06650 13032 13982 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_06650 16005 13984 gene locus_tag LOCUS_06660 16005 13984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 18736 16307 gene locus_tag LOCUS_06670 gene pucD 18736 16307 CDS product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223814.1 protein_id gnl|my_center|LOCUS_06670 >Feature sequence030 1647 346 gene locus_tag LOCUS_06680 1647 346 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537612.1 protein_id gnl|my_center|LOCUS_06680 2670 1657 gene locus_tag LOCUS_06690 2670 1657 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257842.1 protein_id gnl|my_center|LOCUS_06690 3793 2687 gene locus_tag LOCUS_06700 gene pdhA 3793 2687 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257841.1 protein_id gnl|my_center|LOCUS_06700 4952 4275 gene locus_tag LOCUS_06710 4952 4275 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976633.1 protein_id gnl|my_center|LOCUS_06710 5714 6403 gene locus_tag LOCUS_06720 5714 6403 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776273.1 protein_id gnl|my_center|LOCUS_06720 6449 8533 gene locus_tag LOCUS_06730 6449 8533 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777103.1 protein_id gnl|my_center|LOCUS_06730 8863 9867 gene locus_tag LOCUS_06740 8863 9867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 10733 9909 gene locus_tag LOCUS_06750 10733 9909 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803957.1 protein_id gnl|my_center|LOCUS_06750 11344 10736 gene locus_tag LOCUS_06760 11344 10736 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803956.1 protein_id gnl|my_center|LOCUS_06760 12092 11433 gene locus_tag LOCUS_06770 12092 11433 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976672.1 protein_id gnl|my_center|LOCUS_06770 13708 12089 gene locus_tag LOCUS_06780 13708 12089 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028162.1 protein_id gnl|my_center|LOCUS_06780 13950 14138 gene locus_tag LOCUS_06790 13950 14138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 14139 15134 gene locus_tag LOCUS_06800 14139 15134 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803776.1 protein_id gnl|my_center|LOCUS_06800 15161 15811 gene locus_tag LOCUS_06810 15161 15811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06810 15936 16700 gene locus_tag LOCUS_06820 15936 16700 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728092.1 protein_id gnl|my_center|LOCUS_06820 17185 16946 gene locus_tag LOCUS_06830 17185 16946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 17072 17674 gene locus_tag LOCUS_06840 17072 17674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 18134 17691 gene locus_tag LOCUS_06850 18134 17691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 >Feature sequence031 40 777 gene locus_tag LOCUS_06860 40 777 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729452.1 protein_id gnl|my_center|LOCUS_06860 774 2174 gene locus_tag LOCUS_06870 774 2174 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 protein_id gnl|my_center|LOCUS_06870 2552 2920 gene locus_tag LOCUS_06880 2552 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 3037 3654 gene locus_tag LOCUS_06890 3037 3654 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085655.1 protein_id gnl|my_center|LOCUS_06890 4579 3722 gene locus_tag LOCUS_06900 4579 3722 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_06900 5678 4710 gene locus_tag LOCUS_06910 5678 4710 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031126.1 protein_id gnl|my_center|LOCUS_06910 6661 5789 gene locus_tag LOCUS_06920 6661 5789 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804051.1 protein_id gnl|my_center|LOCUS_06920 7587 6658 gene locus_tag LOCUS_06930 7587 6658 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804050.1 protein_id gnl|my_center|LOCUS_06930 8906 7614 gene locus_tag LOCUS_06940 8906 7614 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804049.1 protein_id gnl|my_center|LOCUS_06940 9072 11069 gene locus_tag LOCUS_06950 9072 11069 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804048.1 protein_id gnl|my_center|LOCUS_06950 11256 12392 gene locus_tag LOCUS_06960 11256 12392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 14748 12451 gene locus_tag LOCUS_06970 14748 12451 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449606.1 protein_id gnl|my_center|LOCUS_06970 15070 17283 gene locus_tag LOCUS_06980 15070 17283 CDS product anthranilate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529939.1 protein_id gnl|my_center|LOCUS_06980 17353 17544 gene locus_tag LOCUS_06990 17353 17544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 17694 18491 gene locus_tag LOCUS_07000 gene thyX 17694 18491 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390602.1 protein_id gnl|my_center|LOCUS_07000 >Feature sequence032 642 199 gene locus_tag LOCUS_07010 642 199 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561733.1 protein_id gnl|my_center|LOCUS_07010 1073 639 gene locus_tag LOCUS_07020 1073 639 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229428.1 protein_id gnl|my_center|LOCUS_07020 3497 1074 gene locus_tag LOCUS_07030 3497 1074 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228183.1 protein_id gnl|my_center|LOCUS_07030 5146 3698 gene locus_tag LOCUS_07040 gene argH 5146 3698 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776175.1 protein_id gnl|my_center|LOCUS_07040 5726 5223 gene locus_tag LOCUS_07050 5726 5223 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_07050 6643 5756 gene locus_tag LOCUS_07060 gene argF 6643 5756 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776178.1 protein_id gnl|my_center|LOCUS_07060 7899 6694 gene locus_tag LOCUS_07070 7899 6694 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227835.1 protein_id gnl|my_center|LOCUS_07070 8900 7896 gene locus_tag LOCUS_07080 gene argB 8900 7896 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977246.1 protein_id gnl|my_center|LOCUS_07080 9682 8897 gene locus_tag LOCUS_07090 9682 8897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 10728 9700 gene locus_tag LOCUS_07100 gene argC 10728 9700 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977244.1 protein_id gnl|my_center|LOCUS_07100 12289 10847 gene locus_tag LOCUS_07110 12289 10847 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530465.1 protein_id gnl|my_center|LOCUS_07110 12948 12445 gene locus_tag LOCUS_07120 12948 12445 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230329.1 protein_id gnl|my_center|LOCUS_07120 14432 13125 gene locus_tag LOCUS_07130 14432 13125 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229595.1 protein_id gnl|my_center|LOCUS_07130 17307 14818 gene locus_tag LOCUS_07140 gene pheT 17307 14818 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027870.1 protein_id gnl|my_center|LOCUS_07140 >Feature sequence033 603 232 gene locus_tag LOCUS_07150 603 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 1255 698 gene locus_tag LOCUS_07160 1255 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 2196 1285 gene locus_tag LOCUS_07170 2196 1285 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731587.1 protein_id gnl|my_center|LOCUS_07170 2959 2477 gene locus_tag LOCUS_07180 2959 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 3353 3027 gene locus_tag LOCUS_07190 3353 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 3553 3831 gene locus_tag LOCUS_07200 3553 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 4456 3860 gene locus_tag LOCUS_07210 4456 3860 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704839.1 protein_id gnl|my_center|LOCUS_07210 4538 5446 gene locus_tag LOCUS_07220 4538 5446 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568594.1 protein_id gnl|my_center|LOCUS_07220 5754 6257 gene locus_tag LOCUS_07230 5754 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07230 6650 6189 gene locus_tag LOCUS_07240 6650 6189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 6949 6665 gene locus_tag LOCUS_07250 6949 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 7283 7567 gene locus_tag LOCUS_07260 7283 7567 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975238.1 protein_id gnl|my_center|LOCUS_07260 7567 8649 gene locus_tag LOCUS_07270 gene arsB 7567 8649 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031222.1 protein_id gnl|my_center|LOCUS_07270 9909 8941 gene locus_tag LOCUS_07280 9909 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07280 9839 10069 gene locus_tag LOCUS_07290 9839 10069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 11486 10182 gene locus_tag LOCUS_07300 11486 10182 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485197.1 protein_id gnl|my_center|LOCUS_07300 11580 12479 gene locus_tag LOCUS_07310 11580 12479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 12695 13135 gene locus_tag LOCUS_07320 12695 13135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 13263 13178 gene locus_tag LOCUS_t00090 13263 13178 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13399 14721 gene locus_tag LOCUS_07330 13399 14721 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_07330 14963 16039 gene locus_tag LOCUS_07340 14963 16039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 16202 16735 gene locus_tag LOCUS_07350 16202 16735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 17098 17307 gene locus_tag LOCUS_07360 17098 17307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 >Feature sequence034 145 1440 gene locus_tag LOCUS_07370 145 1440 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_07370 1437 2174 gene locus_tag LOCUS_07380 1437 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 2171 3490 gene locus_tag LOCUS_07390 gene nuoF 2171 3490 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974379.1 protein_id gnl|my_center|LOCUS_07390 3580 5949 gene locus_tag LOCUS_07400 3580 5949 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728121.1 protein_id gnl|my_center|LOCUS_07400 5946 7319 gene locus_tag LOCUS_07410 gene nuoH 5946 7319 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728120.1 protein_id gnl|my_center|LOCUS_07410 7312 7863 gene locus_tag LOCUS_07420 gene nuoI 7312 7863 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222460.1 protein_id gnl|my_center|LOCUS_07420 7860 8819 gene locus_tag LOCUS_07430 7860 8819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 8807 9106 gene locus_tag LOCUS_07440 gene nuoK 8807 9106 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974374.1 protein_id gnl|my_center|LOCUS_07440 9115 11067 gene locus_tag LOCUS_07450 gene nuoL 9115 11067 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893421.1 protein_id gnl|my_center|LOCUS_07450 11068 12708 gene locus_tag LOCUS_07460 11068 12708 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974372.1 protein_id gnl|my_center|LOCUS_07460 12705 14363 gene locus_tag LOCUS_07470 gene nuoN 12705 14363 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_07470 14516 15520 gene locus_tag LOCUS_07480 14516 15520 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_07480 16482 15541 gene locus_tag LOCUS_07490 gene rarD 16482 15541 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence035 880 1647 gene locus_tag LOCUS_07500 880 1647 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_07500 2110 1724 gene locus_tag LOCUS_07510 2110 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 1997 2299 gene locus_tag LOCUS_07520 1997 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 4108 2720 gene locus_tag LOCUS_07530 4108 2720 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976298.1 protein_id gnl|my_center|LOCUS_07530 4670 4320 gene locus_tag LOCUS_07540 4670 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 8379 4696 gene locus_tag LOCUS_07550 8379 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 8634 9002 gene locus_tag LOCUS_07560 8634 9002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 9073 9894 gene locus_tag LOCUS_07570 9073 9894 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028392.1 protein_id gnl|my_center|LOCUS_07570 9887 10783 gene locus_tag LOCUS_07580 9887 10783 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 protein_id gnl|my_center|LOCUS_07580 10780 11163 gene locus_tag LOCUS_07590 10780 11163 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 protein_id gnl|my_center|LOCUS_07590 12041 11208 gene locus_tag LOCUS_07600 12041 11208 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972223.1 protein_id gnl|my_center|LOCUS_07600 12995 12147 gene locus_tag LOCUS_07610 12995 12147 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230311.1 protein_id gnl|my_center|LOCUS_07610 13841 12996 gene locus_tag LOCUS_07620 13841 12996 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976293.1 protein_id gnl|my_center|LOCUS_07620 14599 13838 gene locus_tag LOCUS_07630 gene recO 14599 13838 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228390.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07630 14833 15621 gene locus_tag LOCUS_07640 14833 15621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 <17090 15696 gene locus_tag LOCUS_07650 <17090 15696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976275.1:2-isopropylmalate synthase >Feature sequence036 1998 25 gene locus_tag LOCUS_07660 1998 25 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229814.1 protein_id gnl|my_center|LOCUS_07660 2248 3177 gene locus_tag LOCUS_07670 2248 3177 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226122.1 protein_id gnl|my_center|LOCUS_07670 4191 3190 gene locus_tag LOCUS_07680 4191 3190 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863161.1 protein_id gnl|my_center|LOCUS_07680 5679 4255 gene locus_tag LOCUS_07690 5679 4255 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030958.1 protein_id gnl|my_center|LOCUS_07690 6652 5750 gene locus_tag LOCUS_07700 6652 5750 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030957.1 protein_id gnl|my_center|LOCUS_07700 6835 7545 gene locus_tag LOCUS_07710 gene map 6835 7545 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_07710 7676 7876 gene locus_tag LOCUS_07720 7676 7876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 7926 8621 gene locus_tag LOCUS_07730 gene npdG 7926 8621 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_07730 9710 8670 gene locus_tag LOCUS_07740 9710 8670 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031181.1 protein_id gnl|my_center|LOCUS_07740 10732 9878 gene locus_tag LOCUS_07750 gene panB 10732 9878 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976556.1 protein_id gnl|my_center|LOCUS_07750 11079 11534 gene locus_tag LOCUS_07760 gene nsrR 11079 11534 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031657.1 protein_id gnl|my_center|LOCUS_07760 11835 13016 gene locus_tag LOCUS_07770 11835 13016 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971715.1 protein_id gnl|my_center|LOCUS_07770 13166 16171 gene locus_tag LOCUS_07780 13166 16171 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486951.1 protein_id gnl|my_center|LOCUS_07780 16779 16189 gene locus_tag LOCUS_07790 16779 16189 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973718.1 protein_id gnl|my_center|LOCUS_07790 >Feature sequence037 <1 1391 gene locus_tag LOCUS_07800 <1 1391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056347.1:HNH endonuclease 1388 3058 gene locus_tag LOCUS_07810 1388 3058 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_07810 3372 3575 gene locus_tag LOCUS_07820 3372 3575 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891980.1 protein_id gnl|my_center|LOCUS_07820 3744 4058 gene locus_tag LOCUS_07830 3744 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 4574 4074 gene locus_tag LOCUS_07840 4574 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 6053 5445 gene locus_tag LOCUS_07850 6053 5445 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730835.1 protein_id gnl|my_center|LOCUS_07850 6421 6345 gene locus_tag LOCUS_t00100 6421 6345 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7199 6540 gene locus_tag LOCUS_07860 7199 6540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 8245 7595 gene locus_tag LOCUS_07870 8245 7595 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_07870 9034 8510 gene locus_tag LOCUS_07880 9034 8510 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_07880 9539 9027 gene locus_tag LOCUS_07890 gene moaC 9539 9027 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_07890 10845 9625 gene locus_tag LOCUS_07900 10845 9625 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_07900 11921 10926 gene locus_tag LOCUS_07910 gene galU 11921 10926 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_07910 12022 12672 gene locus_tag LOCUS_07920 12022 12672 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028815.1 protein_id gnl|my_center|LOCUS_07920 12873 13187 gene locus_tag LOCUS_07930 12873 13187 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975630.1 protein_id gnl|my_center|LOCUS_07930 13317 13973 gene locus_tag LOCUS_07940 13317 13973 CDS product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898677.1 protein_id gnl|my_center|LOCUS_07940 14078 14488 gene locus_tag LOCUS_07950 gene mscL 14078 14488 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928676.1 protein_id gnl|my_center|LOCUS_07950 15648 14551 gene locus_tag LOCUS_07960 15648 14551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 16084 16159 gene locus_tag LOCUS_t00110 16084 16159 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence038 6 1175 gene locus_tag LOCUS_07970 6 1175 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228132.1 protein_id gnl|my_center|LOCUS_07970 1150 1809 gene locus_tag LOCUS_07980 1150 1809 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 protein_id gnl|my_center|LOCUS_07980 1971 2675 gene locus_tag LOCUS_07990 gene fabG 1971 2675 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_07990 2728 3492 gene locus_tag LOCUS_08000 gene fabI 2728 3492 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977009.1 protein_id gnl|my_center|LOCUS_08000 3586 4350 gene locus_tag LOCUS_08010 3586 4350 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035669.1 protein_id gnl|my_center|LOCUS_08010 6058 4364 gene locus_tag LOCUS_08020 6058 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08020 6638 6141 gene locus_tag LOCUS_08030 6638 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 6722 8992 gene locus_tag LOCUS_08040 6722 8992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 9966 9013 gene locus_tag LOCUS_08050 9966 9013 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977155.1 protein_id gnl|my_center|LOCUS_08050 10113 10856 gene locus_tag LOCUS_08060 10113 10856 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977159.1 protein_id gnl|my_center|LOCUS_08060 10899 11477 gene locus_tag LOCUS_08070 10899 11477 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_08070 11474 12292 gene locus_tag LOCUS_08080 11474 12292 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270002.1 protein_id gnl|my_center|LOCUS_08080 12348 13169 gene locus_tag LOCUS_08090 12348 13169 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230236.1 protein_id gnl|my_center|LOCUS_08090 13672 13289 gene locus_tag LOCUS_08100 13672 13289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 14453 15829 gene locus_tag LOCUS_08110 14453 15829 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043779113.1 protein_id gnl|my_center|LOCUS_08110 15829 16233 gene locus_tag LOCUS_08120 15829 16233 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971722.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence039 <1 554 gene locus_tag LOCUS_08130 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029292.1:ParA family protein 627 1604 gene locus_tag LOCUS_08140 627 1604 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863476.1 protein_id gnl|my_center|LOCUS_08140 2214 1891 gene locus_tag LOCUS_08150 gene trxA 2214 1891 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_08150 3192 2260 gene locus_tag LOCUS_08160 gene trxB 3192 2260 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_08160 4344 3472 gene locus_tag LOCUS_08170 4344 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 4967 4341 gene locus_tag LOCUS_08180 gene sigM 4967 4341 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284380.1 protein_id gnl|my_center|LOCUS_08180 6580 5003 gene locus_tag LOCUS_08190 6580 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 8654 6834 gene locus_tag LOCUS_08200 8654 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 10641 8782 gene locus_tag LOCUS_08210 gene murJ 10641 8782 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224759.1 protein_id gnl|my_center|LOCUS_08210 13301 10716 gene locus_tag LOCUS_08220 13301 10716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 13523 14986 gene locus_tag LOCUS_08230 13523 14986 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_08230 15719 14991 gene locus_tag LOCUS_08240 15719 14991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence040 <1 784 gene locus_tag LOCUS_08250 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230863.1:ATP-dependent chaperone ClpB 1262 852 gene locus_tag LOCUS_08260 1262 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 1737 1249 gene locus_tag LOCUS_08270 1737 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 3105 1843 gene locus_tag LOCUS_08280 3105 1843 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230367.1 protein_id gnl|my_center|LOCUS_08280 3581 3147 gene locus_tag LOCUS_08290 3581 3147 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086910.1 protein_id gnl|my_center|LOCUS_08290 4913 3726 gene locus_tag LOCUS_08300 4913 3726 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222135.1 protein_id gnl|my_center|LOCUS_08300 5797 5366 gene locus_tag LOCUS_08310 5797 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 6788 6576 gene locus_tag LOCUS_08320 6788 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 7127 7777 gene locus_tag LOCUS_08330 7127 7777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 7997 10042 gene locus_tag LOCUS_08340 7997 10042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975548.1 protein_id gnl|my_center|LOCUS_08340 10044 15089 gene locus_tag LOCUS_08350 10044 15089 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113834.1 protein_id gnl|my_center|LOCUS_08350 15895 15413 gene locus_tag LOCUS_08360 15895 15413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229066.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence041 1904 774 gene locus_tag LOCUS_08370 1904 774 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963858.1 protein_id gnl|my_center|LOCUS_08370 3247 1994 gene locus_tag LOCUS_08380 3247 1994 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209580.1 protein_id gnl|my_center|LOCUS_08380 4253 3258 gene locus_tag LOCUS_08390 4253 3258 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903562.1 protein_id gnl|my_center|LOCUS_08390 5403 4297 gene locus_tag LOCUS_08400 5403 4297 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084875.1 protein_id gnl|my_center|LOCUS_08400 6514 5879 gene locus_tag LOCUS_08410 6514 5879 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943404.1 protein_id gnl|my_center|LOCUS_08410 6816 6511 gene locus_tag LOCUS_08420 6816 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 8027 7245 gene locus_tag LOCUS_08430 8027 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 9891 8191 gene locus_tag LOCUS_08440 9891 8191 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776768.1 protein_id gnl|my_center|LOCUS_08440 10817 10188 gene locus_tag LOCUS_08450 10817 10188 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336871.1 protein_id gnl|my_center|LOCUS_08450 11517 10930 gene locus_tag LOCUS_08460 11517 10930 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059191192.1 protein_id gnl|my_center|LOCUS_08460 11790 11596 gene locus_tag LOCUS_08470 11790 11596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 11690 13195 gene locus_tag LOCUS_08480 11690 13195 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227193.1 protein_id gnl|my_center|LOCUS_08480 14203 13235 gene locus_tag LOCUS_08490 14203 13235 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804021.1 protein_id gnl|my_center|LOCUS_08490 15748 14396 gene locus_tag LOCUS_08500 15748 14396 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398532.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence042 1885 86 gene locus_tag LOCUS_08510 1885 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 2070 2444 gene locus_tag LOCUS_08520 2070 2444 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410246.1 protein_id gnl|my_center|LOCUS_08520 2509 3411 gene locus_tag LOCUS_08530 2509 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145860136.1 protein_id gnl|my_center|LOCUS_08530 3777 3439 gene locus_tag LOCUS_08540 3777 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 3889 5328 gene locus_tag LOCUS_08550 gene pyk 3889 5328 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028096.1 protein_id gnl|my_center|LOCUS_08550 6418 5441 gene locus_tag LOCUS_08560 6418 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 7552 6689 gene locus_tag LOCUS_08570 gene bla 7552 6689 CDS product class A beta-lactamase Bla1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181667.1 protein_id gnl|my_center|LOCUS_08570 9064 8255 gene locus_tag LOCUS_08580 9064 8255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 9213 9138 gene locus_tag LOCUS_t00120 9213 9138 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9371 9940 gene locus_tag LOCUS_08590 9371 9940 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894637.1 protein_id gnl|my_center|LOCUS_08590 10284 11858 gene locus_tag LOCUS_08600 10284 11858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 11871 12860 gene locus_tag LOCUS_08610 11871 12860 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_08610 12850 13731 gene locus_tag LOCUS_08620 12850 13731 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_08620 13724 14581 gene locus_tag LOCUS_08630 13724 14581 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_08630 15949 14714 gene locus_tag LOCUS_08640 15949 14714 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence043 74 1 gene locus_tag LOCUS_t00130 74 1 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1549 224 gene locus_tag LOCUS_08650 1549 224 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229620.1 protein_id gnl|my_center|LOCUS_08650 1635 3098 gene locus_tag LOCUS_08660 1635 3098 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229619.1 protein_id gnl|my_center|LOCUS_08660 3818 3147 gene locus_tag LOCUS_08670 3818 3147 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229616.1 protein_id gnl|my_center|LOCUS_08670 4637 3888 gene locus_tag LOCUS_08680 4637 3888 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877404.1 protein_id gnl|my_center|LOCUS_08680 5468 4647 gene locus_tag LOCUS_08690 5468 4647 CDS product Asp/Glu/hydantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893856.1 protein_id gnl|my_center|LOCUS_08690 6066 5572 gene locus_tag LOCUS_08700 6066 5572 CDS product DUF3830 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229621.1 protein_id gnl|my_center|LOCUS_08700 6357 7379 gene locus_tag LOCUS_08710 6357 7379 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229613.1 protein_id gnl|my_center|LOCUS_08710 7413 8921 gene locus_tag LOCUS_08720 7413 8921 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028604.1 protein_id gnl|my_center|LOCUS_08720 9157 9861 gene locus_tag LOCUS_08730 9157 9861 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026924.1 protein_id gnl|my_center|LOCUS_08730 11640 9883 gene locus_tag LOCUS_08740 11640 9883 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026923.1 protein_id gnl|my_center|LOCUS_08740 12267 13073 gene locus_tag LOCUS_08750 12267 13073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 13430 14035 gene locus_tag LOCUS_08760 13430 14035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 <15600 14170 gene locus_tag LOCUS_08770 <15600 14170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003972903.1:LCP family protein >Feature sequence044 1020 268 gene locus_tag LOCUS_08780 1020 268 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891775.1 protein_id gnl|my_center|LOCUS_08780 1149 1700 gene locus_tag LOCUS_08790 1149 1700 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082774477.1 protein_id gnl|my_center|LOCUS_08790 1769 2308 gene locus_tag LOCUS_08800 1769 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 2758 2339 gene locus_tag LOCUS_08810 2758 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 3024 4691 gene locus_tag LOCUS_08820 3024 4691 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230617.1 protein_id gnl|my_center|LOCUS_08820 4892 5896 gene locus_tag LOCUS_08830 4892 5896 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230616.1 protein_id gnl|my_center|LOCUS_08830 5896 6933 gene locus_tag LOCUS_08840 5896 6933 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230615.1 protein_id gnl|my_center|LOCUS_08840 6936 8003 gene locus_tag LOCUS_08850 6936 8003 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230614.1 protein_id gnl|my_center|LOCUS_08850 8000 9106 gene locus_tag LOCUS_08860 8000 9106 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230613.1 protein_id gnl|my_center|LOCUS_08860 9985 9344 gene locus_tag LOCUS_08870 9985 9344 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731094.1 protein_id gnl|my_center|LOCUS_08870 10989 9985 gene locus_tag LOCUS_08880 10989 9985 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103887.1 protein_id gnl|my_center|LOCUS_08880 11214 11930 gene locus_tag LOCUS_08890 11214 11930 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731092.1 protein_id gnl|my_center|LOCUS_08890 12447 11965 gene locus_tag LOCUS_08900 12447 11965 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888554.1 protein_id gnl|my_center|LOCUS_08900 13341 12613 gene locus_tag LOCUS_08910 13341 12613 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228563.1 protein_id gnl|my_center|LOCUS_08910 13799 13407 gene locus_tag LOCUS_08920 13799 13407 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971845.1 protein_id gnl|my_center|LOCUS_08920 13820 14665 gene locus_tag LOCUS_08930 13820 14665 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025568069.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence045 <1 1277 gene locus_tag LOCUS_08940 <1 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226999.1:FAD-dependent monooxygenase 2389 1640 gene locus_tag LOCUS_08950 2389 1640 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777055.1 protein_id gnl|my_center|LOCUS_08950 2503 3651 gene locus_tag LOCUS_08960 2503 3651 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777054.1 protein_id gnl|my_center|LOCUS_08960 3709 4389 gene locus_tag LOCUS_08970 3709 4389 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029778.1 protein_id gnl|my_center|LOCUS_08970 4911 6212 gene locus_tag LOCUS_08980 4911 6212 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031193.1 protein_id gnl|my_center|LOCUS_08980 7707 6646 gene locus_tag LOCUS_08990 7707 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 8221 8478 gene locus_tag LOCUS_09000 8221 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 9235 8690 gene locus_tag LOCUS_09010 9235 8690 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977232.1 protein_id gnl|my_center|LOCUS_09010 9871 9503 gene locus_tag LOCUS_09020 9871 9503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 10170 9868 gene locus_tag LOCUS_09030 10170 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 10549 10148 gene locus_tag LOCUS_09040 10549 10148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 10754 10948 gene locus_tag LOCUS_09050 10754 10948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 11640 11086 gene locus_tag LOCUS_09060 11640 11086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 13314 12160 gene locus_tag LOCUS_09070 13314 12160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 14542 13457 gene locus_tag LOCUS_09080 14542 13457 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005746663.1 protein_id gnl|my_center|LOCUS_09080 >Feature sequence046 2020 5 gene locus_tag LOCUS_09090 2020 5 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031412.1 protein_id gnl|my_center|LOCUS_09090 2976 2134 gene locus_tag LOCUS_09100 2976 2134 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709302.1 protein_id gnl|my_center|LOCUS_09100 3275 3188 gene locus_tag LOCUS_t00140 3275 3188 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3586 5670 gene locus_tag LOCUS_09110 3586 5670 CDS product DNA polymerase III subunits gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296293.1 protein_id gnl|my_center|LOCUS_09110 6942 5767 gene locus_tag LOCUS_09120 6942 5767 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222361.1 protein_id gnl|my_center|LOCUS_09120 7240 7602 gene locus_tag LOCUS_09130 7240 7602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 7731 8330 gene locus_tag LOCUS_09140 gene recR 7731 8330 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_09140 8511 9782 gene locus_tag LOCUS_09150 8511 9782 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_09150 9779 10840 gene locus_tag LOCUS_09160 9779 10840 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975325.1 protein_id gnl|my_center|LOCUS_09160 11803 10961 gene locus_tag LOCUS_09170 11803 10961 CDS product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028876.1 protein_id gnl|my_center|LOCUS_09170 11997 12344 gene locus_tag LOCUS_09180 11997 12344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 12498 13139 gene locus_tag LOCUS_09190 12498 13139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804164.1 protein_id gnl|my_center|LOCUS_09190 13667 13296 gene locus_tag LOCUS_09200 13667 13296 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975206.1 protein_id gnl|my_center|LOCUS_09200 14545 14003 gene locus_tag LOCUS_09210 14545 14003 CDS product HXXEE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030370.1 protein_id gnl|my_center|LOCUS_09210 14888 14718 gene locus_tag LOCUS_09220 14888 14718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence047 <1 2422 gene locus_tag LOCUS_09230 <1 2422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030433.1:HAMP domain-containing protein 2428 3069 gene locus_tag LOCUS_09240 2428 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 4282 3125 gene locus_tag LOCUS_09250 4282 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 4429 5199 gene locus_tag LOCUS_09260 4429 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 5311 5640 gene locus_tag LOCUS_09270 5311 5640 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226308.1 protein_id gnl|my_center|LOCUS_09270 6592 5630 gene locus_tag LOCUS_09280 6592 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 7995 6727 gene locus_tag LOCUS_09290 7995 6727 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226125.1 protein_id gnl|my_center|LOCUS_09290 8830 9591 gene locus_tag LOCUS_09300 8830 9591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 10341 9700 gene locus_tag LOCUS_09310 10341 9700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 10875 10363 gene locus_tag LOCUS_09320 10875 10363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 11357 11094 gene locus_tag LOCUS_09330 11357 11094 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971835.1 protein_id gnl|my_center|LOCUS_09330 12133 12636 gene locus_tag LOCUS_09340 gene ectA 12133 12636 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976956.1 protein_id gnl|my_center|LOCUS_09340 12733 13998 gene locus_tag LOCUS_09350 gene ectB 12733 13998 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230319.1 protein_id gnl|my_center|LOCUS_09350 14173 14583 gene locus_tag LOCUS_09360 14173 14583 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003071625.1 protein_id gnl|my_center|LOCUS_09360 >Feature sequence048 <1 716 gene locus_tag LOCUS_09370 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030352.1:GntR family transcriptional regulator 1202 1558 gene locus_tag LOCUS_09380 1202 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 1555 1986 gene locus_tag LOCUS_09390 1555 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 2038 2313 gene locus_tag LOCUS_09400 2038 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 2323 2928 gene locus_tag LOCUS_09410 2323 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 2978 3181 gene locus_tag LOCUS_09420 2978 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 3339 3250 gene locus_tag LOCUS_t00150 3339 3250 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3553 4707 gene locus_tag LOCUS_09430 gene dnaN 3553 4707 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_09430 5836 4997 gene locus_tag LOCUS_09440 5836 4997 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230002.1 protein_id gnl|my_center|LOCUS_09440 6440 6024 gene locus_tag LOCUS_09450 6440 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 7115 6597 gene locus_tag LOCUS_09460 7115 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 7629 7799 gene locus_tag LOCUS_09470 7629 7799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 8106 7897 gene locus_tag LOCUS_09480 8106 7897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 7993 10908 gene locus_tag LOCUS_09490 7993 10908 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225870.1 protein_id gnl|my_center|LOCUS_09490 11434 11952 gene locus_tag LOCUS_09500 11434 11952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 12598 13113 gene locus_tag LOCUS_09510 12598 13113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 13485 13925 gene locus_tag LOCUS_09520 13485 13925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 >Feature sequence049 4261 1538 gene locus_tag LOCUS_09530 gene acnA 4261 1538 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_09530 5579 4644 gene locus_tag LOCUS_09540 5579 4644 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973051.1 protein_id gnl|my_center|LOCUS_09540 6970 5663 gene locus_tag LOCUS_09550 6970 5663 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_09550 7190 7882 gene locus_tag LOCUS_09560 7190 7882 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_09560 7884 8567 gene locus_tag LOCUS_09570 7884 8567 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067924.1 protein_id gnl|my_center|LOCUS_09570 9369 8578 gene locus_tag LOCUS_09580 9369 8578 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230310.1 protein_id gnl|my_center|LOCUS_09580 9620 10723 gene locus_tag LOCUS_09590 9620 10723 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228372.1 protein_id gnl|my_center|LOCUS_09590 11479 10733 gene locus_tag LOCUS_09600 11479 10733 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031443.1 protein_id gnl|my_center|LOCUS_09600 12365 11526 gene locus_tag LOCUS_09610 12365 11526 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973152.1 protein_id gnl|my_center|LOCUS_09610 12813 12403 gene locus_tag LOCUS_09620 gene dut 12813 12403 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_09620 <14746 12960 gene locus_tag LOCUS_09630 <14746 12960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224259.1:valine--tRNA ligase >Feature sequence050 1873 3516 gene locus_tag LOCUS_09640 1873 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 3901 4167 gene locus_tag LOCUS_09650 3901 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 4175 4474 gene locus_tag LOCUS_09660 4175 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 5467 4538 gene locus_tag LOCUS_09670 5467 4538 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029931.1 protein_id gnl|my_center|LOCUS_09670 6736 5564 gene locus_tag LOCUS_09680 6736 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 6675 6872 gene locus_tag LOCUS_09690 6675 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 8627 6852 gene locus_tag LOCUS_09700 8627 6852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 9489 10826 gene locus_tag LOCUS_09710 9489 10826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 >Feature sequence051 <1 572 gene locus_tag LOCUS_09720 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973709.1:NADP-dependent malic enzyme 1573 659 gene locus_tag LOCUS_09730 1573 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 2426 1575 gene locus_tag LOCUS_09740 2426 1575 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486398.1 protein_id gnl|my_center|LOCUS_09740 6373 2738 gene locus_tag LOCUS_09750 6373 2738 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_09750 6925 7305 gene locus_tag LOCUS_09760 6925 7305 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112732.1 protein_id gnl|my_center|LOCUS_09760 8400 7315 gene locus_tag LOCUS_09770 8400 7315 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200269.1 protein_id gnl|my_center|LOCUS_09770 8585 8397 gene locus_tag LOCUS_09780 8585 8397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 8601 9698 gene locus_tag LOCUS_09790 gene rlmN 8601 9698 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973380.1 protein_id gnl|my_center|LOCUS_09790 9705 10166 gene locus_tag LOCUS_09800 9705 10166 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228095.1 protein_id gnl|my_center|LOCUS_09800 11058 10207 gene locus_tag LOCUS_09810 11058 10207 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 protein_id gnl|my_center|LOCUS_09810 11533 11282 gene locus_tag LOCUS_09820 11533 11282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 12416 11871 gene locus_tag LOCUS_09830 12416 11871 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029029.1 protein_id gnl|my_center|LOCUS_09830 13436 12426 gene locus_tag LOCUS_09840 13436 12426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence052 168 3050 gene locus_tag LOCUS_09850 168 3050 CDS product DUF4040 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013521.1 protein_id gnl|my_center|LOCUS_09850 3047 3355 gene locus_tag LOCUS_09860 3047 3355 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013520.1 protein_id gnl|my_center|LOCUS_09860 3352 4893 gene locus_tag LOCUS_09870 3352 4893 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211271326.1 protein_id gnl|my_center|LOCUS_09870 4890 5285 gene locus_tag LOCUS_09880 4890 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 5285 5542 gene locus_tag LOCUS_09890 5285 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 5539 5901 gene locus_tag LOCUS_09900 5539 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 7539 5971 gene locus_tag LOCUS_09910 7539 5971 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_09910 7824 8771 gene locus_tag LOCUS_09920 7824 8771 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727331.1 protein_id gnl|my_center|LOCUS_09920 10173 8782 gene locus_tag LOCUS_09930 10173 8782 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224238.1 protein_id gnl|my_center|LOCUS_09930 10872 10177 gene locus_tag LOCUS_09940 10872 10177 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973245.1 protein_id gnl|my_center|LOCUS_09940 11229 10882 gene locus_tag LOCUS_09950 11229 10882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 13963 11405 gene locus_tag LOCUS_09960 13963 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 >Feature sequence053 1636 884 gene locus_tag LOCUS_09970 gene fabG 1636 884 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_09970 2880 1663 gene locus_tag LOCUS_09980 2880 1663 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_09980 3743 2877 gene locus_tag LOCUS_09990 3743 2877 CDS product clavaminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975576.1 protein_id gnl|my_center|LOCUS_09990 4461 3784 gene locus_tag LOCUS_10000 4461 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 4720 4463 gene locus_tag LOCUS_10010 4720 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 5730 4717 gene locus_tag LOCUS_10020 5730 4717 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030514.1 protein_id gnl|my_center|LOCUS_10020 6045 5857 gene locus_tag LOCUS_10030 6045 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 6226 7656 gene locus_tag LOCUS_10040 6226 7656 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223105.1 protein_id gnl|my_center|LOCUS_10040 7653 8294 gene locus_tag LOCUS_10050 7653 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 8569 8315 gene locus_tag LOCUS_10060 8569 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 10040 8562 gene locus_tag LOCUS_10070 10040 8562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 10426 10031 gene locus_tag LOCUS_10080 10426 10031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 10923 11534 gene locus_tag LOCUS_10090 10923 11534 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403546.1 protein_id gnl|my_center|LOCUS_10090 12543 11590 gene locus_tag LOCUS_10100 12543 11590 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226059.1 protein_id gnl|my_center|LOCUS_10100 <14376 12558 gene locus_tag LOCUS_10110 <14376 12558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_147443659.1:non-ribosomal peptide synthetase >Feature sequence054 <1 1025 gene locus_tag LOCUS_10120 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259232.1:acetoacetate--CoA ligase 1069 2385 gene locus_tag LOCUS_10130 1069 2385 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130055604.1 protein_id gnl|my_center|LOCUS_10130 3088 2399 gene locus_tag LOCUS_10140 3088 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 3357 4298 gene locus_tag LOCUS_10150 gene deoC 3357 4298 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_10150 4303 5739 gene locus_tag LOCUS_10160 4303 5739 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029944.1 protein_id gnl|my_center|LOCUS_10160 5732 6658 gene locus_tag LOCUS_10170 5732 6658 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 protein_id gnl|my_center|LOCUS_10170 6708 7337 gene locus_tag LOCUS_10180 6708 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 7367 7969 gene locus_tag LOCUS_10190 7367 7969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 7969 8763 gene locus_tag LOCUS_10200 7969 8763 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974056.1 protein_id gnl|my_center|LOCUS_10200 8777 10444 gene locus_tag LOCUS_10210 8777 10444 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_10210 10953 10459 gene locus_tag LOCUS_10220 10953 10459 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_10220 11609 12646 gene locus_tag LOCUS_10230 11609 12646 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218038702.1 protein_id gnl|my_center|LOCUS_10230 12643 13659 gene locus_tag LOCUS_10240 12643 13659 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_10240 13659 14000 gene locus_tag LOCUS_10250 13659 14000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence055 667 1704 gene locus_tag LOCUS_10260 667 1704 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226175.1 protein_id gnl|my_center|LOCUS_10260 2706 1732 gene locus_tag LOCUS_10270 2706 1732 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031568.1 protein_id gnl|my_center|LOCUS_10270 3160 2744 gene locus_tag LOCUS_10280 3160 2744 CDS product ChaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225977.1 protein_id gnl|my_center|LOCUS_10280 4385 3201 gene locus_tag LOCUS_10290 4385 3201 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031121.1 protein_id gnl|my_center|LOCUS_10290 5442 4549 gene locus_tag LOCUS_10300 5442 4549 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226124.1 protein_id gnl|my_center|LOCUS_10300 6314 5439 gene locus_tag LOCUS_10310 6314 5439 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226123.1 protein_id gnl|my_center|LOCUS_10310 7287 6265 gene locus_tag LOCUS_10320 7287 6265 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030715.1 protein_id gnl|my_center|LOCUS_10320 8054 7368 gene locus_tag LOCUS_10330 8054 7368 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226117.1 protein_id gnl|my_center|LOCUS_10330 9440 8061 gene locus_tag LOCUS_10340 9440 8061 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226118.1 protein_id gnl|my_center|LOCUS_10340 10042 9452 gene locus_tag LOCUS_10350 10042 9452 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226119.1 protein_id gnl|my_center|LOCUS_10350 11304 10042 gene locus_tag LOCUS_10360 11304 10042 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226125.1 protein_id gnl|my_center|LOCUS_10360 12116 11301 gene locus_tag LOCUS_10370 12116 11301 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030720.1 protein_id gnl|my_center|LOCUS_10370 13336 12332 gene locus_tag LOCUS_10380 13336 12332 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226109.1 protein_id gnl|my_center|LOCUS_10380 <14231 13333 gene locus_tag LOCUS_10390 <14231 13333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226110.1:HAD-IIIA family hydrolase >Feature sequence056 392 1993 gene locus_tag LOCUS_10400 392 1993 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206743.1 protein_id gnl|my_center|LOCUS_10400 2035 2970 gene locus_tag LOCUS_10410 2035 2970 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066869201.1 protein_id gnl|my_center|LOCUS_10410 2967 3845 gene locus_tag LOCUS_10420 2967 3845 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206745.1 protein_id gnl|my_center|LOCUS_10420 3842 5473 gene locus_tag LOCUS_10430 3842 5473 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385658.1 protein_id gnl|my_center|LOCUS_10430 6282 5440 gene locus_tag LOCUS_10440 6282 5440 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873433.1 protein_id gnl|my_center|LOCUS_10440 6593 7057 gene locus_tag LOCUS_10450 6593 7057 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977367.1 protein_id gnl|my_center|LOCUS_10450 8798 7089 gene locus_tag LOCUS_10460 8798 7089 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228710.1 protein_id gnl|my_center|LOCUS_10460 9647 8841 gene locus_tag LOCUS_10470 9647 8841 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027793.1 protein_id gnl|my_center|LOCUS_10470 10975 9815 gene locus_tag LOCUS_10480 gene ispG 10975 9815 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973330.1 protein_id gnl|my_center|LOCUS_10480 12564 11200 gene locus_tag LOCUS_10490 12564 11200 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030397.1 protein_id gnl|my_center|LOCUS_10490 13850 12636 gene locus_tag LOCUS_10500 gene dxr 13850 12636 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence057 798 55 gene locus_tag LOCUS_10510 798 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1542 817 gene locus_tag LOCUS_10520 1542 817 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383524.1 protein_id gnl|my_center|LOCUS_10520 1717 2508 gene locus_tag LOCUS_10530 1717 2508 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036395.1 protein_id gnl|my_center|LOCUS_10530 4622 2514 gene locus_tag LOCUS_10540 4622 2514 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027382.1 protein_id gnl|my_center|LOCUS_10540 5987 4752 gene locus_tag LOCUS_10550 5987 4752 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026915.1 protein_id gnl|my_center|LOCUS_10550 6060 6815 gene locus_tag LOCUS_10560 6060 6815 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225920.1 protein_id gnl|my_center|LOCUS_10560 6805 8373 gene locus_tag LOCUS_10570 6805 8373 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225919.1 protein_id gnl|my_center|LOCUS_10570 9344 8343 gene locus_tag LOCUS_10580 9344 8343 CDS product DUF5914 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026912.1 protein_id gnl|my_center|LOCUS_10580 10340 9387 gene locus_tag LOCUS_10590 10340 9387 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225923.1 protein_id gnl|my_center|LOCUS_10590 11803 10340 gene locus_tag LOCUS_10600 gene crtI 11803 10340 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026910.1 protein_id gnl|my_center|LOCUS_10600 11977 12486 gene locus_tag LOCUS_10610 11977 12486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 >Feature sequence058 2757 49 gene locus_tag LOCUS_10620 2757 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 3523 2762 gene locus_tag LOCUS_10630 3523 2762 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028774.1 protein_id gnl|my_center|LOCUS_10630 3801 5024 gene locus_tag LOCUS_10640 3801 5024 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 protein_id gnl|my_center|LOCUS_10640 5713 6405 gene locus_tag LOCUS_10650 5713 6405 CDS product glycoside hydrolase family 11 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978772.1 protein_id gnl|my_center|LOCUS_10650 7186 6542 gene locus_tag LOCUS_10660 7186 6542 CDS product NUDIX hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726735.1 protein_id gnl|my_center|LOCUS_10660 7616 7197 gene locus_tag LOCUS_10670 7616 7197 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171561.1 protein_id gnl|my_center|LOCUS_10670 7615 7869 gene locus_tag LOCUS_10680 7615 7869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 8540 7908 gene locus_tag LOCUS_10690 8540 7908 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030233.1 protein_id gnl|my_center|LOCUS_10690 8600 10012 gene locus_tag LOCUS_10700 8600 10012 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803909.1 protein_id gnl|my_center|LOCUS_10700 10713 10009 gene locus_tag LOCUS_10710 10713 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 12528 10972 gene locus_tag LOCUS_10720 12528 10972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 12876 13094 gene locus_tag LOCUS_10730 12876 13094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence059 428 503 gene locus_tag LOCUS_t00160 428 503 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 657 1010 gene locus_tag LOCUS_10740 657 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1181 1026 gene locus_tag LOCUS_10750 1181 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1348 1548 gene locus_tag LOCUS_10760 1348 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1579 1974 gene locus_tag LOCUS_10770 1579 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 2506 1988 gene locus_tag LOCUS_10780 2506 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 3020 3241 gene locus_tag LOCUS_10790 3020 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 3355 3933 gene locus_tag LOCUS_10800 3355 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 4520 3972 gene locus_tag LOCUS_10810 4520 3972 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_10810 4579 5940 gene locus_tag LOCUS_10820 gene dacB 4579 5940 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485148.1 protein_id gnl|my_center|LOCUS_10820 6000 7139 gene locus_tag LOCUS_10830 6000 7139 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_10830 7187 8104 gene locus_tag LOCUS_10840 gene tilS 7187 8104 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975427.1 protein_id gnl|my_center|LOCUS_10840 8214 8768 gene locus_tag LOCUS_10850 gene hpt 8214 8768 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_10850 9028 11031 gene locus_tag LOCUS_10860 gene ftsH 9028 11031 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_10860 11028 11627 gene locus_tag LOCUS_10870 gene folE 11028 11627 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_10870 11718 12623 gene locus_tag LOCUS_10880 gene folP 11718 12623 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975435.1 protein_id gnl|my_center|LOCUS_10880 12641 13072 gene locus_tag LOCUS_10890 12641 13072 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975434.1 protein_id gnl|my_center|LOCUS_10890 13065 13460 gene locus_tag LOCUS_10900 gene folB 13065 13460 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028954.1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence060 651 454 gene locus_tag LOCUS_10910 651 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 749 1183 gene locus_tag LOCUS_10920 749 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1785 1468 gene locus_tag LOCUS_10930 1785 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10930 2157 3200 gene locus_tag LOCUS_10940 2157 3200 CDS product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776255.1 protein_id gnl|my_center|LOCUS_10940 4087 3218 gene locus_tag LOCUS_10950 4087 3218 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818670.1 protein_id gnl|my_center|LOCUS_10950 5294 4260 gene locus_tag LOCUS_10960 gene pdxA 5294 4260 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063965.1 protein_id gnl|my_center|LOCUS_10960 6481 5291 gene locus_tag LOCUS_10970 6481 5291 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063966.1 protein_id gnl|my_center|LOCUS_10970 7515 6478 gene locus_tag LOCUS_10980 7515 6478 CDS product 2-keto-3-deoxygluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040097.1 protein_id gnl|my_center|LOCUS_10980 8315 7959 gene locus_tag LOCUS_10990 8315 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 8910 8338 gene locus_tag LOCUS_11000 8910 8338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 10409 8907 gene locus_tag LOCUS_11010 10409 8907 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031600.1 protein_id gnl|my_center|LOCUS_11010 10861 11874 gene locus_tag LOCUS_11020 10861 11874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 12269 12580 gene locus_tag LOCUS_11030 12269 12580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 12620 13447 gene locus_tag LOCUS_11040 12620 13447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 >Feature sequence061 372 605 gene locus_tag LOCUS_11050 372 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 653 1480 gene locus_tag LOCUS_11060 653 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 2498 1881 gene locus_tag LOCUS_11070 2498 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 2805 4322 gene locus_tag LOCUS_11080 2805 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 4322 5746 gene locus_tag LOCUS_11090 4322 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 5743 9939 gene locus_tag LOCUS_11100 5743 9939 CDS product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052667156.1 protein_id gnl|my_center|LOCUS_11100 10708 11031 gene locus_tag LOCUS_11110 10708 11031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 11052 12725 gene locus_tag LOCUS_11120 11052 12725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 12728 13210 gene locus_tag LOCUS_11130 12728 13210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 13557 13258 gene locus_tag LOCUS_11140 13557 13258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence062 48 470 gene locus_tag LOCUS_11150 48 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1396 572 gene locus_tag LOCUS_11160 1396 572 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726931.1 protein_id gnl|my_center|LOCUS_11160 3276 1393 gene locus_tag LOCUS_11170 3276 1393 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_11170 4126 3314 gene locus_tag LOCUS_11180 4126 3314 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064015.1 protein_id gnl|my_center|LOCUS_11180 5337 4357 gene locus_tag LOCUS_11190 5337 4357 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977934.1 protein_id gnl|my_center|LOCUS_11190 5487 6131 gene locus_tag LOCUS_11200 5487 6131 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325539.1 protein_id gnl|my_center|LOCUS_11200 6109 8070 gene locus_tag LOCUS_11210 6109 8070 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977936.1 protein_id gnl|my_center|LOCUS_11210 8067 8813 gene locus_tag LOCUS_11220 8067 8813 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225083.1 protein_id gnl|my_center|LOCUS_11220 9505 8876 gene locus_tag LOCUS_11230 9505 8876 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950348.1 protein_id gnl|my_center|LOCUS_11230 10244 9555 gene locus_tag LOCUS_11240 10244 9555 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776560.1 protein_id gnl|my_center|LOCUS_11240 10817 10443 gene locus_tag LOCUS_11250 10817 10443 CDS product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776209.1 protein_id gnl|my_center|LOCUS_11250 11034 12707 gene locus_tag LOCUS_11260 11034 12707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence063 633 34 gene locus_tag LOCUS_11270 633 34 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777073.1 protein_id gnl|my_center|LOCUS_11270 2316 844 gene locus_tag LOCUS_11280 2316 844 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356603.1 protein_id gnl|my_center|LOCUS_11280 2770 2483 gene locus_tag LOCUS_11290 2770 2483 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094643.1 protein_id gnl|my_center|LOCUS_11290 3827 2889 gene locus_tag LOCUS_11300 3827 2889 CDS product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065279.1 protein_id gnl|my_center|LOCUS_11300 4625 3873 gene locus_tag LOCUS_11310 gene narI 4625 3873 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730339.1 protein_id gnl|my_center|LOCUS_11310 5362 4622 gene locus_tag LOCUS_11320 gene narJ 5362 4622 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026934.1 protein_id gnl|my_center|LOCUS_11320 7110 5359 gene locus_tag LOCUS_11330 gene narH 7110 5359 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730341.1 protein_id gnl|my_center|LOCUS_11330 10796 7110 gene locus_tag LOCUS_11340 10796 7110 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972444.1 protein_id gnl|my_center|LOCUS_11340 11004 12158 gene locus_tag LOCUS_11350 11004 12158 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730343.1 protein_id gnl|my_center|LOCUS_11350 12996 12205 gene locus_tag LOCUS_11360 12996 12205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 13085 13010 gene locus_tag LOCUS_t00170 13085 13010 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 13183 13593 gene locus_tag LOCUS_11370 13183 13593 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190696.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence064 504 2027 gene locus_tag LOCUS_11380 504 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 2234 2731 gene locus_tag LOCUS_11390 2234 2731 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246360.1 protein_id gnl|my_center|LOCUS_11390 3991 3278 gene locus_tag LOCUS_11400 3991 3278 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226433.1 protein_id gnl|my_center|LOCUS_11400 4080 5867 gene locus_tag LOCUS_11410 4080 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 5864 6838 gene locus_tag LOCUS_11420 5864 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 6864 7556 gene locus_tag LOCUS_11430 6864 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 8689 8027 gene locus_tag LOCUS_11440 8689 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 9167 9571 gene locus_tag LOCUS_11450 9167 9571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 9493 11100 gene locus_tag LOCUS_11460 9493 11100 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899914.1 protein_id gnl|my_center|LOCUS_11460 11400 12140 gene locus_tag LOCUS_11470 11400 12140 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064405.1 protein_id gnl|my_center|LOCUS_11470 12137 12976 gene locus_tag LOCUS_11480 12137 12976 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808951.1 protein_id gnl|my_center|LOCUS_11480 13021 13293 gene locus_tag LOCUS_11490 13021 13293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence065 59 727 gene locus_tag LOCUS_11500 59 727 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972510.1 protein_id gnl|my_center|LOCUS_11500 732 1514 gene locus_tag LOCUS_11510 gene pssA 732 1514 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972511.1 protein_id gnl|my_center|LOCUS_11510 2488 1778 gene locus_tag LOCUS_11520 2488 1778 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972879.1 protein_id gnl|my_center|LOCUS_11520 3957 2485 gene locus_tag LOCUS_11530 gene hemG 3957 2485 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_11530 4220 5272 gene locus_tag LOCUS_11540 4220 5272 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742052.1 protein_id gnl|my_center|LOCUS_11540 6294 5335 gene locus_tag LOCUS_11550 gene hemE 6294 5335 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 protein_id gnl|my_center|LOCUS_11550 6519 7217 gene locus_tag LOCUS_11560 6519 7217 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030605.1 protein_id gnl|my_center|LOCUS_11560 7272 8534 gene locus_tag LOCUS_11570 7272 8534 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_11570 8739 9752 gene locus_tag LOCUS_11580 8739 9752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 9932 11131 gene locus_tag LOCUS_11590 9932 11131 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224501.1 protein_id gnl|my_center|LOCUS_11590 11189 13276 gene locus_tag LOCUS_11600 11189 13276 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030602.1 protein_id gnl|my_center|LOCUS_11600 13542 13369 gene locus_tag LOCUS_11610 13542 13369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 >Feature sequence066 208 1212 gene locus_tag LOCUS_11620 208 1212 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061502.1 protein_id gnl|my_center|LOCUS_11620 2385 1276 gene locus_tag LOCUS_11630 2385 1276 CDS product DUF3866 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805204.1 protein_id gnl|my_center|LOCUS_11630 2482 4530 gene locus_tag LOCUS_11640 2482 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 4843 5175 gene locus_tag LOCUS_11650 4843 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 5376 6230 gene locus_tag LOCUS_11660 gene tatC 5376 6230 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226711.1 protein_id gnl|my_center|LOCUS_11660 6346 6768 gene locus_tag LOCUS_11670 6346 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 6856 7752 gene locus_tag LOCUS_11680 6856 7752 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729742.1 protein_id gnl|my_center|LOCUS_11680 7763 10609 gene locus_tag LOCUS_11690 7763 10609 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086507.1 protein_id gnl|my_center|LOCUS_11690 10772 11179 gene locus_tag LOCUS_11700 10772 11179 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226860.1 protein_id gnl|my_center|LOCUS_11700 11632 11204 gene locus_tag LOCUS_11710 11632 11204 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223930.1 protein_id gnl|my_center|LOCUS_11710 12452 11616 gene locus_tag LOCUS_11720 12452 11616 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223929.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence067 1450 305 gene locus_tag LOCUS_11730 gene dgoD 1450 305 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230776.1 protein_id gnl|my_center|LOCUS_11730 2178 1447 gene locus_tag LOCUS_11740 2178 1447 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230779.1 protein_id gnl|my_center|LOCUS_11740 2932 2204 gene locus_tag LOCUS_11750 2932 2204 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109031481.1 protein_id gnl|my_center|LOCUS_11750 4214 3003 gene locus_tag LOCUS_11760 4214 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 5302 4211 gene locus_tag LOCUS_11770 5302 4211 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729463.1 protein_id gnl|my_center|LOCUS_11770 6339 5332 gene locus_tag LOCUS_11780 6339 5332 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729462.1 protein_id gnl|my_center|LOCUS_11780 7874 6354 gene locus_tag LOCUS_11790 7874 6354 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729461.1 protein_id gnl|my_center|LOCUS_11790 8918 7920 gene locus_tag LOCUS_11800 8918 7920 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729460.1 protein_id gnl|my_center|LOCUS_11800 9277 10536 gene locus_tag LOCUS_11810 9277 10536 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776920.1 protein_id gnl|my_center|LOCUS_11810 11967 10585 gene locus_tag LOCUS_11820 11967 10585 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110423.1 protein_id gnl|my_center|LOCUS_11820 <13315 12051 gene locus_tag LOCUS_11830 <13315 12051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016327169.1:ABC transporter permease >Feature sequence068 750 118 gene locus_tag LOCUS_11840 750 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1376 747 gene locus_tag LOCUS_11850 1376 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 3961 1466 gene locus_tag LOCUS_11860 gene leuS 3961 1466 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082796.1 protein_id gnl|my_center|LOCUS_11860 4201 5760 gene locus_tag LOCUS_11870 4201 5760 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228252.1 protein_id gnl|my_center|LOCUS_11870 6703 5828 gene locus_tag LOCUS_11880 6703 5828 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776528.1 protein_id gnl|my_center|LOCUS_11880 6919 7206 gene locus_tag LOCUS_11890 6919 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 8129 7233 gene locus_tag LOCUS_11900 8129 7233 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776529.1 protein_id gnl|my_center|LOCUS_11900 9522 8245 gene locus_tag LOCUS_11910 9522 8245 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776530.1 protein_id gnl|my_center|LOCUS_11910 10194 9715 gene locus_tag LOCUS_11920 10194 9715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 11656 10331 gene locus_tag LOCUS_11930 11656 10331 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226359.1 protein_id gnl|my_center|LOCUS_11930 13054 11687 gene locus_tag LOCUS_11940 13054 11687 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226360.1 protein_id gnl|my_center|LOCUS_11940 >Feature sequence069 725 1384 gene locus_tag LOCUS_11950 725 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1562 1762 gene locus_tag LOCUS_11960 1562 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 3290 1833 gene locus_tag LOCUS_11970 3290 1833 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256571.1 protein_id gnl|my_center|LOCUS_11970 5048 3291 gene locus_tag LOCUS_11980 5048 3291 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256570.1 protein_id gnl|my_center|LOCUS_11980 5723 5334 gene locus_tag LOCUS_11990 5723 5334 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 protein_id gnl|my_center|LOCUS_11990 5680 6015 gene locus_tag LOCUS_12000 5680 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 6563 5973 gene locus_tag LOCUS_12010 6563 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12010 10172 6714 gene locus_tag LOCUS_12020 10172 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12020 10727 10254 gene locus_tag LOCUS_12030 gene nrdR 10727 10254 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973218.1 protein_id gnl|my_center|LOCUS_12030 11369 12088 gene locus_tag LOCUS_12040 gene lexA 11369 12088 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076527.1 protein_id gnl|my_center|LOCUS_12040 12279 13187 gene locus_tag LOCUS_12050 12279 13187 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026882.1 protein_id gnl|my_center|LOCUS_12050 >Feature sequence070 934 2598 gene locus_tag LOCUS_12060 gene ettA 934 2598 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976122.1 protein_id gnl|my_center|LOCUS_12060 2901 3371 gene locus_tag LOCUS_12070 2901 3371 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742154.1 protein_id gnl|my_center|LOCUS_12070 3853 3413 gene locus_tag LOCUS_12080 3853 3413 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028505.1 protein_id gnl|my_center|LOCUS_12080 6061 3968 gene locus_tag LOCUS_12090 6061 3968 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_12090 6389 6940 gene locus_tag LOCUS_12100 6389 6940 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899334.1 protein_id gnl|my_center|LOCUS_12100 9142 7280 gene locus_tag LOCUS_12110 gene ilvD 9142 7280 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727570.1 protein_id gnl|my_center|LOCUS_12110 10164 9379 gene locus_tag LOCUS_12120 10164 9379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 10402 11853 gene locus_tag LOCUS_12130 10402 11853 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226072.1 protein_id gnl|my_center|LOCUS_12130 13112 11832 gene locus_tag LOCUS_12140 13112 11832 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870809.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence071 1470 136 gene locus_tag LOCUS_12150 1470 136 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_12150 3847 1541 gene locus_tag LOCUS_12160 3847 1541 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973290.1 protein_id gnl|my_center|LOCUS_12160 4429 4160 gene locus_tag LOCUS_12170 gene rpsO 4429 4160 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973291.1 protein_id gnl|my_center|LOCUS_12170 5652 4666 gene locus_tag LOCUS_12180 5652 4666 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_12180 6611 5700 gene locus_tag LOCUS_12190 gene truB 6611 5700 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091315604.1 protein_id gnl|my_center|LOCUS_12190 7105 6665 gene locus_tag LOCUS_12200 gene rbfA 7105 6665 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228119.1 protein_id gnl|my_center|LOCUS_12200 7404 7108 gene locus_tag LOCUS_12210 7404 7108 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228120.1 protein_id gnl|my_center|LOCUS_12210 10312 7514 gene locus_tag LOCUS_12220 10312 7514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 9987 10070 gene locus_tag LOCUS_t00180 9987 10070 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10730 10548 gene locus_tag LOCUS_12230 10730 10548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 11892 10867 gene locus_tag LOCUS_12240 gene nusA 11892 10867 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_12240 12339 11905 gene locus_tag LOCUS_12250 gene rimP 12339 11905 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285696.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence072 2897 1977 gene locus_tag LOCUS_12260 2897 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 4656 2968 gene locus_tag LOCUS_12270 4656 2968 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259371.1 protein_id gnl|my_center|LOCUS_12270 5670 4675 gene locus_tag LOCUS_12280 5670 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 7674 6127 gene locus_tag LOCUS_12290 gene gatB 7674 6127 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030281.1 protein_id gnl|my_center|LOCUS_12290 7929 9092 gene locus_tag LOCUS_12300 7929 9092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 9482 10663 gene locus_tag LOCUS_12310 9482 10663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 12423 10927 gene locus_tag LOCUS_12320 gene gatA 12423 10927 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973499.1 protein_id gnl|my_center|LOCUS_12320 12699 12427 gene locus_tag LOCUS_12330 gene gatC 12699 12427 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence073 <1 778 gene locus_tag LOCUS_12340 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031148.1:Tex family protein 1577 846 gene locus_tag LOCUS_12350 1577 846 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014177.1 protein_id gnl|my_center|LOCUS_12350 3152 1656 gene locus_tag LOCUS_12360 3152 1656 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484272.1 protein_id gnl|my_center|LOCUS_12360 3370 4731 gene locus_tag LOCUS_12370 3370 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 4858 5817 gene locus_tag LOCUS_12380 4858 5817 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229986.1 protein_id gnl|my_center|LOCUS_12380 6911 6003 gene locus_tag LOCUS_12390 6911 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 7261 6968 gene locus_tag LOCUS_12400 7261 6968 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031863.1 protein_id gnl|my_center|LOCUS_12400 7410 8165 gene locus_tag LOCUS_12410 7410 8165 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224989.1 protein_id gnl|my_center|LOCUS_12410 8152 8949 gene locus_tag LOCUS_12420 8152 8949 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224990.1 protein_id gnl|my_center|LOCUS_12420 8946 9968 gene locus_tag LOCUS_12430 8946 9968 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_12430 9968 11179 gene locus_tag LOCUS_12440 9968 11179 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_12440 11860 11246 gene locus_tag LOCUS_12450 11860 11246 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224998.1 protein_id gnl|my_center|LOCUS_12450 13112 12021 gene locus_tag LOCUS_12460 13112 12021 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868181.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence074 42 506 gene locus_tag LOCUS_12470 42 506 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224731.1 protein_id gnl|my_center|LOCUS_12470 1102 626 gene locus_tag LOCUS_12480 1102 626 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731373.1 protein_id gnl|my_center|LOCUS_12480 1657 1250 gene locus_tag LOCUS_12490 1657 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 2124 1771 gene locus_tag LOCUS_12500 2124 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730478.1 protein_id gnl|my_center|LOCUS_12500 2206 2685 gene locus_tag LOCUS_12510 2206 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 2817 3761 gene locus_tag LOCUS_12520 2817 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 3834 4154 gene locus_tag LOCUS_12530 3834 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 4170 7565 gene locus_tag LOCUS_12540 4170 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 8601 7696 gene locus_tag LOCUS_12550 gene thpD 8601 7696 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976953.1 protein_id gnl|my_center|LOCUS_12550 9112 9777 gene locus_tag LOCUS_12560 9112 9777 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878199.1 protein_id gnl|my_center|LOCUS_12560 9929 12403 gene locus_tag LOCUS_12570 9929 12403 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861918.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence075 1048 542 gene locus_tag LOCUS_12580 1048 542 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727120.1 protein_id gnl|my_center|LOCUS_12580 1744 1172 gene locus_tag LOCUS_12590 1744 1172 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226057.1 protein_id gnl|my_center|LOCUS_12590 3296 1818 gene locus_tag LOCUS_12600 3296 1818 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803913.1 protein_id gnl|my_center|LOCUS_12600 4353 3493 gene locus_tag LOCUS_12610 4353 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 5129 6394 gene locus_tag LOCUS_12620 5129 6394 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028249.1 protein_id gnl|my_center|LOCUS_12620 6540 7106 gene locus_tag LOCUS_12630 6540 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 8727 7207 gene locus_tag LOCUS_12640 8727 7207 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031537.1 protein_id gnl|my_center|LOCUS_12640 9699 8830 gene locus_tag LOCUS_12650 9699 8830 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776639.1 protein_id gnl|my_center|LOCUS_12650 10712 9696 gene locus_tag LOCUS_12660 10712 9696 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776638.1 protein_id gnl|my_center|LOCUS_12660 11974 10709 gene locus_tag LOCUS_12670 11974 10709 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926040.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence076 866 435 gene locus_tag LOCUS_12680 866 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1962 901 gene locus_tag LOCUS_12690 1962 901 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421605.1 protein_id gnl|my_center|LOCUS_12690 3904 2144 gene locus_tag LOCUS_12700 3904 2144 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230654.1 protein_id gnl|my_center|LOCUS_12700 4247 4783 gene locus_tag LOCUS_12710 4247 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 5118 7025 gene locus_tag LOCUS_12720 5118 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 7164 7355 gene locus_tag LOCUS_12730 7164 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 7449 9053 gene locus_tag LOCUS_12740 7449 9053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 10229 9444 gene locus_tag LOCUS_12750 10229 9444 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_12750 11623 10472 gene locus_tag LOCUS_12760 11623 10472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 12992 11691 gene locus_tag LOCUS_12770 12992 11691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence077 1358 75 gene locus_tag LOCUS_12780 1358 75 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630264.1 protein_id gnl|my_center|LOCUS_12780 1997 1572 gene locus_tag LOCUS_12790 1997 1572 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976661.1 protein_id gnl|my_center|LOCUS_12790 3689 2010 gene locus_tag LOCUS_12800 gene ctaD 3689 2010 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_12800 4571 3690 gene locus_tag LOCUS_12810 gene coxB 4571 3690 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028168.1 protein_id gnl|my_center|LOCUS_12810 5803 5192 gene locus_tag LOCUS_12820 gene rpsD 5803 5192 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812853.1 protein_id gnl|my_center|LOCUS_12820 7092 6121 gene locus_tag LOCUS_12830 7092 6121 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 protein_id gnl|my_center|LOCUS_12830 7751 7404 gene locus_tag LOCUS_12840 7751 7404 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_12840 8639 8040 gene locus_tag LOCUS_12850 8639 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028194.1 protein_id gnl|my_center|LOCUS_12850 9546 8680 gene locus_tag LOCUS_12860 gene htpX 9546 8680 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976613.1 protein_id gnl|my_center|LOCUS_12860 10099 9821 gene locus_tag LOCUS_12870 10099 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976649.1 protein_id gnl|my_center|LOCUS_12870 10851 10096 gene locus_tag LOCUS_12880 10851 10096 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739112.1 protein_id gnl|my_center|LOCUS_12880 10970 11611 gene locus_tag LOCUS_12890 10970 11611 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028173.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12890 11771 12775 gene locus_tag LOCUS_12900 11771 12775 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224067.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence078 674 997 gene locus_tag LOCUS_12910 674 997 CDS product integration host factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977346.1 protein_id gnl|my_center|LOCUS_12910 1208 1798 gene locus_tag LOCUS_12920 gene gmk 1208 1798 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977347.1 protein_id gnl|my_center|LOCUS_12920 1897 2163 gene locus_tag LOCUS_12930 gene rpoZ 1897 2163 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_12930 2254 3507 gene locus_tag LOCUS_12940 gene coaBC 2254 3507 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_12940 3699 4892 gene locus_tag LOCUS_12950 gene metK 3699 4892 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_12950 6347 5115 gene locus_tag LOCUS_12960 6347 5115 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 protein_id gnl|my_center|LOCUS_12960 6786 7463 gene locus_tag LOCUS_12970 6786 7463 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_12970 7730 9439 gene locus_tag LOCUS_12980 gene aspS 7730 9439 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_12980 10017 12050 gene locus_tag LOCUS_12990 10017 12050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence079 1455 289 gene locus_tag LOCUS_13000 1455 289 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486041.1 protein_id gnl|my_center|LOCUS_13000 1725 2426 gene locus_tag LOCUS_13010 1725 2426 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728586.1 protein_id gnl|my_center|LOCUS_13010 3273 2488 gene locus_tag LOCUS_13020 3273 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 4438 3461 gene locus_tag LOCUS_13030 4438 3461 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878043.1 protein_id gnl|my_center|LOCUS_13030 4833 6317 gene locus_tag LOCUS_13040 4833 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 6619 7395 gene locus_tag LOCUS_13050 6619 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 7766 7473 gene locus_tag LOCUS_13060 7766 7473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 8207 8422 gene locus_tag LOCUS_13070 8207 8422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 9069 8551 gene locus_tag LOCUS_13080 9069 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 10354 9167 gene locus_tag LOCUS_13090 10354 9167 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230594.1 protein_id gnl|my_center|LOCUS_13090 11366 10359 gene locus_tag LOCUS_13100 gene moaA 11366 10359 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106977887.1 protein_id gnl|my_center|LOCUS_13100 11653 12474 gene locus_tag LOCUS_13110 11653 12474 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031343.1 protein_id gnl|my_center|LOCUS_13110 12949 12503 gene locus_tag LOCUS_13120 12949 12503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence080 2017 17 gene locus_tag LOCUS_13130 2017 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 3359 2163 gene locus_tag LOCUS_13140 3359 2163 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028249.1 protein_id gnl|my_center|LOCUS_13140 4075 3638 gene locus_tag LOCUS_13150 4075 3638 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027736.1 protein_id gnl|my_center|LOCUS_13150 4737 4072 gene locus_tag LOCUS_13160 4737 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977478.1 protein_id gnl|my_center|LOCUS_13160 5805 5101 gene locus_tag LOCUS_13170 5805 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 5951 7009 gene locus_tag LOCUS_13180 5951 7009 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_13180 7015 7983 gene locus_tag LOCUS_13190 7015 7983 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728848.1 protein_id gnl|my_center|LOCUS_13190 8016 8972 gene locus_tag LOCUS_13200 8016 8972 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407530.1 protein_id gnl|my_center|LOCUS_13200 9115 9846 gene locus_tag LOCUS_13210 9115 9846 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284413.1 protein_id gnl|my_center|LOCUS_13210 9843 10640 gene locus_tag LOCUS_13220 9843 10640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 11899 10637 gene locus_tag LOCUS_13230 11899 10637 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029762.1 protein_id gnl|my_center|LOCUS_13230 12629 12156 gene locus_tag LOCUS_13240 12629 12156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence081 135 869 gene locus_tag LOCUS_13250 135 869 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972858.1 protein_id gnl|my_center|LOCUS_13250 872 1552 gene locus_tag LOCUS_13260 872 1552 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030627.1 protein_id gnl|my_center|LOCUS_13260 1609 2523 gene locus_tag LOCUS_13270 1609 2523 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972856.1 protein_id gnl|my_center|LOCUS_13270 3009 2527 gene locus_tag LOCUS_13280 3009 2527 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256436.1 protein_id gnl|my_center|LOCUS_13280 4762 3041 gene locus_tag LOCUS_13290 4762 3041 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390371.1 protein_id gnl|my_center|LOCUS_13290 4897 5565 gene locus_tag LOCUS_13300 4897 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 5678 6988 gene locus_tag LOCUS_13310 5678 6988 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_13310 7085 8431 gene locus_tag LOCUS_13320 7085 8431 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030488.1 protein_id gnl|my_center|LOCUS_13320 8751 10007 gene locus_tag LOCUS_13330 8751 10007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 10143 10068 gene locus_tag LOCUS_t00190 10143 10068 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10729 10247 gene locus_tag LOCUS_13340 gene bcp 10729 10247 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093079.1 protein_id gnl|my_center|LOCUS_13340 11067 12194 gene locus_tag LOCUS_13350 11067 12194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 12209 12607 gene locus_tag LOCUS_13360 12209 12607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence082 1412 171 gene locus_tag LOCUS_13370 gene serB 1412 171 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 protein_id gnl|my_center|LOCUS_13370 2133 1492 gene locus_tag LOCUS_13380 2133 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 3044 2274 gene locus_tag LOCUS_13390 3044 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027983.1 protein_id gnl|my_center|LOCUS_13390 3101 3886 gene locus_tag LOCUS_13400 3101 3886 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_13400 4208 5134 gene locus_tag LOCUS_13410 4208 5134 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027982.1 protein_id gnl|my_center|LOCUS_13410 5280 6038 gene locus_tag LOCUS_13420 5280 6038 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943926.1 protein_id gnl|my_center|LOCUS_13420 6681 6058 gene locus_tag LOCUS_13430 6681 6058 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338230.1 protein_id gnl|my_center|LOCUS_13430 7750 6881 gene locus_tag LOCUS_13440 7750 6881 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227930.1 protein_id gnl|my_center|LOCUS_13440 8334 7747 gene locus_tag LOCUS_13450 8334 7747 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222036.1 protein_id gnl|my_center|LOCUS_13450 8687 10144 gene locus_tag LOCUS_13460 8687 10144 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227765.1 protein_id gnl|my_center|LOCUS_13460 10246 10067 gene locus_tag LOCUS_13470 10246 10067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 11419 10283 gene locus_tag LOCUS_13480 11419 10283 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854536.1 protein_id gnl|my_center|LOCUS_13480 12088 12492 gene locus_tag LOCUS_13490 12088 12492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence083 2160 1087 gene locus_tag LOCUS_13500 2160 1087 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975032.1 protein_id gnl|my_center|LOCUS_13500 3261 3719 gene locus_tag LOCUS_13510 3261 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 3719 5893 gene locus_tag LOCUS_13520 3719 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13520 6162 6452 gene locus_tag LOCUS_13530 gene rpsF 6162 6452 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898321.1 protein_id gnl|my_center|LOCUS_13530 6557 7138 gene locus_tag LOCUS_13540 6557 7138 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231003.1 protein_id gnl|my_center|LOCUS_13540 7243 7479 gene locus_tag LOCUS_13550 gene rpsR 7243 7479 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949403.1 protein_id gnl|my_center|LOCUS_13550 7508 7954 gene locus_tag LOCUS_13560 gene rplI 7508 7954 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_13560 8307 8984 gene locus_tag LOCUS_13570 8307 8984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 10553 9036 gene locus_tag LOCUS_13580 10553 9036 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence084 628 1425 gene locus_tag LOCUS_13590 628 1425 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872966.1 protein_id gnl|my_center|LOCUS_13590 1468 2301 gene locus_tag LOCUS_13600 1468 2301 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 protein_id gnl|my_center|LOCUS_13600 2356 2607 gene locus_tag LOCUS_13610 2356 2607 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224398.1 protein_id gnl|my_center|LOCUS_13610 2663 2926 gene locus_tag LOCUS_13620 2663 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 2923 3204 gene locus_tag LOCUS_13630 2923 3204 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_13630 3508 4296 gene locus_tag LOCUS_13640 3508 4296 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978600.1 protein_id gnl|my_center|LOCUS_13640 5919 4348 gene locus_tag LOCUS_13650 5919 4348 CDS product acyl--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728060.1 protein_id gnl|my_center|LOCUS_13650 6783 5947 gene locus_tag LOCUS_13660 6783 5947 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029384.1 protein_id gnl|my_center|LOCUS_13660 7655 6999 gene locus_tag LOCUS_13670 7655 6999 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978224.1 protein_id gnl|my_center|LOCUS_13670 7895 9481 gene locus_tag LOCUS_13680 7895 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 10258 9560 gene locus_tag LOCUS_13690 10258 9560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 11983 10511 gene locus_tag LOCUS_13700 11983 10511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 >Feature sequence085 635 213 gene locus_tag LOCUS_13710 635 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 839 1651 gene locus_tag LOCUS_13720 839 1651 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749477.1 protein_id gnl|my_center|LOCUS_13720 1731 2942 gene locus_tag LOCUS_13730 1731 2942 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230159.1 protein_id gnl|my_center|LOCUS_13730 3794 3039 gene locus_tag LOCUS_13740 3794 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 3985 6027 gene locus_tag LOCUS_13750 3985 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 6087 7028 gene locus_tag LOCUS_13760 6087 7028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 7025 8131 gene locus_tag LOCUS_13770 7025 8131 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257788.1 protein_id gnl|my_center|LOCUS_13770 9126 8146 gene locus_tag LOCUS_13780 9126 8146 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222165.1 protein_id gnl|my_center|LOCUS_13780 9444 9136 gene locus_tag LOCUS_13790 9444 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 9346 11877 gene locus_tag LOCUS_13800 9346 11877 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455006.1 protein_id gnl|my_center|LOCUS_13800 11927 12205 gene locus_tag LOCUS_13810 11927 12205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 >Feature sequence086 515 1117 gene locus_tag LOCUS_13820 515 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1290 3545 gene locus_tag LOCUS_13830 1290 3545 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028552.1 protein_id gnl|my_center|LOCUS_13830 3657 5549 gene locus_tag LOCUS_13840 gene typA 3657 5549 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_13840 5680 6291 gene locus_tag LOCUS_13850 5680 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973817.1 protein_id gnl|my_center|LOCUS_13850 6329 7201 gene locus_tag LOCUS_13860 6329 7201 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973816.1 protein_id gnl|my_center|LOCUS_13860 7314 8261 gene locus_tag LOCUS_13870 7314 8261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 10116 8611 gene locus_tag LOCUS_13880 10116 8611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 10701 11381 gene locus_tag LOCUS_13890 10701 11381 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973811.1 protein_id gnl|my_center|LOCUS_13890 11571 11882 gene locus_tag LOCUS_13900 11571 11882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 12069 12311 gene locus_tag LOCUS_13910 12069 12311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence087 1398 1757 gene locus_tag LOCUS_13920 1398 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1863 3980 gene locus_tag LOCUS_13930 1863 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 4063 5637 gene locus_tag LOCUS_13940 4063 5637 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104378.1 protein_id gnl|my_center|LOCUS_13940 5726 6190 gene locus_tag LOCUS_13950 5726 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 7135 6389 gene locus_tag LOCUS_13960 gene pgl 7135 6389 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 protein_id gnl|my_center|LOCUS_13960 8058 7132 gene locus_tag LOCUS_13970 gene opcA 8058 7132 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976880.1 protein_id gnl|my_center|LOCUS_13970 9649 8087 gene locus_tag LOCUS_13980 gene zwf 9649 8087 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031084.1 protein_id gnl|my_center|LOCUS_13980 10857 9748 gene locus_tag LOCUS_13990 gene tal 10857 9748 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976882.1 protein_id gnl|my_center|LOCUS_13990 <12162 10956 gene locus_tag LOCUS_14000 <12162 10956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167022841.1:transketolase >Feature sequence088 1349 2002 gene locus_tag LOCUS_14010 1349 2002 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044665005.1 protein_id gnl|my_center|LOCUS_14010 3554 2046 gene locus_tag LOCUS_14020 3554 2046 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060927.1 protein_id gnl|my_center|LOCUS_14020 4758 3580 gene locus_tag LOCUS_14030 4758 3580 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726727.1 protein_id gnl|my_center|LOCUS_14030 5154 4957 gene locus_tag LOCUS_14040 5154 4957 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971465.1 protein_id gnl|my_center|LOCUS_14040 6494 5103 gene locus_tag LOCUS_14050 6494 5103 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222583.1 protein_id gnl|my_center|LOCUS_14050 8107 6587 gene locus_tag LOCUS_14060 8107 6587 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930183.1 protein_id gnl|my_center|LOCUS_14060 9258 8254 gene locus_tag LOCUS_14070 9258 8254 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804785.1 protein_id gnl|my_center|LOCUS_14070 10177 9386 gene locus_tag LOCUS_14080 10177 9386 CDS product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026965.1 protein_id gnl|my_center|LOCUS_14080 11160 10312 gene locus_tag LOCUS_14090 11160 10312 CDS product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104198.1 protein_id gnl|my_center|LOCUS_14090 11859 11257 gene locus_tag LOCUS_14100 11859 11257 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284165.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence089 2829 382 gene locus_tag LOCUS_14110 2829 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 4304 2964 gene locus_tag LOCUS_14120 gene hisS 4304 2964 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805006.1 protein_id gnl|my_center|LOCUS_14120 4982 5596 gene locus_tag LOCUS_14130 4982 5596 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314218.1 protein_id gnl|my_center|LOCUS_14130 5741 8089 gene locus_tag LOCUS_14140 gene secA2 5741 8089 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223120.1 protein_id gnl|my_center|LOCUS_14140 8287 8556 gene locus_tag LOCUS_14150 8287 8556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 9190 8864 gene locus_tag LOCUS_14160 9190 8864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 10285 9431 gene locus_tag LOCUS_14170 10285 9431 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028594.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence090 1459 875 gene locus_tag LOCUS_14180 1459 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805165.1 protein_id gnl|my_center|LOCUS_14180 1582 2691 gene locus_tag LOCUS_14190 gene cobC 1582 2691 CDS product Rv2231c family pyridoxal phosphate-dependent protein CobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897661.1 protein_id gnl|my_center|LOCUS_14190 2673 3623 gene locus_tag LOCUS_14200 2673 3623 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093951710.1 protein_id gnl|my_center|LOCUS_14200 5189 3657 gene locus_tag LOCUS_14210 5189 3657 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899877.1 protein_id gnl|my_center|LOCUS_14210 5970 5263 gene locus_tag LOCUS_14220 5970 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14220 7445 6240 gene locus_tag LOCUS_14230 7445 6240 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227909.1 protein_id gnl|my_center|LOCUS_14230 7481 8152 gene locus_tag LOCUS_14240 7481 8152 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052900.1 protein_id gnl|my_center|LOCUS_14240 8307 8864 gene locus_tag LOCUS_14250 8307 8864 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975987.1 protein_id gnl|my_center|LOCUS_14250 10153 8969 gene locus_tag LOCUS_14260 10153 8969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 11657 10449 gene locus_tag LOCUS_14270 11657 10449 CDS product damage-control phosphatase ARMT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485432.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence091 1409 222 gene locus_tag LOCUS_14280 1409 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776460.1 protein_id gnl|my_center|LOCUS_14280 2275 1406 gene locus_tag LOCUS_14290 2275 1406 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013320.1 protein_id gnl|my_center|LOCUS_14290 3022 2282 gene locus_tag LOCUS_14300 3022 2282 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013321.1 protein_id gnl|my_center|LOCUS_14300 3150 3689 gene locus_tag LOCUS_14310 3150 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030585.1 protein_id gnl|my_center|LOCUS_14310 3749 4075 gene locus_tag LOCUS_14320 3749 4075 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013322.1 protein_id gnl|my_center|LOCUS_14320 4072 5013 gene locus_tag LOCUS_14330 4072 5013 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013323.1 protein_id gnl|my_center|LOCUS_14330 6215 5199 gene locus_tag LOCUS_14340 6215 5199 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755440.1 protein_id gnl|my_center|LOCUS_14340 7330 6212 gene locus_tag LOCUS_14350 7330 6212 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804042.1 protein_id gnl|my_center|LOCUS_14350 8480 7332 gene locus_tag LOCUS_14360 8480 7332 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804043.1 protein_id gnl|my_center|LOCUS_14360 9009 8689 gene locus_tag LOCUS_14370 9009 8689 CDS product DUF3870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804044.1 protein_id gnl|my_center|LOCUS_14370 10489 9437 gene locus_tag LOCUS_14380 10489 9437 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027140.1 protein_id gnl|my_center|LOCUS_14380 11275 10601 gene locus_tag LOCUS_14390 11275 10601 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028033.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence092 508 918 gene locus_tag LOCUS_14400 508 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1137 2888 gene locus_tag LOCUS_14410 gene ftsI 1137 2888 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_14410 3846 2938 gene locus_tag LOCUS_14420 gene mmuM 3846 2938 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909348.1 protein_id gnl|my_center|LOCUS_14420 4468 5727 gene locus_tag LOCUS_14430 4468 5727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 6086 7723 gene locus_tag LOCUS_14440 6086 7723 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 protein_id gnl|my_center|LOCUS_14440 8091 9542 gene locus_tag LOCUS_14450 8091 9542 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_14450 9539 10609 gene locus_tag LOCUS_14460 gene mraY 9539 10609 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976728.1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence093 195 1484 gene locus_tag LOCUS_14470 195 1484 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977384.1 protein_id gnl|my_center|LOCUS_14470 1516 1989 gene locus_tag LOCUS_14480 gene ribH 1516 1989 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224642.1 protein_id gnl|my_center|LOCUS_14480 2038 2532 gene locus_tag LOCUS_14490 2038 2532 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805205.1 protein_id gnl|my_center|LOCUS_14490 2659 3828 gene locus_tag LOCUS_14500 2659 3828 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727161.1 protein_id gnl|my_center|LOCUS_14500 3996 4571 gene locus_tag LOCUS_14510 3996 4571 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 protein_id gnl|my_center|LOCUS_14510 5591 4668 gene locus_tag LOCUS_14520 5591 4668 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804906.1 protein_id gnl|my_center|LOCUS_14520 8411 5706 gene locus_tag LOCUS_14530 8411 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 9300 8755 gene locus_tag LOCUS_14540 9300 8755 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896521.1 protein_id gnl|my_center|LOCUS_14540 9500 9991 gene locus_tag LOCUS_14550 9500 9991 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227147.1 protein_id gnl|my_center|LOCUS_14550 10042 10803 gene locus_tag LOCUS_14560 10042 10803 CDS product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027875.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence094 643 2133 gene locus_tag LOCUS_14570 643 2133 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974973.1 protein_id gnl|my_center|LOCUS_14570 2611 2270 gene locus_tag LOCUS_14580 2611 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 3002 4180 gene locus_tag LOCUS_14590 gene rhaI 3002 4180 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226383.1 protein_id gnl|my_center|LOCUS_14590 4168 6273 gene locus_tag LOCUS_14600 4168 6273 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027370.1 protein_id gnl|my_center|LOCUS_14600 6279 7772 gene locus_tag LOCUS_14610 6279 7772 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978046.1 protein_id gnl|my_center|LOCUS_14610 8205 7813 gene locus_tag LOCUS_14620 8205 7813 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977738.1 protein_id gnl|my_center|LOCUS_14620 8113 8496 gene locus_tag LOCUS_14630 8113 8496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 9754 8555 gene locus_tag LOCUS_14640 gene fdhA 9754 8555 CDS product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226972.1 protein_id gnl|my_center|LOCUS_14640 10710 9931 gene locus_tag LOCUS_14650 10710 9931 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_14650 <11500 10848 gene locus_tag LOCUS_14660 <11500 10848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976584.1:sugar ABC transporter permease >Feature sequence095 190 657 gene locus_tag LOCUS_14670 190 657 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222590.1 protein_id gnl|my_center|LOCUS_14670 654 980 gene locus_tag LOCUS_14680 654 980 CDS product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974664.1 protein_id gnl|my_center|LOCUS_14680 1287 2531 gene locus_tag LOCUS_14690 1287 2531 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975631.1 protein_id gnl|my_center|LOCUS_14690 3331 2528 gene locus_tag LOCUS_14700 3331 2528 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316379.1 protein_id gnl|my_center|LOCUS_14700 3514 4233 gene locus_tag LOCUS_14710 3514 4233 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777044.1 protein_id gnl|my_center|LOCUS_14710 6186 4276 gene locus_tag LOCUS_14720 6186 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 6989 6915 gene locus_tag LOCUS_t00200 6989 6915 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7253 8245 gene locus_tag LOCUS_14730 7253 8245 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226477.1 protein_id gnl|my_center|LOCUS_14730 8368 10890 gene locus_tag LOCUS_14740 8368 10890 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_14740 11367 10891 gene locus_tag LOCUS_14750 11367 10891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence096 911 2521 gene locus_tag LOCUS_14760 911 2521 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222858.1 protein_id gnl|my_center|LOCUS_14760 2831 4609 gene locus_tag LOCUS_14770 2831 4609 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029950.1 protein_id gnl|my_center|LOCUS_14770 5057 6532 gene locus_tag LOCUS_14780 5057 6532 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776817.1 protein_id gnl|my_center|LOCUS_14780 6690 7982 gene locus_tag LOCUS_14790 6690 7982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973466.1 protein_id gnl|my_center|LOCUS_14790 8491 8210 gene locus_tag LOCUS_14800 8491 8210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 8376 8678 gene locus_tag LOCUS_14810 8376 8678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 8901 9533 gene locus_tag LOCUS_14820 8901 9533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 9601 9990 gene locus_tag LOCUS_14830 9601 9990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 10028 11071 gene locus_tag LOCUS_14840 10028 11071 CDS product peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236036873.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence097 <1 1396 gene locus_tag LOCUS_14850 <1 1396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224530.1:L-glutamate gamma-semialdehyde dehydrogenase 1550 2476 gene locus_tag LOCUS_14860 1550 2476 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224531.1 protein_id gnl|my_center|LOCUS_14860 2579 3505 gene locus_tag LOCUS_14870 2579 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 3859 3608 gene locus_tag LOCUS_14880 3859 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 5331 4111 gene locus_tag LOCUS_14890 5331 4111 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229842.1 protein_id gnl|my_center|LOCUS_14890 6475 5426 gene locus_tag LOCUS_14900 6475 5426 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975733.1 protein_id gnl|my_center|LOCUS_14900 6803 8182 gene locus_tag LOCUS_14910 6803 8182 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028755.1 protein_id gnl|my_center|LOCUS_14910 8328 9056 gene locus_tag LOCUS_14920 8328 9056 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977515.1 protein_id gnl|my_center|LOCUS_14920 9144 10289 gene locus_tag LOCUS_14930 9144 10289 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_14930 10668 10426 gene locus_tag LOCUS_14940 10668 10426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence098 <1 1081 gene locus_tag LOCUS_14950 <1 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_093456948.1:trypsin-like peptidase domain-containing protein 2351 1212 gene locus_tag LOCUS_14960 2351 1212 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_14960 2751 3740 gene locus_tag LOCUS_14970 2751 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 4167 3718 gene locus_tag LOCUS_14980 4167 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 4640 4164 gene locus_tag LOCUS_14990 4640 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 4801 5958 gene locus_tag LOCUS_15000 4801 5958 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219537380.1 protein_id gnl|my_center|LOCUS_15000 5955 6491 gene locus_tag LOCUS_15010 gene purE 5955 6491 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 protein_id gnl|my_center|LOCUS_15010 7918 6587 gene locus_tag LOCUS_15020 7918 6587 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975759.1 protein_id gnl|my_center|LOCUS_15020 8816 8154 gene locus_tag LOCUS_15030 8816 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 10369 8855 gene locus_tag LOCUS_15040 10369 8855 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326400.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence099 2193 79 gene locus_tag LOCUS_15050 2193 79 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243180.1 protein_id gnl|my_center|LOCUS_15050 3514 2228 gene locus_tag LOCUS_15060 3514 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 4125 3568 gene locus_tag LOCUS_15070 4125 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 4477 5352 gene locus_tag LOCUS_15080 4477 5352 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028476.1 protein_id gnl|my_center|LOCUS_15080 6289 5363 gene locus_tag LOCUS_15090 6289 5363 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728933.1 protein_id gnl|my_center|LOCUS_15090 6403 7311 gene locus_tag LOCUS_15100 6403 7311 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728945.1 protein_id gnl|my_center|LOCUS_15100 7653 7339 gene locus_tag LOCUS_15110 7653 7339 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862490.1 protein_id gnl|my_center|LOCUS_15110 8072 7650 gene locus_tag LOCUS_15120 8072 7650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 8293 10095 gene locus_tag LOCUS_15130 8293 10095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 >Feature sequence100 801 2255 gene locus_tag LOCUS_15140 801 2255 CDS product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223535.1 protein_id gnl|my_center|LOCUS_15140 2540 2355 gene locus_tag LOCUS_15150 2540 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 2485 3966 gene locus_tag LOCUS_15160 2485 3966 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006194892.1 protein_id gnl|my_center|LOCUS_15160 4653 4018 gene locus_tag LOCUS_15170 4653 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 4845 6146 gene locus_tag LOCUS_15180 4845 6146 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027627.1 protein_id gnl|my_center|LOCUS_15180 6263 7786 gene locus_tag LOCUS_15190 6263 7786 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776830.1 protein_id gnl|my_center|LOCUS_15190 7786 8184 gene locus_tag LOCUS_15200 7786 8184 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070936545.1 protein_id gnl|my_center|LOCUS_15200 8634 8233 gene locus_tag LOCUS_15210 gene mnhG 8634 8233 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064840.1 protein_id gnl|my_center|LOCUS_15210 8933 8631 gene locus_tag LOCUS_15220 8933 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15220 9541 8930 gene locus_tag LOCUS_15230 9541 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 <11175 9541 gene locus_tag LOCUS_15240 <11175 9541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031337.1:Na+/H+ antiporter subunit D >Feature sequence101 438 2969 gene locus_tag LOCUS_15250 438 2969 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228183.1 protein_id gnl|my_center|LOCUS_15250 2972 3427 gene locus_tag LOCUS_15260 2972 3427 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229428.1 protein_id gnl|my_center|LOCUS_15260 3436 3885 gene locus_tag LOCUS_15270 3436 3885 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561733.1 protein_id gnl|my_center|LOCUS_15270 3866 4450 gene locus_tag LOCUS_15280 3866 4450 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561734.1 protein_id gnl|my_center|LOCUS_15280 4674 5642 gene locus_tag LOCUS_15290 4674 5642 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027621.1 protein_id gnl|my_center|LOCUS_15290 6414 5620 gene locus_tag LOCUS_15300 6414 5620 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228155.1 protein_id gnl|my_center|LOCUS_15300 7786 6452 gene locus_tag LOCUS_15310 7786 6452 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974129.1 protein_id gnl|my_center|LOCUS_15310 8646 7783 gene locus_tag LOCUS_15320 8646 7783 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029901.1 protein_id gnl|my_center|LOCUS_15320 9759 8839 gene locus_tag LOCUS_15330 9759 8839 CDS product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229285.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence102 1000 458 gene locus_tag LOCUS_15340 1000 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1165 1078 gene locus_tag LOCUS_t00210 1165 1078 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1802 1275 gene locus_tag LOCUS_15350 1802 1275 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495205.1 protein_id gnl|my_center|LOCUS_15350 2098 3066 gene locus_tag LOCUS_15360 2098 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 3070 4062 gene locus_tag LOCUS_15370 3070 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 4742 4068 gene locus_tag LOCUS_15380 4742 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 4910 5989 gene locus_tag LOCUS_15390 gene hisC 4910 5989 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_15390 7373 6123 gene locus_tag LOCUS_15400 7373 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 8933 7638 gene locus_tag LOCUS_15410 gene murA 8933 7638 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227695.1 protein_id gnl|my_center|LOCUS_15410 10870 9620 gene locus_tag LOCUS_15420 gene purD 10870 9620 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence103 2475 151 gene locus_tag LOCUS_15430 gene purL 2475 151 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974893.1 protein_id gnl|my_center|LOCUS_15430 3040 2507 gene locus_tag LOCUS_15440 3040 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 3775 3080 gene locus_tag LOCUS_15450 gene purQ 3775 3080 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230758.1 protein_id gnl|my_center|LOCUS_15450 4485 4012 gene locus_tag LOCUS_15460 4485 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 4902 4657 gene locus_tag LOCUS_15470 gene purS 4902 4657 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974895.1 protein_id gnl|my_center|LOCUS_15470 5200 5844 gene locus_tag LOCUS_15480 gene sigR 5200 5844 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_15480 6879 5974 gene locus_tag LOCUS_15490 6879 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 7630 7325 gene locus_tag LOCUS_15500 7630 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 8281 9396 gene locus_tag LOCUS_15510 gene pdhA 8281 9396 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_15510 9400 10380 gene locus_tag LOCUS_15520 9400 10380 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence104 <1 864 gene locus_tag LOCUS_15530 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230505.1:site-specific integrase 1038 964 gene locus_tag LOCUS_t00220 1038 964 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2182 1151 gene locus_tag LOCUS_15540 2182 1151 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862312.1 protein_id gnl|my_center|LOCUS_15540 4079 2265 gene locus_tag LOCUS_15550 4079 2265 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227191.1 protein_id gnl|my_center|LOCUS_15550 4327 4758 gene locus_tag LOCUS_15560 4327 4758 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257678.1 protein_id gnl|my_center|LOCUS_15560 7096 5402 gene locus_tag LOCUS_15570 7096 5402 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218916600.1 protein_id gnl|my_center|LOCUS_15570 9010 7697 gene locus_tag LOCUS_15580 9010 7697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 9707 9048 gene locus_tag LOCUS_15590 9707 9048 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522757.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence105 2628 1618 gene locus_tag LOCUS_15600 2628 1618 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972813.1 protein_id gnl|my_center|LOCUS_15600 3071 4768 gene locus_tag LOCUS_15610 gene sirA 3071 4768 CDS product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972818.1 protein_id gnl|my_center|LOCUS_15610 4826 5026 gene locus_tag LOCUS_15620 4826 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 5023 5721 gene locus_tag LOCUS_15630 5023 5721 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972820.1 protein_id gnl|my_center|LOCUS_15630 5718 6473 gene locus_tag LOCUS_15640 5718 6473 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030650.1 protein_id gnl|my_center|LOCUS_15640 6559 7239 gene locus_tag LOCUS_15650 6559 7239 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180345.1 protein_id gnl|my_center|LOCUS_15650 7321 7977 gene locus_tag LOCUS_15660 7321 7977 CDS product pyridoxal 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112028.1 protein_id gnl|my_center|LOCUS_15660 8090 9721 gene locus_tag LOCUS_15670 8090 9721 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence106 309 2342 gene locus_tag LOCUS_15680 309 2342 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776700.1 protein_id gnl|my_center|LOCUS_15680 2339 4189 gene locus_tag LOCUS_15690 2339 4189 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776699.1 protein_id gnl|my_center|LOCUS_15690 5210 4209 gene locus_tag LOCUS_15700 5210 4209 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896728.1 protein_id gnl|my_center|LOCUS_15700 5340 5684 gene locus_tag LOCUS_15710 gene hisI 5340 5684 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976772.1 protein_id gnl|my_center|LOCUS_15710 5732 6403 gene locus_tag LOCUS_15720 5732 6403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 6393 6677 gene locus_tag LOCUS_15730 6393 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 6936 7337 gene locus_tag LOCUS_15740 6936 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 7340 7942 gene locus_tag LOCUS_15750 7340 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 8007 8429 gene locus_tag LOCUS_15760 8007 8429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 8596 9402 gene locus_tag LOCUS_15770 gene trpC 8596 9402 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence107 <1 644 gene locus_tag LOCUS_15780 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162618331.1:penicillin-binding transpeptidase domain-containing protein 1053 1421 gene locus_tag LOCUS_tm00010 1053 1421 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1900 1568 gene locus_tag LOCUS_15790 1900 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 3114 1978 gene locus_tag LOCUS_15800 gene nagA 3114 1978 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728170.1 protein_id gnl|my_center|LOCUS_15800 3770 4285 gene locus_tag LOCUS_15810 3770 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 5219 4296 gene locus_tag LOCUS_15820 5219 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 5510 7318 gene locus_tag LOCUS_15830 5510 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 7319 9157 gene locus_tag LOCUS_15840 7319 9157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229290.1 protein_id gnl|my_center|LOCUS_15840 9154 9294 gene locus_tag LOCUS_15850 9154 9294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence108 1019 231 gene locus_tag LOCUS_15860 1019 231 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230059.1 protein_id gnl|my_center|LOCUS_15860 1251 3464 gene locus_tag LOCUS_15870 1251 3464 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185048585.1 protein_id gnl|my_center|LOCUS_15870 4276 3473 gene locus_tag LOCUS_15880 4276 3473 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726964.1 protein_id gnl|my_center|LOCUS_15880 5248 4457 gene locus_tag LOCUS_15890 5248 4457 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 protein_id gnl|my_center|LOCUS_15890 6183 5383 gene locus_tag LOCUS_15900 6183 5383 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224750.1 protein_id gnl|my_center|LOCUS_15900 6290 7441 gene locus_tag LOCUS_15910 6290 7441 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110594.1 protein_id gnl|my_center|LOCUS_15910 7485 8114 gene locus_tag LOCUS_15920 7485 8114 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087056.1 protein_id gnl|my_center|LOCUS_15920 8242 9444 gene locus_tag LOCUS_15930 8242 9444 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222776.1 protein_id gnl|my_center|LOCUS_15930 10253 9456 gene locus_tag LOCUS_15940 10253 9456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence109 404 54 gene locus_tag LOCUS_15950 404 54 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_15950 676 1266 gene locus_tag LOCUS_15960 676 1266 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975326.1 protein_id gnl|my_center|LOCUS_15960 1263 1964 gene locus_tag LOCUS_15970 1263 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 2797 2054 gene locus_tag LOCUS_15980 2797 2054 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976252.1 protein_id gnl|my_center|LOCUS_15980 3933 2794 gene locus_tag LOCUS_15990 gene dnaJ 3933 2794 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_15990 4951 3938 gene locus_tag LOCUS_16000 gene hrcA 4951 3938 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_16000 5126 5968 gene locus_tag LOCUS_16010 5126 5968 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976247.1 protein_id gnl|my_center|LOCUS_16010 6721 6422 gene locus_tag LOCUS_16020 6721 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 6710 7039 gene locus_tag LOCUS_16030 6710 7039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 7088 7684 gene locus_tag LOCUS_16040 7088 7684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 9063 7831 gene locus_tag LOCUS_16050 gene hemW 9063 7831 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 protein_id gnl|my_center|LOCUS_16050 9334 9876 gene locus_tag LOCUS_16060 9334 9876 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227281.1 protein_id gnl|my_center|LOCUS_16060 <10475 9952 gene locus_tag LOCUS_16070 <10475 9952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976582.1:LacI family DNA-binding transcriptional regulator >Feature sequence110 2257 461 gene locus_tag LOCUS_16080 2257 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 2856 2254 gene locus_tag LOCUS_16090 2856 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 3978 3445 gene locus_tag LOCUS_16100 3978 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 4596 5912 gene locus_tag LOCUS_16110 4596 5912 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013841.1 protein_id gnl|my_center|LOCUS_16110 8295 6043 gene locus_tag LOCUS_16120 8295 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 <10366 8336 gene locus_tag LOCUS_16130 <10366 8336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000218177.1:ATP-dependent helicase >Feature sequence111 <1 710 gene locus_tag LOCUS_16140 <1 710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029795.1:elongation factor Tu 961 1269 gene locus_tag LOCUS_16150 gene rpsJ 961 1269 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_16150 1282 1932 gene locus_tag LOCUS_16160 gene rplC 1282 1932 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_16160 1935 2606 gene locus_tag LOCUS_16170 gene rplD 1935 2606 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 protein_id gnl|my_center|LOCUS_16170 2603 2893 gene locus_tag LOCUS_16180 2603 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 3004 3792 gene locus_tag LOCUS_16190 gene rplB 3004 3792 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727672.1 protein_id gnl|my_center|LOCUS_16190 3805 4083 gene locus_tag LOCUS_16200 gene rpsS 3805 4083 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814508.1 protein_id gnl|my_center|LOCUS_16200 4139 4525 gene locus_tag LOCUS_16210 gene rplV 4139 4525 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974262.1 protein_id gnl|my_center|LOCUS_16210 4525 5319 gene locus_tag LOCUS_16220 4525 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 5323 5739 gene locus_tag LOCUS_16230 gene rplP 5323 5739 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974260.1 protein_id gnl|my_center|LOCUS_16230 5739 5993 gene locus_tag LOCUS_16240 gene rpmC 5739 5993 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 protein_id gnl|my_center|LOCUS_16240 5990 6262 gene locus_tag LOCUS_16250 gene rpsQ 5990 6262 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_16250 6365 6733 gene locus_tag LOCUS_16260 gene rplN 6365 6733 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974257.1 protein_id gnl|my_center|LOCUS_16260 6737 7042 gene locus_tag LOCUS_16270 gene rplX 6737 7042 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222610.1 protein_id gnl|my_center|LOCUS_16270 7042 7617 gene locus_tag LOCUS_16280 gene rplE 7042 7617 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_16280 7634 7819 gene locus_tag LOCUS_16290 7634 7819 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_16290 8100 8498 gene locus_tag LOCUS_16300 gene rpsH 8100 8498 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974254.1 protein_id gnl|my_center|LOCUS_16300 8517 9053 gene locus_tag LOCUS_16310 gene rplF 8517 9053 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 protein_id gnl|my_center|LOCUS_16310 9056 9436 gene locus_tag LOCUS_16320 9056 9436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 9488 10078 gene locus_tag LOCUS_16330 gene rpsE 9488 10078 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974251.1 protein_id gnl|my_center|LOCUS_16330 10081 10266 gene locus_tag LOCUS_16340 gene rpmD 10081 10266 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776359.1 protein_id gnl|my_center|LOCUS_16340 >Feature sequence112 3206 1590 gene locus_tag LOCUS_16350 3206 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 4780 3203 gene locus_tag LOCUS_16360 4780 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 5090 5003 gene locus_tag LOCUS_t00230 5090 5003 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5499 5101 gene locus_tag LOCUS_16370 gene tadA 5499 5101 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974924.1 protein_id gnl|my_center|LOCUS_16370 6070 5585 gene locus_tag LOCUS_16380 6070 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 6612 6112 gene locus_tag LOCUS_16390 6612 6112 CDS product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199198884.1 protein_id gnl|my_center|LOCUS_16390 6851 6615 gene locus_tag LOCUS_16400 6851 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 6949 7602 gene locus_tag LOCUS_16410 gene upp 6949 7602 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 protein_id gnl|my_center|LOCUS_16410 7995 8237 gene locus_tag LOCUS_16420 7995 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 8462 8626 gene locus_tag LOCUS_16430 8462 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 8714 9151 gene locus_tag LOCUS_16440 8714 9151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 9398 9619 gene locus_tag LOCUS_16450 9398 9619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 >Feature sequence113 186 443 gene locus_tag LOCUS_16460 186 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 577 1893 gene locus_tag LOCUS_16470 577 1893 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229668.1 protein_id gnl|my_center|LOCUS_16470 1890 3026 gene locus_tag LOCUS_16480 1890 3026 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229667.1 protein_id gnl|my_center|LOCUS_16480 4567 3143 gene locus_tag LOCUS_16490 gene xylB 4567 3143 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222654.1 protein_id gnl|my_center|LOCUS_16490 4886 5776 gene locus_tag LOCUS_16500 4886 5776 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977267.1 protein_id gnl|my_center|LOCUS_16500 6028 7068 gene locus_tag LOCUS_16510 6028 7068 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_16510 7076 7846 gene locus_tag LOCUS_16520 7076 7846 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972825.1 protein_id gnl|my_center|LOCUS_16520 7839 8717 gene locus_tag LOCUS_16530 7839 8717 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223442.1 protein_id gnl|my_center|LOCUS_16530 9380 8796 gene locus_tag LOCUS_16540 9380 8796 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977779.1 protein_id gnl|my_center|LOCUS_16540 <10157 9534 gene locus_tag LOCUS_16550 <10157 9534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030383.1:PucR family transcriptional regulator >Feature sequence114 <1 1035 gene locus_tag LOCUS_16560 <1 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727542.1:3'-5' exonuclease 2506 1460 gene locus_tag LOCUS_16570 2506 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031309.1 protein_id gnl|my_center|LOCUS_16570 4533 2503 gene locus_tag LOCUS_16580 gene fxlM 4533 2503 CDS product methyltransferase, FxLD system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031310.1 protein_id gnl|my_center|LOCUS_16580 5767 4523 gene locus_tag LOCUS_16590 5767 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 7032 5764 gene locus_tag LOCUS_16600 7032 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16600 7897 7025 gene locus_tag LOCUS_16610 7897 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 8096 7929 gene locus_tag LOCUS_16620 8096 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 9072 8209 gene locus_tag LOCUS_16630 9072 8209 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028635.1 protein_id gnl|my_center|LOCUS_16630 9597 9073 gene locus_tag LOCUS_16640 9597 9073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 9772 9581 gene locus_tag LOCUS_16650 9772 9581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 >Feature sequence115 938 564 gene locus_tag LOCUS_16660 938 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975153.1 protein_id gnl|my_center|LOCUS_16660 2585 1488 gene locus_tag LOCUS_16670 gene paaK 2585 1488 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838237.1 protein_id gnl|my_center|LOCUS_16670 3103 2588 gene locus_tag LOCUS_16680 gene paaJ 3103 2588 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868899.1 protein_id gnl|my_center|LOCUS_16680 3975 3097 gene locus_tag LOCUS_16690 gene paaC 3975 3097 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223465.1 protein_id gnl|my_center|LOCUS_16690 4358 4041 gene locus_tag LOCUS_16700 gene paaB 4358 4041 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454960.1 protein_id gnl|my_center|LOCUS_16700 5329 4355 gene locus_tag LOCUS_16710 gene paaA 5329 4355 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083210.1 protein_id gnl|my_center|LOCUS_16710 6248 5439 gene locus_tag LOCUS_16720 6248 5439 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113330.1 protein_id gnl|my_center|LOCUS_16720 7298 6477 gene locus_tag LOCUS_16730 7298 6477 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_16730 8134 7574 gene locus_tag LOCUS_16740 8134 7574 CDS product DUF2165 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528349.1 protein_id gnl|my_center|LOCUS_16740 8976 8134 gene locus_tag LOCUS_16750 8976 8134 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039537.1 protein_id gnl|my_center|LOCUS_16750 9793 8993 gene locus_tag LOCUS_16760 9793 8993 CDS product AfsA-related hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227007.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence116 676 212 gene locus_tag LOCUS_16770 676 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 2345 687 gene locus_tag LOCUS_16780 2345 687 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731142.1 protein_id gnl|my_center|LOCUS_16780 2642 5890 gene locus_tag LOCUS_16790 gene fdh 2642 5890 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227547.1 protein_id gnl|my_center|LOCUS_16790 5900 6787 gene locus_tag LOCUS_16800 5900 6787 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727951.1 protein_id gnl|my_center|LOCUS_16800 6784 7833 gene locus_tag LOCUS_16810 gene nrfD 6784 7833 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227549.1 protein_id gnl|my_center|LOCUS_16810 7987 8415 gene locus_tag LOCUS_16820 7987 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 8682 9767 gene locus_tag LOCUS_16830 gene pdhA 8682 9767 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467649.1 protein_id gnl|my_center|LOCUS_16830 >Feature sequence117 <1 1664 gene locus_tag LOCUS_16840 <1 1664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003912368.1:cell division-associated protein FhaA 3182 2523 gene locus_tag LOCUS_16850 3182 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 3940 3179 gene locus_tag LOCUS_16860 3940 3179 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028262.1 protein_id gnl|my_center|LOCUS_16860 4928 4059 gene locus_tag LOCUS_16870 4928 4059 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028263.1 protein_id gnl|my_center|LOCUS_16870 5145 6029 gene locus_tag LOCUS_16880 5145 6029 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226050.1 protein_id gnl|my_center|LOCUS_16880 6053 6916 gene locus_tag LOCUS_16890 6053 6916 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976705.1 protein_id gnl|my_center|LOCUS_16890 7364 6894 gene locus_tag LOCUS_16900 7364 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 7722 8075 gene locus_tag LOCUS_16910 7722 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence118 1564 791 gene locus_tag LOCUS_16920 1564 791 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027371.1 protein_id gnl|my_center|LOCUS_16920 1772 2491 gene locus_tag LOCUS_16930 1772 2491 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223733.1 protein_id gnl|my_center|LOCUS_16930 2955 3776 gene locus_tag LOCUS_16940 2955 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 3865 5559 gene locus_tag LOCUS_16950 gene pgi 3865 5559 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028056.1 protein_id gnl|my_center|LOCUS_16950 5710 7539 gene locus_tag LOCUS_16960 5710 7539 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973521.1 protein_id gnl|my_center|LOCUS_16960 8218 7598 gene locus_tag LOCUS_16970 8218 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 8393 8779 gene locus_tag LOCUS_16980 8393 8779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 8929 9291 gene locus_tag LOCUS_16990 8929 9291 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027943.1 protein_id gnl|my_center|LOCUS_16990 9764 9363 gene locus_tag LOCUS_17000 9764 9363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 >Feature sequence119 400 1248 gene locus_tag LOCUS_17010 gene mutM 400 1248 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223692.1 protein_id gnl|my_center|LOCUS_17010 1360 1665 gene locus_tag LOCUS_17020 1360 1665 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223794.1 protein_id gnl|my_center|LOCUS_17020 2014 2202 gene locus_tag LOCUS_17030 2014 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2601 6146 gene locus_tag LOCUS_17040 gene smc 2601 6146 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030315.1 protein_id gnl|my_center|LOCUS_17040 8740 6518 gene locus_tag LOCUS_17050 8740 6518 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_17050 8877 9587 gene locus_tag LOCUS_17060 8877 9587 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231033.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence120 679 152 gene locus_tag LOCUS_17070 679 152 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466682.1 protein_id gnl|my_center|LOCUS_17070 1882 689 gene locus_tag LOCUS_17080 1882 689 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224141.1 protein_id gnl|my_center|LOCUS_17080 3170 1908 gene locus_tag LOCUS_17090 3170 1908 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040674.1 protein_id gnl|my_center|LOCUS_17090 3562 4245 gene locus_tag LOCUS_17100 3562 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 4277 4810 gene locus_tag LOCUS_17110 4277 4810 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222694.1 protein_id gnl|my_center|LOCUS_17110 6950 4854 gene locus_tag LOCUS_17120 6950 4854 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224627.1 protein_id gnl|my_center|LOCUS_17120 7085 8020 gene locus_tag LOCUS_17130 gene fmt 7085 8020 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_17130 8096 9559 gene locus_tag LOCUS_17140 8096 9559 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence121 1195 881 gene locus_tag LOCUS_17150 1195 881 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973260.1 protein_id gnl|my_center|LOCUS_17150 1941 1195 gene locus_tag LOCUS_17160 1941 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 2484 2912 gene locus_tag LOCUS_17170 2484 2912 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283762.1 protein_id gnl|my_center|LOCUS_17170 3066 3725 gene locus_tag LOCUS_17180 3066 3725 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229221.1 protein_id gnl|my_center|LOCUS_17180 5053 3740 gene locus_tag LOCUS_17190 5053 3740 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929866.1 protein_id gnl|my_center|LOCUS_17190 5573 5166 gene locus_tag LOCUS_17200 5573 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 5819 6697 gene locus_tag LOCUS_17210 5819 6697 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029809.1 protein_id gnl|my_center|LOCUS_17210 6694 6891 gene locus_tag LOCUS_17220 6694 6891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 7085 7333 gene locus_tag LOCUS_17230 7085 7333 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030672.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence122 347 2836 gene locus_tag LOCUS_17240 347 2836 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030487.1 protein_id gnl|my_center|LOCUS_17240 2971 3501 gene locus_tag LOCUS_17250 2971 3501 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214742.1 protein_id gnl|my_center|LOCUS_17250 3618 3944 gene locus_tag LOCUS_17260 3618 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 4132 3899 gene locus_tag LOCUS_17270 4132 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 4131 5189 gene locus_tag LOCUS_17280 4131 5189 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222439.1 protein_id gnl|my_center|LOCUS_17280 7326 5221 gene locus_tag LOCUS_17290 7326 5221 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973199.1 protein_id gnl|my_center|LOCUS_17290 7769 7993 gene locus_tag LOCUS_17300 7769 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 8172 8912 gene locus_tag LOCUS_17310 gene yaaA 8172 8912 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 protein_id gnl|my_center|LOCUS_17310 9102 8923 gene locus_tag LOCUS_17320 9102 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 >Feature sequence123 <1 1170 gene locus_tag LOCUS_17330 <1 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223261.1:CHAT domain-containing protein 1826 1173 gene locus_tag LOCUS_17340 1826 1173 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_17340 2747 1929 gene locus_tag LOCUS_17350 2747 1929 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228441.1 protein_id gnl|my_center|LOCUS_17350 3455 2877 gene locus_tag LOCUS_17360 3455 2877 CDS product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_17360 6262 3542 gene locus_tag LOCUS_17370 6262 3542 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_17370 6548 7453 gene locus_tag LOCUS_17380 6548 7453 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466843.1 protein_id gnl|my_center|LOCUS_17380 9670 7484 gene locus_tag LOCUS_17390 9670 7484 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228470.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence124 2698 356 gene locus_tag LOCUS_17400 2698 356 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223220.1 protein_id gnl|my_center|LOCUS_17400 2991 3725 gene locus_tag LOCUS_17410 2991 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17410 5180 4011 gene locus_tag LOCUS_17420 5180 4011 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030274.1 protein_id gnl|my_center|LOCUS_17420 5253 6572 gene locus_tag LOCUS_17430 gene aroA 5253 6572 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 protein_id gnl|my_center|LOCUS_17430 6569 7567 gene locus_tag LOCUS_17440 gene rsgA 6569 7567 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973761.1 protein_id gnl|my_center|LOCUS_17440 7862 7572 gene locus_tag LOCUS_17450 7862 7572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 8484 7876 gene locus_tag LOCUS_17460 8484 7876 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030115.1 protein_id gnl|my_center|LOCUS_17460 8636 9442 gene locus_tag LOCUS_17470 gene hisN 8636 9442 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973764.1 protein_id gnl|my_center|LOCUS_17470 9594 9518 gene locus_tag LOCUS_t00240 9594 9518 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence125 415 149 gene locus_tag LOCUS_17480 415 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 693 412 gene locus_tag LOCUS_17490 693 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1938 817 gene locus_tag LOCUS_17500 1938 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 2069 1935 gene locus_tag LOCUS_17510 2069 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 2253 2062 gene locus_tag LOCUS_17520 2253 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 2453 2241 gene locus_tag LOCUS_17530 2453 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2796 3566 gene locus_tag LOCUS_17540 2796 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 5072 3621 gene locus_tag LOCUS_17550 5072 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 6875 6333 gene locus_tag LOCUS_17560 6875 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 9005 6957 gene locus_tag LOCUS_17570 9005 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 9435 9064 gene locus_tag LOCUS_17580 9435 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 9691 9428 gene locus_tag LOCUS_17590 9691 9428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence126 398 964 gene locus_tag LOCUS_17600 398 964 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223459.1 protein_id gnl|my_center|LOCUS_17600 1217 2098 gene locus_tag LOCUS_17610 1217 2098 CDS product MHYT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484657.1 protein_id gnl|my_center|LOCUS_17610 3055 2108 gene locus_tag LOCUS_17620 3055 2108 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_17620 4921 3104 gene locus_tag LOCUS_17630 gene metG 4921 3104 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467759.1 protein_id gnl|my_center|LOCUS_17630 5175 5570 gene locus_tag LOCUS_17640 5175 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 5650 8328 gene locus_tag LOCUS_17650 5650 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 9303 8416 gene locus_tag LOCUS_17660 gene rsmI 9303 8416 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence127 22 636 gene locus_tag LOCUS_17670 22 636 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030471.1 protein_id gnl|my_center|LOCUS_17670 805 3264 gene locus_tag LOCUS_17680 805 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 3400 4056 gene locus_tag LOCUS_17690 3400 4056 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974737.1 protein_id gnl|my_center|LOCUS_17690 4131 4913 gene locus_tag LOCUS_17700 4131 4913 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972225.1 protein_id gnl|my_center|LOCUS_17700 6556 4937 gene locus_tag LOCUS_17710 6556 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 6957 6679 gene locus_tag LOCUS_17720 6957 6679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 7638 7811 gene locus_tag LOCUS_17730 7638 7811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 7903 8241 gene locus_tag LOCUS_17740 7903 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 >Feature sequence128 2987 399 gene locus_tag LOCUS_17750 2987 399 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_17750 3889 3005 gene locus_tag LOCUS_17760 3889 3005 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256268.1 protein_id gnl|my_center|LOCUS_17760 4778 3894 gene locus_tag LOCUS_17770 4778 3894 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256269.1 protein_id gnl|my_center|LOCUS_17770 6136 4850 gene locus_tag LOCUS_17780 6136 4850 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256270.1 protein_id gnl|my_center|LOCUS_17780 6363 7361 gene locus_tag LOCUS_17790 6363 7361 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978054.1 protein_id gnl|my_center|LOCUS_17790 8194 7385 gene locus_tag LOCUS_17800 8194 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 8382 8224 gene locus_tag LOCUS_17810 8382 8224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 8921 9610 gene locus_tag LOCUS_17820 8921 9610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence129 300 225 gene locus_tag LOCUS_t00250 300 225 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1386 922 gene locus_tag LOCUS_17830 1386 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 1665 4586 gene locus_tag LOCUS_17840 1665 4586 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742126.1 protein_id gnl|my_center|LOCUS_17840 4762 5238 gene locus_tag LOCUS_17850 4762 5238 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971919.1 protein_id gnl|my_center|LOCUS_17850 5277 6377 gene locus_tag LOCUS_17860 5277 6377 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866892.1 protein_id gnl|my_center|LOCUS_17860 7358 6393 gene locus_tag LOCUS_17870 7358 6393 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257832.1 protein_id gnl|my_center|LOCUS_17870 9301 7364 gene locus_tag LOCUS_17880 9301 7364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence130 34 498 gene locus_tag LOCUS_17890 gene rplO 34 498 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974249.1 protein_id gnl|my_center|LOCUS_17890 781 2094 gene locus_tag LOCUS_17900 gene secY 781 2094 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_17900 2095 2751 gene locus_tag LOCUS_17910 2095 2751 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029826.1 protein_id gnl|my_center|LOCUS_17910 2751 3575 gene locus_tag LOCUS_17920 gene map 2751 3575 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222621.1 protein_id gnl|my_center|LOCUS_17920 3646 4089 gene locus_tag LOCUS_17930 3646 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 4379 4600 gene locus_tag LOCUS_17940 gene infA 4379 4600 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948620.1 protein_id gnl|my_center|LOCUS_17940 4982 5362 gene locus_tag LOCUS_17950 gene rpsM 4982 5362 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974244.1 protein_id gnl|my_center|LOCUS_17950 5432 5839 gene locus_tag LOCUS_17960 gene rpsK 5432 5839 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_17960 6023 7042 gene locus_tag LOCUS_17970 6023 7042 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_17970 7108 7665 gene locus_tag LOCUS_17980 gene rplQ 7108 7665 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974243.1 protein_id gnl|my_center|LOCUS_17980 7795 8631 gene locus_tag LOCUS_17990 gene truA 7795 8631 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974242.1 protein_id gnl|my_center|LOCUS_17990 9508 8669 gene locus_tag LOCUS_18000 9508 8669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence131 <1 958 gene locus_tag LOCUS_18010 <1 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728676.1:PfkB family carbohydrate kinase 1209 2711 gene locus_tag LOCUS_18020 gene dop 1209 2711 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_18020 4041 2893 gene locus_tag LOCUS_18030 4041 2893 CDS product alpha-lytic protease prodomain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029803.1 protein_id gnl|my_center|LOCUS_18030 4659 4862 gene locus_tag LOCUS_18040 4659 4862 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027899.1 protein_id gnl|my_center|LOCUS_18040 5036 5881 gene locus_tag LOCUS_18050 gene prcB 5036 5881 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_18050 5937 6689 gene locus_tag LOCUS_18060 gene prcA 5937 6689 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_18060 6798 8156 gene locus_tag LOCUS_18070 gene pafA 6798 8156 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_18070 8301 9422 gene locus_tag LOCUS_18080 8301 9422 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114189.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence132 385 981 gene locus_tag LOCUS_18090 385 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 1194 2261 gene locus_tag LOCUS_18100 1194 2261 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229612.1 protein_id gnl|my_center|LOCUS_18100 4260 3460 gene locus_tag LOCUS_18110 4260 3460 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224710.1 protein_id gnl|my_center|LOCUS_18110 4431 4886 gene locus_tag LOCUS_18120 4431 4886 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226161.1 protein_id gnl|my_center|LOCUS_18120 5443 6252 gene locus_tag LOCUS_18130 5443 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 7292 6477 gene locus_tag LOCUS_18140 7292 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 7913 7338 gene locus_tag LOCUS_18150 7913 7338 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387723.1 protein_id gnl|my_center|LOCUS_18150 9208 8132 gene locus_tag LOCUS_18160 9208 8132 CDS product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775736.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence133 687 1919 gene locus_tag LOCUS_18170 687 1919 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726670.1 protein_id gnl|my_center|LOCUS_18170 2181 1951 gene locus_tag LOCUS_18180 2181 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 2702 2508 gene locus_tag LOCUS_18190 2702 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 2757 3707 gene locus_tag LOCUS_18200 2757 3707 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086031.1 protein_id gnl|my_center|LOCUS_18200 3704 4339 gene locus_tag LOCUS_18210 3704 4339 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086030.1 protein_id gnl|my_center|LOCUS_18210 4529 5296 gene locus_tag LOCUS_18220 4529 5296 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028380.1 protein_id gnl|my_center|LOCUS_18220 6359 5352 gene locus_tag LOCUS_18230 6359 5352 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242746.1 protein_id gnl|my_center|LOCUS_18230 6523 7557 gene locus_tag LOCUS_18240 6523 7557 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027977.1 protein_id gnl|my_center|LOCUS_18240 7554 8642 gene locus_tag LOCUS_18250 7554 8642 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868181.1 protein_id gnl|my_center|LOCUS_18250 8664 9482 gene locus_tag LOCUS_18260 8664 9482 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027975.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence134 761 2449 gene locus_tag LOCUS_18270 761 2449 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224529.1 protein_id gnl|my_center|LOCUS_18270 2540 2466 gene locus_tag LOCUS_t00260 2540 2466 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4031 2652 gene locus_tag LOCUS_18280 4031 2652 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486678.1 protein_id gnl|my_center|LOCUS_18280 5250 4270 gene locus_tag LOCUS_18290 5250 4270 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_18290 5726 5247 gene locus_tag LOCUS_18300 5726 5247 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 protein_id gnl|my_center|LOCUS_18300 6413 5898 gene locus_tag LOCUS_18310 6413 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 7706 6423 gene locus_tag LOCUS_18320 gene eno 7706 6423 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229929.1 protein_id gnl|my_center|LOCUS_18320 8467 7892 gene locus_tag LOCUS_18330 8467 7892 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226546.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence135 509 1060 gene locus_tag LOCUS_18340 509 1060 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975113.1 protein_id gnl|my_center|LOCUS_18340 2395 1121 gene locus_tag LOCUS_18350 gene serS 2395 1121 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831496.1 protein_id gnl|my_center|LOCUS_18350 3481 2534 gene locus_tag LOCUS_18360 gene pheA 3481 2534 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_18360 3980 3492 gene locus_tag LOCUS_18370 3980 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 4907 4107 gene locus_tag LOCUS_18380 4907 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 5219 4920 gene locus_tag LOCUS_18390 gene bldG 5219 4920 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_18390 5923 5360 gene locus_tag LOCUS_18400 5923 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 7995 6109 gene locus_tag LOCUS_18410 7995 6109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 8419 8087 gene locus_tag LOCUS_18420 8419 8087 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222088.1 protein_id gnl|my_center|LOCUS_18420 8479 9078 gene locus_tag LOCUS_18430 8479 9078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 >Feature sequence136 7593 2824 gene locus_tag LOCUS_18440 7593 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 <9538 7580 gene locus_tag LOCUS_18450 <9538 7580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_067456433.1:type I polyketide synthase >Feature sequence137 311 1411 gene locus_tag LOCUS_18460 311 1411 CDS product IS4-like element ISSod7 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071337.1 protein_id gnl|my_center|LOCUS_18460 2419 1769 gene locus_tag LOCUS_18470 2419 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 5021 2427 gene locus_tag LOCUS_18480 5021 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 5383 5018 gene locus_tag LOCUS_18490 5383 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 5745 5380 gene locus_tag LOCUS_18500 5745 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 7428 6013 gene locus_tag LOCUS_18510 7428 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 8235 7684 gene locus_tag LOCUS_18520 8235 7684 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973175.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence138 789 241 gene locus_tag LOCUS_18530 789 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 948 1469 gene locus_tag LOCUS_18540 948 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 1493 2563 gene locus_tag LOCUS_18550 1493 2563 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015101.1 protein_id gnl|my_center|LOCUS_18550 2560 2955 gene locus_tag LOCUS_18560 2560 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 3768 3025 gene locus_tag LOCUS_18570 3768 3025 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 protein_id gnl|my_center|LOCUS_18570 4805 3969 gene locus_tag LOCUS_18580 4805 3969 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896545.1 protein_id gnl|my_center|LOCUS_18580 5697 4807 gene locus_tag LOCUS_18590 5697 4807 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972115.1 protein_id gnl|my_center|LOCUS_18590 6989 5694 gene locus_tag LOCUS_18600 6989 5694 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730345.1 protein_id gnl|my_center|LOCUS_18600 8140 7550 gene locus_tag LOCUS_18610 8140 7550 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896924.1 protein_id gnl|my_center|LOCUS_18610 8373 9134 gene locus_tag LOCUS_18620 8373 9134 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459737.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence139 19 2622 gene locus_tag LOCUS_18630 19 2622 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027530.1 protein_id gnl|my_center|LOCUS_18630 4370 2877 gene locus_tag LOCUS_18640 4370 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 5204 4953 gene locus_tag LOCUS_18650 5204 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 5260 5862 gene locus_tag LOCUS_18660 5260 5862 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974892.1 protein_id gnl|my_center|LOCUS_18660 6115 6882 gene locus_tag LOCUS_18670 6115 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 6950 8689 gene locus_tag LOCUS_18680 gene cas10 6950 8689 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229144.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence140 2090 933 gene locus_tag LOCUS_18690 2090 933 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_18690 3060 2083 gene locus_tag LOCUS_18700 3060 2083 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976665.1 protein_id gnl|my_center|LOCUS_18700 3632 3078 gene locus_tag LOCUS_18710 3632 3078 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_18710 4225 4623 gene locus_tag LOCUS_18720 4225 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976663.1 protein_id gnl|my_center|LOCUS_18720 4851 5936 gene locus_tag LOCUS_18730 gene trpD 4851 5936 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_18730 6279 6004 gene locus_tag LOCUS_18740 6279 6004 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 protein_id gnl|my_center|LOCUS_18740 7096 6332 gene locus_tag LOCUS_18750 7096 6332 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270259.1 protein_id gnl|my_center|LOCUS_18750 8780 7074 gene locus_tag LOCUS_18760 8780 7074 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_18760 8930 9211 gene locus_tag LOCUS_18770 8930 9211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976677.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence141 <1 599 gene locus_tag LOCUS_18780 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064836.1:SWIM zinc finger family protein 800 1633 gene locus_tag LOCUS_18790 800 1633 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978157.1 protein_id gnl|my_center|LOCUS_18790 2783 1653 gene locus_tag LOCUS_18800 gene pcaD 2783 1653 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284957.1 protein_id gnl|my_center|LOCUS_18800 4161 2773 gene locus_tag LOCUS_18810 4161 2773 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993967.1 protein_id gnl|my_center|LOCUS_18810 4757 4197 gene locus_tag LOCUS_18820 gene pcaG 4757 4197 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223754.1 protein_id gnl|my_center|LOCUS_18820 5518 4754 gene locus_tag LOCUS_18830 gene pcaH 5518 4754 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223753.1 protein_id gnl|my_center|LOCUS_18830 6751 5576 gene locus_tag LOCUS_18840 6751 5576 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223752.1 protein_id gnl|my_center|LOCUS_18840 7572 6820 gene locus_tag LOCUS_18850 7572 6820 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_18850 8399 7569 gene locus_tag LOCUS_18860 8399 7569 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223750.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence142 488 27 gene locus_tag LOCUS_18870 488 27 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_18870 661 488 gene locus_tag LOCUS_18880 661 488 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855791.1 protein_id gnl|my_center|LOCUS_18880 816 1862 gene locus_tag LOCUS_18890 816 1862 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029095.1 protein_id gnl|my_center|LOCUS_18890 1859 3037 gene locus_tag LOCUS_18900 1859 3037 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_18900 3523 5814 gene locus_tag LOCUS_18910 3523 5814 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_18910 6363 5908 gene locus_tag LOCUS_18920 6363 5908 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_18920 6448 7365 gene locus_tag LOCUS_18930 6448 7365 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908824.1 protein_id gnl|my_center|LOCUS_18930 7461 7535 gene locus_tag LOCUS_t00270 7461 7535 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8465 7905 gene locus_tag LOCUS_18940 8465 7905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 <9202 8462 gene locus_tag LOCUS_18950 <9202 8462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705504.1:adenosylhomocysteinase >Feature sequence143 774 34 gene locus_tag LOCUS_18960 774 34 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029733.1 protein_id gnl|my_center|LOCUS_18960 1321 776 gene locus_tag LOCUS_18970 1321 776 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061196.1 protein_id gnl|my_center|LOCUS_18970 1733 1374 gene locus_tag LOCUS_18980 1733 1374 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_18980 3241 1871 gene locus_tag LOCUS_18990 3241 1871 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_18990 4315 3605 gene locus_tag LOCUS_19000 4315 3605 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_19000 4508 5149 gene locus_tag LOCUS_19010 4508 5149 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230395.1 protein_id gnl|my_center|LOCUS_19010 5146 6417 gene locus_tag LOCUS_19020 gene mrx(A) 5146 6417 CDS product macrolide resistance MFS transporter Mrx(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004159.1 protein_id gnl|my_center|LOCUS_19020 6794 6450 gene locus_tag LOCUS_19030 6794 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 7452 7646 gene locus_tag LOCUS_19040 7452 7646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 7727 8083 gene locus_tag LOCUS_19050 7727 8083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 <9158 8200 gene locus_tag LOCUS_19060 <9158 8200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226279.1:pectate lyase >Feature sequence144 308 153 gene locus_tag LOCUS_19070 308 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 559 386 gene locus_tag LOCUS_19080 559 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 1604 2248 gene locus_tag LOCUS_19090 1604 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 2744 3076 gene locus_tag LOCUS_19100 2744 3076 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229578.1 protein_id gnl|my_center|LOCUS_19100 4384 3092 gene locus_tag LOCUS_19110 4384 3092 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029195.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19110 4870 4667 gene locus_tag LOCUS_19120 4870 4667 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974279.1 protein_id gnl|my_center|LOCUS_19120 5564 5412 gene locus_tag LOCUS_19130 5564 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 6641 5736 gene locus_tag LOCUS_19140 6641 5736 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226948.1 protein_id gnl|my_center|LOCUS_19140 7525 6638 gene locus_tag LOCUS_19150 7525 6638 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226949.1 protein_id gnl|my_center|LOCUS_19150 7594 8568 gene locus_tag LOCUS_19160 gene bla 7594 8568 CDS product class A beta-lactamase Bla1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013141957.1 protein_id gnl|my_center|LOCUS_19160 9024 8704 gene locus_tag LOCUS_19170 9024 8704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 >Feature sequence145 12 935 gene locus_tag LOCUS_19180 12 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 984 1652 gene locus_tag LOCUS_19190 984 1652 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_19190 1649 2662 gene locus_tag LOCUS_19200 gene xerD 1649 2662 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286377.1 protein_id gnl|my_center|LOCUS_19200 2935 3894 gene locus_tag LOCUS_19210 2935 3894 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227804.1 protein_id gnl|my_center|LOCUS_19210 3867 4289 gene locus_tag LOCUS_19220 3867 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227803.1 protein_id gnl|my_center|LOCUS_19220 4406 5266 gene locus_tag LOCUS_19230 4406 5266 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227802.1 protein_id gnl|my_center|LOCUS_19230 5263 5853 gene locus_tag LOCUS_19240 gene scpB 5263 5853 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_19240 5856 6515 gene locus_tag LOCUS_19250 5856 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 6512 7168 gene locus_tag LOCUS_19260 6512 7168 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895185.1 protein_id gnl|my_center|LOCUS_19260 7267 7629 gene locus_tag LOCUS_19270 gene aroH 7267 7629 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_19270 7690 8826 gene locus_tag LOCUS_19280 7690 8826 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027959.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence146 1351 89 gene locus_tag LOCUS_19290 1351 89 CDS product alanine-phosphoribitol ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227089.1 protein_id gnl|my_center|LOCUS_19290 2902 1619 gene locus_tag LOCUS_19300 2902 1619 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972911.1 protein_id gnl|my_center|LOCUS_19300 3696 2899 gene locus_tag LOCUS_19310 3696 2899 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972912.1 protein_id gnl|my_center|LOCUS_19310 4941 3796 gene locus_tag LOCUS_19320 4941 3796 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972913.1 protein_id gnl|my_center|LOCUS_19320 6308 5133 gene locus_tag LOCUS_19330 6308 5133 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972914.1 protein_id gnl|my_center|LOCUS_19330 6521 7108 gene locus_tag LOCUS_19340 6521 7108 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898102.1 protein_id gnl|my_center|LOCUS_19340 9113 7128 gene locus_tag LOCUS_19350 9113 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 >Feature sequence147 2488 1379 gene locus_tag LOCUS_19360 2488 1379 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225132.1 protein_id gnl|my_center|LOCUS_19360 3916 2828 gene locus_tag LOCUS_19370 3916 2828 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668699.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19370 8018 3996 gene locus_tag LOCUS_19380 gene hrpA 8018 3996 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 protein_id gnl|my_center|LOCUS_19380 9063 8296 gene locus_tag LOCUS_19390 9063 8296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 >Feature sequence148 1182 535 gene locus_tag LOCUS_19400 1182 535 CDS product DUF6230 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030235.1 protein_id gnl|my_center|LOCUS_19400 1397 3274 gene locus_tag LOCUS_19410 1397 3274 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029860.1 protein_id gnl|my_center|LOCUS_19410 4100 3318 gene locus_tag LOCUS_19420 4100 3318 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143427.1 protein_id gnl|my_center|LOCUS_19420 4361 5230 gene locus_tag LOCUS_19430 4361 5230 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027048.1 protein_id gnl|my_center|LOCUS_19430 5227 6138 gene locus_tag LOCUS_19440 5227 6138 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466629.1 protein_id gnl|my_center|LOCUS_19440 6303 7877 gene locus_tag LOCUS_19450 6303 7877 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028809.1 protein_id gnl|my_center|LOCUS_19450 7861 8205 gene locus_tag LOCUS_19460 7861 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence149 2 676 gene locus_tag LOCUS_19470 2 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 1791 691 gene locus_tag LOCUS_19480 1791 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2084 2956 gene locus_tag LOCUS_19490 2084 2956 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868402.1 protein_id gnl|my_center|LOCUS_19490 3116 4438 gene locus_tag LOCUS_19500 3116 4438 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249937.1 protein_id gnl|my_center|LOCUS_19500 5268 4462 gene locus_tag LOCUS_19510 5268 4462 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228665.1 protein_id gnl|my_center|LOCUS_19510 6187 5684 gene locus_tag LOCUS_19520 6187 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 6933 6256 gene locus_tag LOCUS_19530 6933 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 7927 7229 gene locus_tag LOCUS_19540 7927 7229 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230121.1 protein_id gnl|my_center|LOCUS_19540 <9084 8059 gene locus_tag LOCUS_19550 <9084 8059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003856791.1:aminodeoxychorismate synthase component I >Feature sequence150 346 1527 gene locus_tag LOCUS_19560 gene aroC 346 1527 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_19560 1638 2168 gene locus_tag LOCUS_19570 1638 2168 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742170.1 protein_id gnl|my_center|LOCUS_19570 2165 3256 gene locus_tag LOCUS_19580 gene aroB 2165 3256 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027813.1 protein_id gnl|my_center|LOCUS_19580 3393 3953 gene locus_tag LOCUS_19590 gene efp 3393 3953 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224610.1 protein_id gnl|my_center|LOCUS_19590 3953 4369 gene locus_tag LOCUS_19600 gene nusB 3953 4369 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224611.1 protein_id gnl|my_center|LOCUS_19600 4426 5199 gene locus_tag LOCUS_19610 4426 5199 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028138.1 protein_id gnl|my_center|LOCUS_19610 5235 6521 gene locus_tag LOCUS_19620 gene dinB 5235 6521 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_19620 6766 7179 gene locus_tag LOCUS_19630 6766 7179 CDS product spore wall synthesis complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028137.1 protein_id gnl|my_center|LOCUS_19630 <9032 7286 gene locus_tag LOCUS_19640 <9032 7286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193486200.1:DUF3488 and transglutaminase-like domain-containing protein >Feature sequence151 1762 2469 gene locus_tag LOCUS_19650 1762 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 2469 4265 gene locus_tag LOCUS_19660 2469 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 4262 5851 gene locus_tag LOCUS_19670 4262 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 5848 6585 gene locus_tag LOCUS_19680 5848 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 6585 8780 gene locus_tag LOCUS_19690 6585 8780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 >Feature sequence152 1721 366 gene locus_tag LOCUS_19700 1721 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 3340 1928 gene locus_tag LOCUS_19710 3340 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 4058 3549 gene locus_tag LOCUS_19720 4058 3549 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976618.1 protein_id gnl|my_center|LOCUS_19720 4383 4781 gene locus_tag LOCUS_19730 4383 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 4846 5694 gene locus_tag LOCUS_19740 4846 5694 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728413.1 protein_id gnl|my_center|LOCUS_19740 7624 5780 gene locus_tag LOCUS_19750 7624 5780 CDS product carbohydrate-binding module family 20 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259365.1 protein_id gnl|my_center|LOCUS_19750 8193 7855 gene locus_tag LOCUS_19760 8193 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 8926 8327 gene locus_tag LOCUS_19770 8926 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 >Feature sequence153 3072 661 gene locus_tag LOCUS_19780 3072 661 CDS product YfjP family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484979.1 protein_id gnl|my_center|LOCUS_19780 4961 3069 gene locus_tag LOCUS_19790 4961 3069 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073255020.1 protein_id gnl|my_center|LOCUS_19790 6313 5033 gene locus_tag LOCUS_19800 gene cobA 6313 5033 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977272.1 protein_id gnl|my_center|LOCUS_19800 8651 6513 gene locus_tag LOCUS_19810 8651 6513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence154 332 1729 gene locus_tag LOCUS_19820 332 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 2144 1800 gene locus_tag LOCUS_19830 2144 1800 CDS product DUF3140 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972181.1 protein_id gnl|my_center|LOCUS_19830 3166 2144 gene locus_tag LOCUS_19840 3166 2144 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742152.1 protein_id gnl|my_center|LOCUS_19840 2482 2577 gene locus_tag LOCUS_t00280 2482 2577 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3367 3894 gene locus_tag LOCUS_19850 3367 3894 CDS product DUF1360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226138.1 protein_id gnl|my_center|LOCUS_19850 4428 3919 gene locus_tag LOCUS_19860 4428 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 4621 5040 gene locus_tag LOCUS_19870 4621 5040 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027424.1 protein_id gnl|my_center|LOCUS_19870 5563 5102 gene locus_tag LOCUS_19880 5563 5102 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973660.1 protein_id gnl|my_center|LOCUS_19880 6101 5736 gene locus_tag LOCUS_19890 gene crcB 6101 5736 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079419.1 protein_id gnl|my_center|LOCUS_19890 6517 6098 gene locus_tag LOCUS_19900 gene crcB 6517 6098 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392062.1 protein_id gnl|my_center|LOCUS_19900 7248 6514 gene locus_tag LOCUS_19910 7248 6514 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015424.1 protein_id gnl|my_center|LOCUS_19910 7912 7241 gene locus_tag LOCUS_19920 7912 7241 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196240169.1 protein_id gnl|my_center|LOCUS_19920 8532 7909 gene locus_tag LOCUS_19930 8532 7909 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729729.1 protein_id gnl|my_center|LOCUS_19930 >Feature sequence155 2749 791 gene locus_tag LOCUS_19940 2749 791 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230344.1 protein_id gnl|my_center|LOCUS_19940 3229 3957 gene locus_tag LOCUS_19950 3229 3957 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728288.1 protein_id gnl|my_center|LOCUS_19950 6059 4110 gene locus_tag LOCUS_19960 6059 4110 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976053.1 protein_id gnl|my_center|LOCUS_19960 7588 6059 gene locus_tag LOCUS_19970 7588 6059 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028557.1 protein_id gnl|my_center|LOCUS_19970 8610 7585 gene locus_tag LOCUS_19980 8610 7585 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976055.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence156 <1 1794 gene locus_tag LOCUS_19990 <1 1794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031383.1:carbohydrate binding domain-containing protein 2523 1906 gene locus_tag LOCUS_20000 2523 1906 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 protein_id gnl|my_center|LOCUS_20000 2996 3508 gene locus_tag LOCUS_20010 2996 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 3570 5033 gene locus_tag LOCUS_20020 gene purF 3570 5033 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872463.1 protein_id gnl|my_center|LOCUS_20020 5130 6191 gene locus_tag LOCUS_20030 gene purM 5130 6191 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230742.1 protein_id gnl|my_center|LOCUS_20030 6565 6338 gene locus_tag LOCUS_20040 6565 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 6816 7649 gene locus_tag LOCUS_20050 6816 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974882.1 protein_id gnl|my_center|LOCUS_20050 8341 8544 gene locus_tag LOCUS_20060 gene bldC 8341 8544 CDS product developmental transcriptional regulator BldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949541.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence157 1144 440 gene locus_tag LOCUS_20070 1144 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 2073 1141 gene locus_tag LOCUS_20080 2073 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 3311 2061 gene locus_tag LOCUS_20090 3311 2061 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090712.1 protein_id gnl|my_center|LOCUS_20090 4431 3379 gene locus_tag LOCUS_20100 4431 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 5005 4760 gene locus_tag LOCUS_20110 5005 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 5153 6181 gene locus_tag LOCUS_20120 5153 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 6178 7026 gene locus_tag LOCUS_20130 6178 7026 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173962.1 protein_id gnl|my_center|LOCUS_20130 7680 7605 gene locus_tag LOCUS_t00290 7680 7605 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 8399 7749 gene locus_tag LOCUS_20140 gene orn 8399 7749 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 protein_id gnl|my_center|LOCUS_20140 8847 8497 gene locus_tag LOCUS_20150 8847 8497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence158 1281 247 gene locus_tag LOCUS_20160 gene tsaD 1281 247 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_20160 1763 1278 gene locus_tag LOCUS_20170 gene rimI 1763 1278 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 protein_id gnl|my_center|LOCUS_20170 2428 1751 gene locus_tag LOCUS_20180 gene tsaB 2428 1751 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_20180 2922 2443 gene locus_tag LOCUS_20190 gene tsaE 2922 2443 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029837.1 protein_id gnl|my_center|LOCUS_20190 4211 3084 gene locus_tag LOCUS_20200 gene alr 4211 3084 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_20200 4306 4962 gene locus_tag LOCUS_20210 4306 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 5209 5526 gene locus_tag LOCUS_20220 5209 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 5561 5941 gene locus_tag LOCUS_20230 5561 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 >Feature sequence159 39 1064 gene locus_tag LOCUS_20240 39 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 1257 1532 gene locus_tag LOCUS_20250 1257 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 2843 1617 gene locus_tag LOCUS_20260 gene hutI 2843 1617 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028748.1 protein_id gnl|my_center|LOCUS_20260 4183 2840 gene locus_tag LOCUS_20270 4183 2840 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028749.1 protein_id gnl|my_center|LOCUS_20270 5424 4180 gene locus_tag LOCUS_20280 5424 4180 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892540.1 protein_id gnl|my_center|LOCUS_20280 6998 5421 gene locus_tag LOCUS_20290 6998 5421 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028751.1 protein_id gnl|my_center|LOCUS_20290 8645 7098 gene locus_tag LOCUS_20300 gene hutH 8645 7098 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727479.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence160 418 1845 gene locus_tag LOCUS_20310 gene ftsW 418 1845 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976730.1 protein_id gnl|my_center|LOCUS_20310 1842 3002 gene locus_tag LOCUS_20320 gene murG 1842 3002 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 protein_id gnl|my_center|LOCUS_20320 2999 4465 gene locus_tag LOCUS_20330 gene murC 2999 4465 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 protein_id gnl|my_center|LOCUS_20330 4493 5209 gene locus_tag LOCUS_20340 4493 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 5599 7167 gene locus_tag LOCUS_20350 5599 7167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 7293 8012 gene locus_tag LOCUS_20360 gene pgeF 7293 8012 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173521163.1 protein_id gnl|my_center|LOCUS_20360 8062 8790 gene locus_tag LOCUS_20370 8062 8790 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028129.1 protein_id gnl|my_center|LOCUS_20370 >Feature sequence161 2811 343 gene locus_tag LOCUS_20380 gene relA 2811 343 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_20380 3668 3114 gene locus_tag LOCUS_20390 3668 3114 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142741.1 protein_id gnl|my_center|LOCUS_20390 4430 4065 gene locus_tag LOCUS_20400 4430 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 5802 4732 gene locus_tag LOCUS_20410 gene ruvB 5802 4732 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_20410 6451 5831 gene locus_tag LOCUS_20420 gene ruvA 6451 5831 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_20420 7049 6501 gene locus_tag LOCUS_20430 gene ruvC 7049 6501 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977307.1 protein_id gnl|my_center|LOCUS_20430 7925 7176 gene locus_tag LOCUS_20440 7925 7176 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894318.1 protein_id gnl|my_center|LOCUS_20440 <8773 8133 gene locus_tag LOCUS_20450 <8773 8133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977304.1:pyridoxal 5'-phosphate synthase lyase subunit PdxS >Feature sequence162 483 1847 gene locus_tag LOCUS_20460 gene mgtE 483 1847 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071378.1 protein_id gnl|my_center|LOCUS_20460 2013 2240 gene locus_tag LOCUS_20470 2013 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 2537 3400 gene locus_tag LOCUS_20480 2537 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029723.1 protein_id gnl|my_center|LOCUS_20480 5705 3492 gene locus_tag LOCUS_20490 5705 3492 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029156.1 protein_id gnl|my_center|LOCUS_20490 6381 6013 gene locus_tag LOCUS_20500 6381 6013 CDS product TIGR03668 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226497.1 protein_id gnl|my_center|LOCUS_20500 <8737 7292 gene locus_tag LOCUS_20510 <8737 7292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003911742.1:alpha/beta hydrolase >Feature sequence163 577 326 gene locus_tag LOCUS_20520 577 326 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230904.1 protein_id gnl|my_center|LOCUS_20520 1846 704 gene locus_tag LOCUS_20530 1846 704 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191120.1 protein_id gnl|my_center|LOCUS_20530 2034 2879 gene locus_tag LOCUS_20540 2034 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729967.1 protein_id gnl|my_center|LOCUS_20540 5924 2934 gene locus_tag LOCUS_20550 5924 2934 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226436.1 protein_id gnl|my_center|LOCUS_20550 6216 6530 gene locus_tag LOCUS_20560 6216 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 6677 7042 gene locus_tag LOCUS_20570 6677 7042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 7436 8458 gene locus_tag LOCUS_20580 7436 8458 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261615.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence164 360 166 gene locus_tag LOCUS_20590 360 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 1649 504 gene locus_tag LOCUS_20600 1649 504 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029664.1 protein_id gnl|my_center|LOCUS_20600 2063 1656 gene locus_tag LOCUS_20610 2063 1656 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974528.1 protein_id gnl|my_center|LOCUS_20610 3201 2215 gene locus_tag LOCUS_20620 3201 2215 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228161.1 protein_id gnl|my_center|LOCUS_20620 3278 4168 gene locus_tag LOCUS_20630 3278 4168 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972425.1 protein_id gnl|my_center|LOCUS_20630 4847 4197 gene locus_tag LOCUS_20640 4847 4197 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026996.1 protein_id gnl|my_center|LOCUS_20640 5054 5518 gene locus_tag LOCUS_20650 5054 5518 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092308.1 protein_id gnl|my_center|LOCUS_20650 6488 5712 gene locus_tag LOCUS_20660 6488 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 6590 6853 gene locus_tag LOCUS_20670 6590 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 7335 6829 gene locus_tag LOCUS_20680 7335 6829 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027260.1 protein_id gnl|my_center|LOCUS_20680 7578 8495 gene locus_tag LOCUS_20690 7578 8495 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328866.1 protein_id gnl|my_center|LOCUS_20690 >Feature sequence165 1964 1143 gene locus_tag LOCUS_20700 1964 1143 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_20700 2509 1964 gene locus_tag LOCUS_20710 2509 1964 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030209.1 protein_id gnl|my_center|LOCUS_20710 2786 2562 gene locus_tag LOCUS_20720 gene atpE 2786 2562 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973629.1 protein_id gnl|my_center|LOCUS_20720 3752 2904 gene locus_tag LOCUS_20730 gene atpB 3752 2904 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030208.1 protein_id gnl|my_center|LOCUS_20730 4082 3852 gene locus_tag LOCUS_20740 4082 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 4610 4188 gene locus_tag LOCUS_20750 4610 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 6001 4865 gene locus_tag LOCUS_20760 6001 4865 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030207.1 protein_id gnl|my_center|LOCUS_20760 6825 6019 gene locus_tag LOCUS_20770 6825 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 7769 6909 gene locus_tag LOCUS_20780 gene prmC 7769 6909 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973636.1 protein_id gnl|my_center|LOCUS_20780 <8534 7766 gene locus_tag LOCUS_20790 <8534 7766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973637.1:peptide chain release factor 1 >Feature sequence166 186 2237 gene locus_tag LOCUS_20800 186 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 2256 3971 gene locus_tag LOCUS_20810 2256 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 3981 4292 gene locus_tag LOCUS_20820 3981 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 4379 6451 gene locus_tag LOCUS_20830 4379 6451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence167 399 1430 gene locus_tag LOCUS_20840 399 1430 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528694.1 protein_id gnl|my_center|LOCUS_20840 2310 1810 gene locus_tag LOCUS_20850 2310 1810 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027329.1 protein_id gnl|my_center|LOCUS_20850 2592 2404 gene locus_tag LOCUS_20860 2592 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2691 3296 gene locus_tag LOCUS_20870 2691 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20870 3303 3725 gene locus_tag LOCUS_20880 3303 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 3937 6864 gene locus_tag LOCUS_20890 3937 6864 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013860.1 protein_id gnl|my_center|LOCUS_20890 >Feature sequence168 2497 1502 gene locus_tag LOCUS_20900 2497 1502 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223052.1 protein_id gnl|my_center|LOCUS_20900 3519 2560 gene locus_tag LOCUS_20910 3519 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 3610 5457 gene locus_tag LOCUS_20920 3610 5457 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223053.1 protein_id gnl|my_center|LOCUS_20920 5474 5899 gene locus_tag LOCUS_20930 gene dtd 5474 5899 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029487.1 protein_id gnl|my_center|LOCUS_20930 6693 5995 gene locus_tag LOCUS_20940 6693 5995 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_20940 7898 6690 gene locus_tag LOCUS_20950 7898 6690 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence169 366 932 gene locus_tag LOCUS_20960 366 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 1636 977 gene locus_tag LOCUS_20970 1636 977 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466646.1 protein_id gnl|my_center|LOCUS_20970 2841 1624 gene locus_tag LOCUS_20980 2841 1624 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223289.1 protein_id gnl|my_center|LOCUS_20980 3516 3022 gene locus_tag LOCUS_20990 3516 3022 CDS product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975131.1 protein_id gnl|my_center|LOCUS_20990 5334 3781 gene locus_tag LOCUS_21000 5334 3781 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731180.1 protein_id gnl|my_center|LOCUS_21000 5475 6740 gene locus_tag LOCUS_21010 5475 6740 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731181.1 protein_id gnl|my_center|LOCUS_21010 7399 6851 gene locus_tag LOCUS_21020 7399 6851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence170 4136 2190 gene locus_tag LOCUS_21030 4136 2190 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486780.1 protein_id gnl|my_center|LOCUS_21030 5377 4325 gene locus_tag LOCUS_21040 gene mgrA 5377 4325 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_21040 5957 5442 gene locus_tag LOCUS_21050 5957 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 6421 7734 gene locus_tag LOCUS_21060 6421 7734 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776532.1 protein_id gnl|my_center|LOCUS_21060 >Feature sequence171 <1 991 gene locus_tag LOCUS_21070 <1 991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224470.1:1,4-alpha-glucan branching protein GlgB 1115 2326 gene locus_tag LOCUS_21080 1115 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 3245 2310 gene locus_tag LOCUS_21090 3245 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 3806 3249 gene locus_tag LOCUS_21100 gene frr 3806 3249 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_21100 4624 3869 gene locus_tag LOCUS_21110 gene pyrH 4624 3869 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973384.1 protein_id gnl|my_center|LOCUS_21110 5611 4775 gene locus_tag LOCUS_21120 gene tsf 5611 4775 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973385.1 protein_id gnl|my_center|LOCUS_21120 6701 5733 gene locus_tag LOCUS_21130 gene rpsB 6701 5733 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106517497.1 protein_id gnl|my_center|LOCUS_21130 6967 7575 gene locus_tag LOCUS_21140 6967 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 7729 8061 gene locus_tag LOCUS_21150 7729 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence172 479 1165 gene locus_tag LOCUS_21160 479 1165 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230179.1 protein_id gnl|my_center|LOCUS_21160 1350 1275 gene locus_tag LOCUS_t00300 1350 1275 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1470 1397 gene locus_tag LOCUS_t00310 1470 1397 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1608 1536 gene locus_tag LOCUS_t00320 1608 1536 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3187 1739 gene locus_tag LOCUS_21170 gene gltX 3187 1739 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973448.1 protein_id gnl|my_center|LOCUS_21170 4043 3180 gene locus_tag LOCUS_21180 4043 3180 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974625.1 protein_id gnl|my_center|LOCUS_21180 5066 4266 gene locus_tag LOCUS_21190 5066 4266 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973449.1 protein_id gnl|my_center|LOCUS_21190 5312 6118 gene locus_tag LOCUS_21200 5312 6118 CDS product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031527.1 protein_id gnl|my_center|LOCUS_21200 7648 6245 gene locus_tag LOCUS_21210 7648 6245 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963751.1 protein_id gnl|my_center|LOCUS_21210 <8252 7704 gene locus_tag LOCUS_21220 <8252 7704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000635946.1:carbohydrate ABC transporter permease >Feature sequence173 578 1027 gene locus_tag LOCUS_21230 578 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 1258 2154 gene locus_tag LOCUS_21240 1258 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 2151 3113 gene locus_tag LOCUS_21250 2151 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 3560 4765 gene locus_tag LOCUS_21260 3560 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 4769 6070 gene locus_tag LOCUS_21270 4769 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 6603 6424 gene locus_tag LOCUS_21280 6603 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 7361 6600 gene locus_tag LOCUS_21290 7361 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 7490 7771 gene locus_tag LOCUS_21300 7490 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 7947 8240 gene locus_tag LOCUS_21310 7947 8240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence174 <1 875 gene locus_tag LOCUS_21320 <1 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977325.1:alanine--tRNA ligase 1300 1785 gene locus_tag LOCUS_21330 gene ruvX 1300 1785 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 protein_id gnl|my_center|LOCUS_21330 1785 4127 gene locus_tag LOCUS_21340 1785 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 4127 4960 gene locus_tag LOCUS_21350 4127 4960 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_21350 5370 5918 gene locus_tag LOCUS_21360 gene infC 5370 5918 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 protein_id gnl|my_center|LOCUS_21360 6108 6305 gene locus_tag LOCUS_21370 gene rpmI 6108 6305 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776198.1 protein_id gnl|my_center|LOCUS_21370 6450 6821 gene locus_tag LOCUS_21380 gene rplT 6450 6821 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776197.1 protein_id gnl|my_center|LOCUS_21380 6839 7675 gene locus_tag LOCUS_21390 6839 7675 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_21390 >Feature sequence175 <1 553 gene locus_tag LOCUS_21400 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803835.1:LacI family DNA-binding transcriptional regulator 600 1853 gene locus_tag LOCUS_21410 600 1853 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803836.1 protein_id gnl|my_center|LOCUS_21410 1887 2876 gene locus_tag LOCUS_21420 1887 2876 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803837.1 protein_id gnl|my_center|LOCUS_21420 2873 3688 gene locus_tag LOCUS_21430 2873 3688 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803838.1 protein_id gnl|my_center|LOCUS_21430 3744 5684 gene locus_tag LOCUS_21440 3744 5684 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803839.1 protein_id gnl|my_center|LOCUS_21440 5917 6999 gene locus_tag LOCUS_21450 5917 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence176 867 1700 gene locus_tag LOCUS_21460 867 1700 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228550.1 protein_id gnl|my_center|LOCUS_21460 1879 1718 gene locus_tag LOCUS_21470 1879 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 1916 2461 gene locus_tag LOCUS_21480 1916 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 3475 2477 gene locus_tag LOCUS_21490 3475 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 3529 4374 gene locus_tag LOCUS_21500 3529 4374 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030941.1 protein_id gnl|my_center|LOCUS_21500 5181 4534 gene locus_tag LOCUS_21510 5181 4534 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223644.1 protein_id gnl|my_center|LOCUS_21510 6962 5268 gene locus_tag LOCUS_21520 6962 5268 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031533.1 protein_id gnl|my_center|LOCUS_21520 >Feature sequence177 <1 672 gene locus_tag LOCUS_21530 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030406.1:ABC transporter ATP-binding protein 716 1801 gene locus_tag LOCUS_21540 716 1801 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030405.1 protein_id gnl|my_center|LOCUS_21540 2009 3292 gene locus_tag LOCUS_21550 gene egtA 2009 3292 CDS product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027438.1 protein_id gnl|my_center|LOCUS_21550 3289 4644 gene locus_tag LOCUS_21560 gene egtB 3289 4644 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226793.1 protein_id gnl|my_center|LOCUS_21560 4644 5399 gene locus_tag LOCUS_21570 gene egtC 4644 5399 CDS product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027440.1 protein_id gnl|my_center|LOCUS_21570 5468 6469 gene locus_tag LOCUS_21580 gene egtD 5468 6469 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027441.1 protein_id gnl|my_center|LOCUS_21580 6473 7216 gene locus_tag LOCUS_21590 gene dapB 6473 7216 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228101.1 protein_id gnl|my_center|LOCUS_21590 7923 7240 gene locus_tag LOCUS_21600 7923 7240 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970812.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence178 271 1545 gene locus_tag LOCUS_21610 271 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 1629 4568 gene locus_tag LOCUS_21620 1629 4568 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228786.1 protein_id gnl|my_center|LOCUS_21620 5085 4570 gene locus_tag LOCUS_21630 5085 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 5429 5082 gene locus_tag LOCUS_21640 5429 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 5590 5662 gene locus_tag LOCUS_t00330 5590 5662 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5816 5888 gene locus_tag LOCUS_t00340 5816 5888 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 6951 6067 gene locus_tag LOCUS_21650 6951 6067 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 protein_id gnl|my_center|LOCUS_21650 7435 8133 gene locus_tag LOCUS_21660 7435 8133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 >Feature sequence179 218 682 gene locus_tag LOCUS_21670 218 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 1315 698 gene locus_tag LOCUS_21680 1315 698 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230338.1 protein_id gnl|my_center|LOCUS_21680 1749 1507 gene locus_tag LOCUS_21690 1749 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 2755 2228 gene locus_tag LOCUS_21700 2755 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 3282 3725 gene locus_tag LOCUS_21710 3282 3725 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222912.1 protein_id gnl|my_center|LOCUS_21710 4022 4948 gene locus_tag LOCUS_21720 4022 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 4945 6510 gene locus_tag LOCUS_21730 4945 6510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 6543 7694 gene locus_tag LOCUS_21740 6543 7694 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229640.1 protein_id gnl|my_center|LOCUS_21740 >Feature sequence180 6406 629 gene locus_tag LOCUS_21750 6406 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21750 <8050 6534 gene locus_tag LOCUS_21760 <8050 6534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141952.1:type I polyketide synthase >Feature sequence181 766 1440 gene locus_tag LOCUS_21770 gene raiA 766 1440 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975803.1 protein_id gnl|my_center|LOCUS_21770 2034 1513 gene locus_tag LOCUS_21780 2034 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2389 5232 gene locus_tag LOCUS_21790 gene secA 2389 5232 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 protein_id gnl|my_center|LOCUS_21790 6042 5317 gene locus_tag LOCUS_21800 6042 5317 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031575.1 protein_id gnl|my_center|LOCUS_21800 7620 6163 gene locus_tag LOCUS_21810 7620 6163 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028657.1 protein_id gnl|my_center|LOCUS_21810 >Feature sequence182 756 292 gene locus_tag LOCUS_21820 756 292 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404691.1 protein_id gnl|my_center|LOCUS_21820 1344 4370 gene locus_tag LOCUS_21830 1344 4370 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228347.1 protein_id gnl|my_center|LOCUS_21830 4453 6258 gene locus_tag LOCUS_21840 4453 6258 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228345.1 protein_id gnl|my_center|LOCUS_21840 6292 7419 gene locus_tag LOCUS_21850 6292 7419 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228346.1 protein_id gnl|my_center|LOCUS_21850 7838 7644 gene locus_tag LOCUS_21860 7838 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 >Feature sequence183 386 1195 gene locus_tag LOCUS_21870 386 1195 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446872.1 protein_id gnl|my_center|LOCUS_21870 1856 1224 gene locus_tag LOCUS_21880 1856 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 1989 2411 gene locus_tag LOCUS_21890 1989 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 2418 3356 gene locus_tag LOCUS_21900 2418 3356 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974609.1 protein_id gnl|my_center|LOCUS_21900 3558 4673 gene locus_tag LOCUS_21910 3558 4673 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_21910 5895 4609 gene locus_tag LOCUS_21920 5895 4609 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230460.1 protein_id gnl|my_center|LOCUS_21920 6008 6394 gene locus_tag LOCUS_21930 6008 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 7447 6479 gene locus_tag LOCUS_21940 7447 6479 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976885.1 protein_id gnl|my_center|LOCUS_21940 >Feature sequence184 1311 400 gene locus_tag LOCUS_21950 1311 400 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804969.1 protein_id gnl|my_center|LOCUS_21950 2345 1308 gene locus_tag LOCUS_21960 2345 1308 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804968.1 protein_id gnl|my_center|LOCUS_21960 3993 2338 gene locus_tag LOCUS_21970 3993 2338 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804967.1 protein_id gnl|my_center|LOCUS_21970 4204 6987 gene locus_tag LOCUS_21980 4204 6987 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030390.1 protein_id gnl|my_center|LOCUS_21980 <7979 6995 gene locus_tag LOCUS_21990 <7979 6995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977660.1:ROK family transcriptional regulator >Feature sequence185 1205 369 gene locus_tag LOCUS_22000 1205 369 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_22000 1409 2278 gene locus_tag LOCUS_22010 1409 2278 CDS product heavy metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486364.1 protein_id gnl|my_center|LOCUS_22010 3405 2296 gene locus_tag LOCUS_22020 3405 2296 CDS product bifunctional succinyldiaminopimelate transaminase/glutamate-prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_22020 3927 3574 gene locus_tag LOCUS_22030 3927 3574 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 protein_id gnl|my_center|LOCUS_22030 4072 4326 gene locus_tag LOCUS_22040 4072 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 4483 4824 gene locus_tag LOCUS_22050 4483 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 4834 5844 gene locus_tag LOCUS_22060 4834 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 5921 6826 gene locus_tag LOCUS_22070 5921 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 7330 6881 gene locus_tag LOCUS_22080 7330 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 <7975 7408 gene locus_tag LOCUS_22090 <7975 7408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_089212260.1:N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase >Feature sequence186 291 1775 gene locus_tag LOCUS_22100 291 1775 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057464.1 protein_id gnl|my_center|LOCUS_22100 1808 3034 gene locus_tag LOCUS_22110 1808 3034 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 protein_id gnl|my_center|LOCUS_22110 3056 4405 gene locus_tag LOCUS_22120 3056 4405 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_22120 5186 4371 gene locus_tag LOCUS_22130 gene dapF 5186 4371 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224258.1 protein_id gnl|my_center|LOCUS_22130 5272 6267 gene locus_tag LOCUS_22140 gene miaA 5272 6267 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_22140 6492 7238 gene locus_tag LOCUS_22150 6492 7238 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224576.1 protein_id gnl|my_center|LOCUS_22150 >Feature sequence187 309 911 gene locus_tag LOCUS_22160 309 911 CDS product DUF4178 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413441.1 protein_id gnl|my_center|LOCUS_22160 919 1425 gene locus_tag LOCUS_22170 919 1425 CDS product DUF2617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975282.1 protein_id gnl|my_center|LOCUS_22170 1445 1765 gene locus_tag LOCUS_22180 1445 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 1844 3412 gene locus_tag LOCUS_22190 1844 3412 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976349.1 protein_id gnl|my_center|LOCUS_22190 3915 3451 gene locus_tag LOCUS_22200 3915 3451 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978225.1 protein_id gnl|my_center|LOCUS_22200 4090 4836 gene locus_tag LOCUS_22210 4090 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 5231 6697 gene locus_tag LOCUS_22220 5231 6697 CDS product bifunctional cytidylyltransferase/SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107920.1 protein_id gnl|my_center|LOCUS_22220 >Feature sequence188 <1 535 gene locus_tag LOCUS_22230 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775772.1:ComEA family DNA-binding protein 657 3044 gene locus_tag LOCUS_22240 657 3044 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228464.1 protein_id gnl|my_center|LOCUS_22240 3160 4083 gene locus_tag LOCUS_22250 gene holA 3160 4083 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485035.1 protein_id gnl|my_center|LOCUS_22250 5895 4375 gene locus_tag LOCUS_22260 gene hflX 5895 4375 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_22260 >Feature sequence189 1946 744 gene locus_tag LOCUS_22270 1946 744 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229483.1 protein_id gnl|my_center|LOCUS_22270 2649 2032 gene locus_tag LOCUS_22280 2649 2032 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229981.1 protein_id gnl|my_center|LOCUS_22280 3115 2837 gene locus_tag LOCUS_22290 3115 2837 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974680.1 protein_id gnl|my_center|LOCUS_22290 4425 3166 gene locus_tag LOCUS_22300 gene thrC 4425 3166 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270150.1 protein_id gnl|my_center|LOCUS_22300 4859 6295 gene locus_tag LOCUS_22310 4859 6295 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029560.1 protein_id gnl|my_center|LOCUS_22310 6889 6299 gene locus_tag LOCUS_22320 6889 6299 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461300.1 protein_id gnl|my_center|LOCUS_22320 >Feature sequence190 968 717 gene locus_tag LOCUS_22330 968 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 1775 1164 gene locus_tag LOCUS_22340 1775 1164 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043775763.1 protein_id gnl|my_center|LOCUS_22340 2006 2980 gene locus_tag LOCUS_22350 2006 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 3870 3079 gene locus_tag LOCUS_22360 3870 3079 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 protein_id gnl|my_center|LOCUS_22360 4740 4036 gene locus_tag LOCUS_22370 4740 4036 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226786.1 protein_id gnl|my_center|LOCUS_22370 4972 5556 gene locus_tag LOCUS_22380 4972 5556 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031930.1 protein_id gnl|my_center|LOCUS_22380 5549 6430 gene locus_tag LOCUS_22390 5549 6430 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005130012.1 protein_id gnl|my_center|LOCUS_22390 >Feature sequence191 757 681 gene locus_tag LOCUS_t00350 757 681 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 858 783 gene locus_tag LOCUS_t00360 858 783 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1021 948 gene locus_tag LOCUS_t00370 1021 948 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2551 1139 gene locus_tag LOCUS_22400 2551 1139 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974879.1 protein_id gnl|my_center|LOCUS_22400 2756 3106 gene locus_tag LOCUS_22410 2756 3106 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222136.1 protein_id gnl|my_center|LOCUS_22410 3340 4635 gene locus_tag LOCUS_22420 3340 4635 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230812.1 protein_id gnl|my_center|LOCUS_22420 5045 4800 gene locus_tag LOCUS_22430 5045 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 5843 5238 gene locus_tag LOCUS_22440 5843 5238 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031480854.1 protein_id gnl|my_center|LOCUS_22440 6323 5937 gene locus_tag LOCUS_22450 6323 5937 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230341.1 protein_id gnl|my_center|LOCUS_22450 6938 7303 gene locus_tag LOCUS_22460 6938 7303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 7496 7572 gene locus_tag LOCUS_t00380 7496 7572 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence192 2329 1013 gene locus_tag LOCUS_22470 2329 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 2858 2451 gene locus_tag LOCUS_22480 2858 2451 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230234.1 protein_id gnl|my_center|LOCUS_22480 3582 3881 gene locus_tag LOCUS_22490 3582 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 5301 3982 gene locus_tag LOCUS_22500 5301 3982 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403001.1 protein_id gnl|my_center|LOCUS_22500 5958 5398 gene locus_tag LOCUS_22510 5958 5398 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668728.1 protein_id gnl|my_center|LOCUS_22510 6256 7458 gene locus_tag LOCUS_22520 6256 7458 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804859.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence193 442 2007 gene locus_tag LOCUS_22530 442 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 2037 2861 gene locus_tag LOCUS_22540 2037 2861 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922116.1 protein_id gnl|my_center|LOCUS_22540 3006 4547 gene locus_tag LOCUS_22550 3006 4547 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 protein_id gnl|my_center|LOCUS_22550 6110 4578 gene locus_tag LOCUS_22560 6110 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence194 2742 847 gene locus_tag LOCUS_22570 2742 847 CDS product calcineurin-like phosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036986.1 protein_id gnl|my_center|LOCUS_22570 4575 3373 gene locus_tag LOCUS_22580 4575 3373 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234232.1 protein_id gnl|my_center|LOCUS_22580 4785 5681 gene locus_tag LOCUS_22590 4785 5681 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013484.1 protein_id gnl|my_center|LOCUS_22590 6508 5747 gene locus_tag LOCUS_22600 6508 5747 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223098.1 protein_id gnl|my_center|LOCUS_22600 6470 6787 gene locus_tag LOCUS_22610 6470 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 6772 7443 gene locus_tag LOCUS_22620 6772 7443 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972881.1 protein_id gnl|my_center|LOCUS_22620 >Feature sequence195 69 398 gene locus_tag LOCUS_22630 69 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 1388 486 gene locus_tag LOCUS_22640 1388 486 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977970.1 protein_id gnl|my_center|LOCUS_22640 1512 2780 gene locus_tag LOCUS_22650 1512 2780 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266387.1 protein_id gnl|my_center|LOCUS_22650 3106 6483 gene locus_tag LOCUS_22660 3106 6483 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027194.1 protein_id gnl|my_center|LOCUS_22660 7612 6941 gene locus_tag LOCUS_22670 7612 6941 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079467.1 protein_id gnl|my_center|LOCUS_22670 >Feature sequence196 1534 710 gene locus_tag LOCUS_22680 1534 710 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974993.1 protein_id gnl|my_center|LOCUS_22680 1651 2436 gene locus_tag LOCUS_22690 1651 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 2589 3800 gene locus_tag LOCUS_22700 2589 3800 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168581903.1 protein_id gnl|my_center|LOCUS_22700 5259 4486 gene locus_tag LOCUS_22710 5259 4486 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267336.1 protein_id gnl|my_center|LOCUS_22710 6239 5256 gene locus_tag LOCUS_22720 6239 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 6520 6278 gene locus_tag LOCUS_22730 6520 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22730 7515 6517 gene locus_tag LOCUS_22740 7515 6517 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 protein_id gnl|my_center|LOCUS_22740 >Feature sequence197 1501 260 gene locus_tag LOCUS_22750 1501 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 3110 1815 gene locus_tag LOCUS_22760 3110 1815 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028727.1 protein_id gnl|my_center|LOCUS_22760 4087 3107 gene locus_tag LOCUS_22770 gene cofD 4087 3107 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975775.1 protein_id gnl|my_center|LOCUS_22770 4407 5363 gene locus_tag LOCUS_22780 4407 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 5601 5888 gene locus_tag LOCUS_22790 5601 5888 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975777.1 protein_id gnl|my_center|LOCUS_22790 >Feature sequence198 <1 1050 gene locus_tag LOCUS_22800 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027705.1:SMC family ATPase 1142 1570 gene locus_tag LOCUS_22810 1142 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 3886 1766 gene locus_tag LOCUS_22820 3886 1766 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228600.1 protein_id gnl|my_center|LOCUS_22820 4183 5388 gene locus_tag LOCUS_22830 gene allB 4183 5388 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223822.1 protein_id gnl|my_center|LOCUS_22830 5545 6666 gene locus_tag LOCUS_22840 gene ald 5545 6666 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_22840 >Feature sequence199 643 110 gene locus_tag LOCUS_22850 643 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 1241 765 gene locus_tag LOCUS_22860 1241 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 1392 3140 gene locus_tag LOCUS_22870 1392 3140 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224751.1 protein_id gnl|my_center|LOCUS_22870 3137 4735 gene locus_tag LOCUS_22880 3137 4735 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974603.1 protein_id gnl|my_center|LOCUS_22880 4752 6776 gene locus_tag LOCUS_22890 4752 6776 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224754.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence200 367 440 gene locus_tag LOCUS_t00390 367 440 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 571 1968 gene locus_tag LOCUS_22900 gene glmU 571 1968 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975692.1 protein_id gnl|my_center|LOCUS_22900 1987 2955 gene locus_tag LOCUS_22910 1987 2955 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_22910 3289 3885 gene locus_tag LOCUS_22920 3289 3885 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975690.1 protein_id gnl|my_center|LOCUS_22920 3969 4589 gene locus_tag LOCUS_22930 gene pth 3969 4589 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229969.1 protein_id gnl|my_center|LOCUS_22930 5819 4677 gene locus_tag LOCUS_22940 5819 4677 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803997.1 protein_id gnl|my_center|LOCUS_22940 6023 7036 gene locus_tag LOCUS_22950 6023 7036 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977450.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence201 73 1851 gene locus_tag LOCUS_22960 73 1851 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 protein_id gnl|my_center|LOCUS_22960 2031 3896 gene locus_tag LOCUS_22970 2031 3896 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031185.1 protein_id gnl|my_center|LOCUS_22970 3915 4802 gene locus_tag LOCUS_22980 3915 4802 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222345.1 protein_id gnl|my_center|LOCUS_22980 6461 4959 gene locus_tag LOCUS_22990 6461 4959 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028880.1 protein_id gnl|my_center|LOCUS_22990 <7554 6923 gene locus_tag LOCUS_23000 <7554 6923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_189742782.1:CocE/NonD family hydrolase >Feature sequence202 <1 2955 gene locus_tag LOCUS_23010 <1 2955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015777144.1:transglycosylase domain-containing protein 4079 2994 gene locus_tag LOCUS_23020 4079 2994 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_23020 4642 4079 gene locus_tag LOCUS_23030 4642 4079 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731310.1 protein_id gnl|my_center|LOCUS_23030 4616 4924 gene locus_tag LOCUS_23040 4616 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 6186 4825 gene locus_tag LOCUS_23050 6186 4825 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_23050 7387 6365 gene locus_tag LOCUS_23060 7387 6365 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878041.1 protein_id gnl|my_center|LOCUS_23060 >Feature sequence203 2202 349 gene locus_tag LOCUS_23070 2202 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 2446 3192 gene locus_tag LOCUS_23080 2446 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 3189 3959 gene locus_tag LOCUS_23090 3189 3959 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229286.1 protein_id gnl|my_center|LOCUS_23090 4833 3961 gene locus_tag LOCUS_23100 gene ligD 4833 3961 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863172.1 protein_id gnl|my_center|LOCUS_23100 6317 4830 gene locus_tag LOCUS_23110 6317 4830 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107137.1 protein_id gnl|my_center|LOCUS_23110 <7422 6521 gene locus_tag LOCUS_23120 <7422 6521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223551.1:electron transfer flavoprotein subunit alpha/FixB family protein >Feature sequence204 <1 922 gene locus_tag LOCUS_23130 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883981.1:DEAD/DEAH box helicase 1090 4086 gene locus_tag LOCUS_23140 1090 4086 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence205 661 2325 gene locus_tag LOCUS_23150 gene araB 661 2325 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727845.1 protein_id gnl|my_center|LOCUS_23150 2325 3020 gene locus_tag LOCUS_23160 2325 3020 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893113.1 protein_id gnl|my_center|LOCUS_23160 3232 4326 gene locus_tag LOCUS_23170 gene chvE 3232 4326 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287997.1 protein_id gnl|my_center|LOCUS_23170 4323 5900 gene locus_tag LOCUS_23180 gene gguA 4323 5900 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287995.1 protein_id gnl|my_center|LOCUS_23180 5897 7189 gene locus_tag LOCUS_23190 gene gguB 5897 7189 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727841.1 protein_id gnl|my_center|LOCUS_23190 >Feature sequence206 703 317 gene locus_tag LOCUS_23200 703 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 948 2225 gene locus_tag LOCUS_23210 948 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 2258 2731 gene locus_tag LOCUS_23220 2258 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229066.1 protein_id gnl|my_center|LOCUS_23220 3842 2745 gene locus_tag LOCUS_23230 3842 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 3991 4794 gene locus_tag LOCUS_23240 3991 4794 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23240 4823 5518 gene locus_tag LOCUS_23250 4823 5518 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 protein_id gnl|my_center|LOCUS_23250 5748 7133 gene locus_tag LOCUS_23260 5748 7133 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975423.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence207 388 1164 gene locus_tag LOCUS_23270 388 1164 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973615.1 protein_id gnl|my_center|LOCUS_23270 1440 3071 gene locus_tag LOCUS_23280 gene groL 1440 3071 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_23280 3283 3882 gene locus_tag LOCUS_23290 3283 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 4915 3917 gene locus_tag LOCUS_23300 4915 3917 CDS product R2-like ligand-binding oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230220.1 protein_id gnl|my_center|LOCUS_23300 5119 5355 gene locus_tag LOCUS_23310 5119 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 6179 5376 gene locus_tag LOCUS_23320 6179 5376 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 protein_id gnl|my_center|LOCUS_23320 <7382 6300 gene locus_tag LOCUS_23330 <7382 6300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404428.1:DEAD/DEAH box helicase >Feature sequence208 220 999 gene locus_tag LOCUS_23340 gene cpaB 220 999 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973972.1 protein_id gnl|my_center|LOCUS_23340 996 2372 gene locus_tag LOCUS_23350 996 2372 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973971.1 protein_id gnl|my_center|LOCUS_23350 2434 2790 gene locus_tag LOCUS_23360 2434 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 2787 3227 gene locus_tag LOCUS_23370 2787 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 3246 4583 gene locus_tag LOCUS_23380 3246 4583 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973968.1 protein_id gnl|my_center|LOCUS_23380 4546 5547 gene locus_tag LOCUS_23390 4546 5547 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030000.1 protein_id gnl|my_center|LOCUS_23390 5562 6482 gene locus_tag LOCUS_23400 5562 6482 CDS product DUF5936 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030001.1 protein_id gnl|my_center|LOCUS_23400 <7347 6536 gene locus_tag LOCUS_23410 <7347 6536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005082846.1:arylamine N-acetyltransferase >Feature sequence209 <1 543 gene locus_tag LOCUS_23420 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028650.1:DUF1707 domain-containing protein 836 2359 gene locus_tag LOCUS_23430 gene paaP 836 2359 CDS product aminopeptidase PaaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101464.1 protein_id gnl|my_center|LOCUS_23430 2726 3325 gene locus_tag LOCUS_23440 2726 3325 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973616.1 protein_id gnl|my_center|LOCUS_23440 3910 3416 gene locus_tag LOCUS_23450 3910 3416 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973622.1 protein_id gnl|my_center|LOCUS_23450 4336 3947 gene locus_tag LOCUS_23460 4336 3947 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973623.1 protein_id gnl|my_center|LOCUS_23460 6044 4599 gene locus_tag LOCUS_23470 gene atpD 6044 4599 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406701.1 protein_id gnl|my_center|LOCUS_23470 6969 6049 gene locus_tag LOCUS_23480 6969 6049 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_23480 >Feature sequence210 425 1444 gene locus_tag LOCUS_23490 425 1444 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973776.1 protein_id gnl|my_center|LOCUS_23490 1482 1919 gene locus_tag LOCUS_23500 1482 1919 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973775.1 protein_id gnl|my_center|LOCUS_23500 2004 3083 gene locus_tag LOCUS_23510 2004 3083 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804763.1 protein_id gnl|my_center|LOCUS_23510 3668 3126 gene locus_tag LOCUS_23520 3668 3126 CDS product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167526720.1 protein_id gnl|my_center|LOCUS_23520 3967 6921 gene locus_tag LOCUS_23530 3967 6921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 7073 7149 gene locus_tag LOCUS_t00400 7073 7149 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence211 <1 761 gene locus_tag LOCUS_23540 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228230.1:acyltransferase family protein 1600 836 gene locus_tag LOCUS_23550 1600 836 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931350.1 protein_id gnl|my_center|LOCUS_23550 2382 1609 gene locus_tag LOCUS_23560 2382 1609 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891557.1 protein_id gnl|my_center|LOCUS_23560 3525 2455 gene locus_tag LOCUS_23570 3525 2455 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_23570 5193 3856 gene locus_tag LOCUS_23580 gene glmM 5193 3856 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_23580 5859 5350 gene locus_tag LOCUS_23590 gene rpsI 5859 5350 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776323.1 protein_id gnl|my_center|LOCUS_23590 6347 5898 gene locus_tag LOCUS_23600 gene rplM 6347 5898 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974239.1 protein_id gnl|my_center|LOCUS_23600 >Feature sequence212 621 163 gene locus_tag LOCUS_23610 621 163 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190249366.1 protein_id gnl|my_center|LOCUS_23610 1537 749 gene locus_tag LOCUS_23620 1537 749 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170039298.1 protein_id gnl|my_center|LOCUS_23620 2601 1543 gene locus_tag LOCUS_23630 2601 1543 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392274.1 protein_id gnl|my_center|LOCUS_23630 3366 2836 gene locus_tag LOCUS_23640 3366 2836 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230876.1 protein_id gnl|my_center|LOCUS_23640 3574 4536 gene locus_tag LOCUS_23650 3574 4536 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_23650 5756 4545 gene locus_tag LOCUS_23660 5756 4545 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225222.1 protein_id gnl|my_center|LOCUS_23660 6026 6502 gene locus_tag LOCUS_23670 6026 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 6457 6666 gene locus_tag LOCUS_23680 6457 6666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 7085 6843 gene locus_tag LOCUS_23690 7085 6843 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030672.1 protein_id gnl|my_center|LOCUS_23690 7285 7088 gene locus_tag LOCUS_23700 7285 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence213 665 2218 gene locus_tag LOCUS_23710 665 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 2419 3333 gene locus_tag LOCUS_23720 2419 3333 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 protein_id gnl|my_center|LOCUS_23720 3456 4376 gene locus_tag LOCUS_23730 3456 4376 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 protein_id gnl|my_center|LOCUS_23730 4380 4580 gene locus_tag LOCUS_23740 4380 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 5779 5096 gene locus_tag LOCUS_23750 5779 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 5917 6636 gene locus_tag LOCUS_23760 5917 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 7017 6646 gene locus_tag LOCUS_23770 7017 6646 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950169.1 protein_id gnl|my_center|LOCUS_23770 >Feature sequence214 107 922 gene locus_tag LOCUS_23780 107 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 1568 960 gene locus_tag LOCUS_23790 1568 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 1743 2768 gene locus_tag LOCUS_23800 gene glpX 1743 2768 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973930.1 protein_id gnl|my_center|LOCUS_23800 3050 4663 gene locus_tag LOCUS_23810 3050 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 5558 4737 gene locus_tag LOCUS_23820 5558 4737 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810480.1 protein_id gnl|my_center|LOCUS_23820 6478 5555 gene locus_tag LOCUS_23830 6478 5555 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_23830 7159 6704 gene locus_tag LOCUS_23840 7159 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence215 2761 1331 gene locus_tag LOCUS_23850 2761 1331 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224469.1 protein_id gnl|my_center|LOCUS_23850 4707 2761 gene locus_tag LOCUS_23860 gene treS 4707 2761 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031594.1 protein_id gnl|my_center|LOCUS_23860 6774 4804 gene locus_tag LOCUS_23870 6774 4804 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031595.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence216 839 153 gene locus_tag LOCUS_23880 839 153 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530303.1 protein_id gnl|my_center|LOCUS_23880 1930 836 gene locus_tag LOCUS_23890 1930 836 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919053.1 protein_id gnl|my_center|LOCUS_23890 3121 1973 gene locus_tag LOCUS_23900 3121 1973 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537770.1 protein_id gnl|my_center|LOCUS_23900 3957 3121 gene locus_tag LOCUS_23910 3957 3121 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384437.1 protein_id gnl|my_center|LOCUS_23910 4771 3974 gene locus_tag LOCUS_23920 4771 3974 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384438.1 protein_id gnl|my_center|LOCUS_23920 5396 4959 gene locus_tag LOCUS_23930 5396 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 6770 5532 gene locus_tag LOCUS_23940 6770 5532 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082051.1 protein_id gnl|my_center|LOCUS_23940 <7249 6748 gene locus_tag LOCUS_23950 <7249 6748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256402.1:PucR family transcriptional regulator >Feature sequence217 <1 579 gene locus_tag LOCUS_23960 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974722.1:FAD binding domain-containing protein 576 2711 gene locus_tag LOCUS_23970 576 2711 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727118.1 protein_id gnl|my_center|LOCUS_23970 3355 2684 gene locus_tag LOCUS_23980 3355 2684 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222957.1 protein_id gnl|my_center|LOCUS_23980 4428 3499 gene locus_tag LOCUS_23990 4428 3499 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227667.1 protein_id gnl|my_center|LOCUS_23990 4538 5479 gene locus_tag LOCUS_24000 4538 5479 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222703.1 protein_id gnl|my_center|LOCUS_24000 6103 5471 gene locus_tag LOCUS_24010 6103 5471 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727949.1 protein_id gnl|my_center|LOCUS_24010 >Feature sequence218 1 417 gene locus_tag LOCUS_24020 1 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 510 1472 gene locus_tag LOCUS_24030 gene thrB 510 1472 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_24030 1915 3906 gene locus_tag LOCUS_24040 1915 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 4174 5991 gene locus_tag LOCUS_24050 4174 5991 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811125.1 protein_id gnl|my_center|LOCUS_24050 6249 6458 gene locus_tag LOCUS_24060 gene rpmE 6249 6458 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973638.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence219 1916 1023 gene locus_tag LOCUS_24070 1916 1023 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090280.1 protein_id gnl|my_center|LOCUS_24070 2833 1913 gene locus_tag LOCUS_24080 2833 1913 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013534.1 protein_id gnl|my_center|LOCUS_24080 2983 3843 gene locus_tag LOCUS_24090 2983 3843 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225909.1 protein_id gnl|my_center|LOCUS_24090 4885 3809 gene locus_tag LOCUS_24100 4885 3809 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_24100 5745 4882 gene locus_tag LOCUS_24110 5745 4882 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446465.1 protein_id gnl|my_center|LOCUS_24110 6407 5742 gene locus_tag LOCUS_24120 6407 5742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870166.1 protein_id gnl|my_center|LOCUS_24120 7102 6404 gene locus_tag LOCUS_24130 7102 6404 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194783.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence220 <1 978 gene locus_tag LOCUS_24140 <1 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228701.1:LacI family DNA-binding transcriptional regulator 2185 1097 gene locus_tag LOCUS_24150 2185 1097 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029019.1 protein_id gnl|my_center|LOCUS_24150 3094 2189 gene locus_tag LOCUS_24160 3094 2189 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731064.1 protein_id gnl|my_center|LOCUS_24160 4023 3115 gene locus_tag LOCUS_24170 4023 3115 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728493.1 protein_id gnl|my_center|LOCUS_24170 5180 4020 gene locus_tag LOCUS_24180 5180 4020 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028561.1 protein_id gnl|my_center|LOCUS_24180 6331 5177 gene locus_tag LOCUS_24190 6331 5177 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456192.1 protein_id gnl|my_center|LOCUS_24190 >Feature sequence221 499 53 gene locus_tag LOCUS_24200 499 53 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229298.1 protein_id gnl|my_center|LOCUS_24200 722 2101 gene locus_tag LOCUS_24210 722 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 2749 2108 gene locus_tag LOCUS_24220 2749 2108 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977123.1 protein_id gnl|my_center|LOCUS_24220 2937 4112 gene locus_tag LOCUS_24230 2937 4112 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230129.1 protein_id gnl|my_center|LOCUS_24230 4577 4203 gene locus_tag LOCUS_24240 4577 4203 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222011.1 protein_id gnl|my_center|LOCUS_24240 5849 4665 gene locus_tag LOCUS_24250 gene manA 5849 4665 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975786.1 protein_id gnl|my_center|LOCUS_24250 6349 6134 gene locus_tag LOCUS_24260 6349 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 6589 6353 gene locus_tag LOCUS_24270 6589 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence222 <1 1230 gene locus_tag LOCUS_24280 <1 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776950.1:FGGY-family carbohydrate kinase 1492 1418 gene locus_tag LOCUS_t00410 1492 1418 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1601 2020 gene locus_tag LOCUS_24290 1601 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 2017 2301 gene locus_tag LOCUS_24300 2017 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 2335 3099 gene locus_tag LOCUS_24310 2335 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 3219 4604 gene locus_tag LOCUS_24320 gene lysA 3219 4604 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 protein_id gnl|my_center|LOCUS_24320 4677 5963 gene locus_tag LOCUS_24330 4677 5963 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence223 370 1194 gene locus_tag LOCUS_24340 370 1194 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974056.1 protein_id gnl|my_center|LOCUS_24340 2299 1661 gene locus_tag LOCUS_24350 2299 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 3396 2296 gene locus_tag LOCUS_24360 3396 2296 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_24360 4738 3491 gene locus_tag LOCUS_24370 4738 3491 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029925.1 protein_id gnl|my_center|LOCUS_24370 5939 4767 gene locus_tag LOCUS_24380 5939 4767 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224327.1 protein_id gnl|my_center|LOCUS_24380 <6917 6087 gene locus_tag LOCUS_24390 <6917 6087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974125.1:YihY/virulence factor BrkB family protein >Feature sequence224 1600 392 gene locus_tag LOCUS_24400 1600 392 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030441.1 protein_id gnl|my_center|LOCUS_24400 2302 1715 gene locus_tag LOCUS_24410 2302 1715 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727585.1 protein_id gnl|my_center|LOCUS_24410 2584 3249 gene locus_tag LOCUS_24420 2584 3249 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263161.1 protein_id gnl|my_center|LOCUS_24420 4026 3439 gene locus_tag LOCUS_24430 4026 3439 CDS product protoglobin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256689.1 protein_id gnl|my_center|LOCUS_24430 4570 5145 gene locus_tag LOCUS_24440 4570 5145 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_24440 5508 6716 gene locus_tag LOCUS_24450 5508 6716 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977801.1 protein_id gnl|my_center|LOCUS_24450 >Feature sequence225 <1 1454 gene locus_tag LOCUS_24460 <1 1454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027550.1:GH1 family beta-glucosidase 1705 1532 gene locus_tag LOCUS_24470 1705 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 3704 2886 gene locus_tag LOCUS_24480 3704 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 4243 4872 gene locus_tag LOCUS_24490 4243 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583147.1 protein_id gnl|my_center|LOCUS_24490 5546 4929 gene locus_tag LOCUS_24500 5546 4929 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029378.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence226 836 357 gene locus_tag LOCUS_24510 836 357 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971886.1 protein_id gnl|my_center|LOCUS_24510 3478 884 gene locus_tag LOCUS_24520 3478 884 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028834.1 protein_id gnl|my_center|LOCUS_24520 3684 4502 gene locus_tag LOCUS_24530 3684 4502 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388471.1 protein_id gnl|my_center|LOCUS_24530 4646 5005 gene locus_tag LOCUS_24540 4646 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 5195 5383 gene locus_tag LOCUS_24550 5195 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 5598 6770 gene locus_tag LOCUS_24560 gene mshC 5598 6770 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_24560 >Feature sequence227 684 301 gene locus_tag LOCUS_24570 684 301 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223630.1 protein_id gnl|my_center|LOCUS_24570 849 1484 gene locus_tag LOCUS_24580 849 1484 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030760.1 protein_id gnl|my_center|LOCUS_24580 1553 2596 gene locus_tag LOCUS_24590 1553 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 3558 2968 gene locus_tag LOCUS_24600 gene tmrB 3558 2968 CDS product tunicamycin resistance ATP-binding TmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246258.1 protein_id gnl|my_center|LOCUS_24600 4070 3642 gene locus_tag LOCUS_24610 4070 3642 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079731.1 protein_id gnl|my_center|LOCUS_24610 4473 4889 gene locus_tag LOCUS_24620 4473 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 5744 5082 gene locus_tag LOCUS_24630 5744 5082 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401268.1 protein_id gnl|my_center|LOCUS_24630 >Feature sequence228 281 922 gene locus_tag LOCUS_24640 281 922 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031152.1 protein_id gnl|my_center|LOCUS_24640 1492 974 gene locus_tag LOCUS_24650 1492 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 1682 3307 gene locus_tag LOCUS_24660 1682 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 4024 3326 gene locus_tag LOCUS_24670 4024 3326 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140352.1 protein_id gnl|my_center|LOCUS_24670 5289 4021 gene locus_tag LOCUS_24680 5289 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 6156 5335 gene locus_tag LOCUS_24690 6156 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence229 4217 2610 gene locus_tag LOCUS_24700 4217 2610 CDS product SagB family peptide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176762.1 protein_id gnl|my_center|LOCUS_24700 5533 4214 gene locus_tag LOCUS_24710 5533 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 6183 5515 gene locus_tag LOCUS_24720 6183 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 >Feature sequence230 1103 1720 gene locus_tag LOCUS_24730 1103 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 1762 2580 gene locus_tag LOCUS_24740 1762 2580 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067135926.1 protein_id gnl|my_center|LOCUS_24740 2780 3700 gene locus_tag LOCUS_24750 2780 3700 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223960.1 protein_id gnl|my_center|LOCUS_24750 3777 5459 gene locus_tag LOCUS_24760 3777 5459 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228747.1 protein_id gnl|my_center|LOCUS_24760 5665 6846 gene locus_tag LOCUS_24770 5665 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence231 2138 1458 gene locus_tag LOCUS_24780 2138 1458 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977459.1 protein_id gnl|my_center|LOCUS_24780 3232 2135 gene locus_tag LOCUS_24790 3232 2135 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027750.1 protein_id gnl|my_center|LOCUS_24790 3416 4639 gene locus_tag LOCUS_24800 3416 4639 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027751.1 protein_id gnl|my_center|LOCUS_24800 4636 5277 gene locus_tag LOCUS_24810 4636 5277 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977456.1 protein_id gnl|my_center|LOCUS_24810 >Feature sequence232 56 132 gene locus_tag LOCUS_t00420 56 132 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1150 230 gene locus_tag LOCUS_24820 1150 230 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895400.1 protein_id gnl|my_center|LOCUS_24820 2407 1253 gene locus_tag LOCUS_24830 2407 1253 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031719.1 protein_id gnl|my_center|LOCUS_24830 3542 4522 gene locus_tag LOCUS_24840 3542 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24840 5606 4806 gene locus_tag LOCUS_24850 5606 4806 CDS product IS5-like element IS470 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029009.1 protein_id gnl|my_center|LOCUS_24850 >Feature sequence233 499 1590 gene locus_tag LOCUS_24860 499 1590 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803789.1 protein_id gnl|my_center|LOCUS_24860 1605 2483 gene locus_tag LOCUS_24870 1605 2483 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080070.1 protein_id gnl|my_center|LOCUS_24870 2489 3559 gene locus_tag LOCUS_24880 2489 3559 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230097.1 protein_id gnl|my_center|LOCUS_24880 3552 4598 gene locus_tag LOCUS_24890 3552 4598 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868866.1 protein_id gnl|my_center|LOCUS_24890 4787 5716 gene locus_tag LOCUS_24900 4787 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 5780 6592 gene locus_tag LOCUS_24910 5780 6592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 >Feature sequence234 1919 2770 gene locus_tag LOCUS_24920 1919 2770 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231033.1 protein_id gnl|my_center|LOCUS_24920 2859 4049 gene locus_tag LOCUS_24930 2859 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 5480 4071 gene locus_tag LOCUS_24940 5480 4071 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257411.1 protein_id gnl|my_center|LOCUS_24940 <6702 5541 gene locus_tag LOCUS_24950 <6702 5541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003972908.1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence235 1384 1025 gene locus_tag LOCUS_24960 1384 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 1767 2369 gene locus_tag LOCUS_24970 1767 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 3304 2450 gene locus_tag LOCUS_24980 3304 2450 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974148.1 protein_id gnl|my_center|LOCUS_24980 4889 3318 gene locus_tag LOCUS_24990 gene purH 4889 3318 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222720.1 protein_id gnl|my_center|LOCUS_24990 5521 4886 gene locus_tag LOCUS_25000 gene purN 5521 4886 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974158.1 protein_id gnl|my_center|LOCUS_25000 5854 6246 gene locus_tag LOCUS_25010 5854 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 6350 6141 gene locus_tag LOCUS_25020 6350 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 >Feature sequence236 790 134 gene locus_tag LOCUS_25030 790 134 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228511.1 protein_id gnl|my_center|LOCUS_25030 1606 839 gene locus_tag LOCUS_25040 1606 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 3103 1676 gene locus_tag LOCUS_25050 gene tig 3103 1676 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976179.1 protein_id gnl|my_center|LOCUS_25050 3405 3330 gene locus_tag LOCUS_t00430 3405 3330 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3526 3599 gene locus_tag LOCUS_t00440 3526 3599 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3939 3685 gene locus_tag LOCUS_25060 3939 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 3823 4326 gene locus_tag LOCUS_25070 3823 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 4440 6305 gene locus_tag LOCUS_25080 4440 6305 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_25080 6587 6378 gene locus_tag LOCUS_25090 6587 6378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 >Feature sequence237 467 760 gene locus_tag LOCUS_25100 467 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 764 1561 gene locus_tag LOCUS_25110 gene cas6e 764 1561 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227610.1 protein_id gnl|my_center|LOCUS_25110 3018 2050 gene locus_tag LOCUS_25120 3018 2050 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110392.1 protein_id gnl|my_center|LOCUS_25120 3100 3624 gene locus_tag LOCUS_25130 3100 3624 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730781.1 protein_id gnl|my_center|LOCUS_25130 4650 3835 gene locus_tag LOCUS_25140 4650 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 5040 5771 gene locus_tag LOCUS_25150 5040 5771 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742194.1 protein_id gnl|my_center|LOCUS_25150 >Feature sequence238 412 80 gene locus_tag LOCUS_25160 412 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 1479 409 gene locus_tag LOCUS_25170 1479 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 2993 1521 gene locus_tag LOCUS_25180 2993 1521 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228616.1 protein_id gnl|my_center|LOCUS_25180 4408 2990 gene locus_tag LOCUS_25190 4408 2990 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267658.1 protein_id gnl|my_center|LOCUS_25190 4990 4436 gene locus_tag LOCUS_25200 4990 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 5644 5015 gene locus_tag LOCUS_25210 5644 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25210 6414 5641 gene locus_tag LOCUS_25220 6414 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 >Feature sequence239 128 316 gene locus_tag LOCUS_25230 128 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 574 2367 gene locus_tag LOCUS_25240 574 2367 CDS product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110061.1 protein_id gnl|my_center|LOCUS_25240 2833 2375 gene locus_tag LOCUS_25250 2833 2375 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029305.1 protein_id gnl|my_center|LOCUS_25250 3122 3817 gene locus_tag LOCUS_25260 3122 3817 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378111.1 protein_id gnl|my_center|LOCUS_25260 4210 4977 gene locus_tag LOCUS_25270 4210 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 >Feature sequence240 1992 385 gene locus_tag LOCUS_25280 1992 385 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029679.1 protein_id gnl|my_center|LOCUS_25280 2801 1992 gene locus_tag LOCUS_25290 2801 1992 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974477.1 protein_id gnl|my_center|LOCUS_25290 3547 2798 gene locus_tag LOCUS_25300 3547 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 4030 3827 gene locus_tag LOCUS_25310 4030 3827 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004984898.1 protein_id gnl|my_center|LOCUS_25310 5081 4284 gene locus_tag LOCUS_25320 5081 4284 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028912.1 protein_id gnl|my_center|LOCUS_25320 6427 5237 gene locus_tag LOCUS_25330 6427 5237 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326515.1 protein_id gnl|my_center|LOCUS_25330 >Feature sequence241 1570 581 gene locus_tag LOCUS_25340 1570 581 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030067.1 protein_id gnl|my_center|LOCUS_25340 2624 1602 gene locus_tag LOCUS_25350 2624 1602 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229921.1 protein_id gnl|my_center|LOCUS_25350 3548 2637 gene locus_tag LOCUS_25360 3548 2637 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229922.1 protein_id gnl|my_center|LOCUS_25360 4467 3541 gene locus_tag LOCUS_25370 4467 3541 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229923.1 protein_id gnl|my_center|LOCUS_25370 6144 4525 gene locus_tag LOCUS_25380 6144 4525 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973860.1 protein_id gnl|my_center|LOCUS_25380 >Feature sequence242 2680 1403 gene locus_tag LOCUS_25390 2680 1403 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226140.1 protein_id gnl|my_center|LOCUS_25390 3792 3010 gene locus_tag LOCUS_25400 3792 3010 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803832.1 protein_id gnl|my_center|LOCUS_25400 4177 4641 gene locus_tag LOCUS_25410 gene cynS 4177 4641 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896757.1 protein_id gnl|my_center|LOCUS_25410 6007 4979 gene locus_tag LOCUS_25420 6007 4979 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804303.1 protein_id gnl|my_center|LOCUS_25420 >Feature sequence243 291 1214 gene locus_tag LOCUS_25430 gene ehuB 291 1214 CDS product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878311.1 protein_id gnl|my_center|LOCUS_25430 1222 1947 gene locus_tag LOCUS_25440 gene ehuC 1222 1947 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525889.1 protein_id gnl|my_center|LOCUS_25440 1944 2585 gene locus_tag LOCUS_25450 gene ehuD 1944 2585 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729151.1 protein_id gnl|my_center|LOCUS_25450 2572 3396 gene locus_tag LOCUS_25460 gene ehuA 2572 3396 CDS product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896768.1 protein_id gnl|my_center|LOCUS_25460 3696 4637 gene locus_tag LOCUS_25470 3696 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 4675 5139 gene locus_tag LOCUS_25480 4675 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 5201 5989 gene locus_tag LOCUS_25490 5201 5989 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973759.1 protein_id gnl|my_center|LOCUS_25490 6350 5994 gene locus_tag LOCUS_25500 6350 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence244 1955 897 gene locus_tag LOCUS_25510 1955 897 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030290.1 protein_id gnl|my_center|LOCUS_25510 4204 2615 gene locus_tag LOCUS_25520 gene serA 4204 2615 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_25520 5432 4437 gene locus_tag LOCUS_25530 gene ilvC 5432 4437 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973482.1 protein_id gnl|my_center|LOCUS_25530 6035 5511 gene locus_tag LOCUS_25540 gene ilvN 6035 5511 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_25540 6494 6054 gene locus_tag LOCUS_25550 6494 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 >Feature sequence245 3597 397 gene locus_tag LOCUS_25560 gene ileS 3597 397 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_25560 4315 4695 gene locus_tag LOCUS_25570 4315 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25570 4701 5288 gene locus_tag LOCUS_25580 gene lspA 4701 5288 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407722.1 protein_id gnl|my_center|LOCUS_25580 5285 6211 gene locus_tag LOCUS_25590 5285 6211 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976742.1 protein_id gnl|my_center|LOCUS_25590 >Feature sequence246 651 1688 gene locus_tag LOCUS_25600 651 1688 CDS product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223417.1 protein_id gnl|my_center|LOCUS_25600 1704 2981 gene locus_tag LOCUS_25610 1704 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 3162 3665 gene locus_tag LOCUS_25620 3162 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 4101 5171 gene locus_tag LOCUS_25630 4101 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 6022 5573 gene locus_tag LOCUS_25640 gene soxR 6022 5573 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977128.1 protein_id gnl|my_center|LOCUS_25640 >Feature sequence247 455 1162 gene locus_tag LOCUS_25650 455 1162 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225546.1 protein_id gnl|my_center|LOCUS_25650 1167 2615 gene locus_tag LOCUS_25660 1167 2615 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225545.1 protein_id gnl|my_center|LOCUS_25660 3834 2767 gene locus_tag LOCUS_25670 3834 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25670 4648 4361 gene locus_tag LOCUS_25680 4648 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 4568 5116 gene locus_tag LOCUS_25690 4568 5116 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247814.1 protein_id gnl|my_center|LOCUS_25690 <6376 5177 gene locus_tag LOCUS_25700 <6376 5177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973277.1:SpoIIE family protein phosphatase >Feature sequence248 1055 426 gene locus_tag LOCUS_25710 1055 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 2562 1366 gene locus_tag LOCUS_25720 2562 1366 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876734.1 protein_id gnl|my_center|LOCUS_25720 2830 4641 gene locus_tag LOCUS_25730 gene edd 2830 4641 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284323.1 protein_id gnl|my_center|LOCUS_25730 4747 5379 gene locus_tag LOCUS_25740 gene eda 4747 5379 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_25740 6197 5988 gene locus_tag LOCUS_25750 6197 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 >Feature sequence249 1065 1745 gene locus_tag LOCUS_25760 gene mtrA 1065 1745 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_25760 1763 3541 gene locus_tag LOCUS_25770 gene mtrB 1763 3541 CDS product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028715.1 protein_id gnl|my_center|LOCUS_25770 3538 5412 gene locus_tag LOCUS_25780 3538 5412 CDS product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028714.1 protein_id gnl|my_center|LOCUS_25780 5689 6228 gene locus_tag LOCUS_25790 5689 6228 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054881065.1 protein_id gnl|my_center|LOCUS_25790 >Feature sequence250 <1 923 gene locus_tag LOCUS_25800 <1 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976982.1:ABC-F family ATP-binding cassette domain-containing protein 1042 1245 gene locus_tag LOCUS_25810 1042 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 1312 2148 gene locus_tag LOCUS_25820 1312 2148 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028003.1 protein_id gnl|my_center|LOCUS_25820 2475 3995 gene locus_tag LOCUS_25830 2475 3995 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973100.1 protein_id gnl|my_center|LOCUS_25830 4166 5746 gene locus_tag LOCUS_25840 4166 5746 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346373.1 protein_id gnl|my_center|LOCUS_25840 >Feature sequence251 469 1443 gene locus_tag LOCUS_25850 469 1443 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223488.1 protein_id gnl|my_center|LOCUS_25850 1440 2264 gene locus_tag LOCUS_25860 1440 2264 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223487.1 protein_id gnl|my_center|LOCUS_25860 2261 2668 gene locus_tag LOCUS_25870 2261 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223486.1 protein_id gnl|my_center|LOCUS_25870 2665 4317 gene locus_tag LOCUS_25880 2665 4317 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223485.1 protein_id gnl|my_center|LOCUS_25880 5367 4387 gene locus_tag LOCUS_25890 5367 4387 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094369.1 protein_id gnl|my_center|LOCUS_25890 >Feature sequence252 651 578 gene locus_tag LOCUS_t00450 651 578 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 881 1471 gene locus_tag LOCUS_25900 gene dcd 881 1471 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_25900 1883 2902 gene locus_tag LOCUS_25910 1883 2902 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977205.1 protein_id gnl|my_center|LOCUS_25910 2899 4134 gene locus_tag LOCUS_25920 2899 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 4175 5191 gene locus_tag LOCUS_25930 4175 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 5885 5298 gene locus_tag LOCUS_25940 5885 5298 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_25940 >Feature sequence253 1919 357 gene locus_tag LOCUS_25950 1919 357 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450066.1 protein_id gnl|my_center|LOCUS_25950 2616 2293 gene locus_tag LOCUS_25960 2616 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 3859 3014 gene locus_tag LOCUS_25970 3859 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 5118 3937 gene locus_tag LOCUS_25980 5118 3937 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029853.1 protein_id gnl|my_center|LOCUS_25980 >Feature sequence254 376 2382 gene locus_tag LOCUS_25990 376 2382 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229470.1 protein_id gnl|my_center|LOCUS_25990 2940 2416 gene locus_tag LOCUS_26000 2940 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 3564 3220 gene locus_tag LOCUS_26010 3564 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729701.1 protein_id gnl|my_center|LOCUS_26010 3783 5336 gene locus_tag LOCUS_26020 3783 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 6135 5344 gene locus_tag LOCUS_26030 6135 5344 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873288.1 protein_id gnl|my_center|LOCUS_26030 >Feature sequence255 <1 863 gene locus_tag LOCUS_26040 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224839.1:fumarylacetoacetase 1022 1942 gene locus_tag LOCUS_26050 1022 1942 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898125.1 protein_id gnl|my_center|LOCUS_26050 2280 3116 gene locus_tag LOCUS_26060 2280 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 4068 3133 gene locus_tag LOCUS_26070 4068 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 4426 4130 gene locus_tag LOCUS_26080 4426 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 >Feature sequence256 5499 2413 gene locus_tag LOCUS_26090 5499 2413 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013860.1 protein_id gnl|my_center|LOCUS_26090 >Feature sequence257 2321 96 gene locus_tag LOCUS_26100 2321 96 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_26100 3238 2318 gene locus_tag LOCUS_26110 3238 2318 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229761.1 protein_id gnl|my_center|LOCUS_26110 4241 3231 gene locus_tag LOCUS_26120 4241 3231 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229762.1 protein_id gnl|my_center|LOCUS_26120 6028 4322 gene locus_tag LOCUS_26130 6028 4322 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283994.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence258 1688 1176 gene locus_tag LOCUS_26140 1688 1176 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223812.1 protein_id gnl|my_center|LOCUS_26140 2548 1679 gene locus_tag LOCUS_26150 2548 1679 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226422.1 protein_id gnl|my_center|LOCUS_26150 2756 4333 gene locus_tag LOCUS_26160 2756 4333 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030705.1 protein_id gnl|my_center|LOCUS_26160 4480 5877 gene locus_tag LOCUS_26170 4480 5877 CDS product IS1380-like element ISMsm12 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729574.1 protein_id gnl|my_center|LOCUS_26170 6053 6223 gene locus_tag LOCUS_26180 6053 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 >Feature sequence259 2228 1545 gene locus_tag LOCUS_26190 2228 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 3717 2269 gene locus_tag LOCUS_26200 3717 2269 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028498.1 protein_id gnl|my_center|LOCUS_26200 5894 3735 gene locus_tag LOCUS_26210 5894 3735 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014868643.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26210 >Feature sequence260 2556 340 gene locus_tag LOCUS_26220 2556 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 2716 2501 gene locus_tag LOCUS_26230 2716 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 3816 2713 gene locus_tag LOCUS_26240 3816 2713 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730368.1 protein_id gnl|my_center|LOCUS_26240 4010 4903 gene locus_tag LOCUS_26250 gene rsmA 4010 4903 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_26250 5124 4900 gene locus_tag LOCUS_26260 5124 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 6259 5105 gene locus_tag LOCUS_26270 6259 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 >Feature sequence261 58 822 gene locus_tag LOCUS_26280 58 822 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_26280 874 1806 gene locus_tag LOCUS_26290 gene cysD 874 1806 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060060.1 protein_id gnl|my_center|LOCUS_26290 1916 3184 gene locus_tag LOCUS_26300 1916 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 3617 4777 gene locus_tag LOCUS_26310 3617 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 6158 4932 gene locus_tag LOCUS_26320 6158 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 >Feature sequence262 741 121 gene locus_tag LOCUS_26330 741 121 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975539.1 protein_id gnl|my_center|LOCUS_26330 1862 738 gene locus_tag LOCUS_26340 1862 738 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975538.1 protein_id gnl|my_center|LOCUS_26340 2092 2760 gene locus_tag LOCUS_26350 2092 2760 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228658.1 protein_id gnl|my_center|LOCUS_26350 3203 5314 gene locus_tag LOCUS_26360 3203 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 >Feature sequence263 <1 837 gene locus_tag LOCUS_26370 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005113321.1:alpha-ketoacid dehydrogenase subunit beta 834 2150 gene locus_tag LOCUS_26380 834 2150 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113320.1 protein_id gnl|my_center|LOCUS_26380 2648 2193 gene locus_tag LOCUS_26390 2648 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 4737 2701 gene locus_tag LOCUS_26400 gene paaZ 4737 2701 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113323.1 protein_id gnl|my_center|LOCUS_26400 5372 4854 gene locus_tag LOCUS_26410 5372 4854 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_26410 >Feature sequence264 915 130 gene locus_tag LOCUS_26420 915 130 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895306.1 protein_id gnl|my_center|LOCUS_26420 857 1048 gene locus_tag LOCUS_26430 857 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 2019 1135 gene locus_tag LOCUS_26440 2019 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 2169 2020 gene locus_tag LOCUS_26450 2169 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 2273 3043 gene locus_tag LOCUS_26460 2273 3043 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112245808.1 protein_id gnl|my_center|LOCUS_26460 4200 3052 gene locus_tag LOCUS_26470 4200 3052 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027782.1 protein_id gnl|my_center|LOCUS_26470 4578 5894 gene locus_tag LOCUS_26480 4578 5894 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223283.1 protein_id gnl|my_center|LOCUS_26480 6129 5884 gene locus_tag LOCUS_26490 6129 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 >Feature sequence265 100 606 gene locus_tag LOCUS_26500 100 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 749 1552 gene locus_tag LOCUS_26510 749 1552 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088003.1 protein_id gnl|my_center|LOCUS_26510 1560 2843 gene locus_tag LOCUS_26520 1560 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 2933 3265 gene locus_tag LOCUS_26530 gene mhuD 2933 3265 CDS product mycobilin-forming heme oxygenase MhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065009.1 protein_id gnl|my_center|LOCUS_26530 3491 4483 gene locus_tag LOCUS_26540 3491 4483 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860401.1 protein_id gnl|my_center|LOCUS_26540 4591 5469 gene locus_tag LOCUS_26550 4591 5469 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764781.1 protein_id gnl|my_center|LOCUS_26550 <6104 5583 gene locus_tag LOCUS_26560 <6104 5583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804020.1:BCCT family transporter >Feature sequence266 336 1271 gene locus_tag LOCUS_26570 336 1271 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726832.1 protein_id gnl|my_center|LOCUS_26570 1268 1804 gene locus_tag LOCUS_26580 1268 1804 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179664825.1 protein_id gnl|my_center|LOCUS_26580 2303 1794 gene locus_tag LOCUS_26590 2303 1794 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971034.1 protein_id gnl|my_center|LOCUS_26590 2544 3914 gene locus_tag LOCUS_26600 gene proP 2544 3914 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028291.1 protein_id gnl|my_center|LOCUS_26600 5351 3927 gene locus_tag LOCUS_26610 gene der 5351 3927 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_26610 <6071 5450 gene locus_tag LOCUS_26620 <6071 5450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027958.1:(d)CMP kinase >Feature sequence267 1802 69 gene locus_tag LOCUS_26630 1802 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 2904 1879 gene locus_tag LOCUS_26640 gene cydB 2904 1879 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227295.1 protein_id gnl|my_center|LOCUS_26640 4365 2920 gene locus_tag LOCUS_26650 4365 2920 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227294.1 protein_id gnl|my_center|LOCUS_26650 5014 4544 gene locus_tag LOCUS_26660 5014 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 5303 5070 gene locus_tag LOCUS_26670 5303 5070 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 protein_id gnl|my_center|LOCUS_26670 >Feature sequence268 237 1061 gene locus_tag LOCUS_26680 237 1061 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728902.1 protein_id gnl|my_center|LOCUS_26680 2016 1354 gene locus_tag LOCUS_26690 2016 1354 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228133.1 protein_id gnl|my_center|LOCUS_26690 3296 2013 gene locus_tag LOCUS_26700 3296 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 3844 5034 gene locus_tag LOCUS_26710 3844 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 5198 5515 gene locus_tag LOCUS_26720 5198 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 5463 5882 gene locus_tag LOCUS_26730 5463 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 >Feature sequence269 1064 576 gene locus_tag LOCUS_26740 gene coaD 1064 576 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_26740 1742 1164 gene locus_tag LOCUS_26750 gene rsmD 1742 1164 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030310.1 protein_id gnl|my_center|LOCUS_26750 4030 1799 gene locus_tag LOCUS_26760 gene recG 4030 1799 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973428.1 protein_id gnl|my_center|LOCUS_26760 4374 4568 gene locus_tag LOCUS_26770 gene rpmB 4374 4568 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_26770 5346 4702 gene locus_tag LOCUS_26780 5346 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 <6036 5470 gene locus_tag LOCUS_26790 <6036 5470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223640.1:thiamine-phosphate kinase >Feature sequence270 987 160 gene locus_tag LOCUS_26800 987 160 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194445.1 protein_id gnl|my_center|LOCUS_26800 2269 1004 gene locus_tag LOCUS_26810 2269 1004 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028234.1 protein_id gnl|my_center|LOCUS_26810 2555 2349 gene locus_tag LOCUS_26820 gene mbtH 2555 2349 CDS product mycobactin NRPS accessory protein MbtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412265.1 protein_id gnl|my_center|LOCUS_26820 2805 2566 gene locus_tag LOCUS_26830 2805 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 3833 2832 gene locus_tag LOCUS_26840 3833 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 <6018 3897 gene locus_tag LOCUS_26850 <6018 3897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726611.1:non-ribosomal peptide synthetase >Feature sequence271 764 1234 gene locus_tag LOCUS_26860 764 1234 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977815.1 protein_id gnl|my_center|LOCUS_26860 1548 1297 gene locus_tag LOCUS_26870 1548 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 2596 1745 gene locus_tag LOCUS_26880 2596 1745 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110164.1 protein_id gnl|my_center|LOCUS_26880 3434 2715 gene locus_tag LOCUS_26890 3434 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 4458 3574 gene locus_tag LOCUS_26900 4458 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 >Feature sequence272 1002 1241 gene locus_tag LOCUS_26910 1002 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 1310 2113 gene locus_tag LOCUS_26920 1310 2113 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972642.1 protein_id gnl|my_center|LOCUS_26920 2110 2598 gene locus_tag LOCUS_26930 2110 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 3880 2726 gene locus_tag LOCUS_26940 3880 2726 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080817.1 protein_id gnl|my_center|LOCUS_26940 4005 4685 gene locus_tag LOCUS_26950 4005 4685 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972504.1 protein_id gnl|my_center|LOCUS_26950 >Feature sequence273 1838 360 gene locus_tag LOCUS_26960 1838 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 3442 1835 gene locus_tag LOCUS_26970 3442 1835 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974086.1 protein_id gnl|my_center|LOCUS_26970 4672 3623 gene locus_tag LOCUS_26980 4672 3623 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029926.1 protein_id gnl|my_center|LOCUS_26980 5689 4985 gene locus_tag LOCUS_26990 5689 4985 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971721.1 protein_id gnl|my_center|LOCUS_26990 >Feature sequence274 473 1264 gene locus_tag LOCUS_27000 473 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 1512 2666 gene locus_tag LOCUS_27010 1512 2666 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403248.1 protein_id gnl|my_center|LOCUS_27010 3248 2715 gene locus_tag LOCUS_27020 3248 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 3879 3379 gene locus_tag LOCUS_27030 gene greA 3879 3379 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974011.1 protein_id gnl|my_center|LOCUS_27030 4463 4023 gene locus_tag LOCUS_27040 4463 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 4625 5503 gene locus_tag LOCUS_27050 gene mca 4625 5503 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 protein_id gnl|my_center|LOCUS_27050 5500 5862 gene locus_tag LOCUS_27060 5500 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 >Feature sequence275 <1 3343 gene locus_tag LOCUS_27070 <1 3343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030426.1:type VII secretion protein EccC 4719 3367 gene locus_tag LOCUS_27080 4719 3367 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104429.1 protein_id gnl|my_center|LOCUS_27080 4643 4813 gene locus_tag LOCUS_27090 4643 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 >Feature sequence276 506 784 gene locus_tag LOCUS_27100 506 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 1312 1001 gene locus_tag LOCUS_27110 1312 1001 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993510.1 protein_id gnl|my_center|LOCUS_27110 3055 1811 gene locus_tag LOCUS_27120 3055 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 3705 3052 gene locus_tag LOCUS_27130 3705 3052 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 protein_id gnl|my_center|LOCUS_27130 4407 4571 gene locus_tag LOCUS_27140 4407 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 5484 4672 gene locus_tag LOCUS_27150 5484 4672 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153505920.1 protein_id gnl|my_center|LOCUS_27150 >Feature sequence277 952 245 gene locus_tag LOCUS_27160 gene pyrF 952 245 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391171.1 protein_id gnl|my_center|LOCUS_27160 2174 1266 gene locus_tag LOCUS_27170 2174 1266 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_27170 3107 2244 gene locus_tag LOCUS_27180 3107 2244 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_27180 <5903 3282 gene locus_tag LOCUS_27190 <5903 3282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977343.1:carbamoyl-phosphate synthase large subunit >Feature sequence278 <1 862 gene locus_tag LOCUS_27200 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204892.1:DISARM system helicase DrmA 862 2733 gene locus_tag LOCUS_27210 862 2733 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204893.1 protein_id gnl|my_center|LOCUS_27210 2730 3533 gene locus_tag LOCUS_27220 2730 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 5533 3725 gene locus_tag LOCUS_27230 5533 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 >Feature sequence279 1331 1474 gene locus_tag LOCUS_27240 gene rpmH 1331 1474 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400206.1 protein_id gnl|my_center|LOCUS_27240 1564 2001 gene locus_tag LOCUS_27250 gene rnpA 1564 2001 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029288.1 protein_id gnl|my_center|LOCUS_27250 1998 2360 gene locus_tag LOCUS_27260 1998 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 2389 3312 gene locus_tag LOCUS_27270 2389 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 3590 4075 gene locus_tag LOCUS_27280 3590 4075 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029290.1 protein_id gnl|my_center|LOCUS_27280 4363 5076 gene locus_tag LOCUS_27290 gene rsmG 4363 5076 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029291.1 protein_id gnl|my_center|LOCUS_27290 >Feature sequence280 3314 327 gene locus_tag LOCUS_27300 3314 327 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911743.1 protein_id gnl|my_center|LOCUS_27300 4790 3393 gene locus_tag LOCUS_27310 4790 3393 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027778.1 protein_id gnl|my_center|LOCUS_27310 5606 4797 gene locus_tag LOCUS_27320 5606 4797 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_27320 >Feature sequence281 1410 436 gene locus_tag LOCUS_27330 1410 436 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867187.1 protein_id gnl|my_center|LOCUS_27330 1531 2046 gene locus_tag LOCUS_27340 1531 2046 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112798.1 protein_id gnl|my_center|LOCUS_27340 2394 3284 gene locus_tag LOCUS_27350 2394 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 4344 3331 gene locus_tag LOCUS_27360 4344 3331 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715519.1 protein_id gnl|my_center|LOCUS_27360 4478 4861 gene locus_tag LOCUS_27370 4478 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 <5842 4904 gene locus_tag LOCUS_27380 <5842 4904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256062.1:DUF4097 family beta strand repeat-containing protein >Feature sequence282 1211 342 gene locus_tag LOCUS_27390 1211 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 2667 1579 gene locus_tag LOCUS_27400 gene lgt 2667 1579 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976782.1 protein_id gnl|my_center|LOCUS_27400 3723 2740 gene locus_tag LOCUS_27410 3723 2740 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715374.1 protein_id gnl|my_center|LOCUS_27410 4334 3786 gene locus_tag LOCUS_27420 4334 3786 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 protein_id gnl|my_center|LOCUS_27420 5427 4615 gene locus_tag LOCUS_27430 gene trpA 5427 4615 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075867.1 protein_id gnl|my_center|LOCUS_27430 >Feature sequence283 330 920 gene locus_tag LOCUS_27440 gene thpR 330 920 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029587.1 protein_id gnl|my_center|LOCUS_27440 1690 1025 gene locus_tag LOCUS_27450 1690 1025 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730656.1 protein_id gnl|my_center|LOCUS_27450 1848 2912 gene locus_tag LOCUS_27460 1848 2912 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114660815.1 protein_id gnl|my_center|LOCUS_27460 3939 2935 gene locus_tag LOCUS_27470 3939 2935 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102904.1 protein_id gnl|my_center|LOCUS_27470 5241 4102 gene locus_tag LOCUS_27480 gene serC 5241 4102 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029607.1 protein_id gnl|my_center|LOCUS_27480 >Feature sequence284 >Feature sequence285 <1 679 gene locus_tag LOCUS_27490 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742149.1:HEAT repeat domain-containing protein 673 1695 gene locus_tag LOCUS_27500 673 1695 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226641.1 protein_id gnl|my_center|LOCUS_27500 1871 2782 gene locus_tag LOCUS_27510 1871 2782 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226336.1 protein_id gnl|my_center|LOCUS_27510 3911 2943 gene locus_tag LOCUS_27520 3911 2943 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224202.1 protein_id gnl|my_center|LOCUS_27520 >Feature sequence286 2175 238 gene locus_tag LOCUS_27530 gene gyrB 2175 238 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116174448.1 protein_id gnl|my_center|LOCUS_27530 2770 2486 gene locus_tag LOCUS_27540 2770 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 4178 3042 gene locus_tag LOCUS_27550 gene recF 4178 3042 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_27550 5199 4294 gene locus_tag LOCUS_27560 gene gnd 5199 4294 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221957.1 protein_id gnl|my_center|LOCUS_27560 >Feature sequence287 <1 1106 gene locus_tag LOCUS_27570 <1 1106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010908823.1:transglycosylase/D,D-transpeptidase PonA2 1287 2075 gene locus_tag LOCUS_27580 1287 2075 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_27580 2392 4608 gene locus_tag LOCUS_27590 2392 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 >Feature sequence288 354 1280 gene locus_tag LOCUS_27600 354 1280 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_27600 1280 2146 gene locus_tag LOCUS_27610 1280 2146 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328129.1 protein_id gnl|my_center|LOCUS_27610 2143 3228 gene locus_tag LOCUS_27620 2143 3228 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966043.1 protein_id gnl|my_center|LOCUS_27620 3197 4219 gene locus_tag LOCUS_27630 3197 4219 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229920.1 protein_id gnl|my_center|LOCUS_27630 5300 4281 gene locus_tag LOCUS_27640 5300 4281 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969792.1 protein_id gnl|my_center|LOCUS_27640 >Feature sequence289 1121 195 gene locus_tag LOCUS_27650 1121 195 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775838.1 protein_id gnl|my_center|LOCUS_27650 1182 2252 gene locus_tag LOCUS_27660 1182 2252 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929959.1 protein_id gnl|my_center|LOCUS_27660 2552 3574 gene locus_tag LOCUS_27670 2552 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 3909 4586 gene locus_tag LOCUS_27680 3909 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 4821 5522 gene locus_tag LOCUS_27690 4821 5522 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403371.1 protein_id gnl|my_center|LOCUS_27690 >Feature sequence290 <1 539 gene locus_tag LOCUS_27700 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004541610.1:biotin-dependent carboxyltransferase family protein 631 867 gene locus_tag LOCUS_27710 631 867 CDS product acetyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187650.1 protein_id gnl|my_center|LOCUS_27710 938 2326 gene locus_tag LOCUS_27720 938 2326 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188081.1 protein_id gnl|my_center|LOCUS_27720 2973 2323 gene locus_tag LOCUS_27730 2973 2323 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086779.1 protein_id gnl|my_center|LOCUS_27730 3311 2970 gene locus_tag LOCUS_27740 3311 2970 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079340.1 protein_id gnl|my_center|LOCUS_27740 3397 3897 gene locus_tag LOCUS_27750 3397 3897 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027329.1 protein_id gnl|my_center|LOCUS_27750 4631 3957 gene locus_tag LOCUS_27760 4631 3957 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_27760 5384 5130 gene locus_tag LOCUS_27770 5384 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 >Feature sequence291 826 164 gene locus_tag LOCUS_27780 826 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 2413 1184 gene locus_tag LOCUS_27790 2413 1184 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_27790 3900 2581 gene locus_tag LOCUS_27800 3900 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 4237 5535 gene locus_tag LOCUS_27810 gene aceA 4237 5535 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223536.1 protein_id gnl|my_center|LOCUS_27810 >Feature sequence292 2 1852 gene locus_tag LOCUS_27820 2 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 2208 3311 gene locus_tag LOCUS_27830 2208 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 3354 4607 gene locus_tag LOCUS_27840 3354 4607 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028369.1 protein_id gnl|my_center|LOCUS_27840 4925 5137 gene locus_tag LOCUS_27850 4925 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 >Feature sequence293 235 870 gene locus_tag LOCUS_27860 235 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 1912 941 gene locus_tag LOCUS_27870 1912 941 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467730.1 protein_id gnl|my_center|LOCUS_27870 2210 2890 gene locus_tag LOCUS_27880 2210 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 3215 4480 gene locus_tag LOCUS_27890 gene xseA 3215 4480 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030027.1 protein_id gnl|my_center|LOCUS_27890 4483 4752 gene locus_tag LOCUS_27900 4483 4752 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229792.1 protein_id gnl|my_center|LOCUS_27900 5346 4780 gene locus_tag LOCUS_27910 5346 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 >Feature sequence294 1 282 gene locus_tag LOCUS_27920 1 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 901 1134 gene locus_tag LOCUS_27930 901 1134 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028968.1 protein_id gnl|my_center|LOCUS_27930 2386 1496 gene locus_tag LOCUS_27940 2386 1496 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_27940 3128 2628 gene locus_tag LOCUS_27950 3128 2628 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028967.1 protein_id gnl|my_center|LOCUS_27950 3396 4154 gene locus_tag LOCUS_27960 gene fabG 3396 4154 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_27960 4241 4843 gene locus_tag LOCUS_27970 4241 4843 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079489.1 protein_id gnl|my_center|LOCUS_27970 <5687 4869 gene locus_tag LOCUS_27980 <5687 4869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_030862198.1:serine hydrolase >Feature sequence295 571 5 gene locus_tag LOCUS_27990 571 5 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803918.1 protein_id gnl|my_center|LOCUS_27990 720 2408 gene locus_tag LOCUS_28000 720 2408 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803919.1 protein_id gnl|my_center|LOCUS_28000 3580 2345 gene locus_tag LOCUS_28010 3580 2345 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029253.1 protein_id gnl|my_center|LOCUS_28010 3823 3896 gene locus_tag LOCUS_t00460 3823 3896 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3936 4008 gene locus_tag LOCUS_t00470 3936 4008 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4020 4094 gene locus_tag LOCUS_t00480 4020 4094 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5281 4370 gene locus_tag LOCUS_28020 5281 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28020 5598 5278 gene locus_tag LOCUS_28030 5598 5278 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899493.1 protein_id gnl|my_center|LOCUS_28030 >Feature sequence296 829 116 gene locus_tag LOCUS_28040 829 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 1317 2441 gene locus_tag LOCUS_28050 1317 2441 CDS product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729758.1 protein_id gnl|my_center|LOCUS_28050 2916 2512 gene locus_tag LOCUS_28060 2916 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 3864 3097 gene locus_tag LOCUS_28070 3864 3097 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249291.1 protein_id gnl|my_center|LOCUS_28070 4175 4846 gene locus_tag LOCUS_28080 4175 4846 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230956.1 protein_id gnl|my_center|LOCUS_28080 >Feature sequence297 2208 532 gene locus_tag LOCUS_28090 gene lnt 2208 532 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027519.1 protein_id gnl|my_center|LOCUS_28090 2836 4050 gene locus_tag LOCUS_28100 2836 4050 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532949.1 protein_id gnl|my_center|LOCUS_28100 >Feature sequence298 <1 945 gene locus_tag LOCUS_28110 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937547.1:serine--tRNA ligase 949 1968 gene locus_tag LOCUS_28120 949 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 1965 3029 gene locus_tag LOCUS_28130 1965 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 3041 3496 gene locus_tag LOCUS_28140 3041 3496 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191984393.1 protein_id gnl|my_center|LOCUS_28140 3493 4686 gene locus_tag LOCUS_28150 3493 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 5299 4883 gene locus_tag LOCUS_28160 5299 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 >Feature sequence299 1144 557 gene locus_tag LOCUS_28170 1144 557 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229589.1 protein_id gnl|my_center|LOCUS_28170 1670 2731 gene locus_tag LOCUS_28180 1670 2731 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230441.1 protein_id gnl|my_center|LOCUS_28180 2728 3558 gene locus_tag LOCUS_28190 2728 3558 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230442.1 protein_id gnl|my_center|LOCUS_28190 3911 4531 gene locus_tag LOCUS_28200 3911 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 >Feature sequence300 1871 1407 gene locus_tag LOCUS_28210 gene smpB 1871 1407 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_28210 2851 1940 gene locus_tag LOCUS_28220 gene ftsX 2851 1940 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975844.1 protein_id gnl|my_center|LOCUS_28220 3623 2934 gene locus_tag LOCUS_28230 gene ftsE 3623 2934 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_28230 5142 4036 gene locus_tag LOCUS_28240 gene prfB 5142 4036 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975840.1 protein_id gnl|my_center|LOCUS_28240 5607 5236 gene locus_tag LOCUS_28250 5607 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 >Feature sequence301 274 549 gene locus_tag LOCUS_28260 274 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 670 1593 gene locus_tag LOCUS_28270 670 1593 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892776.1 protein_id gnl|my_center|LOCUS_28270 1590 3197 gene locus_tag LOCUS_28280 1590 3197 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941764.1 protein_id gnl|my_center|LOCUS_28280 3313 3903 gene locus_tag LOCUS_28290 3313 3903 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224350.1 protein_id gnl|my_center|LOCUS_28290 4482 3913 gene locus_tag LOCUS_28300 4482 3913 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413588.1 protein_id gnl|my_center|LOCUS_28300 4919 4575 gene locus_tag LOCUS_28310 4919 4575 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727431.1 protein_id gnl|my_center|LOCUS_28310 5050 5538 gene locus_tag LOCUS_28320 5050 5538 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184978408.1 protein_id gnl|my_center|LOCUS_28320 >Feature sequence302 <1 841 gene locus_tag LOCUS_28330 <1 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803805.1:extracellular solute-binding protein 834 1781 gene locus_tag LOCUS_28340 834 1781 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624137.1 protein_id gnl|my_center|LOCUS_28340 1778 2602 gene locus_tag LOCUS_28350 1778 2602 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726998.1 protein_id gnl|my_center|LOCUS_28350 3053 3589 gene locus_tag LOCUS_28360 3053 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 4676 3669 gene locus_tag LOCUS_28370 4676 3669 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014237.1 protein_id gnl|my_center|LOCUS_28370 >Feature sequence303 493 1701 gene locus_tag LOCUS_28380 493 1701 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974180.1 protein_id gnl|my_center|LOCUS_28380 1773 2453 gene locus_tag LOCUS_28390 1773 2453 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029866.1 protein_id gnl|my_center|LOCUS_28390 3398 2463 gene locus_tag LOCUS_28400 3398 2463 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727779.1 protein_id gnl|my_center|LOCUS_28400 >Feature sequence304 465 911 gene locus_tag LOCUS_28410 465 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 1162 980 gene locus_tag LOCUS_28420 1162 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 4587 1324 gene locus_tag LOCUS_28430 4587 1324 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976652.1 protein_id gnl|my_center|LOCUS_28430 >Feature sequence305 <1 3052 gene locus_tag LOCUS_28440 <1 3052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000937974.1:DEAD/DEAH box helicase 3049 5445 gene locus_tag LOCUS_28450 3049 5445 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218177.1 protein_id gnl|my_center|LOCUS_28450 >Feature sequence306 58 133 gene locus_tag LOCUS_t00490 58 133 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 710 462 gene locus_tag LOCUS_28460 710 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 685 1308 gene locus_tag LOCUS_28470 685 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 1301 1501 gene locus_tag LOCUS_28480 1301 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 1923 1615 gene locus_tag LOCUS_28490 1923 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 3952 2363 gene locus_tag LOCUS_28500 3952 2363 CDS product BBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640551.1 protein_id gnl|my_center|LOCUS_28500 4376 4110 gene locus_tag LOCUS_28510 4376 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 <5563 4977 gene locus_tag LOCUS_28520 <5563 4977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729466.1:SMP-30/gluconolactonase/LRE family protein >Feature sequence307 3100 575 gene locus_tag LOCUS_28530 3100 575 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225596.1 protein_id gnl|my_center|LOCUS_28530 3349 4587 gene locus_tag LOCUS_28540 3349 4587 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225591.1 protein_id gnl|my_center|LOCUS_28540 5234 4698 gene locus_tag LOCUS_28550 5234 4698 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972077.1 protein_id gnl|my_center|LOCUS_28550 >Feature sequence308 1613 165 gene locus_tag LOCUS_28560 1613 165 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775793.1 protein_id gnl|my_center|LOCUS_28560 1984 2991 gene locus_tag LOCUS_28570 1984 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 3270 4526 gene locus_tag LOCUS_28580 3270 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 >Feature sequence309 1561 683 gene locus_tag LOCUS_28590 gene sucD 1561 683 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974163.1 protein_id gnl|my_center|LOCUS_28590 2756 1575 gene locus_tag LOCUS_28600 gene sucC 2756 1575 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974164.1 protein_id gnl|my_center|LOCUS_28600 3530 3120 gene locus_tag LOCUS_28610 3530 3120 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_28610 3677 3970 gene locus_tag LOCUS_28620 3677 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 4323 4168 gene locus_tag LOCUS_28630 4323 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 4274 5221 gene locus_tag LOCUS_28640 4274 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 >Feature sequence310 411 1595 gene locus_tag LOCUS_28650 411 1595 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139569.1 protein_id gnl|my_center|LOCUS_28650 1653 2636 gene locus_tag LOCUS_28660 1653 2636 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897409.1 protein_id gnl|my_center|LOCUS_28660 2636 3937 gene locus_tag LOCUS_28670 2636 3937 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223048.1 protein_id gnl|my_center|LOCUS_28670 4988 3984 gene locus_tag LOCUS_28680 4988 3984 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731132.1 protein_id gnl|my_center|LOCUS_28680 >Feature sequence311 <1 1734 gene locus_tag LOCUS_28690 <1 1734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003978196.1:catalase CatB 2762 1938 gene locus_tag LOCUS_28700 2762 1938 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063659.1 protein_id gnl|my_center|LOCUS_28700 2975 3877 gene locus_tag LOCUS_28710 2975 3877 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028109.1 protein_id gnl|my_center|LOCUS_28710 4199 3891 gene locus_tag LOCUS_28720 4199 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 5293 4196 gene locus_tag LOCUS_28730 5293 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 >Feature sequence312 1448 606 gene locus_tag LOCUS_28740 1448 606 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112376.1 protein_id gnl|my_center|LOCUS_28740 1769 2674 gene locus_tag LOCUS_28750 1769 2674 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229868.1 protein_id gnl|my_center|LOCUS_28750 2815 3474 gene locus_tag LOCUS_28760 2815 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 3676 5094 gene locus_tag LOCUS_28770 3676 5094 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_28770 >Feature sequence313 299 1336 gene locus_tag LOCUS_28780 299 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 1342 2523 gene locus_tag LOCUS_28790 1342 2523 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790914.1 protein_id gnl|my_center|LOCUS_28790 2520 4142 gene locus_tag LOCUS_28800 2520 4142 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230735.1 protein_id gnl|my_center|LOCUS_28800 4139 4981 gene locus_tag LOCUS_28810 4139 4981 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230734.1 protein_id gnl|my_center|LOCUS_28810 5352 5050 gene locus_tag LOCUS_28820 5352 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 >Feature sequence314 489 154 gene locus_tag LOCUS_28830 489 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 492 692 gene locus_tag LOCUS_28840 492 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28840 828 1130 gene locus_tag LOCUS_28850 828 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28850 1148 1894 gene locus_tag LOCUS_28860 1148 1894 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031514.1 protein_id gnl|my_center|LOCUS_28860 2216 1881 gene locus_tag LOCUS_28870 2216 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 2596 3237 gene locus_tag LOCUS_28880 2596 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28880 3821 3255 gene locus_tag LOCUS_28890 3821 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 4698 4267 gene locus_tag LOCUS_28900 4698 4267 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974764.1 protein_id gnl|my_center|LOCUS_28900 >Feature sequence315 2576 861 gene locus_tag LOCUS_28910 gene menD 2576 861 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466562.1 protein_id gnl|my_center|LOCUS_28910 3654 2683 gene locus_tag LOCUS_28920 3654 2683 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230276.1 protein_id gnl|my_center|LOCUS_28920 4493 3654 gene locus_tag LOCUS_28930 gene menB 4493 3654 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963885.1 protein_id gnl|my_center|LOCUS_28930 >Feature sequence316 146 487 gene locus_tag LOCUS_28940 146 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 629 1174 gene locus_tag LOCUS_28950 629 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 1359 1829 gene locus_tag LOCUS_28960 1359 1829 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_28960 2247 2747 gene locus_tag LOCUS_28970 2247 2747 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805153.1 protein_id gnl|my_center|LOCUS_28970 2801 3040 gene locus_tag LOCUS_28980 2801 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 >Feature sequence317 1587 271 gene locus_tag LOCUS_28990 1587 271 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776937.1 protein_id gnl|my_center|LOCUS_28990 2478 1603 gene locus_tag LOCUS_29000 2478 1603 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776935.1 protein_id gnl|my_center|LOCUS_29000 3427 2468 gene locus_tag LOCUS_29010 3427 2468 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776936.1 protein_id gnl|my_center|LOCUS_29010 3854 5173 gene locus_tag LOCUS_29020 3854 5173 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467112.1 protein_id gnl|my_center|LOCUS_29020 >Feature sequence318 1035 325 gene locus_tag LOCUS_29030 1035 325 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977680.1 protein_id gnl|my_center|LOCUS_29030 1277 3118 gene locus_tag LOCUS_29040 1277 3118 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030408.1 protein_id gnl|my_center|LOCUS_29040 3115 4179 gene locus_tag LOCUS_29050 3115 4179 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226493.1 protein_id gnl|my_center|LOCUS_29050 4230 5147 gene locus_tag LOCUS_29060 4230 5147 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973312.1 protein_id gnl|my_center|LOCUS_29060 >Feature sequence319 903 562 gene locus_tag LOCUS_29070 903 562 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226991.1 protein_id gnl|my_center|LOCUS_29070 972 1505 gene locus_tag LOCUS_29080 gene pyrE 972 1505 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029143.1 protein_id gnl|my_center|LOCUS_29080 2140 1757 gene locus_tag LOCUS_29090 2140 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 2436 3458 gene locus_tag LOCUS_29100 gene fbaA 2436 3458 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029142.1 protein_id gnl|my_center|LOCUS_29100 3641 4057 gene locus_tag LOCUS_29110 3641 4057 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 protein_id gnl|my_center|LOCUS_29110 >Feature sequence320 3523 2843 gene locus_tag LOCUS_29120 3523 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 4734 3520 gene locus_tag LOCUS_29130 4734 3520 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141151.1 protein_id gnl|my_center|LOCUS_29130 5163 4936 gene locus_tag LOCUS_29140 5163 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 >Feature sequence321 1579 5163 gene locus_tag LOCUS_29150 gene mfd 1579 5163 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_29150 >Feature sequence322 1181 1813 gene locus_tag LOCUS_29160 1181 1813 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027777.1 protein_id gnl|my_center|LOCUS_29160 2052 2282 gene locus_tag LOCUS_29170 2052 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 2293 4053 gene locus_tag LOCUS_29180 2293 4053 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027969.1 protein_id gnl|my_center|LOCUS_29180 4938 4159 gene locus_tag LOCUS_29190 4938 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 >Feature sequence323 228 1766 gene locus_tag LOCUS_29200 228 1766 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141209.1 protein_id gnl|my_center|LOCUS_29200 2855 1836 gene locus_tag LOCUS_29210 2855 1836 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230532.1 protein_id gnl|my_center|LOCUS_29210 3831 2869 gene locus_tag LOCUS_29220 3831 2869 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 protein_id gnl|my_center|LOCUS_29220 4285 4470 gene locus_tag LOCUS_29230 4285 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 4946 5021 gene locus_tag LOCUS_t00500 4946 5021 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5199 5274 gene locus_tag LOCUS_t00510 5199 5274 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence324 1739 3325 gene locus_tag LOCUS_29240 1739 3325 CDS product DUF5719 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028724.1 protein_id gnl|my_center|LOCUS_29240 3707 3363 gene locus_tag LOCUS_29250 3707 3363 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559274.1 protein_id gnl|my_center|LOCUS_29250 >Feature sequence325 <1 543 gene locus_tag LOCUS_29260 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965449.1:carboxyl transferase domain-containing protein 666 1262 gene locus_tag LOCUS_29270 666 1262 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085145692.1 protein_id gnl|my_center|LOCUS_29270 1409 2350 gene locus_tag LOCUS_29280 1409 2350 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087485.1 protein_id gnl|my_center|LOCUS_29280 2347 4044 gene locus_tag LOCUS_29290 2347 4044 CDS product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_29290 4100 4486 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtccatccccgcgtgcgcgg 4892 5091 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cccgcgtgcgcggggctctc >Feature sequence326 1312 308 gene locus_tag LOCUS_29300 1312 308 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223470.1 protein_id gnl|my_center|LOCUS_29300 1944 1420 gene locus_tag LOCUS_29310 1944 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 2869 2009 gene locus_tag LOCUS_29320 2869 2009 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 protein_id gnl|my_center|LOCUS_29320 <5205 3003 gene locus_tag LOCUS_29330 <5205 3003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004116485.1:phosphoenolpyruvate carboxylase >Feature sequence327 77 748 gene locus_tag LOCUS_29340 77 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 >Feature sequence328 731 1066 gene locus_tag LOCUS_29350 731 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 1098 3857 gene locus_tag LOCUS_29360 1098 3857 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406189.1 protein_id gnl|my_center|LOCUS_29360 3887 4345 gene locus_tag LOCUS_29370 3887 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 4460 5005 gene locus_tag LOCUS_29380 4460 5005 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225030.1 protein_id gnl|my_center|LOCUS_29380 >Feature sequence329 >Feature sequence330 1177 65 gene locus_tag LOCUS_29390 1177 65 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972859.1 protein_id gnl|my_center|LOCUS_29390 1148 1471 gene locus_tag LOCUS_29400 1148 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 1933 1352 gene locus_tag LOCUS_29410 1933 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 2798 2052 gene locus_tag LOCUS_29420 2798 2052 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224101.1 protein_id gnl|my_center|LOCUS_29420 2956 3960 gene locus_tag LOCUS_29430 gene nadA 2956 3960 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224102.1 protein_id gnl|my_center|LOCUS_29430 >Feature sequence331 <1 1695 gene locus_tag LOCUS_29440 <1 1695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029237.1:PhoX family protein 3073 1775 gene locus_tag LOCUS_29450 3073 1775 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929999.1 protein_id gnl|my_center|LOCUS_29450 3284 4891 gene locus_tag LOCUS_29460 3284 4891 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193073.1 protein_id gnl|my_center|LOCUS_29460 >Feature sequence332 2225 1608 gene locus_tag LOCUS_29470 2225 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 >Feature sequence333 339 1334 gene locus_tag LOCUS_29480 339 1334 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080068.1 protein_id gnl|my_center|LOCUS_29480 1331 2239 gene locus_tag LOCUS_29490 1331 2239 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080070.1 protein_id gnl|my_center|LOCUS_29490 2239 3195 gene locus_tag LOCUS_29500 2239 3195 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080073.1 protein_id gnl|my_center|LOCUS_29500 3192 4106 gene locus_tag LOCUS_29510 3192 4106 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080075.1 protein_id gnl|my_center|LOCUS_29510 4380 4583 gene locus_tag LOCUS_29520 4380 4583 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891980.1 protein_id gnl|my_center|LOCUS_29520 >Feature sequence334 <1 1459 gene locus_tag LOCUS_29530 <1 1459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933627.1:CRISPR-associated helicase/endonuclease Cas3 1558 3105 gene locus_tag LOCUS_29540 1558 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 3102 3809 gene locus_tag LOCUS_29550 3102 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 3806 4939 gene locus_tag LOCUS_29560 gene cas7e 3806 4939 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 protein_id gnl|my_center|LOCUS_29560 >Feature sequence335 1325 546 gene locus_tag LOCUS_29570 gene pstB 1325 546 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974830.1 protein_id gnl|my_center|LOCUS_29570 2429 1350 gene locus_tag LOCUS_29580 gene pstA 2429 1350 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 protein_id gnl|my_center|LOCUS_29580 3391 2429 gene locus_tag LOCUS_29590 gene pstC 3391 2429 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029460.1 protein_id gnl|my_center|LOCUS_29590 4604 3639 gene locus_tag LOCUS_29600 gene mshD 4604 3639 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_29600 >Feature sequence336 <1 1269 gene locus_tag LOCUS_29610 <1 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727420.1:aconitate hydratase 1552 3069 gene locus_tag LOCUS_29620 1552 3069 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730278.1 protein_id gnl|my_center|LOCUS_29620 3423 4550 gene locus_tag LOCUS_29630 3423 4550 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123665.1 protein_id gnl|my_center|LOCUS_29630 >Feature sequence337 <1 803 gene locus_tag LOCUS_29640 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223039.1:ATP-dependent DNA helicase 890 1837 gene locus_tag LOCUS_29650 gene nudC 890 1837 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 protein_id gnl|my_center|LOCUS_29650 2320 1859 gene locus_tag LOCUS_29660 2320 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 2734 2465 gene locus_tag LOCUS_29670 2734 2465 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 protein_id gnl|my_center|LOCUS_29670 >Feature sequence338 178 1098 gene locus_tag LOCUS_29680 178 1098 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189804125.1 protein_id gnl|my_center|LOCUS_29680 1989 1186 gene locus_tag LOCUS_29690 1989 1186 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 protein_id gnl|my_center|LOCUS_29690 3921 2125 gene locus_tag LOCUS_29700 3921 2125 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726610.1 protein_id gnl|my_center|LOCUS_29700 <4981 3918 gene locus_tag LOCUS_29710 <4981 3918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003891342.1:ABC transporter ATP-binding protein >Feature sequence339 271 729 gene locus_tag LOCUS_29720 271 729 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222264.1 protein_id gnl|my_center|LOCUS_29720 817 1245 gene locus_tag LOCUS_29730 817 1245 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063604.1 protein_id gnl|my_center|LOCUS_29730 1473 1324 gene locus_tag LOCUS_29740 1473 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 2667 1657 gene locus_tag LOCUS_29750 2667 1657 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026954.1 protein_id gnl|my_center|LOCUS_29750 4046 2664 gene locus_tag LOCUS_29760 4046 2664 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014192.1 protein_id gnl|my_center|LOCUS_29760 4861 4301 gene locus_tag LOCUS_29770 4861 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 >Feature sequence340 227 1129 gene locus_tag LOCUS_29780 227 1129 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_29780 1346 1702 gene locus_tag LOCUS_29790 1346 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 1910 2191 gene locus_tag LOCUS_29800 1910 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 2242 2412 gene locus_tag LOCUS_29810 2242 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 2715 3146 gene locus_tag LOCUS_29820 2715 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 3711 3127 gene locus_tag LOCUS_29830 3711 3127 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973778.1 protein_id gnl|my_center|LOCUS_29830 <4972 3713 gene locus_tag LOCUS_29840 <4972 3713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973777.1:zinc-dependent metalloprotease >Feature sequence341 2211 1249 gene locus_tag LOCUS_29850 2211 1249 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227077.1 protein_id gnl|my_center|LOCUS_29850 2445 2984 gene locus_tag LOCUS_29860 2445 2984 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227078.1 protein_id gnl|my_center|LOCUS_29860 3017 4096 gene locus_tag LOCUS_29870 3017 4096 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028020.1 protein_id gnl|my_center|LOCUS_29870 4608 4153 gene locus_tag LOCUS_29880 4608 4153 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_29880 >Feature sequence342 463 1539 gene locus_tag LOCUS_29890 463 1539 CDS product thiopeptide-type bacteriocin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004937.1 protein_id gnl|my_center|LOCUS_29890 1536 2819 gene locus_tag LOCUS_29900 1536 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 2816 3739 gene locus_tag LOCUS_29910 2816 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 3736 4488 gene locus_tag LOCUS_29920 3736 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 4622 4807 gene locus_tag LOCUS_29930 4622 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 >Feature sequence343 235 3270 gene locus_tag LOCUS_29940 235 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029583.1 protein_id gnl|my_center|LOCUS_29940 4884 3316 gene locus_tag LOCUS_29950 4884 3316 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975390.1 protein_id gnl|my_center|LOCUS_29950 >Feature sequence344 1512 310 gene locus_tag LOCUS_29960 1512 310 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860838.1 protein_id gnl|my_center|LOCUS_29960 2088 1777 gene locus_tag LOCUS_29970 2088 1777 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974904.1 protein_id gnl|my_center|LOCUS_29970 2525 2085 gene locus_tag LOCUS_29980 2525 2085 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029408.1 protein_id gnl|my_center|LOCUS_29980 2658 3242 gene locus_tag LOCUS_29990 2658 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 <4946 3333 gene locus_tag LOCUS_30000 <4946 3333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226015.1:biotin carboxylase N-terminal domain-containing protein >Feature sequence345 2192 981 gene locus_tag LOCUS_30010 gene metZ 2192 981 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722742.1 protein_id gnl|my_center|LOCUS_30010 3271 2204 gene locus_tag LOCUS_30020 3271 2204 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_30020 4080 3268 gene locus_tag LOCUS_30030 4080 3268 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_30030 >Feature sequence346 722 141 gene locus_tag LOCUS_30040 722 141 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449652.1 protein_id gnl|my_center|LOCUS_30040 1079 756 gene locus_tag LOCUS_30050 1079 756 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160972.1 protein_id gnl|my_center|LOCUS_30050 1406 2695 gene locus_tag LOCUS_30060 1406 2695 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630264.1 protein_id gnl|my_center|LOCUS_30060 2882 3154 gene locus_tag LOCUS_30070 2882 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 3241 4488 gene locus_tag LOCUS_30080 3241 4488 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896733.1 protein_id gnl|my_center|LOCUS_30080 >Feature sequence347 435 2657 gene locus_tag LOCUS_30090 435 2657 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014908176.1 protein_id gnl|my_center|LOCUS_30090 2644 3084 gene locus_tag LOCUS_30100 2644 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 3316 3720 gene locus_tag LOCUS_30110 3316 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 4430 3726 gene locus_tag LOCUS_30120 4430 3726 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222232.1 protein_id gnl|my_center|LOCUS_30120 4796 4569 gene locus_tag LOCUS_30130 4796 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 >Feature sequence348 846 235 gene locus_tag LOCUS_30140 846 235 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284042.1 protein_id gnl|my_center|LOCUS_30140 1147 2520 gene locus_tag LOCUS_30150 1147 2520 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229897.1 protein_id gnl|my_center|LOCUS_30150 4585 2537 gene locus_tag LOCUS_30160 4585 2537 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_30160 4825 4655 gene locus_tag LOCUS_30170 4825 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 >Feature sequence349 740 1540 gene locus_tag LOCUS_30180 740 1540 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969949.1 protein_id gnl|my_center|LOCUS_30180 1540 2343 gene locus_tag LOCUS_30190 1540 2343 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482930.1 protein_id gnl|my_center|LOCUS_30190 2340 3578 gene locus_tag LOCUS_30200 2340 3578 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530208.1 protein_id gnl|my_center|LOCUS_30200 >Feature sequence350 617 3928 gene locus_tag LOCUS_30210 617 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 4152 4553 gene locus_tag LOCUS_30220 4152 4553 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973453.1 protein_id gnl|my_center|LOCUS_30220 >Feature sequence351 885 220 gene locus_tag LOCUS_30230 885 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 2097 1063 gene locus_tag LOCUS_30240 2097 1063 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027638.1 protein_id gnl|my_center|LOCUS_30240 3727 2270 gene locus_tag LOCUS_30250 3727 2270 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896540.1 protein_id gnl|my_center|LOCUS_30250 4617 3880 gene locus_tag LOCUS_30260 4617 3880 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161798788.1 protein_id gnl|my_center|LOCUS_30260 >Feature sequence352 215 2992 gene locus_tag LOCUS_30270 gene polA 215 2992 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408063.1 protein_id gnl|my_center|LOCUS_30270 3045 3485 gene locus_tag LOCUS_30280 gene arfB 3045 3485 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974697.1 protein_id gnl|my_center|LOCUS_30280 >Feature sequence353 1468 179 gene locus_tag LOCUS_30290 1468 179 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 protein_id gnl|my_center|LOCUS_30290 1649 2668 gene locus_tag LOCUS_30300 1649 2668 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973161.1 protein_id gnl|my_center|LOCUS_30300 >Feature sequence354 <1 973 gene locus_tag LOCUS_30310 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066877119.1:low-specificity L-threonine aldolase 1005 1799 gene locus_tag LOCUS_30320 1005 1799 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226255.1 protein_id gnl|my_center|LOCUS_30320 2069 3562 gene locus_tag LOCUS_30330 gene glpK 2069 3562 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977165.1 protein_id gnl|my_center|LOCUS_30330 3766 4530 gene locus_tag LOCUS_30340 3766 4530 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081684.1 protein_id gnl|my_center|LOCUS_30340 >Feature sequence355 1591 719 gene locus_tag LOCUS_30350 1591 719 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229588.1 protein_id gnl|my_center|LOCUS_30350 3614 1869 gene locus_tag LOCUS_30360 3614 1869 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804193.1 protein_id gnl|my_center|LOCUS_30360 >Feature sequence356 560 1606 gene locus_tag LOCUS_30370 560 1606 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092074.1 protein_id gnl|my_center|LOCUS_30370 1852 2088 gene locus_tag LOCUS_30380 1852 2088 CDS product PTS glucose/sucrose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975905.1 protein_id gnl|my_center|LOCUS_30380 2238 2672 gene locus_tag LOCUS_30390 2238 2672 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224597.1 protein_id gnl|my_center|LOCUS_30390 2783 4453 gene locus_tag LOCUS_30400 2783 4453 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230528.1 protein_id gnl|my_center|LOCUS_30400 >Feature sequence357 1120 1596 gene locus_tag LOCUS_30410 1120 1596 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878769.1 protein_id gnl|my_center|LOCUS_30410 1866 2084 gene locus_tag LOCUS_30420 1866 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 2468 2731 gene locus_tag LOCUS_30430 2468 2731 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230904.1 protein_id gnl|my_center|LOCUS_30430 3681 2755 gene locus_tag LOCUS_30440 3681 2755 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129251257.1 protein_id gnl|my_center|LOCUS_30440 <4619 3768 gene locus_tag LOCUS_30450 <4619 3768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028786.1:galactokinase >Feature sequence358 1612 269 gene locus_tag LOCUS_30460 gene mgtE 1612 269 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803803.1 protein_id gnl|my_center|LOCUS_30460 2994 1891 gene locus_tag LOCUS_30470 2994 1891 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976175.1 protein_id gnl|my_center|LOCUS_30470 3780 3406 gene locus_tag LOCUS_30480 3780 3406 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666673.1 protein_id gnl|my_center|LOCUS_30480 >Feature sequence359 883 2346 gene locus_tag LOCUS_30490 883 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 2343 2498 gene locus_tag LOCUS_30500 2343 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 2951 2538 gene locus_tag LOCUS_30510 2951 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 >Feature sequence360 <1 1217 gene locus_tag LOCUS_30520 <1 1217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005113135.1:substrate-binding domain-containing protein 1532 3286 gene locus_tag LOCUS_30530 1532 3286 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742065.1 protein_id gnl|my_center|LOCUS_30530 >Feature sequence361 795 70 gene locus_tag LOCUS_30540 795 70 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976619.1 protein_id gnl|my_center|LOCUS_30540 1954 1013 gene locus_tag LOCUS_30550 gene lipA 1954 1013 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466774.1 protein_id gnl|my_center|LOCUS_30550 2752 2048 gene locus_tag LOCUS_30560 gene lipB 2752 2048 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976622.1 protein_id gnl|my_center|LOCUS_30560 3623 3066 gene locus_tag LOCUS_30570 3623 3066 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224876.1 protein_id gnl|my_center|LOCUS_30570 <4583 3766 gene locus_tag LOCUS_30580 <4583 3766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005110455.1:2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase >Feature sequence362 159 1130 gene locus_tag LOCUS_30590 159 1130 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086857074.1 protein_id gnl|my_center|LOCUS_30590 1144 1821 gene locus_tag LOCUS_30600 1144 1821 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975684.1 protein_id gnl|my_center|LOCUS_30600 1917 2426 gene locus_tag LOCUS_30610 gene tamR 1917 2426 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_30610 2543 3535 gene locus_tag LOCUS_30620 2543 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 4495 3581 gene locus_tag LOCUS_30630 4495 3581 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111640.1 protein_id gnl|my_center|LOCUS_30630 >Feature sequence363 <1 1017 gene locus_tag LOCUS_30640 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027862.1:alpha-L-arabinofuranosidase C-terminal domain-containing protein 2122 1139 gene locus_tag LOCUS_30650 gene yjfF 2122 1139 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 protein_id gnl|my_center|LOCUS_30650 3141 2119 gene locus_tag LOCUS_30660 3141 2119 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877168.1 protein_id gnl|my_center|LOCUS_30660 <4550 3138 gene locus_tag LOCUS_30670 <4550 3138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467107.1:sugar ABC transporter ATP-binding protein >Feature sequence364 114 821 gene locus_tag LOCUS_30680 114 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 >Feature sequence365 1335 274 gene locus_tag LOCUS_30690 1335 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 2015 1332 gene locus_tag LOCUS_30700 2015 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 2617 2012 gene locus_tag LOCUS_30710 gene sigE 2617 2012 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973830.1 protein_id gnl|my_center|LOCUS_30710 2899 3549 gene locus_tag LOCUS_30720 2899 3549 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222974.1 protein_id gnl|my_center|LOCUS_30720 <4532 3606 gene locus_tag LOCUS_30730 <4532 3606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222970.1:M17 family metallopeptidase >Feature sequence366 722 2002 gene locus_tag LOCUS_30740 722 2002 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_30740 2516 2271 gene locus_tag LOCUS_30750 2516 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 3576 2764 gene locus_tag LOCUS_30760 3576 2764 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894754.1 protein_id gnl|my_center|LOCUS_30760 3689 4348 gene locus_tag LOCUS_30770 gene raaS 3689 4348 CDS product transcriptional regulator RaaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406254.1 protein_id gnl|my_center|LOCUS_30770 >Feature sequence367 180 1 gene locus_tag LOCUS_30780 180 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 408 1265 gene locus_tag LOCUS_30790 408 1265 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_30790 1279 1476 gene locus_tag LOCUS_30800 1279 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 1809 2462 gene locus_tag LOCUS_30810 1809 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 3376 2564 gene locus_tag LOCUS_30820 3376 2564 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733074.1 protein_id gnl|my_center|LOCUS_30820 4340 3393 gene locus_tag LOCUS_30830 4340 3393 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724071.1 protein_id gnl|my_center|LOCUS_30830 >Feature sequence368 <1 859 gene locus_tag LOCUS_30840 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973903.1:NADP-dependent oxidoreductase 940 2286 gene locus_tag LOCUS_30850 940 2286 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298733.1 protein_id gnl|my_center|LOCUS_30850 2321 2971 gene locus_tag LOCUS_30860 2321 2971 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224876.1 protein_id gnl|my_center|LOCUS_30860 >Feature sequence369 835 59 gene locus_tag LOCUS_30870 835 59 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284355.1 protein_id gnl|my_center|LOCUS_30870 1013 1921 gene locus_tag LOCUS_30880 1013 1921 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_30880 2218 3978 gene locus_tag LOCUS_30890 gene arc 2218 3978 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_30890 >Feature sequence370 272 595 gene locus_tag LOCUS_30900 272 595 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405871.1 protein_id gnl|my_center|LOCUS_30900 1691 744 gene locus_tag LOCUS_30910 1691 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 4065 1930 gene locus_tag LOCUS_30920 4065 1930 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218177.1 protein_id gnl|my_center|LOCUS_30920 >Feature sequence371 3 917 gene locus_tag LOCUS_30930 3 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 2024 945 gene locus_tag LOCUS_30940 2024 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 >Feature sequence372 <1 820 gene locus_tag LOCUS_30950 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005767507.1:mandelate racemase/muconate lactonizing enzyme family protein 1102 2805 gene locus_tag LOCUS_30960 1102 2805 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_30960 3735 3466 gene locus_tag LOCUS_30970 3735 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 3971 3732 gene locus_tag LOCUS_30980 3971 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 4426 3971 gene locus_tag LOCUS_30990 4426 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 >Feature sequence373 >Feature sequence374 1019 423 gene locus_tag LOCUS_31000 1019 423 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089008.1 protein_id gnl|my_center|LOCUS_31000 1037 2674 gene locus_tag LOCUS_31010 1037 2674 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729741.1 protein_id gnl|my_center|LOCUS_31010 3419 2694 gene locus_tag LOCUS_31020 3419 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 >Feature sequence375 1296 34 gene locus_tag LOCUS_31030 1296 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028496.1 protein_id gnl|my_center|LOCUS_31030 2195 1485 gene locus_tag LOCUS_31040 2195 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 3684 2422 gene locus_tag LOCUS_31050 3684 2422 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063579.1 protein_id gnl|my_center|LOCUS_31050 >Feature sequence376 784 629 gene locus_tag LOCUS_31060 784 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 1450 824 gene locus_tag LOCUS_31070 1450 824 CDS product Rv2466c family mycothiol-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412664.1 protein_id gnl|my_center|LOCUS_31070 1593 4142 gene locus_tag LOCUS_31080 gene pepN 1593 4142 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228585.1 protein_id gnl|my_center|LOCUS_31080 >Feature sequence377 483 277 gene locus_tag LOCUS_31090 483 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976644.1 protein_id gnl|my_center|LOCUS_31090 686 1678 gene locus_tag LOCUS_31100 686 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 1675 2487 gene locus_tag LOCUS_31110 1675 2487 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028180.1 protein_id gnl|my_center|LOCUS_31110 2822 4327 gene locus_tag LOCUS_31120 2822 4327 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 protein_id gnl|my_center|LOCUS_31120 >Feature sequence378 178 927 gene locus_tag LOCUS_31130 178 927 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 protein_id gnl|my_center|LOCUS_31130 1081 1752 gene locus_tag LOCUS_31140 1081 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 2262 2825 gene locus_tag LOCUS_31150 2262 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 >Feature sequence379 1356 1066 gene locus_tag LOCUS_31160 1356 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 2448 1675 gene locus_tag LOCUS_31170 2448 1675 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326902.1 protein_id gnl|my_center|LOCUS_31170 3504 2833 gene locus_tag LOCUS_31180 3504 2833 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027267.1 protein_id gnl|my_center|LOCUS_31180 >Feature sequence380 3111 10 gene locus_tag LOCUS_31190 3111 10 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223038.1 protein_id gnl|my_center|LOCUS_31190 3580 3230 gene locus_tag LOCUS_31200 3580 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 4086 3718 gene locus_tag LOCUS_31210 4086 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 >Feature sequence381 210 614 gene locus_tag LOCUS_31220 210 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 2023 755 gene locus_tag LOCUS_31230 2023 755 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973528.1 protein_id gnl|my_center|LOCUS_31230 2411 2031 gene locus_tag LOCUS_31240 gene gcvH 2411 2031 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973527.1 protein_id gnl|my_center|LOCUS_31240 3554 2412 gene locus_tag LOCUS_31250 gene gcvT 3554 2412 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973526.1 protein_id gnl|my_center|LOCUS_31250 >Feature sequence382 537 1895 gene locus_tag LOCUS_31260 537 1895 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031641.1 protein_id gnl|my_center|LOCUS_31260 1971 4022 gene locus_tag LOCUS_31270 1971 4022 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031640.1 protein_id gnl|my_center|LOCUS_31270 >Feature sequence383 2605 1568 gene locus_tag LOCUS_31280 2605 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 2926 4023 gene locus_tag LOCUS_31290 2926 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 >Feature sequence384 <1 747 gene locus_tag LOCUS_31300 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167441465.1:isoprenyl transferase 1015 2382 gene locus_tag LOCUS_31310 1015 2382 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973949.1 protein_id gnl|my_center|LOCUS_31310 2479 3081 gene locus_tag LOCUS_31320 2479 3081 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030020.1 protein_id gnl|my_center|LOCUS_31320 >Feature sequence385 <1 1634 gene locus_tag LOCUS_31330 <1 1634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035939.1:CocE/NonD family hydrolase 1747 2790 gene locus_tag LOCUS_31340 1747 2790 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224183.1 protein_id gnl|my_center|LOCUS_31340 >Feature sequence386 1145 561 gene locus_tag LOCUS_31350 1145 561 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028578.1 protein_id gnl|my_center|LOCUS_31350 1286 2911 gene locus_tag LOCUS_31360 1286 2911 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 protein_id gnl|my_center|LOCUS_31360 >Feature sequence387 <1 908 gene locus_tag LOCUS_31370 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030079.1:succinyl-diaminopimelate desuccinylase 1000 1764 gene locus_tag LOCUS_31380 1000 1764 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973837.1 protein_id gnl|my_center|LOCUS_31380 1852 2274 gene locus_tag LOCUS_31390 1852 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 2440 3027 gene locus_tag LOCUS_31400 2440 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 3298 3465 gene locus_tag LOCUS_31410 3298 3465 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406247.1 protein_id gnl|my_center|LOCUS_31410 >Feature sequence388 1277 594 gene locus_tag LOCUS_31420 1277 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 3183 1642 gene locus_tag LOCUS_31430 3183 1642 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726846.1 protein_id gnl|my_center|LOCUS_31430 3971 3180 gene locus_tag LOCUS_31440 3971 3180 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091874.1 protein_id gnl|my_center|LOCUS_31440 >Feature sequence389 644 1342 gene locus_tag LOCUS_31450 644 1342 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977032.1 protein_id gnl|my_center|LOCUS_31450 1381 1785 gene locus_tag LOCUS_31460 1381 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 2799 1816 gene locus_tag LOCUS_31470 2799 1816 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977097.1 protein_id gnl|my_center|LOCUS_31470 3831 2827 gene locus_tag LOCUS_31480 3831 2827 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257434.1 protein_id gnl|my_center|LOCUS_31480 >Feature sequence390 206 1531 gene locus_tag LOCUS_31490 206 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 1545 2432 gene locus_tag LOCUS_31500 1545 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 3069 3305 gene locus_tag LOCUS_31510 3069 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 >Feature sequence391 269 823 gene locus_tag LOCUS_31520 269 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143647548.1 protein_id gnl|my_center|LOCUS_31520 1708 971 gene locus_tag LOCUS_31530 1708 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 2937 1936 gene locus_tag LOCUS_31540 2937 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 3165 3521 gene locus_tag LOCUS_31550 3165 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 3514 4098 gene locus_tag LOCUS_31560 3514 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 >Feature sequence392 1160 234 gene locus_tag LOCUS_31570 1160 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 3094 1856 gene locus_tag LOCUS_31580 gene kynU 3094 1856 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114854.1 protein_id gnl|my_center|LOCUS_31580 4047 3133 gene locus_tag LOCUS_31590 4047 3133 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029139.1 protein_id gnl|my_center|LOCUS_31590 >Feature sequence393 1763 600 gene locus_tag LOCUS_31600 1763 600 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028757.1 protein_id gnl|my_center|LOCUS_31600 2045 3505 gene locus_tag LOCUS_31610 2045 3505 CDS product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031663.1 protein_id gnl|my_center|LOCUS_31610 <4179 3540 gene locus_tag LOCUS_31620 <4179 3540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803883.1:SulP family inorganic anion transporter >Feature sequence394 2039 261 gene locus_tag LOCUS_31630 2039 261 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_31630 3026 2088 gene locus_tag LOCUS_31640 3026 2088 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222582.1 protein_id gnl|my_center|LOCUS_31640 3756 3046 gene locus_tag LOCUS_31650 3756 3046 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224137.1 protein_id gnl|my_center|LOCUS_31650 >Feature sequence395 156 815 gene locus_tag LOCUS_31660 156 815 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020980579.1 protein_id gnl|my_center|LOCUS_31660 910 2055 gene locus_tag LOCUS_31670 910 2055 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977530.1 protein_id gnl|my_center|LOCUS_31670 >Feature sequence396 2095 1403 gene locus_tag LOCUS_31680 2095 1403 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_31680 2499 2254 gene locus_tag LOCUS_31690 2499 2254 CDS product DUF2630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224533.1 protein_id gnl|my_center|LOCUS_31690 2734 3060 gene locus_tag LOCUS_31700 2734 3060 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228661.1 protein_id gnl|my_center|LOCUS_31700 <4154 3175 gene locus_tag LOCUS_31710 <4154 3175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_030866777.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence397 197 730 gene locus_tag LOCUS_31720 197 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 727 1008 gene locus_tag LOCUS_31730 727 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 1181 1444 gene locus_tag LOCUS_31740 1181 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 1447 1881 gene locus_tag LOCUS_31750 1447 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 2051 2884 gene locus_tag LOCUS_31760 2051 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 2884 3270 gene locus_tag LOCUS_31770 2884 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 3740 3579 gene locus_tag LOCUS_31780 3740 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 >Feature sequence398 1143 127 gene locus_tag LOCUS_31790 1143 127 CDS product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929848.1 protein_id gnl|my_center|LOCUS_31790 2172 1297 gene locus_tag LOCUS_31800 2172 1297 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855402.1 protein_id gnl|my_center|LOCUS_31800 3743 2331 gene locus_tag LOCUS_31810 3743 2331 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014277.1 protein_id gnl|my_center|LOCUS_31810 >Feature sequence399 220 912 gene locus_tag LOCUS_31820 220 912 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007447704.1 protein_id gnl|my_center|LOCUS_31820 1174 2547 gene locus_tag LOCUS_31830 1174 2547 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221998.1 protein_id gnl|my_center|LOCUS_31830 >Feature sequence400 2441 369 gene locus_tag LOCUS_31840 2441 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 3204 2584 gene locus_tag LOCUS_31850 3204 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 3569 3384 gene locus_tag LOCUS_31860 3569 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 >Feature sequence401 118 321 gene locus_tag LOCUS_31870 118 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 473 1288 gene locus_tag LOCUS_31880 473 1288 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027753.1 protein_id gnl|my_center|LOCUS_31880 1413 2165 gene locus_tag LOCUS_31890 1413 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228025.1 protein_id gnl|my_center|LOCUS_31890 2185 2850 gene locus_tag LOCUS_31900 2185 2850 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977621.1 protein_id gnl|my_center|LOCUS_31900 >Feature sequence402 368 649 gene locus_tag LOCUS_31910 368 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 884 2308 gene locus_tag LOCUS_31920 884 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 2736 2497 gene locus_tag LOCUS_31930 2736 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 3196 2825 gene locus_tag LOCUS_31940 3196 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978181.1 protein_id gnl|my_center|LOCUS_31940 3780 3295 gene locus_tag LOCUS_31950 3780 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 >Feature sequence403 89 1516 gene locus_tag LOCUS_31960 gene araA 89 1516 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368279.1 protein_id gnl|my_center|LOCUS_31960 1623 2966 gene locus_tag LOCUS_31970 1623 2966 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028349.1 protein_id gnl|my_center|LOCUS_31970 2978 3910 gene locus_tag LOCUS_31980 2978 3910 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971641.1 protein_id gnl|my_center|LOCUS_31980 >Feature sequence404 828 565 gene locus_tag LOCUS_31990 828 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 1416 970 gene locus_tag LOCUS_32000 1416 970 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229428.1 protein_id gnl|my_center|LOCUS_32000 3746 1416 gene locus_tag LOCUS_32010 3746 1416 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228183.1 protein_id gnl|my_center|LOCUS_32010 >Feature sequence405 745 2352 gene locus_tag LOCUS_32020 gene cimA 745 2352 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030295.1 protein_id gnl|my_center|LOCUS_32020 2727 3662 gene locus_tag LOCUS_32030 2727 3662 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573797.1 protein_id gnl|my_center|LOCUS_32030 >Feature sequence406 3 980 gene locus_tag LOCUS_32040 3 980 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112799.1 protein_id gnl|my_center|LOCUS_32040 1993 1058 gene locus_tag LOCUS_32050 1993 1058 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031385.1 protein_id gnl|my_center|LOCUS_32050 3764 2412 gene locus_tag LOCUS_32060 3764 2412 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028160.1 protein_id gnl|my_center|LOCUS_32060 >Feature sequence407 748 329 gene locus_tag LOCUS_32070 748 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 3283 848 gene locus_tag LOCUS_32080 3283 848 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230251.1 protein_id gnl|my_center|LOCUS_32080 >Feature sequence408 764 1885 gene locus_tag LOCUS_32090 764 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 2033 3298 gene locus_tag LOCUS_32100 2033 3298 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197702410.1 protein_id gnl|my_center|LOCUS_32100 >Feature sequence409 3 677 gene locus_tag LOCUS_32110 3 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 677 1732 gene locus_tag LOCUS_32120 677 1732 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_32120 1921 2253 gene locus_tag LOCUS_32130 1921 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 <3959 2327 gene locus_tag LOCUS_32140 <3959 2327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083936454.1:penicillin-binding transpeptidase domain-containing protein >Feature sequence410 363 731 gene locus_tag LOCUS_32150 363 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 1660 1238 gene locus_tag LOCUS_32160 1660 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 2207 1746 gene locus_tag LOCUS_32170 2207 1746 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109029198.1 protein_id gnl|my_center|LOCUS_32170 2398 3456 gene locus_tag LOCUS_32180 gene pdhA 2398 3456 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467649.1 protein_id gnl|my_center|LOCUS_32180 >Feature sequence411 883 95 gene locus_tag LOCUS_32190 883 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223993.1 protein_id gnl|my_center|LOCUS_32190 1825 1166 gene locus_tag LOCUS_32200 1825 1166 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_32200 2300 2076 gene locus_tag LOCUS_32210 2300 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 2574 3737 gene locus_tag LOCUS_32220 gene moeZ 2574 3737 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 protein_id gnl|my_center|LOCUS_32220 >Feature sequence412 267 722 gene locus_tag LOCUS_32230 267 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 869 2068 gene locus_tag LOCUS_32240 869 2068 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222515.1 protein_id gnl|my_center|LOCUS_32240 2116 3033 gene locus_tag LOCUS_32250 2116 3033 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918355.1 protein_id gnl|my_center|LOCUS_32250 >Feature sequence413 2329 2607 gene locus_tag LOCUS_32260 2329 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32260 2689 2964 gene locus_tag LOCUS_32270 2689 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32270 >Feature sequence414 1239 172 gene locus_tag LOCUS_32280 1239 172 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730435.1 protein_id gnl|my_center|LOCUS_32280 1981 1388 gene locus_tag LOCUS_32290 1981 1388 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227317.1 protein_id gnl|my_center|LOCUS_32290 2852 2547 gene locus_tag LOCUS_32300 2852 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 3820 2996 gene locus_tag LOCUS_32310 3820 2996 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776276.1 protein_id gnl|my_center|LOCUS_32310 >Feature sequence415 3255 451 gene locus_tag LOCUS_32320 gene topA 3255 451 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029075.1 protein_id gnl|my_center|LOCUS_32320 >Feature sequence416 533 3025 gene locus_tag LOCUS_32330 533 3025 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030897.1 protein_id gnl|my_center|LOCUS_32330 3251 3093 gene locus_tag LOCUS_32340 3251 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 >Feature sequence417 79 738 gene locus_tag LOCUS_32350 79 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 742 2070 gene locus_tag LOCUS_32360 742 2070 CDS product lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226866.1 protein_id gnl|my_center|LOCUS_32360 >Feature sequence418 954 1049 gene locus_tag LOCUS_t00520 954 1049 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2332 1655 gene locus_tag LOCUS_32370 2332 1655 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221514425.1 protein_id gnl|my_center|LOCUS_32370 3389 2454 gene locus_tag LOCUS_32380 3389 2454 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_32380 3637 3386 gene locus_tag LOCUS_32390 3637 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 >Feature sequence419 690 2102 gene locus_tag LOCUS_32400 gene leuC 690 2102 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223619.1 protein_id gnl|my_center|LOCUS_32400 2132 2722 gene locus_tag LOCUS_32410 gene leuD 2132 2722 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030306.1 protein_id gnl|my_center|LOCUS_32410 3166 3447 gene locus_tag LOCUS_32420 3166 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32420 >Feature sequence420 43 855 gene locus_tag LOCUS_32430 43 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 920 1471 gene locus_tag LOCUS_32440 gene def 920 1471 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_32440 1724 2698 gene locus_tag LOCUS_32450 1724 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 3754 2780 gene locus_tag LOCUS_32460 3754 2780 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228776.1 protein_id gnl|my_center|LOCUS_32460 >Feature sequence421 257 2800 gene locus_tag LOCUS_32470 gene gyrA 257 2800 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326690.1 protein_id gnl|my_center|LOCUS_32470 2907 3506 gene locus_tag LOCUS_32480 2907 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 3682 3757 gene locus_tag LOCUS_t00530 3682 3757 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence422 1306 245 gene locus_tag LOCUS_32490 1306 245 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184633.1 protein_id gnl|my_center|LOCUS_32490 3175 1460 gene locus_tag LOCUS_32500 gene ibuL 3175 1460 CDS product isobutyrate:CoA ligase IbuL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030731.1 protein_id gnl|my_center|LOCUS_32500 >Feature sequence423 576 40 gene locus_tag LOCUS_32510 576 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 1406 669 gene locus_tag LOCUS_32520 1406 669 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467175.1 protein_id gnl|my_center|LOCUS_32520 1827 1492 gene locus_tag LOCUS_32530 1827 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 2029 2868 gene locus_tag LOCUS_32540 gene parJ 2029 2868 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_32540 3305 2892 gene locus_tag LOCUS_32550 3305 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 >Feature sequence424 717 1967 gene locus_tag LOCUS_32560 717 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 1964 2452 gene locus_tag LOCUS_32570 1964 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 2468 3142 gene locus_tag LOCUS_32580 2468 3142 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056818.1 protein_id gnl|my_center|LOCUS_32580 >Feature sequence425 <1 749 gene locus_tag LOCUS_32590 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229114.1:type I-E CRISPR-associated protein Cas7/Cse4/CasC 746 1516 gene locus_tag LOCUS_32600 746 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 1513 2157 gene locus_tag LOCUS_32610 gene cas6e 1513 2157 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227610.1 protein_id gnl|my_center|LOCUS_32610 2157 3134 gene locus_tag LOCUS_32620 gene cas1e 2157 3134 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229111.1 protein_id gnl|my_center|LOCUS_32620 3144 3473 gene locus_tag LOCUS_32630 3144 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 >Feature sequence426 500 243 gene locus_tag LOCUS_32640 500 243 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030672.1 protein_id gnl|my_center|LOCUS_32640 1293 502 gene locus_tag LOCUS_32650 1293 502 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_32650 1580 2173 gene locus_tag LOCUS_32660 1580 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 2267 2677 gene locus_tag LOCUS_32670 2267 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 >Feature sequence427 1122 634 gene locus_tag LOCUS_32680 1122 634 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975271.1 protein_id gnl|my_center|LOCUS_32680 2273 1119 gene locus_tag LOCUS_32690 gene dnaJ 2273 1119 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975270.1 protein_id gnl|my_center|LOCUS_32690 3140 2415 gene locus_tag LOCUS_32700 gene grpE 3140 2415 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975269.1 protein_id gnl|my_center|LOCUS_32700 <3688 3178 gene locus_tag LOCUS_32710 <3688 3178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975268.1:molecular chaperone DnaK >Feature sequence428 212 1537 gene locus_tag LOCUS_32720 212 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 2487 1561 gene locus_tag LOCUS_32730 2487 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 3216 2800 gene locus_tag LOCUS_32740 3216 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 >Feature sequence429 1672 152 gene locus_tag LOCUS_32750 1672 152 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776894.1 protein_id gnl|my_center|LOCUS_32750 2848 1796 gene locus_tag LOCUS_32760 2848 1796 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226282.1 protein_id gnl|my_center|LOCUS_32760 3618 2869 gene locus_tag LOCUS_32770 3618 2869 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031710.1 protein_id gnl|my_center|LOCUS_32770 >Feature sequence430 2130 1063 gene locus_tag LOCUS_32780 2130 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 2507 3481 gene locus_tag LOCUS_32790 2507 3481 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325822.1 protein_id gnl|my_center|LOCUS_32790 >Feature sequence431 1693 764 gene locus_tag LOCUS_32800 1693 764 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226502.1 protein_id gnl|my_center|LOCUS_32800 2728 2051 gene locus_tag LOCUS_32810 2728 2051 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891750.1 protein_id gnl|my_center|LOCUS_32810 >Feature sequence432 3376 2633 gene locus_tag LOCUS_32820 3376 2633 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228563.1 protein_id gnl|my_center|LOCUS_32820 >Feature sequence433 268 1728 gene locus_tag LOCUS_32830 268 1728 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804962.1 protein_id gnl|my_center|LOCUS_32830 1905 3317 gene locus_tag LOCUS_32840 1905 3317 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_32840 >Feature sequence434 <1 998 gene locus_tag LOCUS_32850 <1 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029800.1:sensor histidine kinase 971 1654 gene locus_tag LOCUS_32860 971 1654 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029801.1 protein_id gnl|my_center|LOCUS_32860 1740 2684 gene locus_tag LOCUS_32870 1740 2684 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971907.1 protein_id gnl|my_center|LOCUS_32870 2784 3002 gene locus_tag LOCUS_32880 2784 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 >Feature sequence435 <1 1226 gene locus_tag LOCUS_32890 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005111246.1:glycogen debranching protein GlgX 1303 2127 gene locus_tag LOCUS_32900 1303 2127 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030623.1 protein_id gnl|my_center|LOCUS_32900 2307 3086 gene locus_tag LOCUS_32910 2307 3086 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029507.1 protein_id gnl|my_center|LOCUS_32910 >Feature sequence436 <1 769 gene locus_tag LOCUS_32920 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976013.1:DUF4429 domain-containing protein 882 1838 gene locus_tag LOCUS_32930 gene pip 882 1838 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009923076.1 protein_id gnl|my_center|LOCUS_32930 3249 1993 gene locus_tag LOCUS_32940 3249 1993 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727657.1 protein_id gnl|my_center|LOCUS_32940 3522 3280 gene locus_tag LOCUS_32950 3522 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 >Feature sequence437 170 1132 gene locus_tag LOCUS_32960 170 1132 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729138.1 protein_id gnl|my_center|LOCUS_32960 1269 1484 gene locus_tag LOCUS_32970 1269 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 2974 1544 gene locus_tag LOCUS_32980 gene purB 2974 1544 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_32980 >Feature sequence438 848 219 gene locus_tag LOCUS_32990 848 219 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887646.1 protein_id gnl|my_center|LOCUS_32990 1167 2174 gene locus_tag LOCUS_33000 1167 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 2178 3353 gene locus_tag LOCUS_33010 2178 3353 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 protein_id gnl|my_center|LOCUS_33010 >Feature sequence439 1385 804 gene locus_tag LOCUS_33020 1385 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 1987 2187 gene locus_tag LOCUS_33030 1987 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 >Feature sequence440 <1 726 gene locus_tag LOCUS_33040 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229616.1:GntR family transcriptional regulator 723 1676 gene locus_tag LOCUS_33050 723 1676 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_33050 1676 2497 gene locus_tag LOCUS_33060 1676 2497 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227577.1 protein_id gnl|my_center|LOCUS_33060 >Feature sequence441 716 1474 gene locus_tag LOCUS_33070 716 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 <3476 1542 gene locus_tag LOCUS_33080 <3476 1542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029074.1:dTMP kinase >Feature sequence442 26 727 gene locus_tag LOCUS_33090 26 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 873 1313 gene locus_tag LOCUS_33100 873 1313 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968167.1 protein_id gnl|my_center|LOCUS_33100 2431 1409 gene locus_tag LOCUS_33110 2431 1409 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878198.1 protein_id gnl|my_center|LOCUS_33110 2859 2602 gene locus_tag LOCUS_33120 2859 2602 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_33120 3114 2869 gene locus_tag LOCUS_33130 3114 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 >Feature sequence443 1283 2713 gene locus_tag LOCUS_33140 1283 2713 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026469007.1 protein_id gnl|my_center|LOCUS_33140 3356 2817 gene locus_tag LOCUS_33150 3356 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 >Feature sequence444 1464 3281 gene locus_tag LOCUS_33160 1464 3281 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230903.1 protein_id gnl|my_center|LOCUS_33160 >Feature sequence445 <1 849 gene locus_tag LOCUS_33170 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_216843435.1:o-succinylbenzoate--CoA ligase 1344 2753 gene locus_tag LOCUS_33180 1344 2753 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728563.1 protein_id gnl|my_center|LOCUS_33180 3365 2949 gene locus_tag LOCUS_33190 3365 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 >Feature sequence446 1136 306 gene locus_tag LOCUS_33200 1136 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 <3419 1133 gene locus_tag LOCUS_33210 <3419 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031336.1:Na+/H+ antiporter subunit A >Feature sequence447 287 1468 gene locus_tag LOCUS_33220 287 1468 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028031.1 protein_id gnl|my_center|LOCUS_33220 1465 2304 gene locus_tag LOCUS_33230 1465 2304 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976936.1 protein_id gnl|my_center|LOCUS_33230 2372 3277 gene locus_tag LOCUS_33240 2372 3277 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975159.1 protein_id gnl|my_center|LOCUS_33240 >Feature sequence448 848 504 gene locus_tag LOCUS_33250 848 504 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013963.1 protein_id gnl|my_center|LOCUS_33250 942 1853 gene locus_tag LOCUS_33260 942 1853 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972246.1 protein_id gnl|my_center|LOCUS_33260 >Feature sequence449 >Feature sequence450 2429 150 gene locus_tag LOCUS_33270 gene metE 2429 150 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027494.1 protein_id gnl|my_center|LOCUS_33270 >Feature sequence451 1125 274 gene locus_tag LOCUS_33280 1125 274 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974811.1 protein_id gnl|my_center|LOCUS_33280 2340 1252 gene locus_tag LOCUS_33290 2340 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 3258 2455 gene locus_tag LOCUS_33300 3258 2455 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110164.1 protein_id gnl|my_center|LOCUS_33300 >Feature sequence452 1672 422 gene locus_tag LOCUS_33310 gene ltrA 1672 422 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024495.1 protein_id gnl|my_center|LOCUS_33310 2341 3147 gene locus_tag LOCUS_33320 2341 3147 CDS product IS5-like element IS470 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029009.1 protein_id gnl|my_center|LOCUS_33320 >Feature sequence453 <1 713 gene locus_tag LOCUS_33330 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229660.1:acetyl-CoA carboxylase biotin carboxylase subunit 758 1867 gene locus_tag LOCUS_33340 758 1867 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229659.1 protein_id gnl|my_center|LOCUS_33340 1975 2124 gene locus_tag LOCUS_33350 1975 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 <3333 2191 gene locus_tag LOCUS_33360 <3333 2191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977296.1:threonine--tRNA ligase >Feature sequence454 1056 85 gene locus_tag LOCUS_33370 1056 85 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743977.1 protein_id gnl|my_center|LOCUS_33370 2583 1081 gene locus_tag LOCUS_33380 2583 1081 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731599.1 protein_id gnl|my_center|LOCUS_33380 3331 2756 gene locus_tag LOCUS_33390 3331 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 >Feature sequence455 260 1237 gene locus_tag LOCUS_33400 260 1237 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222236.1 protein_id gnl|my_center|LOCUS_33400 2680 1313 gene locus_tag LOCUS_33410 gene gdhA 2680 1313 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974280.1 protein_id gnl|my_center|LOCUS_33410 >Feature sequence456 386 1381 gene locus_tag LOCUS_33420 386 1381 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974897.1 protein_id gnl|my_center|LOCUS_33420 1433 2275 gene locus_tag LOCUS_33430 1433 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 >Feature sequence457 447 2216 gene locus_tag LOCUS_33440 447 2216 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229350.1 protein_id gnl|my_center|LOCUS_33440 2229 2675 gene locus_tag LOCUS_33450 2229 2675 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229349.1 protein_id gnl|my_center|LOCUS_33450 2741 3262 gene locus_tag LOCUS_33460 2741 3262 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975011.1 protein_id gnl|my_center|LOCUS_33460 >Feature sequence458 <1 631 gene locus_tag LOCUS_33470 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977279.1:aminodeoxychorismate lyase 1130 711 gene locus_tag LOCUS_33480 1130 711 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004002642.1 protein_id gnl|my_center|LOCUS_33480 1605 1679 gene locus_tag LOCUS_t00540 1605 1679 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2076 1768 gene locus_tag LOCUS_33490 2076 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 >Feature sequence459 2043 58 gene locus_tag LOCUS_33500 2043 58 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777103.1 protein_id gnl|my_center|LOCUS_33500 2648 3064 gene locus_tag LOCUS_33510 2648 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 >Feature sequence460 72 968 gene locus_tag LOCUS_33520 72 968 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230532.1 protein_id gnl|my_center|LOCUS_33520 965 1912 gene locus_tag LOCUS_33530 965 1912 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027584.1 protein_id gnl|my_center|LOCUS_33530 2161 3150 gene locus_tag LOCUS_33540 2161 3150 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051005886.1 protein_id gnl|my_center|LOCUS_33540 >Feature sequence461 1927 1055 gene locus_tag LOCUS_33550 1927 1055 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_33550 2218 3006 gene locus_tag LOCUS_33560 2218 3006 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228931.1 protein_id gnl|my_center|LOCUS_33560 >Feature sequence462 279 857 gene locus_tag LOCUS_33570 279 857 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897831.1 protein_id gnl|my_center|LOCUS_33570 973 1746 gene locus_tag LOCUS_33580 973 1746 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028120.1 protein_id gnl|my_center|LOCUS_33580 1895 2374 gene locus_tag LOCUS_33590 gene ybaK 1895 2374 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976757.1 protein_id gnl|my_center|LOCUS_33590 >Feature sequence463 1607 615 gene locus_tag LOCUS_33600 1607 615 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_33600 1973 2404 gene locus_tag LOCUS_33610 gene mraZ 1973 2404 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467434.1 protein_id gnl|my_center|LOCUS_33610 >Feature sequence464 <1 1234 gene locus_tag LOCUS_33620 <1 1234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404392.1:multicopper oxidase MmcO 1307 2179 gene locus_tag LOCUS_33630 1307 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 2308 2985 gene locus_tag LOCUS_33640 2308 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 >Feature sequence465 1824 664 gene locus_tag LOCUS_33650 1824 664 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230131.1 protein_id gnl|my_center|LOCUS_33650 2666 1893 gene locus_tag LOCUS_33660 2666 1893 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244476.1 protein_id gnl|my_center|LOCUS_33660 >Feature sequence466 2196 1744 gene locus_tag LOCUS_33670 2196 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33670 <3210 2169 gene locus_tag LOCUS_33680 <3210 2169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_189024193.1:non-ribosomal peptide synthetase note possible pseudo, frameshifted >Feature sequence467 1233 1604 gene locus_tag LOCUS_33690 gene rpsL 1233 1604 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_33690 1607 2077 gene locus_tag LOCUS_33700 gene rpsG 1607 2077 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776385.1 protein_id gnl|my_center|LOCUS_33700 >Feature sequence468 2472 706 gene locus_tag LOCUS_33710 2472 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 >Feature sequence469 52 495 gene locus_tag LOCUS_33720 52 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 972 565 gene locus_tag LOCUS_33730 972 565 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963868.1 protein_id gnl|my_center|LOCUS_33730 1107 1871 gene locus_tag LOCUS_33740 1107 1871 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141632568.1 protein_id gnl|my_center|LOCUS_33740 2031 2582 gene locus_tag LOCUS_33750 2031 2582 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031718.1 protein_id gnl|my_center|LOCUS_33750 >Feature sequence470 368 1417 gene locus_tag LOCUS_33760 368 1417 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030277.1 protein_id gnl|my_center|LOCUS_33760 >Feature sequence471 392 1285 gene locus_tag LOCUS_33770 392 1285 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030587.1 protein_id gnl|my_center|LOCUS_33770 1437 2528 gene locus_tag LOCUS_33780 1437 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 2627 2959 gene locus_tag LOCUS_33790 2627 2959 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225370.1 protein_id gnl|my_center|LOCUS_33790 >Feature sequence472 633 430 gene locus_tag LOCUS_33800 633 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 2098 947 gene locus_tag LOCUS_33810 2098 947 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114757.1 protein_id gnl|my_center|LOCUS_33810 2924 2469 gene locus_tag LOCUS_33820 2924 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 >Feature sequence473 2428 1220 gene locus_tag LOCUS_33830 2428 1220 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031651.1 protein_id gnl|my_center|LOCUS_33830 3111 2506 gene locus_tag LOCUS_33840 3111 2506 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469546.1 protein_id gnl|my_center|LOCUS_33840 >Feature sequence474 384 2561 gene locus_tag LOCUS_33850 384 2561 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030068.1 protein_id gnl|my_center|LOCUS_33850 >Feature sequence475 1188 1550 gene locus_tag LOCUS_33860 1188 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 1543 1968 gene locus_tag LOCUS_33870 1543 1968 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222283.1 protein_id gnl|my_center|LOCUS_33870 2098 2964 gene locus_tag LOCUS_33880 2098 2964 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804288.1 protein_id gnl|my_center|LOCUS_33880 >Feature sequence476 <3105 585 gene locus_tag LOCUS_33890 <3105 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974308.1:DNA-directed RNA polymerase subunit beta' >Feature sequence477 <1 1042 gene locus_tag LOCUS_33900 <1 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390071.1:MmgE/PrpD family protein 1042 1935 gene locus_tag LOCUS_33910 gene prpB 1042 1935 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265603.1 protein_id gnl|my_center|LOCUS_33910 1951 3087 gene locus_tag LOCUS_33920 1951 3087 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405909.1 protein_id gnl|my_center|LOCUS_33920 >Feature sequence478 234 10 gene locus_tag LOCUS_33930 234 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 336 902 gene locus_tag LOCUS_33940 336 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 1328 1624 gene locus_tag LOCUS_33950 1328 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 1621 2289 gene locus_tag LOCUS_33960 gene cas6e 1621 2289 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227610.1 protein_id gnl|my_center|LOCUS_33960 2298 2990 gene locus_tag LOCUS_33970 2298 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33970 >Feature sequence479 2858 1692 gene locus_tag LOCUS_33980 2858 1692 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027238.1 protein_id gnl|my_center|LOCUS_33980 >Feature sequence480 1 246 gene locus_tag LOCUS_33990 1 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 243 1247 gene locus_tag LOCUS_34000 gene ccsB 243 1247 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855590.1 protein_id gnl|my_center|LOCUS_34000 2790 1240 gene locus_tag LOCUS_34010 2790 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 >Feature sequence481 1480 524 gene locus_tag LOCUS_34020 1480 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 >Feature sequence482 64 1287 gene locus_tag LOCUS_34030 64 1287 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109278575.1 protein_id gnl|my_center|LOCUS_34030 1513 1310 gene locus_tag LOCUS_34040 1513 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 2477 1692 gene locus_tag LOCUS_34050 2477 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 >Feature sequence483 552 890 gene locus_tag LOCUS_34060 552 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 955 2478 gene locus_tag LOCUS_34070 955 2478 CDS product glutathione ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211308.1 protein_id gnl|my_center|LOCUS_34070 >Feature sequence484 896 678 gene locus_tag LOCUS_34080 896 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228349.1 protein_id gnl|my_center|LOCUS_34080 1548 2846 gene locus_tag LOCUS_34090 1548 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 >Feature sequence485 1176 1943 gene locus_tag LOCUS_34100 1176 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 2467 1958 gene locus_tag LOCUS_34110 2467 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 >Feature sequence486 >Feature sequence487 263 1495 gene locus_tag LOCUS_34120 263 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 2674 1508 gene locus_tag LOCUS_34130 2674 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 >Feature sequence488 1023 391 gene locus_tag LOCUS_34140 1023 391 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894458.1 protein_id gnl|my_center|LOCUS_34140 2380 1337 gene locus_tag LOCUS_34150 2380 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 >Feature sequence489 95 237 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gagagccccgcgcacgcgggg 283 582 gene locus_tag LOCUS_34160 283 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 662 1123 gene locus_tag LOCUS_34170 662 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 1197 1631 gene locus_tag LOCUS_34180 1197 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 1636 1890 gene locus_tag LOCUS_34190 1636 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 2013 2285 gene locus_tag LOCUS_34200 2013 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 2431 2856 gene locus_tag LOCUS_34210 2431 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 >Feature sequence490 2691 406 gene locus_tag LOCUS_34220 2691 406 CDS product xyloglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030999.1 protein_id gnl|my_center|LOCUS_34220 >Feature sequence491 1087 197 gene locus_tag LOCUS_34230 1087 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 1280 2134 gene locus_tag LOCUS_34240 1280 2134 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971565.1 protein_id gnl|my_center|LOCUS_34240 2131 2496 gene locus_tag LOCUS_34250 2131 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 >Feature sequence492 1363 683 gene locus_tag LOCUS_34260 1363 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 1988 1443 gene locus_tag LOCUS_34270 1988 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34270 2592 2756 gene locus_tag LOCUS_34280 2592 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 >Feature sequence493 1097 30 gene locus_tag LOCUS_34290 1097 30 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230309.1 protein_id gnl|my_center|LOCUS_34290 1401 2669 gene locus_tag LOCUS_34300 1401 2669 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028461.1 protein_id gnl|my_center|LOCUS_34300 >Feature sequence494 <1 864 gene locus_tag LOCUS_34310 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004114440.1:DMT family transporter 842 1003 gene locus_tag LOCUS_34320 842 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 1136 1555 gene locus_tag LOCUS_34330 gene furA3 1136 1555 CDS product fur family transcriptional regulator FurA3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731162.1 protein_id gnl|my_center|LOCUS_34330 >Feature sequence495 3 503 gene locus_tag LOCUS_34340 3 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 721 2751 gene locus_tag LOCUS_34350 gene rmdB 721 2751 CDS product cyclic Di-GMP phosphodiesterase RmdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030279.1 protein_id gnl|my_center|LOCUS_34350 >Feature sequence496 >Feature sequence497 565 1104 gene locus_tag LOCUS_34360 565 1104 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224813.1 protein_id gnl|my_center|LOCUS_34360 2893 1193 gene locus_tag LOCUS_34370 2893 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 >Feature sequence498 492 2261 gene locus_tag LOCUS_34380 492 2261 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029339.1 protein_id gnl|my_center|LOCUS_34380 >Feature sequence499 335 1084 gene locus_tag LOCUS_34390 335 1084 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_34390 1136 1861 gene locus_tag LOCUS_34400 gene rph 1136 1861 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 protein_id gnl|my_center|LOCUS_34400 1858 2487 gene locus_tag LOCUS_34410 gene rdgB 1858 2487 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229451.1 protein_id gnl|my_center|LOCUS_34410 >Feature sequence500 2296 1640 gene locus_tag LOCUS_34420 2296 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 >Feature sequence501 <1 865 gene locus_tag LOCUS_34430 <1 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027829.1:phosphatidylinositol mannoside acyltransferase 862 2004 gene locus_tag LOCUS_34440 862 2004 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_34440 2019 2555 gene locus_tag LOCUS_34450 2019 2555 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027827.1 protein_id gnl|my_center|LOCUS_34450 >Feature sequence502 <1 616 gene locus_tag LOCUS_34460 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003978042.1:LUD domain-containing protein 723 2306 gene locus_tag LOCUS_34470 723 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 >Feature sequence503 <1 972 gene locus_tag LOCUS_34480 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072692.1:prolyl oligopeptidase family serine peptidase 1218 2420 gene locus_tag LOCUS_34490 1218 2420 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225636.1 protein_id gnl|my_center|LOCUS_34490 >Feature sequence504 1233 235 gene locus_tag LOCUS_34500 1233 235 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_34500 1623 2558 gene locus_tag LOCUS_34510 1623 2558 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_34510 >Feature sequence505 1007 648 gene locus_tag LOCUS_34520 1007 648 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_34520 1127 1681 gene locus_tag LOCUS_34530 1127 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 1794 2684 gene locus_tag LOCUS_34540 1794 2684 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776415.1 protein_id gnl|my_center|LOCUS_34540 >Feature sequence506 718 2361 gene locus_tag LOCUS_34550 718 2361 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227752.1 protein_id gnl|my_center|LOCUS_34550 >Feature sequence507 <1 1248 gene locus_tag LOCUS_34560 <1 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_026469107.1:GGDEF domain-containing protein 1305 2486 gene locus_tag LOCUS_34570 1305 2486 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179809238.1 protein_id gnl|my_center|LOCUS_34570 >Feature sequence508 <1 1126 gene locus_tag LOCUS_34580 <1 1126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976762.1:histidinol-phosphate transaminase 1157 1750 gene locus_tag LOCUS_34590 gene hisB 1157 1750 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976763.1 protein_id gnl|my_center|LOCUS_34590 1751 1915 gene locus_tag LOCUS_34600 1751 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 >Feature sequence509 1079 336 gene locus_tag LOCUS_34610 1079 336 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636852.1 protein_id gnl|my_center|LOCUS_34610 1903 1259 gene locus_tag LOCUS_34620 1903 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 >Feature sequence510 <1 713 gene locus_tag LOCUS_34630 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030431.1:4-hydroxy-tetrahydrodipicolinate synthase 710 2395 gene locus_tag LOCUS_34640 710 2395 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_34640 >Feature sequence511 <1 2475 gene locus_tag LOCUS_34650 <1 2475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861850.1:helicase-related protein >Feature sequence512 55 2031 gene locus_tag LOCUS_34660 55 2031 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226475.1 protein_id gnl|my_center|LOCUS_34660 2701 2105 gene locus_tag LOCUS_34670 2701 2105 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081641.1 protein_id gnl|my_center|LOCUS_34670 >Feature sequence513 1402 794 gene locus_tag LOCUS_34680 1402 794 CDS product AmiS/UreI family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730476.1 protein_id gnl|my_center|LOCUS_34680 1648 2667 gene locus_tag LOCUS_34690 1648 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 >Feature sequence514 2196 433 gene locus_tag LOCUS_34700 2196 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 >Feature sequence515 1393 2067 gene locus_tag LOCUS_34710 1393 2067 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063695.1 protein_id gnl|my_center|LOCUS_34710 >Feature sequence516 613 1266 gene locus_tag LOCUS_34720 613 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 1266 1685 gene locus_tag LOCUS_34730 1266 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 >Feature sequence517 691 308 gene locus_tag LOCUS_34740 691 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 2029 2310 gene locus_tag LOCUS_34750 2029 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 >Feature sequence518 395 2308 gene locus_tag LOCUS_34760 395 2308 CDS product AfsR/SARP family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028835.1 protein_id gnl|my_center|LOCUS_34760 >Feature sequence519 2243 612 gene locus_tag LOCUS_34770 2243 612 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615419.1 protein_id gnl|my_center|LOCUS_34770 >Feature sequence520 1562 300 gene locus_tag LOCUS_34780 gene ahcY 1562 300 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_34780 <2672 1579 gene locus_tag LOCUS_34790 <2672 1579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975788.1:adenosylhomocysteinase >Feature sequence521 278 1570 gene locus_tag LOCUS_34800 278 1570 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408560.1 protein_id gnl|my_center|LOCUS_34800 2370 2140 gene locus_tag LOCUS_34810 2370 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 >Feature sequence522 1289 2215 gene locus_tag LOCUS_34820 1289 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 2665 2345 gene locus_tag LOCUS_34830 2665 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 >Feature sequence523 2064 442 gene locus_tag LOCUS_34840 2064 442 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804842.1 protein_id gnl|my_center|LOCUS_34840 <2662 2067 gene locus_tag LOCUS_34850 <2662 2067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804843.1:extracellular solute-binding protein >Feature sequence524 956 1285 gene locus_tag LOCUS_34860 956 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 1356 1658 gene locus_tag LOCUS_34870 1356 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 >Feature sequence525 1303 473 gene locus_tag LOCUS_34880 1303 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113317.1 protein_id gnl|my_center|LOCUS_34880 2505 1300 gene locus_tag LOCUS_34890 2505 1300 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083253.1 protein_id gnl|my_center|LOCUS_34890 >Feature sequence526 1009 314 gene locus_tag LOCUS_34900 1009 314 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_34900 1511 1242 gene locus_tag LOCUS_34910 1511 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 1802 1545 gene locus_tag LOCUS_34920 1802 1545 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974810.1 protein_id gnl|my_center|LOCUS_34920 >Feature sequence527 >Feature sequence528 1159 578 gene locus_tag LOCUS_34930 1159 578 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975893.1 protein_id gnl|my_center|LOCUS_34930 2475 1177 gene locus_tag LOCUS_34940 2475 1177 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 protein_id gnl|my_center|LOCUS_34940 >Feature sequence529 1089 2189 gene locus_tag LOCUS_34950 gene mnmA 1089 2189 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_34950 >Feature sequence530 1255 770 gene locus_tag LOCUS_34960 1255 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 1459 2463 gene locus_tag LOCUS_34970 1459 2463 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168512796.1 protein_id gnl|my_center|LOCUS_34970 >Feature sequence531 <1 1554 gene locus_tag LOCUS_34980 <1 1554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029332.1:thiol reductant ABC exporter subunit CydD 1578 2369 gene locus_tag LOCUS_34990 1578 2369 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028326.1 protein_id gnl|my_center|LOCUS_34990 >Feature sequence532 298 924 gene locus_tag LOCUS_35000 298 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 1010 1609 gene locus_tag LOCUS_35010 1010 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 >Feature sequence533 1317 1625 gene locus_tag LOCUS_35020 1317 1625 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221419030.1 protein_id gnl|my_center|LOCUS_35020 1622 2482 gene locus_tag LOCUS_35030 1622 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35030 >Feature sequence534 1782 526 gene locus_tag LOCUS_35040 1782 526 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208195.1 protein_id gnl|my_center|LOCUS_35040 >Feature sequence535 1847 873 gene locus_tag LOCUS_35050 1847 873 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384737.1 protein_id gnl|my_center|LOCUS_35050 <2551 1844 gene locus_tag LOCUS_35060 <2551 1844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939732.1:ABC transporter permease >Feature sequence536 495 208 gene locus_tag LOCUS_35070 495 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 1046 1600 gene locus_tag LOCUS_35080 1046 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 1616 1975 gene locus_tag LOCUS_35090 1616 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 2515 2440 gene locus_tag LOCUS_t00550 2515 2440 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence537 >Feature sequence538 1606 14 gene locus_tag LOCUS_35100 1606 14 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028213.1 protein_id gnl|my_center|LOCUS_35100 >Feature sequence539 1926 1159 gene locus_tag LOCUS_35110 gene tgmB 1926 1159 CDS product ATP-grasp ribosomal peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228560.1 protein_id gnl|my_center|LOCUS_35110 2378 2133 gene locus_tag LOCUS_35120 2378 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 >Feature sequence540 2511 259 gene locus_tag LOCUS_35130 2511 259 CDS product cellulase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027340.1 protein_id gnl|my_center|LOCUS_35130 >Feature sequence541 2444 1272 gene locus_tag LOCUS_35140 2444 1272 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975394.1 protein_id gnl|my_center|LOCUS_35140 >Feature sequence542 946 290 gene locus_tag LOCUS_35150 946 290 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 protein_id gnl|my_center|LOCUS_35150 1657 1088 gene locus_tag LOCUS_35160 1657 1088 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027833.1 protein_id gnl|my_center|LOCUS_35160 <2522 1840 gene locus_tag LOCUS_35170 <2522 1840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530134.1:DUF885 domain-containing protein >Feature sequence543 <1 536 gene locus_tag LOCUS_35180 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005110170.1:FAD-dependent monooxygenase 1686 520 gene locus_tag LOCUS_35190 1686 520 CDS product lactate 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978098.1 protein_id gnl|my_center|LOCUS_35190 2059 1986 gene locus_tag LOCUS_t00560 2059 1986 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2186 2509 gene locus_tag LOCUS_35200 2186 2509 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230909.1 protein_id gnl|my_center|LOCUS_35200 >Feature sequence544 87 689 gene locus_tag LOCUS_35210 87 689 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894347.1 protein_id gnl|my_center|LOCUS_35210 1797 754 gene locus_tag LOCUS_35220 1797 754 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030756.1 protein_id gnl|my_center|LOCUS_35220 >Feature sequence545 24 452 gene locus_tag LOCUS_35230 24 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 449 1864 gene locus_tag LOCUS_35240 449 1864 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830529.1 protein_id gnl|my_center|LOCUS_35240 2187 1984 gene locus_tag LOCUS_35250 2187 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250