>Feature sequence001 1417 20 gene locus_tag LOCUS_00010 1417 20 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_00010 2051 1967 gene locus_tag LOCUS_t00010 2051 1967 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3623 2100 gene locus_tag LOCUS_00020 3623 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3892 5487 gene locus_tag LOCUS_00030 3892 5487 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_00030 5508 6209 gene locus_tag LOCUS_00040 5508 6209 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262722.1 protein_id gnl|my_center|LOCUS_00040 6224 6403 gene locus_tag LOCUS_00050 6224 6403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6435 7895 gene locus_tag LOCUS_00060 gene araA 6435 7895 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964655.1 protein_id gnl|my_center|LOCUS_00060 7952 10021 gene locus_tag LOCUS_00070 7952 10021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 10097 11320 gene locus_tag LOCUS_00080 10097 11320 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_00080 11320 11667 gene locus_tag LOCUS_00090 11320 11667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11962 13485 gene locus_tag LOCUS_00100 gene abfA 11962 13485 CDS product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 protein_id gnl|my_center|LOCUS_00100 13513 14673 gene locus_tag LOCUS_00110 13513 14673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 14894 16249 gene locus_tag LOCUS_00120 14894 16249 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_00120 16440 17201 gene locus_tag LOCUS_00130 gene minD 16440 17201 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082421.1 protein_id gnl|my_center|LOCUS_00130 17214 17444 gene locus_tag LOCUS_00140 17214 17444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17552 18421 gene locus_tag LOCUS_00150 17552 18421 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_00150 18547 18634 gene locus_tag LOCUS_t00020 18547 18634 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19975 19085 gene locus_tag LOCUS_00160 19975 19085 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905004.1 protein_id gnl|my_center|LOCUS_00160 20407 20150 gene locus_tag LOCUS_00170 20407 20150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 22052 20418 gene locus_tag LOCUS_00180 gene feoB 22052 20418 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044821.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00180 22465 22025 gene locus_tag LOCUS_00190 22465 22025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00190 22688 22449 gene locus_tag LOCUS_00200 22688 22449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23874 22906 gene locus_tag LOCUS_00210 23874 22906 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_00210 24140 25567 gene locus_tag LOCUS_00220 24140 25567 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296810.1 protein_id gnl|my_center|LOCUS_00220 25564 25758 gene locus_tag LOCUS_00230 25564 25758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25755 27782 gene locus_tag LOCUS_00240 25755 27782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 27801 29777 gene locus_tag LOCUS_00250 27801 29777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 29789 30853 gene locus_tag LOCUS_00260 29789 30853 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148691226.1 protein_id gnl|my_center|LOCUS_00260 30858 31775 gene locus_tag LOCUS_00270 30858 31775 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980619.1 protein_id gnl|my_center|LOCUS_00270 31784 32791 gene locus_tag LOCUS_00280 31784 32791 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230097.1 protein_id gnl|my_center|LOCUS_00280 32781 33839 gene locus_tag LOCUS_00290 32781 33839 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677558.1 protein_id gnl|my_center|LOCUS_00290 33836 36787 gene locus_tag LOCUS_00300 33836 36787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 36906 37964 gene locus_tag LOCUS_00310 36906 37964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 37968 38777 gene locus_tag LOCUS_00320 37968 38777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 38980 39411 gene locus_tag LOCUS_00330 38980 39411 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020469.1 protein_id gnl|my_center|LOCUS_00330 39425 40396 gene locus_tag LOCUS_00340 gene fabG 39425 40396 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_00340 41453 40491 gene locus_tag LOCUS_00350 41453 40491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 41630 41965 gene locus_tag LOCUS_00360 41630 41965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 42019 42318 gene locus_tag LOCUS_00370 42019 42318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 42315 42950 gene locus_tag LOCUS_00380 42315 42950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 43322 45760 gene locus_tag LOCUS_00390 43322 45760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 47539 45899 gene locus_tag LOCUS_00400 47539 45899 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_00400 48853 47555 gene locus_tag LOCUS_00410 48853 47555 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788204.1 protein_id gnl|my_center|LOCUS_00410 49474 48893 gene locus_tag LOCUS_00420 49474 48893 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_00420 51215 49485 gene locus_tag LOCUS_00430 gene iorA 51215 49485 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_00430 52135 51278 gene locus_tag LOCUS_00440 52135 51278 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_00440 52329 53906 gene locus_tag LOCUS_00450 52329 53906 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_00450 54357 54040 gene locus_tag LOCUS_00460 54357 54040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 54671 54456 gene locus_tag LOCUS_00470 54671 54456 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814889.1 protein_id gnl|my_center|LOCUS_00470 55606 54800 gene locus_tag LOCUS_00480 55606 54800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00480 56091 55603 gene locus_tag LOCUS_00490 56091 55603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00490 56671 56099 gene locus_tag LOCUS_00500 56671 56099 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_00500 57282 56668 gene locus_tag LOCUS_00510 57282 56668 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016599.1 protein_id gnl|my_center|LOCUS_00510 57370 58242 gene locus_tag LOCUS_00520 57370 58242 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439497.1 protein_id gnl|my_center|LOCUS_00520 58344 60275 gene locus_tag LOCUS_00530 58344 60275 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_00530 60343 61317 gene locus_tag LOCUS_00540 60343 61317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 61375 62832 gene locus_tag LOCUS_00550 61375 62832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 64118 62922 gene locus_tag LOCUS_00560 64118 62922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 64256 66031 gene locus_tag LOCUS_00570 64256 66031 CDS product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459600.1 protein_id gnl|my_center|LOCUS_00570 66033 68357 gene locus_tag LOCUS_00580 66033 68357 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157437265.1 protein_id gnl|my_center|LOCUS_00580 68370 70073 gene locus_tag LOCUS_00590 68370 70073 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_00590 70077 72623 gene locus_tag LOCUS_00600 70077 72623 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_00600 72620 73933 gene locus_tag LOCUS_00610 72620 73933 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286145.1 protein_id gnl|my_center|LOCUS_00610 73930 75369 gene locus_tag LOCUS_00620 73930 75369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 75373 76068 gene locus_tag LOCUS_00630 75373 76068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 76111 77898 gene locus_tag LOCUS_00640 76111 77898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00640 77906 79450 gene locus_tag LOCUS_00650 77906 79450 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920215.1 protein_id gnl|my_center|LOCUS_00650 79543 81015 gene locus_tag LOCUS_00660 79543 81015 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963747.1 protein_id gnl|my_center|LOCUS_00660 83040 81052 gene locus_tag LOCUS_00670 83040 81052 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 protein_id gnl|my_center|LOCUS_00670 84432 83209 gene locus_tag LOCUS_00680 84432 83209 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_00680 84720 85589 gene locus_tag LOCUS_00690 84720 85589 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868898.1 protein_id gnl|my_center|LOCUS_00690 85576 86184 gene locus_tag LOCUS_00700 85576 86184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 86169 88514 gene locus_tag LOCUS_00710 86169 88514 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_00710 88685 89710 gene locus_tag LOCUS_00720 88685 89710 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068167.1 protein_id gnl|my_center|LOCUS_00720 90792 89776 gene locus_tag LOCUS_00730 gene galE 90792 89776 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389959.1 protein_id gnl|my_center|LOCUS_00730 91956 90805 gene locus_tag LOCUS_00740 91956 90805 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016043.1 protein_id gnl|my_center|LOCUS_00740 93497 91959 gene locus_tag LOCUS_00750 gene galT 93497 91959 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_00750 93828 94700 gene locus_tag LOCUS_00760 93828 94700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 94835 96052 gene locus_tag LOCUS_00770 94835 96052 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_00770 97593 96145 gene locus_tag LOCUS_00780 97593 96145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 98306 97725 gene locus_tag LOCUS_00790 98306 97725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 98448 98705 gene locus_tag LOCUS_00800 gene spoIIID 98448 98705 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393849.1 protein_id gnl|my_center|LOCUS_00800 98818 101763 gene locus_tag LOCUS_00810 98818 101763 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016931.1 protein_id gnl|my_center|LOCUS_00810 101760 103046 gene locus_tag LOCUS_00820 101760 103046 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016932.1 protein_id gnl|my_center|LOCUS_00820 103618 105054 gene locus_tag LOCUS_00830 103618 105054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 105038 105697 gene locus_tag LOCUS_00840 105038 105697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 105751 107106 gene locus_tag LOCUS_00850 gene glmM 105751 107106 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521476.1 protein_id gnl|my_center|LOCUS_00850 107124 108959 gene locus_tag LOCUS_00860 gene glmS 107124 108959 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_00860 109015 110502 gene locus_tag LOCUS_00870 109015 110502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 110567 111832 gene locus_tag LOCUS_00880 110567 111832 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476101.1 protein_id gnl|my_center|LOCUS_00880 111858 112409 gene locus_tag LOCUS_00890 111858 112409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 112466 113176 gene locus_tag LOCUS_00900 112466 113176 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476100.1 protein_id gnl|my_center|LOCUS_00900 113180 113680 gene locus_tag LOCUS_00910 113180 113680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 114970 113792 gene locus_tag LOCUS_00920 114970 113792 CDS product IS110-like element ISFnu4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015895.1 protein_id gnl|my_center|LOCUS_00920 115320 116594 gene locus_tag LOCUS_00930 115320 116594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 116618 117559 gene locus_tag LOCUS_00940 116618 117559 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046622.1 protein_id gnl|my_center|LOCUS_00940 117559 117867 gene locus_tag LOCUS_00950 117559 117867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 117867 119054 gene locus_tag LOCUS_00960 117867 119054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 119061 120032 gene locus_tag LOCUS_00970 119061 120032 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_00970 120029 121237 gene locus_tag LOCUS_00980 120029 121237 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202263.1 protein_id gnl|my_center|LOCUS_00980 121274 122362 gene locus_tag LOCUS_00990 121274 122362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 122384 122887 gene locus_tag LOCUS_01000 122384 122887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 123424 123810 gene locus_tag LOCUS_01010 123424 123810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 123824 124024 gene locus_tag LOCUS_01020 123824 124024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 124189 124566 gene locus_tag LOCUS_01030 124189 124566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01030 124570 125799 gene locus_tag LOCUS_01040 124570 125799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 126477 127040 gene locus_tag LOCUS_01050 126477 127040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 127066 128529 gene locus_tag LOCUS_01060 127066 128529 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101282.1 protein_id gnl|my_center|LOCUS_01060 128567 129010 gene locus_tag LOCUS_01070 128567 129010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 129465 130529 gene locus_tag LOCUS_01080 129465 130529 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107231.1 protein_id gnl|my_center|LOCUS_01080 130526 131728 gene locus_tag LOCUS_01090 130526 131728 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107232.1 protein_id gnl|my_center|LOCUS_01090 131873 133060 gene locus_tag LOCUS_01100 131873 133060 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107233.1 protein_id gnl|my_center|LOCUS_01100 >Feature sequence002 1224 22 gene locus_tag LOCUS_01110 1224 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 1350 3833 gene locus_tag LOCUS_01120 1350 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 3920 4096 gene locus_tag LOCUS_01130 3920 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 4190 5977 gene locus_tag LOCUS_01140 4190 5977 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775581.1 protein_id gnl|my_center|LOCUS_01140 5980 6807 gene locus_tag LOCUS_01150 5980 6807 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228638.1 protein_id gnl|my_center|LOCUS_01150 6922 7746 gene locus_tag LOCUS_01160 6922 7746 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047578.1 protein_id gnl|my_center|LOCUS_01160 7939 8994 gene locus_tag LOCUS_01170 7939 8994 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767017.1 protein_id gnl|my_center|LOCUS_01170 9032 10360 gene locus_tag LOCUS_01180 gene uxaC 9032 10360 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303177.1 protein_id gnl|my_center|LOCUS_01180 10357 11922 gene locus_tag LOCUS_01190 10357 11922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 11940 12977 gene locus_tag LOCUS_01200 gene uxuA 11940 12977 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082566.1 protein_id gnl|my_center|LOCUS_01200 13008 13901 gene locus_tag LOCUS_01210 13008 13901 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495563.1 protein_id gnl|my_center|LOCUS_01210 13898 14518 gene locus_tag LOCUS_01220 13898 14518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01220 15590 14952 gene locus_tag LOCUS_01230 15590 14952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 16097 17824 gene locus_tag LOCUS_01240 16097 17824 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814583.1 protein_id gnl|my_center|LOCUS_01240 17821 19593 gene locus_tag LOCUS_01250 17821 19593 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461397.1 protein_id gnl|my_center|LOCUS_01250 19703 20692 gene locus_tag LOCUS_01260 19703 20692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 20705 23083 gene locus_tag LOCUS_01270 20705 23083 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582697.1 protein_id gnl|my_center|LOCUS_01270 23322 23792 gene locus_tag LOCUS_01280 23322 23792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 23785 24120 gene locus_tag LOCUS_01290 23785 24120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 25409 24171 gene locus_tag LOCUS_01300 25409 24171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 25544 26632 gene locus_tag LOCUS_01310 25544 26632 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_01310 26790 27761 gene locus_tag LOCUS_01320 26790 27761 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_01320 27796 29784 gene locus_tag LOCUS_01330 27796 29784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 29843 31834 gene locus_tag LOCUS_01340 29843 31834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 31897 33903 gene locus_tag LOCUS_01350 31897 33903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 34022 36724 gene locus_tag LOCUS_01360 34022 36724 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_01360 36724 37764 gene locus_tag LOCUS_01370 36724 37764 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766598.1 protein_id gnl|my_center|LOCUS_01370 37810 40185 gene locus_tag LOCUS_01380 37810 40185 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082594.1 protein_id gnl|my_center|LOCUS_01380 40246 41496 gene locus_tag LOCUS_01390 40246 41496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 41628 43430 gene locus_tag LOCUS_01400 41628 43430 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_01400 43519 44499 gene locus_tag LOCUS_01410 43519 44499 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_01410 44834 47098 gene locus_tag LOCUS_01420 44834 47098 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107432.1 protein_id gnl|my_center|LOCUS_01420 47200 47805 gene locus_tag LOCUS_01430 47200 47805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 48173 48439 gene locus_tag LOCUS_01440 48173 48439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 48513 49136 gene locus_tag LOCUS_01450 48513 49136 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721280.1 protein_id gnl|my_center|LOCUS_01450 50286 49270 gene locus_tag LOCUS_01460 50286 49270 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367479.1 protein_id gnl|my_center|LOCUS_01460 52004 50283 gene locus_tag LOCUS_01470 52004 50283 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861596.1 protein_id gnl|my_center|LOCUS_01470 53563 52004 gene locus_tag LOCUS_01480 53563 52004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 53711 54910 gene locus_tag LOCUS_01490 53711 54910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 56313 55114 gene locus_tag LOCUS_01500 56313 55114 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_01500 56496 58730 gene locus_tag LOCUS_01510 56496 58730 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_01510 58727 59521 gene locus_tag LOCUS_01520 58727 59521 CDS product acyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321472.1 protein_id gnl|my_center|LOCUS_01520 59518 60216 gene locus_tag LOCUS_01530 59518 60216 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267815.1 protein_id gnl|my_center|LOCUS_01530 60213 61100 gene locus_tag LOCUS_01540 60213 61100 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390165.1 protein_id gnl|my_center|LOCUS_01540 61277 62926 gene locus_tag LOCUS_01550 61277 62926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 62961 63968 gene locus_tag LOCUS_01560 62961 63968 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_01560 63982 64869 gene locus_tag LOCUS_01570 63982 64869 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_01570 65938 64928 gene locus_tag LOCUS_01580 65938 64928 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_01580 66070 67536 gene locus_tag LOCUS_01590 66070 67536 CDS product DUF5605 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080612.1 protein_id gnl|my_center|LOCUS_01590 67553 68953 gene locus_tag LOCUS_01600 67553 68953 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989642.1 protein_id gnl|my_center|LOCUS_01600 68955 69773 gene locus_tag LOCUS_01610 68955 69773 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989643.1 protein_id gnl|my_center|LOCUS_01610 69766 70692 gene locus_tag LOCUS_01620 69766 70692 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732677.1 protein_id gnl|my_center|LOCUS_01620 70689 72104 gene locus_tag LOCUS_01630 gene glpK 70689 72104 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080610.1 protein_id gnl|my_center|LOCUS_01630 72238 72909 gene locus_tag LOCUS_01640 72238 72909 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129648.1 protein_id gnl|my_center|LOCUS_01640 72909 73220 gene locus_tag LOCUS_01650 72909 73220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 >Feature sequence003 5661 70 gene locus_tag LOCUS_01660 5661 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 6967 5804 gene locus_tag LOCUS_01670 6967 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 7337 6978 gene locus_tag LOCUS_01680 7337 6978 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546712.1 protein_id gnl|my_center|LOCUS_01680 7891 7277 gene locus_tag LOCUS_01690 7891 7277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 8755 7904 gene locus_tag LOCUS_01700 gene ylqF 8755 7904 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861161.1 protein_id gnl|my_center|LOCUS_01700 9424 8759 gene locus_tag LOCUS_01710 gene trmD 9424 8759 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384686.1 protein_id gnl|my_center|LOCUS_01710 10038 9538 gene locus_tag LOCUS_01720 gene rimM 10038 9538 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965064.1 protein_id gnl|my_center|LOCUS_01720 10712 10035 gene locus_tag LOCUS_01730 gene tmk 10712 10035 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035216759.1 protein_id gnl|my_center|LOCUS_01730 11614 10733 gene locus_tag LOCUS_01740 11614 10733 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_01740 12725 11730 gene locus_tag LOCUS_01750 12725 11730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 14393 12729 gene locus_tag LOCUS_01760 14393 12729 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_01760 18092 14412 gene locus_tag LOCUS_01770 18092 14412 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 protein_id gnl|my_center|LOCUS_01770 19377 18106 gene locus_tag LOCUS_01780 gene purD 19377 18106 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_01780 20640 19456 gene locus_tag LOCUS_01790 20640 19456 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_01790 21509 20796 gene locus_tag LOCUS_01800 21509 20796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 22399 21794 gene locus_tag LOCUS_01810 gene purN 22399 21794 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_01810 23433 22396 gene locus_tag LOCUS_01820 gene purM 23433 22396 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081095.1 protein_id gnl|my_center|LOCUS_01820 24888 23443 gene locus_tag LOCUS_01830 gene purF 24888 23443 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 protein_id gnl|my_center|LOCUS_01830 25600 24890 gene locus_tag LOCUS_01840 25600 24890 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964700.1 protein_id gnl|my_center|LOCUS_01840 26176 25682 gene locus_tag LOCUS_01850 gene purE 26176 25682 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544997.1 protein_id gnl|my_center|LOCUS_01850 27461 26565 gene locus_tag LOCUS_01860 gene rbsK 27461 26565 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693668.1 protein_id gnl|my_center|LOCUS_01860 28843 27458 gene locus_tag LOCUS_01870 28843 27458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 29792 28815 gene locus_tag LOCUS_01880 29792 28815 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528958.1 protein_id gnl|my_center|LOCUS_01880 30946 29786 gene locus_tag LOCUS_01890 30946 29786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 32465 30939 gene locus_tag LOCUS_01900 32465 30939 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383861.1 protein_id gnl|my_center|LOCUS_01900 33647 32490 gene locus_tag LOCUS_01910 33647 32490 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383860.1 protein_id gnl|my_center|LOCUS_01910 34174 33707 gene locus_tag LOCUS_01920 34174 33707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 35707 34220 gene locus_tag LOCUS_01930 35707 34220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 35911 36714 gene locus_tag LOCUS_01940 35911 36714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 38096 37341 gene locus_tag LOCUS_01950 38096 37341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01950 38567 38127 gene locus_tag LOCUS_01960 38567 38127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01960 38915 38571 gene locus_tag LOCUS_01970 38915 38571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 39378 38908 gene locus_tag LOCUS_01980 39378 38908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 39901 39536 gene locus_tag LOCUS_01990 39901 39536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 40226 40915 gene locus_tag LOCUS_02000 40226 40915 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922420.1 protein_id gnl|my_center|LOCUS_02000 42505 41003 gene locus_tag LOCUS_02010 gene malQ 42505 41003 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_02010 44784 42508 gene locus_tag LOCUS_02020 44784 42508 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016705.1 protein_id gnl|my_center|LOCUS_02020 46798 44900 gene locus_tag LOCUS_02030 46798 44900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 48292 46817 gene locus_tag LOCUS_02040 48292 46817 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906091.1 protein_id gnl|my_center|LOCUS_02040 49234 48356 gene locus_tag LOCUS_02050 49234 48356 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262978.1 protein_id gnl|my_center|LOCUS_02050 50741 49236 gene locus_tag LOCUS_02060 50741 49236 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357775.1 protein_id gnl|my_center|LOCUS_02060 52068 50815 gene locus_tag LOCUS_02070 52068 50815 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399406.1 protein_id gnl|my_center|LOCUS_02070 53878 52127 gene locus_tag LOCUS_02080 53878 52127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 54404 55390 gene locus_tag LOCUS_02090 54404 55390 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498680.1 protein_id gnl|my_center|LOCUS_02090 55463 55978 gene locus_tag LOCUS_02100 55463 55978 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_02100 >Feature sequence004 645 1532 gene locus_tag LOCUS_02110 645 1532 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495563.1 protein_id gnl|my_center|LOCUS_02110 1520 2320 gene locus_tag LOCUS_02120 1520 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 2320 4848 gene locus_tag LOCUS_02130 2320 4848 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_02130 6121 4916 gene locus_tag LOCUS_02140 6121 4916 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067278.1 protein_id gnl|my_center|LOCUS_02140 6233 8674 gene locus_tag LOCUS_02150 6233 8674 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582697.1 protein_id gnl|my_center|LOCUS_02150 8664 9728 gene locus_tag LOCUS_02160 8664 9728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 9773 11737 gene locus_tag LOCUS_02170 9773 11737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 11737 13056 gene locus_tag LOCUS_02180 11737 13056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 13061 14392 gene locus_tag LOCUS_02190 13061 14392 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_02190 14401 15156 gene locus_tag LOCUS_02200 14401 15156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 15180 16133 gene locus_tag LOCUS_02210 15180 16133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 16130 18682 gene locus_tag LOCUS_02220 16130 18682 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_02220 18703 19662 gene locus_tag LOCUS_02230 18703 19662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 19706 20722 gene locus_tag LOCUS_02240 19706 20722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 20724 22244 gene locus_tag LOCUS_02250 20724 22244 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682348.1 protein_id gnl|my_center|LOCUS_02250 23521 22298 gene locus_tag LOCUS_02260 23521 22298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 23648 26362 gene locus_tag LOCUS_02270 23648 26362 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955702.1 protein_id gnl|my_center|LOCUS_02270 26502 28379 gene locus_tag LOCUS_02280 26502 28379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 28402 29037 gene locus_tag LOCUS_02290 28402 29037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 28988 29569 gene locus_tag LOCUS_02300 28988 29569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 29645 30646 gene locus_tag LOCUS_02310 29645 30646 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803821.1 protein_id gnl|my_center|LOCUS_02310 30659 31564 gene locus_tag LOCUS_02320 30659 31564 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 protein_id gnl|my_center|LOCUS_02320 31575 33950 gene locus_tag LOCUS_02330 31575 33950 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_02330 34401 34024 gene locus_tag LOCUS_02340 34401 34024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 35081 34395 gene locus_tag LOCUS_02350 35081 34395 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963990.1 protein_id gnl|my_center|LOCUS_02350 35335 36030 gene locus_tag LOCUS_02360 35335 36030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 36131 37300 gene locus_tag LOCUS_02370 36131 37300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 37302 38732 gene locus_tag LOCUS_02380 37302 38732 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_02380 38734 39219 gene locus_tag LOCUS_02390 38734 39219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 39245 39922 gene locus_tag LOCUS_02400 39245 39922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 39873 40823 gene locus_tag LOCUS_02410 39873 40823 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965413.1 protein_id gnl|my_center|LOCUS_02410 40820 41344 gene locus_tag LOCUS_02420 gene pyrR 40820 41344 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_02420 41397 42704 gene locus_tag LOCUS_02430 gene der 41397 42704 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_02430 42722 43459 gene locus_tag LOCUS_02440 gene plsY 42722 43459 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880403.1 protein_id gnl|my_center|LOCUS_02440 43627 44463 gene locus_tag LOCUS_02450 43627 44463 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476335.1 protein_id gnl|my_center|LOCUS_02450 44439 45353 gene locus_tag LOCUS_02460 44439 45353 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435657.1 protein_id gnl|my_center|LOCUS_02460 45350 46165 gene locus_tag LOCUS_02470 45350 46165 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_02470 46162 46920 gene locus_tag LOCUS_02480 gene truA 46162 46920 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_02480 46930 47817 gene locus_tag LOCUS_02490 46930 47817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 47965 49254 gene locus_tag LOCUS_02500 gene mnmE 47965 49254 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880529.1 protein_id gnl|my_center|LOCUS_02500 49264 50151 gene locus_tag LOCUS_02510 49264 50151 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462306.1 protein_id gnl|my_center|LOCUS_02510 50574 50224 gene locus_tag LOCUS_02520 50574 50224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 52445 50763 gene locus_tag LOCUS_02530 gene uidA 52445 50763 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966715.1 protein_id gnl|my_center|LOCUS_02530 53041 52442 gene locus_tag LOCUS_02540 53041 52442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 53147 53743 gene locus_tag LOCUS_02550 53147 53743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 53839 54297 gene locus_tag LOCUS_02560 53839 54297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 54294 55142 gene locus_tag LOCUS_02570 54294 55142 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674491.1 protein_id gnl|my_center|LOCUS_02570 >Feature sequence005 223 6624 gene locus_tag LOCUS_02580 223 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 6644 8485 gene locus_tag LOCUS_02590 6644 8485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 8499 10337 gene locus_tag LOCUS_02600 8499 10337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 10349 11305 gene locus_tag LOCUS_02610 10349 11305 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_02610 11302 12258 gene locus_tag LOCUS_02620 11302 12258 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776898.1 protein_id gnl|my_center|LOCUS_02620 12292 13455 gene locus_tag LOCUS_02630 12292 13455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 13457 14110 gene locus_tag LOCUS_02640 gene pgmB 13457 14110 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114408.1 protein_id gnl|my_center|LOCUS_02640 14131 15981 gene locus_tag LOCUS_02650 14131 15981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 15983 17944 gene locus_tag LOCUS_02660 15983 17944 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_02660 18110 20209 gene locus_tag LOCUS_02670 18110 20209 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_02670 20232 21473 gene locus_tag LOCUS_02680 20232 21473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 21475 22164 gene locus_tag LOCUS_02690 21475 22164 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145123293.1 protein_id gnl|my_center|LOCUS_02690 22191 22841 gene locus_tag LOCUS_02700 22191 22841 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966920.1 protein_id gnl|my_center|LOCUS_02700 24165 22966 gene locus_tag LOCUS_02710 24165 22966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 24686 24162 gene locus_tag LOCUS_02720 gene rpoE 24686 24162 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554912.1 protein_id gnl|my_center|LOCUS_02720 24920 25912 gene locus_tag LOCUS_02730 24920 25912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 26033 26407 gene locus_tag LOCUS_02740 26033 26407 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949091.1 protein_id gnl|my_center|LOCUS_02740 26519 27796 gene locus_tag LOCUS_02750 26519 27796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 28006 29229 gene locus_tag LOCUS_02760 28006 29229 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_02760 30159 29245 gene locus_tag LOCUS_02770 30159 29245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 30344 31318 gene locus_tag LOCUS_02780 30344 31318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 31332 32249 gene locus_tag LOCUS_02790 31332 32249 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112888.1 protein_id gnl|my_center|LOCUS_02790 32274 33923 gene locus_tag LOCUS_02800 32274 33923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 33948 36449 gene locus_tag LOCUS_02810 33948 36449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 36462 37664 gene locus_tag LOCUS_02820 36462 37664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 37684 44283 gene locus_tag LOCUS_02830 37684 44283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 44355 45191 gene locus_tag LOCUS_02840 44355 45191 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369253.1 protein_id gnl|my_center|LOCUS_02840 45191 46801 gene locus_tag LOCUS_02850 45191 46801 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777117.1 protein_id gnl|my_center|LOCUS_02850 46805 48823 gene locus_tag LOCUS_02860 46805 48823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 48836 49498 gene locus_tag LOCUS_02870 48836 49498 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674221.1 protein_id gnl|my_center|LOCUS_02870 49542 51086 gene locus_tag LOCUS_02880 49542 51086 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 protein_id gnl|my_center|LOCUS_02880 51096 52190 gene locus_tag LOCUS_02890 51096 52190 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_02890 52187 52708 gene locus_tag LOCUS_02900 52187 52708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 52705 53526 gene locus_tag LOCUS_02910 52705 53526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 53523 54248 gene locus_tag LOCUS_02920 gene nagB 53523 54248 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_02920 >Feature sequence006 1841 867 gene locus_tag LOCUS_02930 1841 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 3400 1838 gene locus_tag LOCUS_02940 3400 1838 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870275.1 protein_id gnl|my_center|LOCUS_02940 4881 3484 gene locus_tag LOCUS_02950 4881 3484 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461040.1 protein_id gnl|my_center|LOCUS_02950 6638 5466 gene locus_tag LOCUS_02960 6638 5466 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_02960 7597 6662 gene locus_tag LOCUS_02970 7597 6662 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_02970 12705 8011 gene locus_tag LOCUS_02980 12705 8011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 14102 12876 gene locus_tag LOCUS_02990 14102 12876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 15456 14119 gene locus_tag LOCUS_03000 15456 14119 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141444.1 protein_id gnl|my_center|LOCUS_03000 17398 15563 gene locus_tag LOCUS_03010 17398 15563 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_03010 19166 17391 gene locus_tag LOCUS_03020 19166 17391 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_03020 21122 19239 gene locus_tag LOCUS_03030 21122 19239 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257959.1 protein_id gnl|my_center|LOCUS_03030 22905 21115 gene locus_tag LOCUS_03040 22905 21115 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862455.1 protein_id gnl|my_center|LOCUS_03040 24747 23098 gene locus_tag LOCUS_03050 24747 23098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 25837 24980 gene locus_tag LOCUS_03060 gene pstB 25837 24980 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536449.1 protein_id gnl|my_center|LOCUS_03060 27633 25834 gene locus_tag LOCUS_03070 gene pstA 27633 25834 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183131.1 protein_id gnl|my_center|LOCUS_03070 28529 27651 gene locus_tag LOCUS_03080 28529 27651 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_03080 29265 28768 gene locus_tag LOCUS_03090 gene dfrA 29265 28768 CDS product dihydrofolate reductase DfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230799.1 protein_id gnl|my_center|LOCUS_03090 30092 29262 gene locus_tag LOCUS_03100 30092 29262 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_03100 31732 30089 gene locus_tag LOCUS_03110 31732 30089 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_03110 32439 31735 gene locus_tag LOCUS_03120 32439 31735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 33412 32450 gene locus_tag LOCUS_03130 33412 32450 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815913.1 protein_id gnl|my_center|LOCUS_03130 33924 33409 gene locus_tag LOCUS_03140 33924 33409 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_03140 34073 34492 gene locus_tag LOCUS_03150 34073 34492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 34630 34953 gene locus_tag LOCUS_03160 34630 34953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 35033 37129 gene locus_tag LOCUS_03170 gene rnr 35033 37129 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391084.1 protein_id gnl|my_center|LOCUS_03170 37138 37590 gene locus_tag LOCUS_03180 gene smpB 37138 37590 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_03180 37625 38896 gene locus_tag LOCUS_03190 37625 38896 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439438.1 protein_id gnl|my_center|LOCUS_03190 38899 39801 gene locus_tag LOCUS_03200 gene metA 38899 39801 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_03200 40151 39882 gene locus_tag LOCUS_03210 40151 39882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 40428 41540 gene locus_tag LOCUS_03220 40428 41540 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761753.1 protein_id gnl|my_center|LOCUS_03220 43073 41610 gene locus_tag LOCUS_03230 gene xylB 43073 41610 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_03230 43249 43091 gene locus_tag LOCUS_03240 43249 43091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 43865 43260 gene locus_tag LOCUS_03250 43865 43260 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775494.1 protein_id gnl|my_center|LOCUS_03250 45361 43868 gene locus_tag LOCUS_03260 45361 43868 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_03260 45730 45640 gene locus_tag LOCUS_t00030 45730 45640 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 47340 45862 gene locus_tag LOCUS_03270 47340 45862 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061775.1 protein_id gnl|my_center|LOCUS_03270 48297 47587 gene locus_tag LOCUS_03280 gene sigE 48297 47587 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_03280 49084 48215 gene locus_tag LOCUS_03290 49084 48215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 >Feature sequence007 <1 524 gene locus_tag LOCUS_03300 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002357775.1:sugar ABC transporter permease 521 1363 gene locus_tag LOCUS_03310 521 1363 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360454.1 protein_id gnl|my_center|LOCUS_03310 2056 1499 gene locus_tag LOCUS_03320 2056 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 3567 2398 gene locus_tag LOCUS_03330 3567 2398 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116878287.1 protein_id gnl|my_center|LOCUS_03330 4533 3733 gene locus_tag LOCUS_03340 4533 3733 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_03340 5114 4569 gene locus_tag LOCUS_03350 5114 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 5804 5253 gene locus_tag LOCUS_03360 5804 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 6477 5896 gene locus_tag LOCUS_03370 6477 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 6791 6570 gene locus_tag LOCUS_03380 6791 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 7796 6804 gene locus_tag LOCUS_03390 7796 6804 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389640.1 protein_id gnl|my_center|LOCUS_03390 8638 7793 gene locus_tag LOCUS_03400 8638 7793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 10224 8731 gene locus_tag LOCUS_03410 10224 8731 CDS product DUF2779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846383.1 protein_id gnl|my_center|LOCUS_03410 11114 10266 gene locus_tag LOCUS_03420 11114 10266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 12899 11127 gene locus_tag LOCUS_03430 12899 11127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 13657 12968 gene locus_tag LOCUS_03440 13657 12968 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966072.1 protein_id gnl|my_center|LOCUS_03440 15036 13753 gene locus_tag LOCUS_03450 15036 13753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 15711 15190 gene locus_tag LOCUS_03460 15711 15190 CDS product SLOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323417.1 protein_id gnl|my_center|LOCUS_03460 16269 15718 gene locus_tag LOCUS_03470 16269 15718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 17340 16273 gene locus_tag LOCUS_03480 17340 16273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 17894 17337 gene locus_tag LOCUS_03490 17894 17337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 19117 17996 gene locus_tag LOCUS_03500 19117 17996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 19965 19168 gene locus_tag LOCUS_03510 19965 19168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 20657 19983 gene locus_tag LOCUS_03520 20657 19983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 21090 20668 gene locus_tag LOCUS_03530 21090 20668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 23228 21087 gene locus_tag LOCUS_03540 23228 21087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 23455 23664 gene locus_tag LOCUS_03550 23455 23664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 24603 23782 gene locus_tag LOCUS_03560 24603 23782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 25287 24718 gene locus_tag LOCUS_03570 25287 24718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03570 27840 25306 gene locus_tag LOCUS_03580 27840 25306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 29474 27855 gene locus_tag LOCUS_03590 29474 27855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 30426 29971 gene locus_tag LOCUS_03600 30426 29971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 31099 30488 gene locus_tag LOCUS_03610 31099 30488 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740920.1 protein_id gnl|my_center|LOCUS_03610 31634 31080 gene locus_tag LOCUS_03620 31634 31080 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054641.1 protein_id gnl|my_center|LOCUS_03620 31878 33710 gene locus_tag LOCUS_03630 31878 33710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 34552 33755 gene locus_tag LOCUS_03640 34552 33755 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014612372.1 protein_id gnl|my_center|LOCUS_03640 34606 36294 gene locus_tag LOCUS_03650 34606 36294 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922389.1 protein_id gnl|my_center|LOCUS_03650 36296 37756 gene locus_tag LOCUS_03660 36296 37756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 37768 39159 gene locus_tag LOCUS_03670 37768 39159 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357775.1 protein_id gnl|my_center|LOCUS_03670 39156 40001 gene locus_tag LOCUS_03680 39156 40001 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360454.1 protein_id gnl|my_center|LOCUS_03680 40378 40292 gene locus_tag LOCUS_t00040 40378 40292 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 40588 40514 gene locus_tag LOCUS_t00050 40588 40514 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence008 3068 2514 gene locus_tag LOCUS_03690 3068 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 4598 3192 gene locus_tag LOCUS_03700 gene rlmD 4598 3192 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_03700 5210 4680 gene locus_tag LOCUS_03710 5210 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 5828 5220 gene locus_tag LOCUS_03720 5828 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 6723 5854 gene locus_tag LOCUS_03730 6723 5854 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_03730 7738 6725 gene locus_tag LOCUS_03740 gene trpS 7738 6725 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454934.1 protein_id gnl|my_center|LOCUS_03740 11026 7931 gene locus_tag LOCUS_03750 11026 7931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 11315 12250 gene locus_tag LOCUS_03760 11315 12250 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932731.1 protein_id gnl|my_center|LOCUS_03760 13185 12325 gene locus_tag LOCUS_03770 13185 12325 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202730.1 protein_id gnl|my_center|LOCUS_03770 14017 13271 gene locus_tag LOCUS_03780 gene recO 14017 13271 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941240.1 protein_id gnl|my_center|LOCUS_03780 15091 14198 gene locus_tag LOCUS_03790 gene era 15091 14198 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047995.1 protein_id gnl|my_center|LOCUS_03790 15561 15088 gene locus_tag LOCUS_03800 15561 15088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 17053 15554 gene locus_tag LOCUS_03810 17053 15554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 18060 17050 gene locus_tag LOCUS_03820 18060 17050 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_03820 18911 18057 gene locus_tag LOCUS_03830 18911 18057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 19155 18913 gene locus_tag LOCUS_03840 19155 18913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 19957 19274 gene locus_tag LOCUS_03850 19957 19274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 20331 20137 gene locus_tag LOCUS_03860 20331 20137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 21567 20548 gene locus_tag LOCUS_03870 gene gap 21567 20548 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_03870 23233 21737 gene locus_tag LOCUS_03880 gene thrC 23233 21737 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263406.1 protein_id gnl|my_center|LOCUS_03880 23769 23362 gene locus_tag LOCUS_03890 23769 23362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_03890 25078 23882 gene locus_tag LOCUS_03900 25078 23882 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986780.1 protein_id gnl|my_center|LOCUS_03900 26189 25122 gene locus_tag LOCUS_03910 gene prfA 26189 25122 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_03910 28048 26216 gene locus_tag LOCUS_03920 28048 26216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 28342 28139 gene locus_tag LOCUS_03930 gene rpmE 28342 28139 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994430.1 protein_id gnl|my_center|LOCUS_03930 28593 29600 gene locus_tag LOCUS_03940 28593 29600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 29663 30463 gene locus_tag LOCUS_03950 29663 30463 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 protein_id gnl|my_center|LOCUS_03950 30465 30998 gene locus_tag LOCUS_03960 gene yfcE 30465 30998 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_03960 31181 31411 gene locus_tag LOCUS_03970 31181 31411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 32529 31480 gene locus_tag LOCUS_03980 32529 31480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 33182 32538 gene locus_tag LOCUS_03990 33182 32538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03990 33400 33074 gene locus_tag LOCUS_04000 33400 33074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 33544 34923 gene locus_tag LOCUS_04010 33544 34923 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_04010 34911 36074 gene locus_tag LOCUS_04020 34911 36074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 36071 36388 gene locus_tag LOCUS_04030 36071 36388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 36529 36813 gene locus_tag LOCUS_04040 gene rpsF 36529 36813 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462318.1 protein_id gnl|my_center|LOCUS_04040 36830 37264 gene locus_tag LOCUS_04050 gene ssb 36830 37264 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934759.1 protein_id gnl|my_center|LOCUS_04050 37297 37665 gene locus_tag LOCUS_04060 37297 37665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 >Feature sequence009 <1 1104 gene locus_tag LOCUS_04070 <1 1104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032841481.1:DUF4975 domain-containing protein 1121 2596 gene locus_tag LOCUS_04080 1121 2596 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963747.1 protein_id gnl|my_center|LOCUS_04080 3731 2742 gene locus_tag LOCUS_04090 3731 2742 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_04090 4919 3732 gene locus_tag LOCUS_04100 4919 3732 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_04100 6577 4916 gene locus_tag LOCUS_04110 6577 4916 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865052.1 protein_id gnl|my_center|LOCUS_04110 7894 6680 gene locus_tag LOCUS_04120 7894 6680 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339413.1 protein_id gnl|my_center|LOCUS_04120 8538 7963 gene locus_tag LOCUS_04130 8538 7963 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476270.1 protein_id gnl|my_center|LOCUS_04130 8754 11207 gene locus_tag LOCUS_04140 8754 11207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 11352 11771 gene locus_tag LOCUS_04150 gene mutT 11352 11771 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932370.1 protein_id gnl|my_center|LOCUS_04150 12696 11917 gene locus_tag LOCUS_04160 12696 11917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 13062 13916 gene locus_tag LOCUS_04170 13062 13916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 13913 14344 gene locus_tag LOCUS_04180 13913 14344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 14357 14872 gene locus_tag LOCUS_04190 14357 14872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 14869 16611 gene locus_tag LOCUS_04200 gene atpA 14869 16611 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356056.1 protein_id gnl|my_center|LOCUS_04200 16612 17496 gene locus_tag LOCUS_04210 gene atpG 16612 17496 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_04210 17493 18893 gene locus_tag LOCUS_04220 gene atpD 17493 18893 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_04220 18893 19297 gene locus_tag LOCUS_04230 18893 19297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 19608 20678 gene locus_tag LOCUS_04240 19608 20678 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_04240 20692 21657 gene locus_tag LOCUS_04250 20692 21657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 21674 23737 gene locus_tag LOCUS_04260 21674 23737 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470194.1 protein_id gnl|my_center|LOCUS_04260 25902 23848 gene locus_tag LOCUS_04270 25902 23848 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_04270 26355 25915 gene locus_tag LOCUS_04280 26355 25915 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680049.1 protein_id gnl|my_center|LOCUS_04280 27178 26357 gene locus_tag LOCUS_04290 27178 26357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04290 27634 27197 gene locus_tag LOCUS_04300 27634 27197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04300 27831 28208 gene locus_tag LOCUS_04310 27831 28208 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_04310 28205 29044 gene locus_tag LOCUS_04320 28205 29044 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_04320 29041 29661 gene locus_tag LOCUS_04330 29041 29661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 30126 31553 gene locus_tag LOCUS_04340 30126 31553 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892302.1 protein_id gnl|my_center|LOCUS_04340 31924 32910 gene locus_tag LOCUS_04350 31924 32910 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430615.1 protein_id gnl|my_center|LOCUS_04350 32910 33107 gene locus_tag LOCUS_04360 32910 33107 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393745.1 protein_id gnl|my_center|LOCUS_04360 >Feature sequence010 1674 1519 gene locus_tag LOCUS_04370 1674 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 3300 1708 gene locus_tag LOCUS_04380 3300 1708 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101306.1 protein_id gnl|my_center|LOCUS_04380 4313 3279 gene locus_tag LOCUS_04390 4313 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 5598 4306 gene locus_tag LOCUS_04400 5598 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 6608 5595 gene locus_tag LOCUS_04410 6608 5595 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 protein_id gnl|my_center|LOCUS_04410 7585 6632 gene locus_tag LOCUS_04420 7585 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 9367 7604 gene locus_tag LOCUS_04430 9367 7604 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104219.1 protein_id gnl|my_center|LOCUS_04430 10425 9364 gene locus_tag LOCUS_04440 10425 9364 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426511.1 protein_id gnl|my_center|LOCUS_04440 11561 10422 gene locus_tag LOCUS_04450 11561 10422 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765279.1 protein_id gnl|my_center|LOCUS_04450 12267 11581 gene locus_tag LOCUS_04460 12267 11581 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986980.1 protein_id gnl|my_center|LOCUS_04460 12716 12630 gene locus_tag LOCUS_t00060 12716 12630 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12816 15350 gene locus_tag LOCUS_04470 gene polA 12816 15350 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038317.1 protein_id gnl|my_center|LOCUS_04470 15340 15927 gene locus_tag LOCUS_04480 gene coaE 15340 15927 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173002.1 protein_id gnl|my_center|LOCUS_04480 15966 16478 gene locus_tag LOCUS_04490 15966 16478 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393337.1 protein_id gnl|my_center|LOCUS_04490 16562 16646 gene locus_tag LOCUS_t00070 16562 16646 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18953 16824 gene locus_tag LOCUS_04500 18953 16824 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965152.1 protein_id gnl|my_center|LOCUS_04500 19696 18950 gene locus_tag LOCUS_04510 19696 18950 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460203.1 protein_id gnl|my_center|LOCUS_04510 20703 19696 gene locus_tag LOCUS_04520 20703 19696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 22014 20770 gene locus_tag LOCUS_04530 22014 20770 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_04530 23592 22126 gene locus_tag LOCUS_04540 gene spoIVA 23592 22126 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944577.1 protein_id gnl|my_center|LOCUS_04540 24462 23710 gene locus_tag LOCUS_04550 24462 23710 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020462.1 protein_id gnl|my_center|LOCUS_04550 25372 24533 gene locus_tag LOCUS_04560 25372 24533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 27050 25383 gene locus_tag LOCUS_04570 27050 25383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 27922 27047 gene locus_tag LOCUS_04580 gene hslO 27922 27047 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148598.1 protein_id gnl|my_center|LOCUS_04580 28647 27907 gene locus_tag LOCUS_04590 28647 27907 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229973.1 protein_id gnl|my_center|LOCUS_04590 29945 28647 gene locus_tag LOCUS_04600 29945 28647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 30365 31450 gene locus_tag LOCUS_04610 gene asd 30365 31450 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963889.1 protein_id gnl|my_center|LOCUS_04610 31487 32377 gene locus_tag LOCUS_04620 gene dapA 31487 32377 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438799.1 protein_id gnl|my_center|LOCUS_04620 32374 33126 gene locus_tag LOCUS_04630 gene dapB 32374 33126 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438808.1 protein_id gnl|my_center|LOCUS_04630 >Feature sequence011 2641 509 gene locus_tag LOCUS_04640 gene relA 2641 509 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262795.1 protein_id gnl|my_center|LOCUS_04640 4984 2669 gene locus_tag LOCUS_04650 4984 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 6094 5093 gene locus_tag LOCUS_04660 6094 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 7580 6087 gene locus_tag LOCUS_04670 7580 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 9007 7700 gene locus_tag LOCUS_04680 gene scfB 9007 7700 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_04680 9291 9139 gene locus_tag LOCUS_04690 gene scfA 9291 9139 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_04690 9734 9357 gene locus_tag LOCUS_04700 9734 9357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 10314 9817 gene locus_tag LOCUS_04710 10314 9817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 11600 10467 gene locus_tag LOCUS_04720 gene tgt 11600 10467 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_04720 11970 11659 gene locus_tag LOCUS_04730 11970 11659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 12258 11989 gene locus_tag LOCUS_04740 12258 11989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 13480 12449 gene locus_tag LOCUS_04750 gene queA 13480 12449 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_04750 14628 13561 gene locus_tag LOCUS_04760 gene ruvB 14628 13561 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_04760 15231 14641 gene locus_tag LOCUS_04770 gene ruvA 15231 14641 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859897.1 protein_id gnl|my_center|LOCUS_04770 15747 15250 gene locus_tag LOCUS_04780 gene ruvC 15747 15250 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_04780 15941 17317 gene locus_tag LOCUS_04790 gene argH 15941 17317 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_04790 17454 19112 gene locus_tag LOCUS_04800 gene ilvB 17454 19112 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_04800 19112 19627 gene locus_tag LOCUS_04810 gene ilvN 19112 19627 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_04810 20058 21725 gene locus_tag LOCUS_04820 gene ilvD 20058 21725 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966447.1 protein_id gnl|my_center|LOCUS_04820 23205 21865 gene locus_tag LOCUS_04830 23205 21865 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_04830 24202 23381 gene locus_tag LOCUS_04840 24202 23381 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225080.1 protein_id gnl|my_center|LOCUS_04840 24312 25565 gene locus_tag LOCUS_04850 gene leuC 24312 25565 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895941.1 protein_id gnl|my_center|LOCUS_04850 25567 26049 gene locus_tag LOCUS_04860 gene leuD 25567 26049 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_04860 26046 26462 gene locus_tag LOCUS_04870 26046 26462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 26470 27030 gene locus_tag LOCUS_04880 26470 27030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 27032 28120 gene locus_tag LOCUS_04890 gene leuB 27032 28120 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_04890 28117 28791 gene locus_tag LOCUS_04900 28117 28791 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965420.1 protein_id gnl|my_center|LOCUS_04900 29054 29968 gene locus_tag LOCUS_04910 29054 29968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 30073 30375 gene locus_tag LOCUS_04920 30073 30375 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811036.1 protein_id gnl|my_center|LOCUS_04920 30372 30746 gene locus_tag LOCUS_04930 30372 30746 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811035.1 protein_id gnl|my_center|LOCUS_04930 30743 31807 gene locus_tag LOCUS_04940 30743 31807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 >Feature sequence012 635 9 gene locus_tag LOCUS_04950 635 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 3204 790 gene locus_tag LOCUS_04960 3204 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 4509 3286 gene locus_tag LOCUS_04970 4509 3286 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_04970 4674 5981 gene locus_tag LOCUS_04980 4674 5981 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_04980 7051 6056 gene locus_tag LOCUS_04990 7051 6056 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262467.1 protein_id gnl|my_center|LOCUS_04990 8200 7253 gene locus_tag LOCUS_05000 8200 7253 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715519.1 protein_id gnl|my_center|LOCUS_05000 8884 8204 gene locus_tag LOCUS_05010 8884 8204 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263190.1 protein_id gnl|my_center|LOCUS_05010 9771 9094 gene locus_tag LOCUS_05020 9771 9094 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966326.1 protein_id gnl|my_center|LOCUS_05020 11263 9797 gene locus_tag LOCUS_05030 11263 9797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 12878 11457 gene locus_tag LOCUS_05040 12878 11457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 14662 12875 gene locus_tag LOCUS_05050 14662 12875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 14903 16267 gene locus_tag LOCUS_05060 14903 16267 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798170.1 protein_id gnl|my_center|LOCUS_05060 16804 16364 gene locus_tag LOCUS_05070 16804 16364 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816014.1 protein_id gnl|my_center|LOCUS_05070 17307 17232 gene locus_tag LOCUS_t00080 17307 17232 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 18949 17606 gene locus_tag LOCUS_05080 18949 17606 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_05080 23527 18962 gene locus_tag LOCUS_05090 23527 18962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 24690 23539 gene locus_tag LOCUS_05100 24690 23539 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583995.1 protein_id gnl|my_center|LOCUS_05100 25661 24714 gene locus_tag LOCUS_05110 gene araQ 25661 24714 CDS product arabinose ABC transporter permease AraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229508.1 protein_id gnl|my_center|LOCUS_05110 26716 25658 gene locus_tag LOCUS_05120 26716 25658 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083605764.1 protein_id gnl|my_center|LOCUS_05120 28070 26730 gene locus_tag LOCUS_05130 28070 26730 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028589.1 protein_id gnl|my_center|LOCUS_05130 29314 28307 gene locus_tag LOCUS_05140 29314 28307 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583096.1 protein_id gnl|my_center|LOCUS_05140 30816 29311 gene locus_tag LOCUS_05150 30816 29311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 31097 31480 gene locus_tag LOCUS_tm00010 31097 31480 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence013 1957 59 gene locus_tag LOCUS_05160 1957 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 2105 1947 gene locus_tag LOCUS_05170 2105 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 2205 2486 gene locus_tag LOCUS_05180 2205 2486 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_05180 2503 2718 gene locus_tag LOCUS_05190 2503 2718 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_05190 14994 2836 gene locus_tag LOCUS_05200 14994 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 15908 15006 gene locus_tag LOCUS_05210 15908 15006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 16606 16343 gene locus_tag LOCUS_05220 16606 16343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 16911 16675 gene locus_tag LOCUS_05230 16911 16675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 17689 16913 gene locus_tag LOCUS_05240 17689 16913 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596591.1 protein_id gnl|my_center|LOCUS_05240 18156 17767 gene locus_tag LOCUS_05250 18156 17767 CDS product YopX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047624.1 protein_id gnl|my_center|LOCUS_05250 18413 18228 gene locus_tag LOCUS_05260 18413 18228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 19405 18389 gene locus_tag LOCUS_05270 19405 18389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 20522 20097 gene locus_tag LOCUS_05280 20522 20097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 20876 20730 gene locus_tag LOCUS_05290 20876 20730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 21147 20914 gene locus_tag LOCUS_05300 21147 20914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 21312 21557 gene locus_tag LOCUS_05310 21312 21557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 21719 22072 gene locus_tag LOCUS_05320 21719 22072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 22142 22306 gene locus_tag LOCUS_05330 22142 22306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 22303 22647 gene locus_tag LOCUS_05340 22303 22647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 23000 22710 gene locus_tag LOCUS_05350 23000 22710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 23352 23002 gene locus_tag LOCUS_05360 23352 23002 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766756.1 protein_id gnl|my_center|LOCUS_05360 23615 23791 gene locus_tag LOCUS_05370 23615 23791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 23788 24963 gene locus_tag LOCUS_05380 23788 24963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 25185 25103 gene locus_tag LOCUS_t00090 25185 25103 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 25878 25198 gene locus_tag LOCUS_05390 25878 25198 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245002.1 protein_id gnl|my_center|LOCUS_05390 26714 25875 gene locus_tag LOCUS_05400 26714 25875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 28249 26714 gene locus_tag LOCUS_05410 28249 26714 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_05410 28732 28280 gene locus_tag LOCUS_05420 gene rpiB 28732 28280 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966164.1 protein_id gnl|my_center|LOCUS_05420 29223 28729 gene locus_tag LOCUS_05430 29223 28729 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437844.1 protein_id gnl|my_center|LOCUS_05430 30258 29266 gene locus_tag LOCUS_05440 30258 29266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 <31296 30262 gene locus_tag LOCUS_05450 <31296 30262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003226923.1:replicative DNA helicase >Feature sequence014 126 716 gene locus_tag LOCUS_05460 gene clpP 126 716 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_05460 738 1973 gene locus_tag LOCUS_05470 gene clpX 738 1973 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_05470 2219 2470 gene locus_tag LOCUS_05480 2219 2470 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393237.1 protein_id gnl|my_center|LOCUS_05480 2483 3508 gene locus_tag LOCUS_05490 2483 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 3513 4256 gene locus_tag LOCUS_05500 3513 4256 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439810.1 protein_id gnl|my_center|LOCUS_05500 4253 4957 gene locus_tag LOCUS_05510 gene ssuB 4253 4957 CDS product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090506.1 protein_id gnl|my_center|LOCUS_05510 5039 6673 gene locus_tag LOCUS_05520 5039 6673 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817202.1 protein_id gnl|my_center|LOCUS_05520 6694 7818 gene locus_tag LOCUS_05530 6694 7818 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459714.1 protein_id gnl|my_center|LOCUS_05530 7846 8424 gene locus_tag LOCUS_05540 7846 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 8421 8843 gene locus_tag LOCUS_05550 8421 8843 CDS product DUF1893 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761597.1 protein_id gnl|my_center|LOCUS_05550 9023 9712 gene locus_tag LOCUS_05560 9023 9712 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902398.1 protein_id gnl|my_center|LOCUS_05560 9706 10500 gene locus_tag LOCUS_05570 9706 10500 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124353.1 protein_id gnl|my_center|LOCUS_05570 10475 11188 gene locus_tag LOCUS_05580 10475 11188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 11293 11853 gene locus_tag LOCUS_05590 11293 11853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 11823 12200 gene locus_tag LOCUS_05600 11823 12200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 12208 13008 gene locus_tag LOCUS_05610 12208 13008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 13076 13780 gene locus_tag LOCUS_05620 13076 13780 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921919.1 protein_id gnl|my_center|LOCUS_05620 14470 13871 gene locus_tag LOCUS_05630 gene lexA 14470 13871 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392634.1 protein_id gnl|my_center|LOCUS_05630 14612 14797 gene locus_tag LOCUS_05640 14612 14797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 16017 14848 gene locus_tag LOCUS_05650 gene hflX 16017 14848 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048525537.1 protein_id gnl|my_center|LOCUS_05650 17078 16014 gene locus_tag LOCUS_05660 17078 16014 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_05660 19226 17619 gene locus_tag LOCUS_05670 19226 17619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 21896 19503 gene locus_tag LOCUS_05680 gene glgP 21896 19503 CDS product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494109.1 protein_id gnl|my_center|LOCUS_05680 23641 21968 gene locus_tag LOCUS_05690 gene glgA 23641 21968 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_05690 24791 23682 gene locus_tag LOCUS_05700 gene glgD 24791 23682 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_05700 25993 24797 gene locus_tag LOCUS_05710 gene glgC 25993 24797 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057611.1 protein_id gnl|my_center|LOCUS_05710 28105 26021 gene locus_tag LOCUS_05720 gene glgB 28105 26021 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880434.1 protein_id gnl|my_center|LOCUS_05720 >Feature sequence015 1337 30 gene locus_tag LOCUS_05730 1337 30 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_05730 2189 1341 gene locus_tag LOCUS_05740 2189 1341 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232221.1 protein_id gnl|my_center|LOCUS_05740 2220 3158 gene locus_tag LOCUS_05750 2220 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 3958 3152 gene locus_tag LOCUS_05760 3958 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 4983 3955 gene locus_tag LOCUS_05770 4983 3955 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_05770 5460 4987 gene locus_tag LOCUS_05780 gene coaD 5460 4987 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962815.1 protein_id gnl|my_center|LOCUS_05780 6011 5457 gene locus_tag LOCUS_05790 gene rsmD 6011 5457 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_05790 6769 6008 gene locus_tag LOCUS_05800 6769 6008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 7374 6847 gene locus_tag LOCUS_05810 7374 6847 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258342.1 protein_id gnl|my_center|LOCUS_05810 8341 7364 gene locus_tag LOCUS_05820 gene alr 8341 7364 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384180.1 protein_id gnl|my_center|LOCUS_05820 9134 8676 gene locus_tag LOCUS_05830 gene tnpA 9134 8676 CDS product IS200/IS605-like element IS1541A family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213759.1 protein_id gnl|my_center|LOCUS_05830 10059 9361 gene locus_tag LOCUS_05840 10059 9361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 10868 10092 gene locus_tag LOCUS_05850 10868 10092 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964615.1 protein_id gnl|my_center|LOCUS_05850 11523 10846 gene locus_tag LOCUS_05860 11523 10846 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917062.1 protein_id gnl|my_center|LOCUS_05860 12591 11524 gene locus_tag LOCUS_05870 gene rpoD 12591 11524 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_05870 14471 12702 gene locus_tag LOCUS_05880 14471 12702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 15460 14468 gene locus_tag LOCUS_05890 15460 14468 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_05890 16465 15752 gene locus_tag LOCUS_05900 16465 15752 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948252.1 protein_id gnl|my_center|LOCUS_05900 16998 16462 gene locus_tag LOCUS_05910 16998 16462 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_05910 17417 16995 gene locus_tag LOCUS_05920 gene aroQ 17417 16995 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757082.1 protein_id gnl|my_center|LOCUS_05920 18253 17414 gene locus_tag LOCUS_05930 18253 17414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 19311 18247 gene locus_tag LOCUS_05940 gene aroB 19311 18247 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439805.1 protein_id gnl|my_center|LOCUS_05940 20435 19308 gene locus_tag LOCUS_05950 gene aroC 20435 19308 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768335.1 protein_id gnl|my_center|LOCUS_05950 21461 20439 gene locus_tag LOCUS_05960 21461 20439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 22249 21368 gene locus_tag LOCUS_05970 22249 21368 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232221.1 protein_id gnl|my_center|LOCUS_05970 22443 23204 gene locus_tag LOCUS_05980 22443 23204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 24049 23210 gene locus_tag LOCUS_05990 24049 23210 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287898.1 protein_id gnl|my_center|LOCUS_05990 24892 24053 gene locus_tag LOCUS_06000 24892 24053 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369253.1 protein_id gnl|my_center|LOCUS_06000 25498 25061 gene locus_tag LOCUS_06010 gene dtd 25498 25061 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_06010 >Feature sequence016 160 1473 gene locus_tag LOCUS_06020 160 1473 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_06020 2111 3286 gene locus_tag LOCUS_06030 2111 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 3315 4151 gene locus_tag LOCUS_06040 3315 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 4329 5129 gene locus_tag LOCUS_06050 4329 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 5489 6142 gene locus_tag LOCUS_06060 5489 6142 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281989.1 protein_id gnl|my_center|LOCUS_06060 6245 6499 gene locus_tag LOCUS_06070 6245 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 6709 7014 gene locus_tag LOCUS_06080 gene csoR 6709 7014 CDS product copper-sensing transcriptional repressor CsoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228404.1 protein_id gnl|my_center|LOCUS_06080 7222 9633 gene locus_tag LOCUS_06090 7222 9633 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_06090 10060 9785 gene locus_tag LOCUS_06100 10060 9785 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836838.1 protein_id gnl|my_center|LOCUS_06100 10229 10564 gene locus_tag LOCUS_06110 10229 10564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 10686 12488 gene locus_tag LOCUS_06120 gene uvrC 10686 12488 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_06120 12492 13334 gene locus_tag LOCUS_06130 12492 13334 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462186.1 protein_id gnl|my_center|LOCUS_06130 13331 14257 gene locus_tag LOCUS_06140 gene hprK 13331 14257 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 protein_id gnl|my_center|LOCUS_06140 14254 16437 gene locus_tag LOCUS_06150 14254 16437 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048131.1 protein_id gnl|my_center|LOCUS_06150 16434 18785 gene locus_tag LOCUS_06160 16434 18785 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048130.1 protein_id gnl|my_center|LOCUS_06160 18883 19584 gene locus_tag LOCUS_06170 18883 19584 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183748.1 protein_id gnl|my_center|LOCUS_06170 19638 20876 gene locus_tag LOCUS_06180 19638 20876 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245717.1 protein_id gnl|my_center|LOCUS_06180 20873 21406 gene locus_tag LOCUS_06190 20873 21406 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_06190 21403 22104 gene locus_tag LOCUS_06200 21403 22104 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_06200 22187 22414 gene locus_tag LOCUS_06210 gene acpP 22187 22414 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902726.1 protein_id gnl|my_center|LOCUS_06210 22577 22876 gene locus_tag LOCUS_06220 22577 22876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 22873 24384 gene locus_tag LOCUS_06230 22873 24384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 24386 25033 gene locus_tag LOCUS_06240 24386 25033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 >Feature sequence017 1943 549 gene locus_tag LOCUS_06250 gene abnB 1943 549 CDS product arabinan endo-1,5-alpha-L-arabinosidase AbnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244268.1 protein_id gnl|my_center|LOCUS_06250 3145 2105 gene locus_tag LOCUS_06260 3145 2105 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113800.1 protein_id gnl|my_center|LOCUS_06260 4298 3159 gene locus_tag LOCUS_06270 4298 3159 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776897.1 protein_id gnl|my_center|LOCUS_06270 6881 4416 gene locus_tag LOCUS_06280 6881 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 8444 7554 gene locus_tag LOCUS_06290 8444 7554 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_06290 9225 8449 gene locus_tag LOCUS_06300 gene soj 9225 8449 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_06300 11238 9244 gene locus_tag LOCUS_06310 11238 9244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 12400 11642 gene locus_tag LOCUS_06320 12400 11642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 12479 13087 gene locus_tag LOCUS_06330 gene yyaC 12479 13087 CDS product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398420.1 protein_id gnl|my_center|LOCUS_06330 13198 13428 gene locus_tag LOCUS_06340 13198 13428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 13945 13580 gene locus_tag LOCUS_06350 13945 13580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 14212 14039 gene locus_tag LOCUS_06360 14212 14039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 15333 14350 gene locus_tag LOCUS_06370 15333 14350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 16766 15354 gene locus_tag LOCUS_06380 16766 15354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 17108 16806 gene locus_tag LOCUS_06390 gene yidD 17108 16806 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701741.1 protein_id gnl|my_center|LOCUS_06390 17424 17044 gene locus_tag LOCUS_06400 gene rnpA 17424 17044 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542420.1 protein_id gnl|my_center|LOCUS_06400 17572 17438 gene locus_tag LOCUS_06410 gene rpmH 17572 17438 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640225.1 protein_id gnl|my_center|LOCUS_06410 18751 17654 gene locus_tag LOCUS_06420 gene dnaN 18751 17654 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_06420 19289 19981 gene locus_tag LOCUS_06430 gene rsmG 19289 19981 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 protein_id gnl|my_center|LOCUS_06430 19978 20433 gene locus_tag LOCUS_06440 19978 20433 CDS product SLOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485423.1 protein_id gnl|my_center|LOCUS_06440 20446 21015 gene locus_tag LOCUS_06450 20446 21015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 21433 22869 gene locus_tag LOCUS_06460 21433 22869 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_06460 23053 24411 gene locus_tag LOCUS_06470 23053 24411 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814758.1 protein_id gnl|my_center|LOCUS_06470 24813 24460 gene locus_tag LOCUS_06480 24813 24460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 >Feature sequence018 1123 680 gene locus_tag LOCUS_06490 gene rplI 1123 680 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_06490 1231 1389 gene locus_tag LOCUS_06500 1231 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 1626 2528 gene locus_tag LOCUS_06510 1626 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 2569 3453 gene locus_tag LOCUS_06520 gene murB 2569 3453 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943692.1 protein_id gnl|my_center|LOCUS_06520 3543 4313 gene locus_tag LOCUS_06530 3543 4313 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436256.1 protein_id gnl|my_center|LOCUS_06530 4393 5307 gene locus_tag LOCUS_06540 gene whiA 4393 5307 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_06540 5304 8885 gene locus_tag LOCUS_06550 5304 8885 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_06550 8991 9953 gene locus_tag LOCUS_06560 gene pfkA 8991 9953 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429132.1 protein_id gnl|my_center|LOCUS_06560 10180 11103 gene locus_tag LOCUS_06570 gene pfkB 10180 11103 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884013.1 protein_id gnl|my_center|LOCUS_06570 11353 13524 gene locus_tag LOCUS_06580 gene nrdD 11353 13524 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837630.1 protein_id gnl|my_center|LOCUS_06580 13525 14046 gene locus_tag LOCUS_06590 gene nrdG 13525 14046 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_06590 14167 15393 gene locus_tag LOCUS_06600 14167 15393 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429165.1 protein_id gnl|my_center|LOCUS_06600 15474 16622 gene locus_tag LOCUS_06610 15474 16622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 16626 17573 gene locus_tag LOCUS_06620 16626 17573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 17575 18903 gene locus_tag LOCUS_06630 17575 18903 CDS product Trk family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888508.1 protein_id gnl|my_center|LOCUS_06630 18930 19583 gene locus_tag LOCUS_06640 gene ktrC 18930 19583 CDS product Ktr system potassium transporter KtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222311.1 protein_id gnl|my_center|LOCUS_06640 19692 20564 gene locus_tag LOCUS_06650 19692 20564 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943378.1 protein_id gnl|my_center|LOCUS_06650 20685 21203 gene locus_tag LOCUS_06660 20685 21203 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_06660 21807 21304 gene locus_tag LOCUS_06670 21807 21304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 21904 22083 gene locus_tag LOCUS_06680 21904 22083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 22270 24228 gene locus_tag LOCUS_06690 22270 24228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 24625 24549 gene locus_tag LOCUS_t00100 24625 24549 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence019 1 1041 gene locus_tag LOCUS_06700 1 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 1280 2119 gene locus_tag LOCUS_06710 gene spoIIIAA 1280 2119 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965393.1 protein_id gnl|my_center|LOCUS_06710 2106 2576 gene locus_tag LOCUS_06720 2106 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 2579 2776 gene locus_tag LOCUS_06730 2579 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 2778 3170 gene locus_tag LOCUS_06740 gene spoIIIAD 2778 3170 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359080.1 protein_id gnl|my_center|LOCUS_06740 3167 4351 gene locus_tag LOCUS_06750 gene spoIIIAE 3167 4351 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438121.1 protein_id gnl|my_center|LOCUS_06750 4351 4809 gene locus_tag LOCUS_06760 4351 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 4806 5153 gene locus_tag LOCUS_06770 4806 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 5184 5669 gene locus_tag LOCUS_06780 5184 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 5749 6132 gene locus_tag LOCUS_06790 5749 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 6184 6576 gene locus_tag LOCUS_06800 gene nusB 6184 6576 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632549.1 protein_id gnl|my_center|LOCUS_06800 6573 7421 gene locus_tag LOCUS_06810 gene folD 6573 7421 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_06810 7418 8290 gene locus_tag LOCUS_06820 7418 8290 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055875.1 protein_id gnl|my_center|LOCUS_06820 8310 10085 gene locus_tag LOCUS_06830 gene dxs 8310 10085 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_06830 10072 10833 gene locus_tag LOCUS_06840 10072 10833 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_06840 10958 11755 gene locus_tag LOCUS_06850 10958 11755 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880555.1 protein_id gnl|my_center|LOCUS_06850 11779 12234 gene locus_tag LOCUS_06860 11779 12234 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_06860 12238 13941 gene locus_tag LOCUS_06870 gene recN 12238 13941 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393016.1 protein_id gnl|my_center|LOCUS_06870 13986 15032 gene locus_tag LOCUS_06880 gene spoIVB 13986 15032 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965372.1 protein_id gnl|my_center|LOCUS_06880 15084 16208 gene locus_tag LOCUS_06890 gene dacF 15084 16208 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831996.1 protein_id gnl|my_center|LOCUS_06890 16379 17707 gene locus_tag LOCUS_06900 gene lysA 16379 17707 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_06900 17835 19697 gene locus_tag LOCUS_06910 gene htpG 17835 19697 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_06910 19846 20058 gene locus_tag LOCUS_06920 19846 20058 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187926.1 protein_id gnl|my_center|LOCUS_06920 20198 21511 gene locus_tag LOCUS_06930 gene murC 20198 21511 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 protein_id gnl|my_center|LOCUS_06930 22734 21562 gene locus_tag LOCUS_06940 22734 21562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 >Feature sequence020 186 110 gene locus_tag LOCUS_t00110 186 110 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1314 337 gene locus_tag LOCUS_06950 1314 337 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_06950 1913 1320 gene locus_tag LOCUS_06960 gene recR 1913 1320 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387203.1 protein_id gnl|my_center|LOCUS_06960 2255 1914 gene locus_tag LOCUS_06970 2255 1914 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001996460.1 protein_id gnl|my_center|LOCUS_06970 4117 2270 gene locus_tag LOCUS_06980 4117 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 4715 4128 gene locus_tag LOCUS_06990 4715 4128 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387193.1 protein_id gnl|my_center|LOCUS_06990 5409 4696 gene locus_tag LOCUS_07000 gene rlmB 5409 4696 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966431.1 protein_id gnl|my_center|LOCUS_07000 5804 5406 gene locus_tag LOCUS_07010 5804 5406 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293091.1 protein_id gnl|my_center|LOCUS_07010 6043 7299 gene locus_tag LOCUS_07020 6043 7299 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679691.1 protein_id gnl|my_center|LOCUS_07020 7487 8461 gene locus_tag LOCUS_07030 7487 8461 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051219.1 protein_id gnl|my_center|LOCUS_07030 10096 8627 gene locus_tag LOCUS_07040 gene glpK 10096 8627 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669730.1 protein_id gnl|my_center|LOCUS_07040 10974 10120 gene locus_tag LOCUS_07050 10974 10120 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860973.1 protein_id gnl|my_center|LOCUS_07050 13202 10977 gene locus_tag LOCUS_07060 13202 10977 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_07060 13363 13854 gene locus_tag LOCUS_07070 13363 13854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 14794 14006 gene locus_tag LOCUS_07080 14794 14006 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350071.1 protein_id gnl|my_center|LOCUS_07080 15582 14791 gene locus_tag LOCUS_07090 15582 14791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 15674 16654 gene locus_tag LOCUS_07100 15674 16654 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681080.1 protein_id gnl|my_center|LOCUS_07100 16763 17986 gene locus_tag LOCUS_07110 16763 17986 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429718.1 protein_id gnl|my_center|LOCUS_07110 18490 18023 gene locus_tag LOCUS_07120 18490 18023 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357651.1 protein_id gnl|my_center|LOCUS_07120 19074 18487 gene locus_tag LOCUS_07130 19074 18487 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_07130 20804 19071 gene locus_tag LOCUS_07140 gene ade 20804 19071 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_07140 21714 20872 gene locus_tag LOCUS_07150 21714 20872 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268502.1 protein_id gnl|my_center|LOCUS_07150 22523 21756 gene locus_tag LOCUS_07160 22523 21756 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404186.1 protein_id gnl|my_center|LOCUS_07160 <23499 22714 gene locus_tag LOCUS_07170 <23499 22714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003429485.1:DNA-directed RNA polymerase subunit beta' >Feature sequence021 656 24 gene locus_tag LOCUS_07180 656 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 2278 851 gene locus_tag LOCUS_07190 2278 851 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_07190 4019 2418 gene locus_tag LOCUS_07200 4019 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 4018 4302 gene locus_tag LOCUS_07210 4018 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 4521 5867 gene locus_tag LOCUS_07220 gene ugpC 4521 5867 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_07220 6042 6983 gene locus_tag LOCUS_07230 6042 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 6996 8057 gene locus_tag LOCUS_07240 gene hisC 6996 8057 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088965.1 protein_id gnl|my_center|LOCUS_07240 8071 9132 gene locus_tag LOCUS_07250 8071 9132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 9231 10010 gene locus_tag LOCUS_07260 9231 10010 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082267.1 protein_id gnl|my_center|LOCUS_07260 10112 10420 gene locus_tag LOCUS_07270 10112 10420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 10417 10782 gene locus_tag LOCUS_07280 10417 10782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 10782 11510 gene locus_tag LOCUS_07290 10782 11510 CDS product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420464.1 protein_id gnl|my_center|LOCUS_07290 11510 11869 gene locus_tag LOCUS_07300 11510 11869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 11990 12370 gene locus_tag LOCUS_07310 11990 12370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 13411 12410 gene locus_tag LOCUS_07320 13411 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 13809 14771 gene locus_tag LOCUS_07330 13809 14771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 14790 16265 gene locus_tag LOCUS_07340 14790 16265 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_07340 16545 16243 gene locus_tag LOCUS_07350 16545 16243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 16653 16922 gene locus_tag LOCUS_07360 16653 16922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 18098 16974 gene locus_tag LOCUS_07370 18098 16974 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942513.1 protein_id gnl|my_center|LOCUS_07370 18187 18429 gene locus_tag LOCUS_07380 18187 18429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 18478 19131 gene locus_tag LOCUS_07390 gene nth 18478 19131 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_07390 19200 19391 gene locus_tag LOCUS_07400 19200 19391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 19381 19683 gene locus_tag LOCUS_07410 19381 19683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 19754 21889 gene locus_tag LOCUS_07420 19754 21889 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679111.1 protein_id gnl|my_center|LOCUS_07420 21973 22125 gene locus_tag LOCUS_07430 21973 22125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 22154 22300 gene locus_tag LOCUS_07440 22154 22300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 >Feature sequence022 1356 3014 gene locus_tag LOCUS_07450 1356 3014 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392405.1 protein_id gnl|my_center|LOCUS_07450 3011 3904 gene locus_tag LOCUS_07460 3011 3904 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213640.1 protein_id gnl|my_center|LOCUS_07460 4615 3962 gene locus_tag LOCUS_07470 4615 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 5259 4741 gene locus_tag LOCUS_07480 5259 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 6760 5282 gene locus_tag LOCUS_07490 gene malQ 6760 5282 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_07490 7972 6776 gene locus_tag LOCUS_07500 7972 6776 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461084.1 protein_id gnl|my_center|LOCUS_07500 9582 7978 gene locus_tag LOCUS_07510 9582 7978 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_07510 10460 9627 gene locus_tag LOCUS_07520 gene dapF 10460 9627 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077385.1 protein_id gnl|my_center|LOCUS_07520 11792 10518 gene locus_tag LOCUS_07530 11792 10518 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262728.1 protein_id gnl|my_center|LOCUS_07530 12060 12557 gene locus_tag LOCUS_07540 12060 12557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 13849 12614 gene locus_tag LOCUS_07550 13849 12614 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704295.1 protein_id gnl|my_center|LOCUS_07550 14671 13931 gene locus_tag LOCUS_07560 14671 13931 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_07560 15426 14695 gene locus_tag LOCUS_07570 15426 14695 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003158483.1 protein_id gnl|my_center|LOCUS_07570 15835 15485 gene locus_tag LOCUS_07580 gene rplT 15835 15485 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965656.1 protein_id gnl|my_center|LOCUS_07580 16051 15851 gene locus_tag LOCUS_07590 gene rpmI 16051 15851 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297539.1 protein_id gnl|my_center|LOCUS_07590 16613 16119 gene locus_tag LOCUS_07600 gene infC 16613 16119 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965658.1 protein_id gnl|my_center|LOCUS_07600 17807 16959 gene locus_tag LOCUS_07610 17807 16959 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583026.1 protein_id gnl|my_center|LOCUS_07610 19765 17825 gene locus_tag LOCUS_07620 gene yesZ 19765 17825 CDS product beta-galactosidase YesZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242572.1 protein_id gnl|my_center|LOCUS_07620 21246 19873 gene locus_tag LOCUS_07630 gene asnS 21246 19873 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948326.1 protein_id gnl|my_center|LOCUS_07630 <22069 21277 gene locus_tag LOCUS_07640 <22069 21277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004450718.1:proline--tRNA ligase >Feature sequence023 1616 84 gene locus_tag LOCUS_07650 1616 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 2775 1624 gene locus_tag LOCUS_07660 2775 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 3779 3000 gene locus_tag LOCUS_07670 3779 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 5058 3802 gene locus_tag LOCUS_07680 gene murA 5058 3802 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_07680 6254 5142 gene locus_tag LOCUS_07690 gene spoVE 6254 5142 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_07690 7677 6283 gene locus_tag LOCUS_07700 gene murD 7677 6283 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262065.1 protein_id gnl|my_center|LOCUS_07700 8636 7689 gene locus_tag LOCUS_07710 gene mraY 8636 7689 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358738.1 protein_id gnl|my_center|LOCUS_07710 10072 8636 gene locus_tag LOCUS_07720 10072 8636 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_07720 11730 10069 gene locus_tag LOCUS_07730 11730 10069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 12915 11839 gene locus_tag LOCUS_07740 12915 11839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 13906 12965 gene locus_tag LOCUS_07750 gene rsmH 13906 12965 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_07750 14332 13910 gene locus_tag LOCUS_07760 gene mraZ 14332 13910 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358778.1 protein_id gnl|my_center|LOCUS_07760 15262 14420 gene locus_tag LOCUS_07770 15262 14420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 15393 15656 gene locus_tag LOCUS_07780 15393 15656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 16309 15884 gene locus_tag LOCUS_07790 16309 15884 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461281.1 protein_id gnl|my_center|LOCUS_07790 17493 16486 gene locus_tag LOCUS_07800 17493 16486 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667339.1 protein_id gnl|my_center|LOCUS_07800 17810 18343 gene locus_tag LOCUS_07810 17810 18343 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_07810 18435 19937 gene locus_tag LOCUS_07820 gene potA 18435 19937 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762997.1 protein_id gnl|my_center|LOCUS_07820 19934 20722 gene locus_tag LOCUS_07830 19934 20722 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence024 297 965 gene locus_tag LOCUS_07840 297 965 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_07840 970 2199 gene locus_tag LOCUS_07850 970 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 2177 3595 gene locus_tag LOCUS_07860 2177 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 4525 3656 gene locus_tag LOCUS_07870 4525 3656 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003266758.1 protein_id gnl|my_center|LOCUS_07870 4740 5582 gene locus_tag LOCUS_07880 4740 5582 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_07880 5582 6979 gene locus_tag LOCUS_07890 gene gltA 5582 6979 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_07890 7731 7051 gene locus_tag LOCUS_07900 7731 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 9122 7728 gene locus_tag LOCUS_07910 9122 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 10394 9261 gene locus_tag LOCUS_07920 gene dnaJ 10394 9261 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816474.1 protein_id gnl|my_center|LOCUS_07920 12280 10481 gene locus_tag LOCUS_07930 gene dnaK 12280 10481 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_07930 12913 12353 gene locus_tag LOCUS_07940 12913 12353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 13760 13107 gene locus_tag LOCUS_07950 gene pyrE 13760 13107 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884129.1 protein_id gnl|my_center|LOCUS_07950 14684 13782 gene locus_tag LOCUS_07960 14684 13782 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245610.1 protein_id gnl|my_center|LOCUS_07960 15295 14843 gene locus_tag LOCUS_07970 15295 14843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 15774 15295 gene locus_tag LOCUS_07980 15774 15295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 16553 15771 gene locus_tag LOCUS_07990 16553 15771 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263218.1 protein_id gnl|my_center|LOCUS_07990 17515 16607 gene locus_tag LOCUS_08000 gene pyrF 17515 16607 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_08000 18379 17720 gene locus_tag LOCUS_08010 gene pyrE 18379 17720 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389897.1 protein_id gnl|my_center|LOCUS_08010 19715 18444 gene locus_tag LOCUS_08020 19715 18444 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_08020 20643 19708 gene locus_tag LOCUS_08030 20643 19708 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_08030 21280 20744 gene locus_tag LOCUS_08040 gene pyrR 21280 20744 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869840.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence025 496 23 gene locus_tag LOCUS_08050 496 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 1601 504 gene locus_tag LOCUS_08060 1601 504 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966047.1 protein_id gnl|my_center|LOCUS_08060 2595 1648 gene locus_tag LOCUS_08070 2595 1648 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081773.1 protein_id gnl|my_center|LOCUS_08070 4046 2592 gene locus_tag LOCUS_08080 4046 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 4692 4027 gene locus_tag LOCUS_08090 4692 4027 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583839.1 protein_id gnl|my_center|LOCUS_08090 5069 4689 gene locus_tag LOCUS_08100 5069 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 5954 5136 gene locus_tag LOCUS_08110 5954 5136 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_08110 6602 5964 gene locus_tag LOCUS_08120 6602 5964 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189715.1 protein_id gnl|my_center|LOCUS_08120 6694 7953 gene locus_tag LOCUS_08130 gene aroA 6694 7953 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229519.1 protein_id gnl|my_center|LOCUS_08130 9600 8011 gene locus_tag LOCUS_08140 9600 8011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 11933 9615 gene locus_tag LOCUS_08150 11933 9615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 12376 11948 gene locus_tag LOCUS_08160 12376 11948 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_08160 12538 12741 gene locus_tag LOCUS_08170 12538 12741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 13928 12861 gene locus_tag LOCUS_08180 13928 12861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 14788 13925 gene locus_tag LOCUS_08190 14788 13925 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894028.1 protein_id gnl|my_center|LOCUS_08190 15061 14792 gene locus_tag LOCUS_08200 15061 14792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 15390 15007 gene locus_tag LOCUS_08210 15390 15007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 15635 15387 gene locus_tag LOCUS_08220 15635 15387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 17558 15729 gene locus_tag LOCUS_08230 gene typA 17558 15729 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_08230 18771 17701 gene locus_tag LOCUS_08240 18771 17701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 19319 18978 gene locus_tag LOCUS_08250 19319 18978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 19971 19360 gene locus_tag LOCUS_08260 19971 19360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 >Feature sequence026 45 989 gene locus_tag LOCUS_08270 gene prmA 45 989 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861555.1 protein_id gnl|my_center|LOCUS_08270 990 1706 gene locus_tag LOCUS_08280 990 1706 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921244.1 protein_id gnl|my_center|LOCUS_08280 1715 2932 gene locus_tag LOCUS_08290 gene mtaB 1715 2932 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816469.1 protein_id gnl|my_center|LOCUS_08290 3234 3566 gene locus_tag LOCUS_08300 3234 3566 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_08300 3809 4171 gene locus_tag LOCUS_08310 3809 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 4251 4877 gene locus_tag LOCUS_08320 4251 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 5142 8969 gene locus_tag LOCUS_08330 5142 8969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 9458 9622 gene locus_tag LOCUS_08340 gene rpmG 9458 9622 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_08340 9660 9962 gene locus_tag LOCUS_08350 9660 9962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 9966 10538 gene locus_tag LOCUS_08360 gene nusG 9966 10538 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_08360 10652 11077 gene locus_tag LOCUS_08370 gene rplK 10652 11077 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_08370 11133 11822 gene locus_tag LOCUS_08380 gene rplA 11133 11822 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_08380 12071 12568 gene locus_tag LOCUS_08390 gene rplJ 12071 12568 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_08390 12599 12967 gene locus_tag LOCUS_08400 gene rplL 12599 12967 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966422.1 protein_id gnl|my_center|LOCUS_08400 13265 14164 gene locus_tag LOCUS_08410 13265 14164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 15107 14226 gene locus_tag LOCUS_08420 15107 14226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 15189 15761 gene locus_tag LOCUS_08430 15189 15761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 15820 16005 gene locus_tag LOCUS_08440 15820 16005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 16159 16920 gene locus_tag LOCUS_08450 16159 16920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 16968 17339 gene locus_tag LOCUS_08460 16968 17339 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143722.1 protein_id gnl|my_center|LOCUS_08460 17706 19367 gene locus_tag LOCUS_08470 17706 19367 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence027 1805 2773 gene locus_tag LOCUS_08480 1805 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 2770 3978 gene locus_tag LOCUS_08490 2770 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 5280 4132 gene locus_tag LOCUS_08500 gene fucO 5280 4132 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013588.1 protein_id gnl|my_center|LOCUS_08500 6172 5339 gene locus_tag LOCUS_08510 gene rhaD 6172 5339 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924506.1 protein_id gnl|my_center|LOCUS_08510 7410 6169 gene locus_tag LOCUS_08520 gene rhaA 7410 6169 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244294.1 protein_id gnl|my_center|LOCUS_08520 8747 7452 gene locus_tag LOCUS_08530 gene rhaB 8747 7452 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243094.1 protein_id gnl|my_center|LOCUS_08530 8871 9824 gene locus_tag LOCUS_08540 8871 9824 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613409.1 protein_id gnl|my_center|LOCUS_08540 10722 10003 gene locus_tag LOCUS_08550 10722 10003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 11736 10873 gene locus_tag LOCUS_08560 11736 10873 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844667.1 protein_id gnl|my_center|LOCUS_08560 12167 11790 gene locus_tag LOCUS_08570 gene spoVAE 12167 11790 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_08570 13180 12188 gene locus_tag LOCUS_08580 gene spoVAD 13180 12188 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965601.1 protein_id gnl|my_center|LOCUS_08580 13372 13884 gene locus_tag LOCUS_08590 gene eetB 13372 13884 CDS product flavin-based extracellular electron transfer system protein EetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723627.1 protein_id gnl|my_center|LOCUS_08590 13881 15173 gene locus_tag LOCUS_08600 gene rsxC 13881 15173 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_08600 15170 16234 gene locus_tag LOCUS_08610 15170 16234 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428487.1 protein_id gnl|my_center|LOCUS_08610 16231 16830 gene locus_tag LOCUS_08620 16231 16830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 16823 17491 gene locus_tag LOCUS_08630 16823 17491 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082951.1 protein_id gnl|my_center|LOCUS_08630 17495 18094 gene locus_tag LOCUS_08640 gene rsxA 17495 18094 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence028 183 109 gene locus_tag LOCUS_t00120 183 109 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1431 583 gene locus_tag LOCUS_08650 1431 583 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_08650 1787 2086 gene locus_tag LOCUS_08660 1787 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 3626 2250 gene locus_tag LOCUS_08670 3626 2250 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_08670 4244 3867 gene locus_tag LOCUS_08680 4244 3867 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476321.1 protein_id gnl|my_center|LOCUS_08680 4483 4241 gene locus_tag LOCUS_08690 4483 4241 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003013836.1 protein_id gnl|my_center|LOCUS_08690 5133 4600 gene locus_tag LOCUS_08700 5133 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 5366 6991 gene locus_tag LOCUS_08710 5366 6991 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615608.1 protein_id gnl|my_center|LOCUS_08710 7083 7466 gene locus_tag LOCUS_08720 7083 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 7463 7828 gene locus_tag LOCUS_08730 7463 7828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 7924 9885 gene locus_tag LOCUS_08740 gene uvrB 7924 9885 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357634.1 protein_id gnl|my_center|LOCUS_08740 9896 10486 gene locus_tag LOCUS_08750 9896 10486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 10483 10950 gene locus_tag LOCUS_08760 10483 10950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 10953 13766 gene locus_tag LOCUS_08770 gene uvrA 10953 13766 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_08770 13841 15016 gene locus_tag LOCUS_08780 13841 15016 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948693.1 protein_id gnl|my_center|LOCUS_08780 15221 15382 gene locus_tag LOCUS_08790 15221 15382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 15375 16361 gene locus_tag LOCUS_08800 15375 16361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 16855 16427 gene locus_tag LOCUS_08810 16855 16427 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329067.1 protein_id gnl|my_center|LOCUS_08810 16905 17450 gene locus_tag LOCUS_08820 gene spoVT 16905 17450 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966490.1 protein_id gnl|my_center|LOCUS_08820 18531 17548 gene locus_tag LOCUS_08830 18531 17548 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963688.1 protein_id gnl|my_center|LOCUS_08830 >Feature sequence029 2495 1146 gene locus_tag LOCUS_08840 gene dnaA 2495 1146 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_08840 2623 3708 gene locus_tag LOCUS_08850 gene recF 2623 3708 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359456.1 protein_id gnl|my_center|LOCUS_08850 3705 4565 gene locus_tag LOCUS_08860 3705 4565 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_08860 4592 5347 gene locus_tag LOCUS_08870 4592 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 5512 5856 gene locus_tag LOCUS_08880 gene rplS 5512 5856 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419350.1 protein_id gnl|my_center|LOCUS_08880 5996 7972 gene locus_tag LOCUS_08890 5996 7972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 8132 9649 gene locus_tag LOCUS_08900 8132 9649 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_08900 9885 10973 gene locus_tag LOCUS_08910 gene dprA 9885 10973 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929874.1 protein_id gnl|my_center|LOCUS_08910 11002 13272 gene locus_tag LOCUS_08920 gene topA 11002 13272 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_08920 13269 14570 gene locus_tag LOCUS_08930 gene trmFO 13269 14570 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813284.1 protein_id gnl|my_center|LOCUS_08930 14571 15104 gene locus_tag LOCUS_08940 gene hslV 14571 15104 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724001.1 protein_id gnl|my_center|LOCUS_08940 15155 16465 gene locus_tag LOCUS_08950 gene hslU 15155 16465 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_08950 16486 16956 gene locus_tag LOCUS_08960 16486 16956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 16953 18215 gene locus_tag LOCUS_08970 gene hisS 16953 18215 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048076.1 protein_id gnl|my_center|LOCUS_08970 18220 18546 gene locus_tag LOCUS_08980 gene trxA 18220 18546 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966364.1 protein_id gnl|my_center|LOCUS_08980 >Feature sequence030 1426 884 gene locus_tag LOCUS_08990 1426 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1683 2861 gene locus_tag LOCUS_09000 1683 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 2978 3580 gene locus_tag LOCUS_09010 2978 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 3580 4158 gene locus_tag LOCUS_09020 3580 4158 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272229.1 protein_id gnl|my_center|LOCUS_09020 4171 7761 gene locus_tag LOCUS_09030 gene brxC 4171 7761 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065383.1 protein_id gnl|my_center|LOCUS_09030 7791 10427 gene locus_tag LOCUS_09040 7791 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 10470 11258 gene locus_tag LOCUS_09050 10470 11258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 11246 12235 gene locus_tag LOCUS_09060 11246 12235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 12251 14767 gene locus_tag LOCUS_09070 gene pglZ 12251 14767 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459232.1 protein_id gnl|my_center|LOCUS_09070 14782 16839 gene locus_tag LOCUS_09080 gene brxL 14782 16839 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459233.1 protein_id gnl|my_center|LOCUS_09080 16908 18302 gene locus_tag LOCUS_09090 16908 18302 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109350.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence031 519 716 gene locus_tag LOCUS_09100 519 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 972 3704 gene locus_tag LOCUS_09110 972 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 3707 7192 gene locus_tag LOCUS_09120 3707 7192 CDS product tubulin-like doman-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175100.1 protein_id gnl|my_center|LOCUS_09120 7284 9455 gene locus_tag LOCUS_09130 7284 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 9468 14648 gene locus_tag LOCUS_09140 9468 14648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 14699 17476 gene locus_tag LOCUS_09150 14699 17476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 <18198 17656 gene locus_tag LOCUS_09160 <18198 17656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162013089.1:tetratricopeptide repeat protein >Feature sequence032 234 1910 gene locus_tag LOCUS_09170 234 1910 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_09170 1941 2591 gene locus_tag LOCUS_09180 1941 2591 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966496.1 protein_id gnl|my_center|LOCUS_09180 2601 3956 gene locus_tag LOCUS_09190 2601 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 4095 6020 gene locus_tag LOCUS_09200 4095 6020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 6233 8311 gene locus_tag LOCUS_09210 6233 8311 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 protein_id gnl|my_center|LOCUS_09210 8379 8819 gene locus_tag LOCUS_09220 gene dut 8379 8819 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933085.1 protein_id gnl|my_center|LOCUS_09220 8816 9511 gene locus_tag LOCUS_09230 gene trmB 8816 9511 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 protein_id gnl|my_center|LOCUS_09230 9508 10623 gene locus_tag LOCUS_09240 9508 10623 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459186.1 protein_id gnl|my_center|LOCUS_09240 12082 10706 gene locus_tag LOCUS_09250 gene radA 12082 10706 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_09250 13969 12857 gene locus_tag LOCUS_09260 13969 12857 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087257.1 protein_id gnl|my_center|LOCUS_09260 14208 13966 gene locus_tag LOCUS_09270 14208 13966 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_09270 14287 14481 gene locus_tag LOCUS_09280 14287 14481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence033 985 20 gene locus_tag LOCUS_09290 985 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1786 1301 gene locus_tag LOCUS_09300 1786 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 1902 3092 gene locus_tag LOCUS_09310 1902 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 4764 3148 gene locus_tag LOCUS_09320 gene rny 4764 3148 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_09320 4939 5139 gene locus_tag LOCUS_09330 4939 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 7084 5330 gene locus_tag LOCUS_09340 7084 5330 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_09340 8802 7081 gene locus_tag LOCUS_09350 8802 7081 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_09350 10291 8990 gene locus_tag LOCUS_09360 10291 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 10976 10398 gene locus_tag LOCUS_09370 10976 10398 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851996.1 protein_id gnl|my_center|LOCUS_09370 11422 11165 gene locus_tag LOCUS_09380 11422 11165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 13022 11442 gene locus_tag LOCUS_09390 gene cls 13022 11442 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837633.1 protein_id gnl|my_center|LOCUS_09390 13812 13105 gene locus_tag LOCUS_09400 13812 13105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 14303 13809 gene locus_tag LOCUS_09410 gene trmL 14303 13809 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_09410 15264 14503 gene locus_tag LOCUS_09420 gene spo0A 15264 14503 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_09420 17100 15523 gene locus_tag LOCUS_09430 17100 15523 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966231.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence034 1250 387 gene locus_tag LOCUS_09440 1250 387 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_09440 1968 1240 gene locus_tag LOCUS_09450 1968 1240 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059661.1 protein_id gnl|my_center|LOCUS_09450 2942 1980 gene locus_tag LOCUS_09460 2942 1980 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126169.1 protein_id gnl|my_center|LOCUS_09460 3640 2939 gene locus_tag LOCUS_09470 3640 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 4199 3678 gene locus_tag LOCUS_09480 4199 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 4730 4416 gene locus_tag LOCUS_09490 4730 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 4850 5581 gene locus_tag LOCUS_09500 4850 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 5930 7837 gene locus_tag LOCUS_09510 gene thrS 5930 7837 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965659.1 protein_id gnl|my_center|LOCUS_09510 8001 8255 gene locus_tag LOCUS_09520 8001 8255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 8259 8669 gene locus_tag LOCUS_09530 8259 8669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 11447 8817 gene locus_tag LOCUS_09540 11447 8817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 12492 11686 gene locus_tag LOCUS_09550 12492 11686 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815800.1 protein_id gnl|my_center|LOCUS_09550 13220 12489 gene locus_tag LOCUS_09560 13220 12489 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040538.1 protein_id gnl|my_center|LOCUS_09560 14252 13251 gene locus_tag LOCUS_09570 14252 13251 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_09570 14251 14448 gene locus_tag LOCUS_09580 14251 14448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 14417 17038 gene locus_tag LOCUS_09590 14417 17038 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence035 1063 29 gene locus_tag LOCUS_09600 1063 29 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_09600 2315 1104 gene locus_tag LOCUS_09610 gene galK 2315 1104 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_09610 2382 3065 gene locus_tag LOCUS_09620 2382 3065 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987079.1 protein_id gnl|my_center|LOCUS_09620 5559 3019 gene locus_tag LOCUS_09630 5559 3019 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032453.1 protein_id gnl|my_center|LOCUS_09630 8127 5743 gene locus_tag LOCUS_09640 8127 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 8320 9750 gene locus_tag LOCUS_09650 8320 9750 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890705.1 protein_id gnl|my_center|LOCUS_09650 9747 10826 gene locus_tag LOCUS_09660 9747 10826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 10823 12073 gene locus_tag LOCUS_09670 10823 12073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 13865 13332 gene locus_tag LOCUS_09680 13865 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 14050 14583 gene locus_tag LOCUS_09690 14050 14583 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459303.1 protein_id gnl|my_center|LOCUS_09690 14733 17012 gene locus_tag LOCUS_09700 14733 17012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 >Feature sequence036 2054 33 gene locus_tag LOCUS_09710 2054 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 2757 2056 gene locus_tag LOCUS_09720 2757 2056 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068640.1 protein_id gnl|my_center|LOCUS_09720 3143 2946 gene locus_tag LOCUS_09730 3143 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 3820 3362 gene locus_tag LOCUS_09740 gene spoVAC 3820 3362 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403642.1 protein_id gnl|my_center|LOCUS_09740 4479 3988 gene locus_tag LOCUS_09750 4479 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 5732 4476 gene locus_tag LOCUS_09760 5732 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 6289 5729 gene locus_tag LOCUS_09770 6289 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 7459 6305 gene locus_tag LOCUS_09780 7459 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 8040 7456 gene locus_tag LOCUS_09790 8040 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 9934 8111 gene locus_tag LOCUS_09800 9934 8111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 10184 9924 gene locus_tag LOCUS_09810 10184 9924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 11669 10239 gene locus_tag LOCUS_09820 11669 10239 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397213.1 protein_id gnl|my_center|LOCUS_09820 11724 12434 gene locus_tag LOCUS_09830 11724 12434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 13199 15682 gene locus_tag LOCUS_09840 13199 15682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 15754 16749 gene locus_tag LOCUS_09850 15754 16749 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964837.1 protein_id gnl|my_center|LOCUS_09850 >Feature sequence037 186 662 gene locus_tag LOCUS_09860 186 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1747 728 gene locus_tag LOCUS_09870 1747 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 2264 1905 gene locus_tag LOCUS_09880 2264 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 3510 2752 gene locus_tag LOCUS_09890 3510 2752 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704990.1 protein_id gnl|my_center|LOCUS_09890 3795 4421 gene locus_tag LOCUS_09900 3795 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 4856 5605 gene locus_tag LOCUS_09910 gene cysE 4856 5605 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476500.1 protein_id gnl|my_center|LOCUS_09910 5592 6983 gene locus_tag LOCUS_09920 gene cysS 5592 6983 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_09920 7108 8919 gene locus_tag LOCUS_09930 7108 8919 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_09930 9091 9654 gene locus_tag LOCUS_09940 9091 9654 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888695.1 protein_id gnl|my_center|LOCUS_09940 9663 9947 gene locus_tag LOCUS_09950 9663 9947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 10083 10514 gene locus_tag LOCUS_09960 gene rplM 10083 10514 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966379.1 protein_id gnl|my_center|LOCUS_09960 10527 10940 gene locus_tag LOCUS_09970 gene rpsI 10527 10940 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_09970 11438 11127 gene locus_tag LOCUS_09980 11438 11127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 11583 13931 gene locus_tag LOCUS_09990 11583 13931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 14117 14608 gene locus_tag LOCUS_10000 14117 14608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 >Feature sequence038 264 761 gene locus_tag LOCUS_10010 gene nrdR 264 761 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_10010 771 1814 gene locus_tag LOCUS_10020 gene ispG 771 1814 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541503.1 protein_id gnl|my_center|LOCUS_10020 1846 3357 gene locus_tag LOCUS_10030 1846 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 4041 3517 gene locus_tag LOCUS_10040 4041 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 4304 4759 gene locus_tag LOCUS_10050 gene rimP 4304 4759 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929303.1 protein_id gnl|my_center|LOCUS_10050 4816 6018 gene locus_tag LOCUS_10060 gene nusA 4816 6018 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_10060 6019 6291 gene locus_tag LOCUS_10070 6019 6291 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419469.1 protein_id gnl|my_center|LOCUS_10070 6278 6589 gene locus_tag LOCUS_10080 6278 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 6665 9274 gene locus_tag LOCUS_10090 gene infB 6665 9274 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460393.1 protein_id gnl|my_center|LOCUS_10090 9271 9627 gene locus_tag LOCUS_10100 gene rbfA 9271 9627 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776437.1 protein_id gnl|my_center|LOCUS_10100 9694 10665 gene locus_tag LOCUS_10110 9694 10665 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_10110 10662 11495 gene locus_tag LOCUS_10120 gene truB 10662 11495 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258869.1 protein_id gnl|my_center|LOCUS_10120 11489 12376 gene locus_tag LOCUS_10130 gene ribF 11489 12376 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228004.1 protein_id gnl|my_center|LOCUS_10130 12373 13227 gene locus_tag LOCUS_10140 12373 13227 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460424.1 protein_id gnl|my_center|LOCUS_10140 13378 14433 gene locus_tag LOCUS_10150 13378 14433 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722481.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence039 542 78 gene locus_tag LOCUS_10160 gene ybaK 542 78 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437064.1 protein_id gnl|my_center|LOCUS_10160 1225 617 gene locus_tag LOCUS_10170 1225 617 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_10170 1764 1234 gene locus_tag LOCUS_10180 1764 1234 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_10180 1990 2080 gene locus_tag LOCUS_t00130 1990 2080 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2349 3251 gene locus_tag LOCUS_10190 2349 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 4807 4028 gene locus_tag LOCUS_10200 4807 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 5991 4819 gene locus_tag LOCUS_10210 5991 4819 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491711.1 protein_id gnl|my_center|LOCUS_10210 6998 6471 gene locus_tag LOCUS_10220 6998 6471 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965894.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10220 7108 6929 gene locus_tag LOCUS_10230 7108 6929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10230 7989 7183 gene locus_tag LOCUS_10240 7989 7183 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783664.1 protein_id gnl|my_center|LOCUS_10240 9109 8000 gene locus_tag LOCUS_10250 9109 8000 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287753.1 protein_id gnl|my_center|LOCUS_10250 11161 9119 gene locus_tag LOCUS_10260 11161 9119 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767024.1 protein_id gnl|my_center|LOCUS_10260 12407 11502 gene locus_tag LOCUS_10270 12407 11502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 12844 12659 gene locus_tag LOCUS_10280 12844 12659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 13176 14639 gene locus_tag LOCUS_10290 13176 14639 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809868.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence040 1401 1715 gene locus_tag LOCUS_10300 1401 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1705 3717 gene locus_tag LOCUS_10310 1705 3717 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986938.1 protein_id gnl|my_center|LOCUS_10310 3805 4299 gene locus_tag LOCUS_10320 3805 4299 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869602.1 protein_id gnl|my_center|LOCUS_10320 4318 4896 gene locus_tag LOCUS_10330 4318 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 4901 5866 gene locus_tag LOCUS_10340 4901 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 6035 6382 gene locus_tag LOCUS_10350 6035 6382 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357676.1 protein_id gnl|my_center|LOCUS_10350 6379 8151 gene locus_tag LOCUS_10360 6379 8151 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033047490.1 protein_id gnl|my_center|LOCUS_10360 8144 9526 gene locus_tag LOCUS_10370 8144 9526 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986932.1 protein_id gnl|my_center|LOCUS_10370 9528 10154 gene locus_tag LOCUS_10380 9528 10154 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359170.1 protein_id gnl|my_center|LOCUS_10380 10282 11484 gene locus_tag LOCUS_10390 10282 11484 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_10390 11481 11654 gene locus_tag LOCUS_10400 11481 11654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 11706 11861 gene locus_tag LOCUS_10410 11706 11861 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_10410 12097 14418 gene locus_tag LOCUS_10420 gene lon 12097 14418 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097289.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence041 750 1577 gene locus_tag LOCUS_10430 750 1577 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454798.1 protein_id gnl|my_center|LOCUS_10430 1890 1588 gene locus_tag LOCUS_10440 1890 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1944 3470 gene locus_tag LOCUS_10450 gene purH 1944 3470 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745439.1 protein_id gnl|my_center|LOCUS_10450 3523 4725 gene locus_tag LOCUS_10460 3523 4725 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_10460 5134 4889 gene locus_tag LOCUS_10470 5134 4889 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428433.1 protein_id gnl|my_center|LOCUS_10470 5670 5146 gene locus_tag LOCUS_10480 5670 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 6042 5815 gene locus_tag LOCUS_10490 6042 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 6204 6911 gene locus_tag LOCUS_10500 6204 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 6922 7455 gene locus_tag LOCUS_10510 6922 7455 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_10510 7573 8568 gene locus_tag LOCUS_10520 7573 8568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 8825 8628 gene locus_tag LOCUS_10530 8825 8628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 9076 9810 gene locus_tag LOCUS_10540 9076 9810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 9807 10589 gene locus_tag LOCUS_10550 9807 10589 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359441.1 protein_id gnl|my_center|LOCUS_10550 10591 11871 gene locus_tag LOCUS_10560 10591 11871 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816736.1 protein_id gnl|my_center|LOCUS_10560 11932 12846 gene locus_tag LOCUS_10570 11932 12846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 13422 12961 gene locus_tag LOCUS_10580 gene rnhA 13422 12961 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933276.1 protein_id gnl|my_center|LOCUS_10580 14222 13419 gene locus_tag LOCUS_10590 gene proC 14222 13419 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694358.1 protein_id gnl|my_center|LOCUS_10590 14304 14378 gene locus_tag LOCUS_t00140 14304 14378 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence042 654 1853 gene locus_tag LOCUS_10600 654 1853 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462283.1 protein_id gnl|my_center|LOCUS_10600 2428 2189 gene locus_tag LOCUS_10610 2428 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 4547 2643 gene locus_tag LOCUS_10620 4547 2643 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_10620 5575 4544 gene locus_tag LOCUS_10630 gene recA 5575 4544 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_10630 6717 5635 gene locus_tag LOCUS_10640 6717 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 7370 6738 gene locus_tag LOCUS_10650 gene pgsA 7370 6738 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296025.1 protein_id gnl|my_center|LOCUS_10650 8757 7429 gene locus_tag LOCUS_10660 gene rimO 8757 7429 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_10660 13061 8775 gene locus_tag LOCUS_10670 13061 8775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence043 1025 501 gene locus_tag LOCUS_10680 1025 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 2830 1337 gene locus_tag LOCUS_10690 2830 1337 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392093.1 protein_id gnl|my_center|LOCUS_10690 3963 2935 gene locus_tag LOCUS_10700 3963 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 4678 3950 gene locus_tag LOCUS_10710 4678 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 5927 4818 gene locus_tag LOCUS_10720 gene nifS 5927 4818 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_10720 6761 6021 gene locus_tag LOCUS_10730 6761 6021 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242850.1 protein_id gnl|my_center|LOCUS_10730 7889 6954 gene locus_tag LOCUS_10740 7889 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 8812 7907 gene locus_tag LOCUS_10750 8812 7907 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336977.1 protein_id gnl|my_center|LOCUS_10750 10380 8887 gene locus_tag LOCUS_10760 10380 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 10490 10732 gene locus_tag LOCUS_10770 10490 10732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 11912 10863 gene locus_tag LOCUS_10780 11912 10863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 12444 11920 gene locus_tag LOCUS_10790 12444 11920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 12687 13136 gene locus_tag LOCUS_10800 12687 13136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 13193 13657 gene locus_tag LOCUS_10810 13193 13657 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621142.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence044 1176 118 gene locus_tag LOCUS_10820 1176 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1775 1176 gene locus_tag LOCUS_10830 1775 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 2080 1874 gene locus_tag LOCUS_10840 2080 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 2774 2085 gene locus_tag LOCUS_10850 2774 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 4181 2802 gene locus_tag LOCUS_10860 4181 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 5778 4174 gene locus_tag LOCUS_10870 5778 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 6442 5789 gene locus_tag LOCUS_10880 6442 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 6956 6642 gene locus_tag LOCUS_10890 6956 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 7508 7038 gene locus_tag LOCUS_10900 7508 7038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 7998 7522 gene locus_tag LOCUS_10910 7998 7522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 10001 8019 gene locus_tag LOCUS_10920 10001 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 11907 10102 gene locus_tag LOCUS_10930 11907 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 >Feature sequence045 1471 1070 gene locus_tag LOCUS_10940 1471 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 2756 1473 gene locus_tag LOCUS_10950 2756 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 4998 2761 gene locus_tag LOCUS_10960 4998 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 6562 5000 gene locus_tag LOCUS_10970 6562 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 7571 6564 gene locus_tag LOCUS_10980 7571 6564 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521533.1 protein_id gnl|my_center|LOCUS_10980 10296 7714 gene locus_tag LOCUS_10990 10296 7714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 11856 10936 gene locus_tag LOCUS_11000 11856 10936 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810616.1 protein_id gnl|my_center|LOCUS_11000 <13072 12099 gene locus_tag LOCUS_11010 <13072 12099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047993.1:pyruvate, phosphate dikinase >Feature sequence046 1392 337 gene locus_tag LOCUS_11020 gene rlmN 1392 337 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450540.1 protein_id gnl|my_center|LOCUS_11020 2615 1389 gene locus_tag LOCUS_11030 gene rsmB 2615 1389 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921990.1 protein_id gnl|my_center|LOCUS_11030 3519 2596 gene locus_tag LOCUS_11040 gene fmt 3519 2596 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930505.1 protein_id gnl|my_center|LOCUS_11040 3974 3519 gene locus_tag LOCUS_11050 gene def 3974 3519 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388617.1 protein_id gnl|my_center|LOCUS_11050 6153 3985 gene locus_tag LOCUS_11060 gene priA 6153 3985 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_11060 6441 6220 gene locus_tag LOCUS_11070 6441 6220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 7032 6466 gene locus_tag LOCUS_11080 gene gmk 7032 6466 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_11080 7918 7046 gene locus_tag LOCUS_11090 7918 7046 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_11090 10044 8101 gene locus_tag LOCUS_11100 gene ligA 10044 8101 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965961.1 protein_id gnl|my_center|LOCUS_11100 12703 10316 gene locus_tag LOCUS_11110 gene pcrA 12703 10316 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674369.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence047 164 88 gene locus_tag LOCUS_t00150 164 88 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 359 667 gene locus_tag LOCUS_11120 gene spoIIAA 359 667 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_11120 676 1113 gene locus_tag LOCUS_11130 gene spoIIAB 676 1113 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418415.1 protein_id gnl|my_center|LOCUS_11130 1103 1828 gene locus_tag LOCUS_11140 gene sigF 1103 1828 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350729.1 protein_id gnl|my_center|LOCUS_11140 2004 3167 gene locus_tag LOCUS_11150 gene hisZ 2004 3167 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393533.1 protein_id gnl|my_center|LOCUS_11150 3164 3790 gene locus_tag LOCUS_11160 gene hisG 3164 3790 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721362.1 protein_id gnl|my_center|LOCUS_11160 3787 5064 gene locus_tag LOCUS_11170 gene hisD 3787 5064 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393531.1 protein_id gnl|my_center|LOCUS_11170 5061 5639 gene locus_tag LOCUS_11180 gene hisB 5061 5639 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436680.1 protein_id gnl|my_center|LOCUS_11180 5636 6223 gene locus_tag LOCUS_11190 gene hisH 5636 6223 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496519.1 protein_id gnl|my_center|LOCUS_11190 6225 6932 gene locus_tag LOCUS_11200 gene hisA 6225 6932 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393528.1 protein_id gnl|my_center|LOCUS_11200 6926 7690 gene locus_tag LOCUS_11210 gene hisF 6926 7690 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_11210 7691 8293 gene locus_tag LOCUS_11220 gene hisIE 7691 8293 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243045.1 protein_id gnl|my_center|LOCUS_11220 8309 9283 gene locus_tag LOCUS_11230 8309 9283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 9507 11252 gene locus_tag LOCUS_11240 9507 11252 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_11240 >Feature sequence048 1263 166 gene locus_tag LOCUS_11250 gene ychF 1263 166 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_11250 1443 3128 gene locus_tag LOCUS_11260 gene argS 1443 3128 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_11260 3268 3600 gene locus_tag LOCUS_11270 3268 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 3616 4260 gene locus_tag LOCUS_11280 3616 4260 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_11280 4335 4862 gene locus_tag LOCUS_11290 gene rbr3B 4335 4862 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966860.1 protein_id gnl|my_center|LOCUS_11290 5117 5785 gene locus_tag LOCUS_11300 5117 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 6325 6939 gene locus_tag LOCUS_11310 6325 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 6943 8034 gene locus_tag LOCUS_11320 6943 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 8183 8626 gene locus_tag LOCUS_11330 8183 8626 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966468.1 protein_id gnl|my_center|LOCUS_11330 8623 9729 gene locus_tag LOCUS_11340 8623 9729 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966467.1 protein_id gnl|my_center|LOCUS_11340 9776 12289 gene locus_tag LOCUS_11350 9776 12289 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810223.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence049 2725 419 gene locus_tag LOCUS_11360 2725 419 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016705.1 protein_id gnl|my_center|LOCUS_11360 3140 3637 gene locus_tag LOCUS_11370 gene nuoE 3140 3637 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766748.1 protein_id gnl|my_center|LOCUS_11370 3634 5544 gene locus_tag LOCUS_11380 gene nuoF 3634 5544 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_11380 5553 7280 gene locus_tag LOCUS_11390 5553 7280 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_11390 8883 7393 gene locus_tag LOCUS_11400 8883 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 10484 9048 gene locus_tag LOCUS_11410 gene purB 10484 9048 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965127.1 protein_id gnl|my_center|LOCUS_11410 11077 10559 gene locus_tag LOCUS_11420 11077 10559 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_11420 11542 11078 gene locus_tag LOCUS_11430 11542 11078 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_11430 11786 12073 gene locus_tag LOCUS_11440 11786 12073 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence050 1017 115 gene locus_tag LOCUS_11450 1017 115 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_11450 2248 1019 gene locus_tag LOCUS_11460 2248 1019 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986881.1 protein_id gnl|my_center|LOCUS_11460 2765 2250 gene locus_tag LOCUS_11470 2765 2250 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458839.1 protein_id gnl|my_center|LOCUS_11470 3358 2762 gene locus_tag LOCUS_11480 3358 2762 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288107.1 protein_id gnl|my_center|LOCUS_11480 5422 3392 gene locus_tag LOCUS_11490 5422 3392 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861169.1 protein_id gnl|my_center|LOCUS_11490 5541 5735 gene locus_tag LOCUS_11500 5541 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 5814 6887 gene locus_tag LOCUS_11510 gene serC 5814 6887 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_11510 6884 8035 gene locus_tag LOCUS_11520 6884 8035 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490229.1 protein_id gnl|my_center|LOCUS_11520 8520 8167 gene locus_tag LOCUS_11530 8520 8167 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791443.1 protein_id gnl|my_center|LOCUS_11530 8696 9022 gene locus_tag LOCUS_11540 8696 9022 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901934.1 protein_id gnl|my_center|LOCUS_11540 11612 9072 gene locus_tag LOCUS_11550 11612 9072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 <12260 11679 gene locus_tag LOCUS_11560 <12260 11679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459544.1:ABC transporter ATP-binding protein >Feature sequence051 1462 23 gene locus_tag LOCUS_11570 1462 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 2345 1545 gene locus_tag LOCUS_11580 gene rsmI 2345 1545 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_11580 3073 2342 gene locus_tag LOCUS_11590 3073 2342 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910686.1 protein_id gnl|my_center|LOCUS_11590 3745 3575 gene locus_tag LOCUS_11600 3745 3575 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943346.1 protein_id gnl|my_center|LOCUS_11600 4693 3830 gene locus_tag LOCUS_11610 4693 3830 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_11610 5613 4672 gene locus_tag LOCUS_11620 5613 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 6848 5610 gene locus_tag LOCUS_11630 6848 5610 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243352.1 protein_id gnl|my_center|LOCUS_11630 7819 6845 gene locus_tag LOCUS_11640 7819 6845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 9346 7853 gene locus_tag LOCUS_11650 gene lysS 9346 7853 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048371.1 protein_id gnl|my_center|LOCUS_11650 9822 9355 gene locus_tag LOCUS_11660 gene greA 9822 9355 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_11660 11170 9995 gene locus_tag LOCUS_11670 11170 9995 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_11670 11655 11167 gene locus_tag LOCUS_11680 11655 11167 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_11680 11755 12012 gene locus_tag LOCUS_11690 11755 12012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence052 144 329 gene locus_tag LOCUS_11700 144 329 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357636.1 protein_id gnl|my_center|LOCUS_11700 341 733 gene locus_tag LOCUS_11710 gene rpsH 341 733 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_11710 744 1292 gene locus_tag LOCUS_11720 gene rplF 744 1292 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379228.1 protein_id gnl|my_center|LOCUS_11720 1304 1672 gene locus_tag LOCUS_11730 gene rplR 1304 1672 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288679.1 protein_id gnl|my_center|LOCUS_11730 1685 2203 gene locus_tag LOCUS_11740 gene rpsE 1685 2203 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003328273.1 protein_id gnl|my_center|LOCUS_11740 2215 2388 gene locus_tag LOCUS_11750 2215 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 2399 2848 gene locus_tag LOCUS_11760 gene rplO 2399 2848 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_11760 2917 4230 gene locus_tag LOCUS_11770 gene secY 2917 4230 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427725.1 protein_id gnl|my_center|LOCUS_11770 4249 4890 gene locus_tag LOCUS_11780 4249 4890 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860634.1 protein_id gnl|my_center|LOCUS_11780 4892 5635 gene locus_tag LOCUS_11790 gene map 4892 5635 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_11790 5661 5882 gene locus_tag LOCUS_11800 gene infA 5661 5882 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421127.1 protein_id gnl|my_center|LOCUS_11800 6329 6697 gene locus_tag LOCUS_11810 gene rpsM 6329 6697 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966388.1 protein_id gnl|my_center|LOCUS_11810 6708 7106 gene locus_tag LOCUS_11820 gene rpsK 6708 7106 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_11820 7119 7742 gene locus_tag LOCUS_11830 gene rpsD 7119 7742 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_11830 7765 8718 gene locus_tag LOCUS_11840 7765 8718 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357472.1 protein_id gnl|my_center|LOCUS_11840 8722 9228 gene locus_tag LOCUS_11850 gene rplQ 8722 9228 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723675.1 protein_id gnl|my_center|LOCUS_11850 9484 9236 gene locus_tag LOCUS_11860 9484 9236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 10885 9488 gene locus_tag LOCUS_11870 10885 9488 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861085.1 protein_id gnl|my_center|LOCUS_11870 11258 11079 gene locus_tag LOCUS_11880 11258 11079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 11535 11356 gene locus_tag LOCUS_11890 11535 11356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 >Feature sequence053 1843 395 gene locus_tag LOCUS_11900 1843 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 2761 2087 gene locus_tag LOCUS_11910 2761 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 3369 2830 gene locus_tag LOCUS_11920 3369 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 3983 3399 gene locus_tag LOCUS_11930 3983 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 4657 4184 gene locus_tag LOCUS_11940 4657 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 5360 4803 gene locus_tag LOCUS_11950 5360 4803 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180154.1 protein_id gnl|my_center|LOCUS_11950 5961 5344 gene locus_tag LOCUS_11960 5961 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 6176 7246 gene locus_tag LOCUS_11970 6176 7246 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_11970 8017 7307 gene locus_tag LOCUS_11980 8017 7307 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295857.1 protein_id gnl|my_center|LOCUS_11980 8755 8093 gene locus_tag LOCUS_11990 8755 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 8934 9010 gene locus_tag LOCUS_t00160 8934 9010 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10237 9566 gene locus_tag LOCUS_12000 10237 9566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 10568 10227 gene locus_tag LOCUS_12010 10568 10227 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670505.1 protein_id gnl|my_center|LOCUS_12010 10790 11698 gene locus_tag LOCUS_12020 10790 11698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence054 401 165 gene locus_tag LOCUS_12030 401 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12030 2476 416 gene locus_tag LOCUS_12040 gene pflB 2476 416 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195472.1 protein_id gnl|my_center|LOCUS_12040 2807 2526 gene locus_tag LOCUS_12050 2807 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 3547 2807 gene locus_tag LOCUS_12060 gene pflA 3547 2807 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357530.1 protein_id gnl|my_center|LOCUS_12060 4873 3887 gene locus_tag LOCUS_12070 4873 3887 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583756.1 protein_id gnl|my_center|LOCUS_12070 5421 4870 gene locus_tag LOCUS_12080 5421 4870 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887849.1 protein_id gnl|my_center|LOCUS_12080 6932 5418 gene locus_tag LOCUS_12090 6932 5418 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814147.1 protein_id gnl|my_center|LOCUS_12090 7501 7100 gene locus_tag LOCUS_12100 7501 7100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 7857 7498 gene locus_tag LOCUS_12110 7857 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 8064 11555 gene locus_tag LOCUS_12120 8064 11555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence055 386 54 gene locus_tag LOCUS_12130 386 54 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965540.1 protein_id gnl|my_center|LOCUS_12130 3221 567 gene locus_tag LOCUS_12140 3221 567 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355749.1 protein_id gnl|my_center|LOCUS_12140 4485 3493 gene locus_tag LOCUS_12150 4485 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 4655 7687 gene locus_tag LOCUS_12160 4655 7687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 7684 10959 gene locus_tag LOCUS_12170 7684 10959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 >Feature sequence056 2307 838 gene locus_tag LOCUS_12180 2307 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 3965 2304 gene locus_tag LOCUS_12190 3965 2304 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922389.1 protein_id gnl|my_center|LOCUS_12190 5694 4027 gene locus_tag LOCUS_12200 5694 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 5900 6931 gene locus_tag LOCUS_12210 5900 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 7039 7443 gene locus_tag LOCUS_12220 7039 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 7852 7637 gene locus_tag LOCUS_12230 7852 7637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 7911 8252 gene locus_tag LOCUS_12240 7911 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 8298 8960 gene locus_tag LOCUS_12250 8298 8960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 10563 9202 gene locus_tag LOCUS_12260 10563 9202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 11250 10576 gene locus_tag LOCUS_12270 11250 10576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence057 388 723 gene locus_tag LOCUS_12280 388 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 2553 832 gene locus_tag LOCUS_12290 2553 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 2710 3861 gene locus_tag LOCUS_12300 2710 3861 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233099.1 protein_id gnl|my_center|LOCUS_12300 3858 6434 gene locus_tag LOCUS_12310 gene sbcC 3858 6434 CDS product exonuclease SbcCD subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888557.1 protein_id gnl|my_center|LOCUS_12310 6445 8124 gene locus_tag LOCUS_12320 6445 8124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 8115 8306 gene locus_tag LOCUS_12330 8115 8306 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966985.1 protein_id gnl|my_center|LOCUS_12330 8306 8920 gene locus_tag LOCUS_12340 gene sipX 8306 8920 CDS product type I signal peptidase SipX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723887.1 protein_id gnl|my_center|LOCUS_12340 8947 9789 gene locus_tag LOCUS_12350 8947 9789 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 protein_id gnl|my_center|LOCUS_12350 9791 10363 gene locus_tag LOCUS_12360 9791 10363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 10364 10633 gene locus_tag LOCUS_12370 10364 10633 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871082.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence058 568 1902 gene locus_tag LOCUS_12380 gene gdhA 568 1902 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815054.1 protein_id gnl|my_center|LOCUS_12380 2088 3353 gene locus_tag LOCUS_12390 gene pepV 2088 3353 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048281.1 protein_id gnl|my_center|LOCUS_12390 3480 4172 gene locus_tag LOCUS_12400 3480 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 4278 4991 gene locus_tag LOCUS_12410 gene radC 4278 4991 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338763.1 protein_id gnl|my_center|LOCUS_12410 4988 6238 gene locus_tag LOCUS_12420 4988 6238 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948977.1 protein_id gnl|my_center|LOCUS_12420 6248 6892 gene locus_tag LOCUS_12430 6248 6892 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963563.1 protein_id gnl|my_center|LOCUS_12430 7047 8282 gene locus_tag LOCUS_12440 7047 8282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 8275 8544 gene locus_tag LOCUS_12450 8275 8544 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660754.1 protein_id gnl|my_center|LOCUS_12450 8538 9332 gene locus_tag LOCUS_12460 8538 9332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 9326 9946 gene locus_tag LOCUS_12470 9326 9946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence059 96 686 gene locus_tag LOCUS_12480 96 686 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_12480 859 981 gene locus_tag LOCUS_12490 859 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1212 2630 gene locus_tag LOCUS_12500 1212 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 4278 3019 gene locus_tag LOCUS_12510 4278 3019 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_12510 4530 4456 gene locus_tag LOCUS_t00170 4530 4456 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4990 5154 gene locus_tag LOCUS_12520 4990 5154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 5276 5779 gene locus_tag LOCUS_12530 5276 5779 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965781.1 protein_id gnl|my_center|LOCUS_12530 5776 7548 gene locus_tag LOCUS_12540 5776 7548 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_12540 7532 9484 gene locus_tag LOCUS_12550 7532 9484 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence060 113 811 gene locus_tag LOCUS_12560 gene cwlD 113 811 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860636.1 protein_id gnl|my_center|LOCUS_12560 883 1629 gene locus_tag LOCUS_12570 883 1629 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402843.1 protein_id gnl|my_center|LOCUS_12570 1679 2170 gene locus_tag LOCUS_12580 1679 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 2342 3571 gene locus_tag LOCUS_12590 2342 3571 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393768.1 protein_id gnl|my_center|LOCUS_12590 3568 4491 gene locus_tag LOCUS_12600 gene argC 3568 4491 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919254.1 protein_id gnl|my_center|LOCUS_12600 4709 5932 gene locus_tag LOCUS_12610 gene argJ 4709 5932 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_12610 5929 6786 gene locus_tag LOCUS_12620 gene argB 5929 6786 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435171.1 protein_id gnl|my_center|LOCUS_12620 6860 8023 gene locus_tag LOCUS_12630 6860 8023 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082331.1 protein_id gnl|my_center|LOCUS_12630 8020 8922 gene locus_tag LOCUS_12640 gene argF 8020 8922 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_12640 8936 10009 gene locus_tag LOCUS_12650 8936 10009 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723080.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence061 163 1041 gene locus_tag LOCUS_12660 163 1041 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_12660 1034 1771 gene locus_tag LOCUS_12670 1034 1771 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_12670 1953 4274 gene locus_tag LOCUS_12680 1953 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 4398 4643 gene locus_tag LOCUS_12690 4398 4643 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986779.1 protein_id gnl|my_center|LOCUS_12690 4743 4973 gene locus_tag LOCUS_12700 4743 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 4952 6787 gene locus_tag LOCUS_12710 4952 6787 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037005.1 protein_id gnl|my_center|LOCUS_12710 6729 7541 gene locus_tag LOCUS_12720 6729 7541 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964333.1 protein_id gnl|my_center|LOCUS_12720 7635 9692 gene locus_tag LOCUS_12730 7635 9692 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379416.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence062 285 130 gene locus_tag LOCUS_12740 285 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 1082 351 gene locus_tag LOCUS_12750 gene uppP 1082 351 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_12750 3291 1189 gene locus_tag LOCUS_12760 3291 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 6798 3403 gene locus_tag LOCUS_12770 gene mfd 6798 3403 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_12770 7358 6795 gene locus_tag LOCUS_12780 gene pth 7358 6795 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880175.1 protein_id gnl|my_center|LOCUS_12780 8355 7408 gene locus_tag LOCUS_12790 8355 7408 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359343.1 protein_id gnl|my_center|LOCUS_12790 9018 8488 gene locus_tag LOCUS_12800 gene tadA 9018 8488 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_12800 9881 8988 gene locus_tag LOCUS_12810 9881 8988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence063 807 172 gene locus_tag LOCUS_12820 gene upp 807 172 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_12820 2269 809 gene locus_tag LOCUS_12830 2269 809 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775347.1 protein_id gnl|my_center|LOCUS_12830 3401 2472 gene locus_tag LOCUS_12840 gene cysK 3401 2472 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_12840 4930 3398 gene locus_tag LOCUS_12850 4930 3398 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682348.1 protein_id gnl|my_center|LOCUS_12850 7589 5424 gene locus_tag LOCUS_12860 7589 5424 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461496.1 protein_id gnl|my_center|LOCUS_12860 8434 7742 gene locus_tag LOCUS_12870 8434 7742 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680231.1 protein_id gnl|my_center|LOCUS_12870 9344 8727 gene locus_tag LOCUS_12880 9344 8727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 9754 9344 gene locus_tag LOCUS_12890 9754 9344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence064 247 1161 gene locus_tag LOCUS_12900 gene tsf 247 1161 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231929.1 protein_id gnl|my_center|LOCUS_12900 1711 2292 gene locus_tag LOCUS_12910 1711 2292 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_12910 2484 3194 gene locus_tag LOCUS_12920 gene pyrH 2484 3194 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_12920 3211 3780 gene locus_tag LOCUS_12930 gene frr 3211 3780 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_12930 3780 4478 gene locus_tag LOCUS_12940 3780 4478 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017071.1 protein_id gnl|my_center|LOCUS_12940 4486 5385 gene locus_tag LOCUS_12950 4486 5385 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962766.1 protein_id gnl|my_center|LOCUS_12950 5461 6582 gene locus_tag LOCUS_12960 5461 6582 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_12960 6575 7834 gene locus_tag LOCUS_12970 gene rseP 6575 7834 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312540.1 protein_id gnl|my_center|LOCUS_12970 9048 7900 gene locus_tag LOCUS_12980 9048 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 9385 9966 gene locus_tag LOCUS_12990 gene yfbR 9385 9966 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813860.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence065 3 3449 gene locus_tag LOCUS_13000 3 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 3450 4055 gene locus_tag LOCUS_13010 3450 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 4076 5203 gene locus_tag LOCUS_13020 4076 5203 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 protein_id gnl|my_center|LOCUS_13020 5205 6365 gene locus_tag LOCUS_13030 gene thiI 5205 6365 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_13030 8635 6476 gene locus_tag LOCUS_13040 8635 6476 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459072.1 protein_id gnl|my_center|LOCUS_13040 8742 9446 gene locus_tag LOCUS_13050 8742 9446 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence066 1237 38 gene locus_tag LOCUS_13060 1237 38 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_13060 2378 1278 gene locus_tag LOCUS_13070 2378 1278 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_13070 4060 2486 gene locus_tag LOCUS_13080 4060 2486 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405061.1 protein_id gnl|my_center|LOCUS_13080 4751 4050 gene locus_tag LOCUS_13090 gene estV 4751 4050 CDS product lipase EstV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129409.1 protein_id gnl|my_center|LOCUS_13090 5185 4748 gene locus_tag LOCUS_13100 gene rimI 5185 4748 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_13100 5799 5182 gene locus_tag LOCUS_13110 5799 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 6215 5796 gene locus_tag LOCUS_13120 gene tsaE 6215 5796 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931832.1 protein_id gnl|my_center|LOCUS_13120 6995 6243 gene locus_tag LOCUS_13130 6995 6243 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_13130 7396 7232 gene locus_tag LOCUS_13140 7396 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 7487 7690 gene locus_tag LOCUS_13150 7487 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 7692 7895 gene locus_tag LOCUS_13160 7692 7895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 7969 8448 gene locus_tag LOCUS_13170 7969 8448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 8635 9609 gene locus_tag LOCUS_13180 8635 9609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 >Feature sequence067 654 2414 gene locus_tag LOCUS_13190 654 2414 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928975.1 protein_id gnl|my_center|LOCUS_13190 2401 4158 gene locus_tag LOCUS_13200 2401 4158 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258301.1 protein_id gnl|my_center|LOCUS_13200 4256 4585 gene locus_tag LOCUS_13210 4256 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 6502 5762 gene locus_tag LOCUS_13220 6502 5762 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295857.1 protein_id gnl|my_center|LOCUS_13220 7190 6678 gene locus_tag LOCUS_13230 7190 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 8041 7187 gene locus_tag LOCUS_13240 gene mscS 8041 7187 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_13240 8739 8344 gene locus_tag LOCUS_13250 8739 8344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 9507 8749 gene locus_tag LOCUS_13260 9507 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 >Feature sequence068 1533 61 gene locus_tag LOCUS_13270 1533 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 2137 1901 gene locus_tag LOCUS_13280 2137 1901 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670215.1 protein_id gnl|my_center|LOCUS_13280 2475 2185 gene locus_tag LOCUS_13290 gene rpsP 2475 2185 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173115.1 protein_id gnl|my_center|LOCUS_13290 3849 2530 gene locus_tag LOCUS_13300 gene ffh 3849 2530 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_13300 4192 3860 gene locus_tag LOCUS_13310 4192 3860 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402075.1 protein_id gnl|my_center|LOCUS_13310 6011 5115 gene locus_tag LOCUS_13320 gene ftsY 6011 5115 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965059.1 protein_id gnl|my_center|LOCUS_13320 <9282 6142 gene locus_tag LOCUS_13330 <9282 6142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232028.1:chromosome segregation protein SMC >Feature sequence069 1369 419 gene locus_tag LOCUS_13340 1369 419 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_13340 3295 1415 gene locus_tag LOCUS_13350 3295 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 4994 3306 gene locus_tag LOCUS_13360 4994 3306 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775818.1 protein_id gnl|my_center|LOCUS_13360 5964 5023 gene locus_tag LOCUS_13370 5964 5023 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 protein_id gnl|my_center|LOCUS_13370 7014 5977 gene locus_tag LOCUS_13380 7014 5977 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775210.1 protein_id gnl|my_center|LOCUS_13380 7226 8248 gene locus_tag LOCUS_13390 7226 8248 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence070 788 501 gene locus_tag LOCUS_13400 788 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1326 898 gene locus_tag LOCUS_13410 1326 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2165 1323 gene locus_tag LOCUS_13420 2165 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 2440 3636 gene locus_tag LOCUS_13430 2440 3636 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399531.1 protein_id gnl|my_center|LOCUS_13430 3633 4508 gene locus_tag LOCUS_13440 3633 4508 CDS product radical SAM mobile pair protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679438.1 protein_id gnl|my_center|LOCUS_13440 6116 4629 gene locus_tag LOCUS_13450 6116 4629 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_13450 8137 6146 gene locus_tag LOCUS_13460 8137 6146 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_13460 8998 8246 gene locus_tag LOCUS_13470 8998 8246 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774239.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence071 <1 718 gene locus_tag LOCUS_13480 <1 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941834.1:nucleoside triphosphate pyrophosphohydrolase 705 1778 gene locus_tag LOCUS_13490 gene dusB 705 1778 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966475.1 protein_id gnl|my_center|LOCUS_13490 1847 2767 gene locus_tag LOCUS_13500 1847 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 3031 4944 gene locus_tag LOCUS_13510 gene gyrB 3031 4944 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434229.1 protein_id gnl|my_center|LOCUS_13510 5481 8048 gene locus_tag LOCUS_13520 gene gyrA 5481 8048 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence072 312 2729 gene locus_tag LOCUS_13530 312 2729 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263668.1 protein_id gnl|my_center|LOCUS_13530 2734 3489 gene locus_tag LOCUS_13540 gene cas5c 2734 3489 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205009051.1 protein_id gnl|my_center|LOCUS_13540 3486 5387 gene locus_tag LOCUS_13550 3486 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 5384 6265 gene locus_tag LOCUS_13560 gene cas7c 5384 6265 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922510.1 protein_id gnl|my_center|LOCUS_13560 6289 6954 gene locus_tag LOCUS_13570 gene cas4 6289 6954 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_13570 6951 7982 gene locus_tag LOCUS_13580 gene cas1c 6951 7982 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_13580 7990 8280 gene locus_tag LOCUS_13590 gene cas2 7990 8280 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence073 1549 32 gene locus_tag LOCUS_13600 1549 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941782.1 protein_id gnl|my_center|LOCUS_13600 2685 1540 gene locus_tag LOCUS_13610 2685 1540 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966853.1 protein_id gnl|my_center|LOCUS_13610 2787 3437 gene locus_tag LOCUS_13620 2787 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 4722 3871 gene locus_tag LOCUS_13630 4722 3871 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_13630 6561 4786 gene locus_tag LOCUS_13640 6561 4786 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732216.1 protein_id gnl|my_center|LOCUS_13640 8378 6558 gene locus_tag LOCUS_13650 8378 6558 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721734.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence074 708 10 gene locus_tag LOCUS_13660 gene sigK 708 10 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964996.1 protein_id gnl|my_center|LOCUS_13660 2615 819 gene locus_tag LOCUS_13670 gene aspS 2615 819 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599762.1 protein_id gnl|my_center|LOCUS_13670 3109 2717 gene locus_tag LOCUS_13680 3109 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 4648 3263 gene locus_tag LOCUS_13690 4648 3263 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_13690 5142 6476 gene locus_tag LOCUS_13700 gene vmrA 5142 6476 CDS product sodium-coupled multidrug efflux MATE transporter VmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481584.1 protein_id gnl|my_center|LOCUS_13700 6628 7797 gene locus_tag LOCUS_13710 6628 7797 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228869.1 protein_id gnl|my_center|LOCUS_13710 7810 8463 gene locus_tag LOCUS_13720 7810 8463 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890811.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence075 2268 2044 gene locus_tag LOCUS_13730 2268 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 2807 2355 gene locus_tag LOCUS_13740 2807 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 5816 3183 gene locus_tag LOCUS_13750 5816 3183 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263553.1 protein_id gnl|my_center|LOCUS_13750 6409 5945 gene locus_tag LOCUS_13760 6409 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 7533 6637 gene locus_tag LOCUS_13770 7533 6637 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966363.1 protein_id gnl|my_center|LOCUS_13770 <8086 7562 gene locus_tag LOCUS_13780 <8086 7562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986115.1:2-isopropylmalate synthase >Feature sequence076 <1 845 gene locus_tag LOCUS_13790 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986381.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB 865 3435 gene locus_tag LOCUS_13800 gene mutS 865 3435 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047675.1 protein_id gnl|my_center|LOCUS_13800 3432 5531 gene locus_tag LOCUS_13810 3432 5531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 5528 6454 gene locus_tag LOCUS_13820 gene miaA 5528 6454 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_13820 6441 7670 gene locus_tag LOCUS_13830 6441 7670 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence077 1549 41 gene locus_tag LOCUS_13840 1549 41 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_13840 3892 2003 gene locus_tag LOCUS_13850 3892 2003 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207808.1 protein_id gnl|my_center|LOCUS_13850 4062 4883 gene locus_tag LOCUS_13860 4062 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 4885 5859 gene locus_tag LOCUS_13870 4885 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 5923 7638 gene locus_tag LOCUS_13880 5923 7638 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674328.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence078 716 48 gene locus_tag LOCUS_13890 716 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 2849 717 gene locus_tag LOCUS_13900 2849 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 3035 4585 gene locus_tag LOCUS_13910 3035 4585 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 protein_id gnl|my_center|LOCUS_13910 4727 5212 gene locus_tag LOCUS_13920 4727 5212 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816021.1 protein_id gnl|my_center|LOCUS_13920 5202 5555 gene locus_tag LOCUS_13930 5202 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 5569 6870 gene locus_tag LOCUS_13940 5569 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 6860 7402 gene locus_tag LOCUS_13950 6860 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 >Feature sequence079 1330 365 gene locus_tag LOCUS_13960 1330 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1538 1942 gene locus_tag LOCUS_13970 1538 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 4165 2162 gene locus_tag LOCUS_13980 gene recG 4165 2162 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_13980 5968 4322 gene locus_tag LOCUS_13990 5968 4322 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454872.1 protein_id gnl|my_center|LOCUS_13990 6457 6107 gene locus_tag LOCUS_14000 6457 6107 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830156.1 protein_id gnl|my_center|LOCUS_14000 6677 6865 gene locus_tag LOCUS_14010 gene rpmB 6677 6865 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416297.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence080 1597 440 gene locus_tag LOCUS_14020 1597 440 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887571.1 protein_id gnl|my_center|LOCUS_14020 2376 1594 gene locus_tag LOCUS_14030 2376 1594 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_14030 3072 2386 gene locus_tag LOCUS_14040 3072 2386 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259108.1 protein_id gnl|my_center|LOCUS_14040 3399 3145 gene locus_tag LOCUS_14050 3399 3145 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909394.1 protein_id gnl|my_center|LOCUS_14050 3659 4594 gene locus_tag LOCUS_14060 3659 4594 CDS product 4Fe-4S-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430299.1 protein_id gnl|my_center|LOCUS_14060 4587 5564 gene locus_tag LOCUS_14070 4587 5564 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156774516.1 protein_id gnl|my_center|LOCUS_14070 5561 6553 gene locus_tag LOCUS_14080 5561 6553 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018304962.1 protein_id gnl|my_center|LOCUS_14080 6546 7271 gene locus_tag LOCUS_14090 6546 7271 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385686.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence081 1593 37 gene locus_tag LOCUS_14100 gene gpmI 1593 37 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861866.1 protein_id gnl|my_center|LOCUS_14100 2347 1595 gene locus_tag LOCUS_14110 gene tpiA 2347 1595 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_14110 2984 2439 gene locus_tag LOCUS_14120 2984 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 4332 3010 gene locus_tag LOCUS_14130 4332 3010 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_14130 4664 5035 gene locus_tag LOCUS_14140 gene rpsL 4664 5035 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_14140 5223 5693 gene locus_tag LOCUS_14150 gene rpsG 5223 5693 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393941.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence082 1821 487 gene locus_tag LOCUS_14160 1821 487 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_14160 2947 1814 gene locus_tag LOCUS_14170 2947 1814 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_14170 3901 3086 gene locus_tag LOCUS_14180 gene cdaA 3901 3086 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360232.1 protein_id gnl|my_center|LOCUS_14180 4968 3997 gene locus_tag LOCUS_14190 gene holA 4968 3997 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392113.1 protein_id gnl|my_center|LOCUS_14190 6905 4965 gene locus_tag LOCUS_14200 6905 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence083 1126 98 gene locus_tag LOCUS_14210 1126 98 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582929.1 protein_id gnl|my_center|LOCUS_14210 1966 1253 gene locus_tag LOCUS_14220 1966 1253 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460408.1 protein_id gnl|my_center|LOCUS_14220 2617 3225 gene locus_tag LOCUS_14230 2617 3225 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_14230 3219 4595 gene locus_tag LOCUS_14240 3219 4595 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_14240 4781 5035 gene locus_tag LOCUS_14250 gene rpsO 4781 5035 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence084 504 1358 gene locus_tag LOCUS_14260 504 1358 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_14260 1506 1363 gene locus_tag LOCUS_14270 1506 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1538 3406 gene locus_tag LOCUS_14280 1538 3406 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287747.1 protein_id gnl|my_center|LOCUS_14280 4667 3522 gene locus_tag LOCUS_14290 4667 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 5292 4822 gene locus_tag LOCUS_14300 5292 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 5923 5378 gene locus_tag LOCUS_14310 5923 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 6112 6324 gene locus_tag LOCUS_14320 6112 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 6321 6581 gene locus_tag LOCUS_14330 6321 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence085 1122 457 gene locus_tag LOCUS_14340 gene rnc 1122 457 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257002.1 protein_id gnl|my_center|LOCUS_14340 2146 1115 gene locus_tag LOCUS_14350 gene plsX 2146 1115 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_14350 3352 2291 gene locus_tag LOCUS_14360 3352 2291 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386999.1 protein_id gnl|my_center|LOCUS_14360 3587 3946 gene locus_tag LOCUS_14370 3587 3946 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_14370 4009 4503 gene locus_tag LOCUS_14380 4009 4503 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696696.1 protein_id gnl|my_center|LOCUS_14380 4573 4848 gene locus_tag LOCUS_14390 4573 4848 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671306.1 protein_id gnl|my_center|LOCUS_14390 4841 5173 gene locus_tag LOCUS_14400 4841 5173 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817080.1 protein_id gnl|my_center|LOCUS_14400 6607 5246 gene locus_tag LOCUS_14410 6607 5246 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence086 163 1638 gene locus_tag LOCUS_14420 163 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 3116 1839 gene locus_tag LOCUS_14430 3116 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 3880 3113 gene locus_tag LOCUS_14440 3880 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 5621 3882 gene locus_tag LOCUS_14450 5621 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 6333 >6693 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccacgcaccccttgcggggtgcgac >Feature sequence087 736 2148 gene locus_tag LOCUS_14460 gene pyk 736 2148 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_14460 2818 2258 gene locus_tag LOCUS_14470 2818 2258 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_14470 3856 3200 gene locus_tag LOCUS_14480 3856 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 3996 4664 gene locus_tag LOCUS_14490 3996 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 4657 6108 gene locus_tag LOCUS_14500 gene guaB 4657 6108 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048242.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence088 486 310 gene locus_tag LOCUS_14510 486 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 3054 625 gene locus_tag LOCUS_14520 3054 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 3856 3068 gene locus_tag LOCUS_14530 3856 3068 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048205.1 protein_id gnl|my_center|LOCUS_14530 4980 3856 gene locus_tag LOCUS_14540 gene egsA 4980 3856 CDS product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229504.1 protein_id gnl|my_center|LOCUS_14540 6137 5226 gene locus_tag LOCUS_14550 6137 5226 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058303659.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence089 484 2475 gene locus_tag LOCUS_14560 gene tkt 484 2475 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964657.1 protein_id gnl|my_center|LOCUS_14560 2529 3074 gene locus_tag LOCUS_14570 2529 3074 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107707.1 protein_id gnl|my_center|LOCUS_14570 3305 4246 gene locus_tag LOCUS_14580 3305 4246 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_14580 4433 5374 gene locus_tag LOCUS_14590 4433 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 <6263 5466 gene locus_tag LOCUS_14600 <6263 5466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966140.1:methionine adenosyltransferase >Feature sequence090 1639 272 gene locus_tag LOCUS_14610 1639 272 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460409.1 protein_id gnl|my_center|LOCUS_14610 1857 2525 gene locus_tag LOCUS_14620 1857 2525 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_14620 2528 4000 gene locus_tag LOCUS_14630 2528 4000 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172635924.1 protein_id gnl|my_center|LOCUS_14630 4314 5033 gene locus_tag LOCUS_14640 4314 5033 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_14640 5122 6042 gene locus_tag LOCUS_14650 5122 6042 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence091 3608 1548 gene locus_tag LOCUS_14660 3608 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 4305 3610 gene locus_tag LOCUS_14670 4305 3610 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964148.1 protein_id gnl|my_center|LOCUS_14670 5939 4548 gene locus_tag LOCUS_14680 5939 4548 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence092 792 1487 gene locus_tag LOCUS_14690 792 1487 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427805.1 protein_id gnl|my_center|LOCUS_14690 1722 2267 gene locus_tag LOCUS_14700 gene pyrR 1722 2267 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460661.1 protein_id gnl|my_center|LOCUS_14700 2254 3174 gene locus_tag LOCUS_14710 2254 3174 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_14710 3171 4433 gene locus_tag LOCUS_14720 3171 4433 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_14720 4712 5392 gene locus_tag LOCUS_14730 4712 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 >Feature sequence093 2083 32 gene locus_tag LOCUS_14740 gene fusA 2083 32 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048368.1 protein_id gnl|my_center|LOCUS_14740 2331 3566 gene locus_tag LOCUS_14750 2331 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 4459 3602 gene locus_tag LOCUS_14760 4459 3602 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362794.1 protein_id gnl|my_center|LOCUS_14760 4583 5728 gene locus_tag LOCUS_14770 4583 5728 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence094 2496 148 gene locus_tag LOCUS_14780 2496 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 5255 3018 gene locus_tag LOCUS_14790 5255 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 5421 5497 gene locus_tag LOCUS_t00180 5421 5497 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5605 5743 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctccctcaaagagggaggca >Feature sequence095 271 1521 gene locus_tag LOCUS_14800 271 1521 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965562.1 protein_id gnl|my_center|LOCUS_14800 1820 2251 gene locus_tag LOCUS_14810 1820 2251 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143849.1 protein_id gnl|my_center|LOCUS_14810 2248 3888 gene locus_tag LOCUS_14820 2248 3888 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_14820 3996 5801 gene locus_tag LOCUS_14830 3996 5801 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence096 1307 276 gene locus_tag LOCUS_14840 gene pheS 1307 276 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458978.1 protein_id gnl|my_center|LOCUS_14840 1859 1653 gene locus_tag LOCUS_14850 1859 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 2923 1856 gene locus_tag LOCUS_14860 2923 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 3320 3144 gene locus_tag LOCUS_14870 3320 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 3516 4025 gene locus_tag LOCUS_14880 3516 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 4767 4096 gene locus_tag LOCUS_14890 4767 4096 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048153.1 protein_id gnl|my_center|LOCUS_14890 5576 4815 gene locus_tag LOCUS_14900 5576 4815 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391588.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence097 721 2670 gene locus_tag LOCUS_14910 721 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 2816 4777 gene locus_tag LOCUS_14920 2816 4777 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_14920 4787 5311 gene locus_tag LOCUS_14930 4787 5311 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948551.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence098 86 718 gene locus_tag LOCUS_14940 86 718 CDS product RecX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257010.1 protein_id gnl|my_center|LOCUS_14940 715 2169 gene locus_tag LOCUS_14950 715 2169 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963812.1 protein_id gnl|my_center|LOCUS_14950 2985 2242 gene locus_tag LOCUS_14960 2985 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 3064 4206 gene locus_tag LOCUS_14970 3064 4206 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183272.1 protein_id gnl|my_center|LOCUS_14970 4264 4614 gene locus_tag LOCUS_14980 gene rsfS 4264 4614 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067112.1 protein_id gnl|my_center|LOCUS_14980 4617 5582 gene locus_tag LOCUS_14990 4617 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence099 558 85 gene locus_tag LOCUS_15000 558 85 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_15000 1184 567 gene locus_tag LOCUS_15010 1184 567 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_15010 2361 1270 gene locus_tag LOCUS_15020 gene tsaD 2361 1270 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964219.1 protein_id gnl|my_center|LOCUS_15020 3564 2467 gene locus_tag LOCUS_15030 gene prfB 3564 2467 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181244843.1 protein_id gnl|my_center|LOCUS_15030 <5462 3685 gene locus_tag LOCUS_15040 <5462 3685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_177221404.1:preprotein translocase subunit SecA >Feature sequence100 191 6 gene locus_tag LOCUS_15050 191 6 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357636.1 protein_id gnl|my_center|LOCUS_15050 793 203 gene locus_tag LOCUS_15060 gene rplE 793 203 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080831.1 protein_id gnl|my_center|LOCUS_15060 1262 816 gene locus_tag LOCUS_15070 1262 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1643 1275 gene locus_tag LOCUS_15080 gene rplN 1643 1275 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_15080 1916 1662 gene locus_tag LOCUS_15090 gene rpsQ 1916 1662 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_15090 2127 1927 gene locus_tag LOCUS_15100 gene rpmC 2127 1927 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 protein_id gnl|my_center|LOCUS_15100 2567 2127 gene locus_tag LOCUS_15110 gene rplP 2567 2127 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421160.1 protein_id gnl|my_center|LOCUS_15110 3226 2567 gene locus_tag LOCUS_15120 gene rpsC 3226 2567 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_15120 3626 3228 gene locus_tag LOCUS_15130 gene rplV 3626 3228 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966407.1 protein_id gnl|my_center|LOCUS_15130 3916 3638 gene locus_tag LOCUS_15140 gene rpsS 3916 3638 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_15140 4761 3931 gene locus_tag LOCUS_15150 gene rplB 4761 3931 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_15150 5073 4783 gene locus_tag LOCUS_15160 gene rplW 5073 4783 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence101 <1 943 gene locus_tag LOCUS_15170 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964591.1:radical SAM family heme chaperone HemW 2113 1220 gene locus_tag LOCUS_15180 2113 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 2627 2100 gene locus_tag LOCUS_15190 2627 2100 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966371.1 protein_id gnl|my_center|LOCUS_15190 3499 2627 gene locus_tag LOCUS_15200 3499 2627 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 protein_id gnl|my_center|LOCUS_15200 3579 4496 gene locus_tag LOCUS_15210 3579 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 4489 4926 gene locus_tag LOCUS_15220 gene rlmH 4489 4926 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002981964.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence102 996 1199 gene locus_tag LOCUS_15230 996 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1228 1464 gene locus_tag LOCUS_15240 1228 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15240 1461 3773 gene locus_tag LOCUS_15250 gene feoB 1461 3773 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027350.1 protein_id gnl|my_center|LOCUS_15250 3770 3943 gene locus_tag LOCUS_15260 3770 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence103 <1 733 gene locus_tag LOCUS_15270 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048370.1:glycine--tRNA ligase 991 2379 gene locus_tag LOCUS_15280 991 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 3187 2450 gene locus_tag LOCUS_15290 3187 2450 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681345.1 protein_id gnl|my_center|LOCUS_15290 3999 3184 gene locus_tag LOCUS_15300 3999 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 4110 5003 gene locus_tag LOCUS_15310 4110 5003 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226450.1 protein_id gnl|my_center|LOCUS_15310 >Feature sequence104 891 52 gene locus_tag LOCUS_15320 gene rsmA 891 52 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991156.1 protein_id gnl|my_center|LOCUS_15320 1887 1291 gene locus_tag LOCUS_15330 1887 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15330 2670 1906 gene locus_tag LOCUS_15340 2670 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15340 4736 2667 gene locus_tag LOCUS_15350 gene metG 4736 2667 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence105 <1 1207 gene locus_tag LOCUS_15360 <1 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461242.1:energy-coupling factor ABC transporter ATP-binding protein 1263 1646 gene locus_tag LOCUS_15370 1263 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15370 1707 2114 gene locus_tag LOCUS_15380 1707 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15380 2063 3337 gene locus_tag LOCUS_15390 2063 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15390 3334 3717 gene locus_tag LOCUS_15400 3334 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 3810 4451 gene locus_tag LOCUS_15410 3810 4451 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760815.1 protein_id gnl|my_center|LOCUS_15410 4636 4709 gene locus_tag LOCUS_t00190 4636 4709 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence106 1412 351 gene locus_tag LOCUS_15420 1412 351 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_15420 2100 1471 gene locus_tag LOCUS_15430 2100 1471 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 protein_id gnl|my_center|LOCUS_15430 3298 2102 gene locus_tag LOCUS_15440 gene tyrS 3298 2102 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_15440 3690 4616 gene locus_tag LOCUS_15450 3690 4616 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231290.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence107 <1 752 gene locus_tag LOCUS_15460 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813582.1:pyridoxal 5'-phosphate synthase lyase subunit PdxS 1040 1648 gene locus_tag LOCUS_15470 gene pdxT 1040 1648 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689943.1 protein_id gnl|my_center|LOCUS_15470 1789 2400 gene locus_tag LOCUS_15480 1789 2400 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957156.1 protein_id gnl|my_center|LOCUS_15480 3760 2450 gene locus_tag LOCUS_15490 3760 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence108 195 836 gene locus_tag LOCUS_15500 195 836 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936275.1 protein_id gnl|my_center|LOCUS_15500 877 3489 gene locus_tag LOCUS_15510 gene adhE 877 3489 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861762.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence109 668 285 gene locus_tag LOCUS_15520 668 285 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812106.1 protein_id gnl|my_center|LOCUS_15520 2008 812 gene locus_tag LOCUS_15530 gene ilvA 2008 812 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_15530 2298 4109 gene locus_tag LOCUS_15540 gene lepA 2298 4109 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence110 <1 1771 gene locus_tag LOCUS_15550 <1 1771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391556.1:DNA topoisomerase (ATP-hydrolyzing) subunit B 1758 4193 gene locus_tag LOCUS_15560 gene gyrA 1758 4193 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027057.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence111 1238 45 gene locus_tag LOCUS_15570 1238 45 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460506.1 protein_id gnl|my_center|LOCUS_15570 2319 1276 gene locus_tag LOCUS_15580 gene pta 2319 1276 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_15580 2498 3688 gene locus_tag LOCUS_15590 2498 3688 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388463.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence112 1387 167 gene locus_tag LOCUS_15600 1387 167 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_15600 1801 2592 gene locus_tag LOCUS_15610 1801 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 2608 3978 gene locus_tag LOCUS_15620 2608 3978 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272444.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence113 934 41 gene locus_tag LOCUS_15630 934 41 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074572.1 protein_id gnl|my_center|LOCUS_15630 1042 1629 gene locus_tag LOCUS_15640 1042 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1632 2225 gene locus_tag LOCUS_15650 1632 2225 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762312.1 protein_id gnl|my_center|LOCUS_15650 3034 3981 gene locus_tag LOCUS_15660 3034 3981 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947915.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence114 225 776 gene locus_tag LOCUS_15670 225 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1478 822 gene locus_tag LOCUS_15680 1478 822 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890774.1 protein_id gnl|my_center|LOCUS_15680 2323 1472 gene locus_tag LOCUS_15690 2323 1472 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890775.1 protein_id gnl|my_center|LOCUS_15690 2541 2320 gene locus_tag LOCUS_15700 2541 2320 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836789.1 protein_id gnl|my_center|LOCUS_15700 2755 3240 gene locus_tag LOCUS_15710 2755 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 3237 3875 gene locus_tag LOCUS_15720 3237 3875 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798139.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence115 925 509 gene locus_tag LOCUS_15730 925 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 1120 1425 gene locus_tag LOCUS_15740 gene rplU 1120 1425 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_15740 1483 1749 gene locus_tag LOCUS_15750 gene rpmA 1483 1749 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_15750 3050 1884 gene locus_tag LOCUS_15760 3050 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 3517 3047 gene locus_tag LOCUS_15770 3517 3047 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence116 185 1522 gene locus_tag LOCUS_15780 gene tilS 185 1522 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 protein_id gnl|my_center|LOCUS_15780 1541 2089 gene locus_tag LOCUS_15790 1541 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15790 3600 2254 gene locus_tag LOCUS_15800 3600 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence117 59 2434 gene locus_tag LOCUS_15810 59 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 2474 3151 gene locus_tag LOCUS_15820 2474 3151 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475861.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence118 2687 72 gene locus_tag LOCUS_15830 2687 72 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence119 477 49 gene locus_tag LOCUS_15840 477 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 1108 608 gene locus_tag LOCUS_15850 1108 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 1395 3167 gene locus_tag LOCUS_15860 1395 3167 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence120 1262 18 gene locus_tag LOCUS_15870 1262 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 1473 2129 gene locus_tag LOCUS_15880 1473 2129 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350459.1 protein_id gnl|my_center|LOCUS_15880 2242 2682 gene locus_tag LOCUS_15890 2242 2682 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656744.1 protein_id gnl|my_center|LOCUS_15890 2679 3350 gene locus_tag LOCUS_15900 gene ung 2679 3350 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759768.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence121 <1 2120 gene locus_tag LOCUS_15910 <1 2120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965653.1:phenylalanine--tRNA ligase subunit beta 2383 3318 gene locus_tag LOCUS_15920 2383 3318 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679981.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence122 200 1465 gene locus_tag LOCUS_15930 200 1465 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102011.1 protein_id gnl|my_center|LOCUS_15930 1458 1826 gene locus_tag LOCUS_15940 1458 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 2880 1879 gene locus_tag LOCUS_15950 2880 1879 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence123 535 29 gene locus_tag LOCUS_15960 535 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 607 1248 gene locus_tag LOCUS_15970 gene yunB 607 1248 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075141567.1 protein_id gnl|my_center|LOCUS_15970 2354 1308 gene locus_tag LOCUS_15980 2354 1308 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965529.1 protein_id gnl|my_center|LOCUS_15980 2498 2665 gene locus_tag LOCUS_15990 2498 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 2695 3198 gene locus_tag LOCUS_16000 2695 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence124 760 927 gene locus_tag LOCUS_16010 760 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 973 1590 gene locus_tag LOCUS_16020 973 1590 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_16020 2985 1747 gene locus_tag LOCUS_16030 2985 1747 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence125 <1 784 gene locus_tag LOCUS_16040 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002218495.1:PFL family protein 835 2607 gene locus_tag LOCUS_16050 gene pepF 835 2607 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence126 1660 38 gene locus_tag LOCUS_16060 1660 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 2400 1678 gene locus_tag LOCUS_16070 gene sleB 2400 1678 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398991.1 protein_id gnl|my_center|LOCUS_16070 2968 2441 gene locus_tag LOCUS_16080 gene spoIIR 2968 2441 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425996.1 protein_id gnl|my_center|LOCUS_16080 >Feature sequence127 1325 2221 gene locus_tag LOCUS_16090 1325 2221 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288377.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence128 451 1410 gene locus_tag LOCUS_16100 451 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 1477 2814 gene locus_tag LOCUS_16110 1477 2814 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence129 469 2 gene locus_tag LOCUS_16120 469 2 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797437.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence130 2457 25 gene locus_tag LOCUS_16130 gene leuS 2457 25 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963965.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence131 250 825 gene locus_tag LOCUS_16140 gene yihA 250 825 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002915299.1 protein_id gnl|my_center|LOCUS_16140 1244 1834 gene locus_tag LOCUS_16150 1244 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence132 325 1377 gene locus_tag LOCUS_16160 325 1377 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_16160 1395 2372 gene locus_tag LOCUS_16170 1395 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence133 469 1227 gene locus_tag LOCUS_16180 469 1227 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_16180 1400 2293 gene locus_tag LOCUS_16190 1400 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190