>Feature sequence001 424 1026 gene locus_tag LOCUS_00010 424 1026 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_00010 1266 1508 gene locus_tag LOCUS_00020 1266 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1772 1602 gene locus_tag LOCUS_00030 1772 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1879 2085 gene locus_tag LOCUS_00040 1879 2085 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286254.1 protein_id gnl|my_center|LOCUS_00040 2229 2942 gene locus_tag LOCUS_00050 2229 2942 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942799.1 protein_id gnl|my_center|LOCUS_00050 2929 4617 gene locus_tag LOCUS_00060 2929 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4583 6001 gene locus_tag LOCUS_00070 4583 6001 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459130.1 protein_id gnl|my_center|LOCUS_00070 6235 8040 gene locus_tag LOCUS_00080 6235 8040 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_00080 8018 9613 gene locus_tag LOCUS_00090 8018 9613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9614 10867 gene locus_tag LOCUS_00100 9614 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10997 12265 gene locus_tag LOCUS_00110 10997 12265 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836857.1 protein_id gnl|my_center|LOCUS_00110 12327 13217 gene locus_tag LOCUS_00120 12327 13217 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_00120 13214 14086 gene locus_tag LOCUS_00130 13214 14086 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383582.1 protein_id gnl|my_center|LOCUS_00130 14108 16210 gene locus_tag LOCUS_00140 14108 16210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16533 16270 gene locus_tag LOCUS_00150 16533 16270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16690 16995 gene locus_tag LOCUS_00160 16690 16995 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052490.1 protein_id gnl|my_center|LOCUS_00160 16967 17380 gene locus_tag LOCUS_00170 16967 17380 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052491.1 protein_id gnl|my_center|LOCUS_00170 17463 17909 gene locus_tag LOCUS_00180 17463 17909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 17916 18971 gene locus_tag LOCUS_00190 17916 18971 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681843.1 protein_id gnl|my_center|LOCUS_00190 19114 19896 gene locus_tag LOCUS_00200 19114 19896 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723980.1 protein_id gnl|my_center|LOCUS_00200 20984 20022 gene locus_tag LOCUS_00210 20984 20022 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437173.1 protein_id gnl|my_center|LOCUS_00210 21459 20977 gene locus_tag LOCUS_00220 21459 20977 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060880.1 protein_id gnl|my_center|LOCUS_00220 22562 21501 gene locus_tag LOCUS_00230 22562 21501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 22794 24659 gene locus_tag LOCUS_00240 22794 24659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 24687 25226 gene locus_tag LOCUS_00250 24687 25226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 25281 26516 gene locus_tag LOCUS_00260 gene hflX 25281 26516 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016249.1 protein_id gnl|my_center|LOCUS_00260 27315 26533 gene locus_tag LOCUS_00270 27315 26533 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_00270 27581 29377 gene locus_tag LOCUS_00280 27581 29377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 29398 30990 gene locus_tag LOCUS_00290 29398 30990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 31028 32218 gene locus_tag LOCUS_00300 31028 32218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 32215 34035 gene locus_tag LOCUS_00310 32215 34035 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_00310 34210 34632 gene locus_tag LOCUS_00320 34210 34632 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236585661.1 protein_id gnl|my_center|LOCUS_00320 34616 35200 gene locus_tag LOCUS_00330 34616 35200 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632643.1 protein_id gnl|my_center|LOCUS_00330 35202 36077 gene locus_tag LOCUS_00340 35202 36077 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287024.1 protein_id gnl|my_center|LOCUS_00340 36070 36942 gene locus_tag LOCUS_00350 36070 36942 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002401797.1 protein_id gnl|my_center|LOCUS_00350 37027 37662 gene locus_tag LOCUS_00360 37027 37662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 37677 38813 gene locus_tag LOCUS_00370 37677 38813 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287753.1 protein_id gnl|my_center|LOCUS_00370 38835 39653 gene locus_tag LOCUS_00380 38835 39653 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964017.1 protein_id gnl|my_center|LOCUS_00380 39655 41274 gene locus_tag LOCUS_00390 gene xynB 39655 41274 CDS product xylan 1,4-beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245202.1 protein_id gnl|my_center|LOCUS_00390 41271 43469 gene locus_tag LOCUS_00400 41271 43469 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584017.1 protein_id gnl|my_center|LOCUS_00400 44352 43492 gene locus_tag LOCUS_00410 44352 43492 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965896.1 protein_id gnl|my_center|LOCUS_00410 44521 45384 gene locus_tag LOCUS_00420 gene kduI 44521 45384 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383224.1 protein_id gnl|my_center|LOCUS_00420 45410 46204 gene locus_tag LOCUS_00430 45410 46204 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922042.1 protein_id gnl|my_center|LOCUS_00430 47030 46269 gene locus_tag LOCUS_00440 47030 46269 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582830.1 protein_id gnl|my_center|LOCUS_00440 47239 47880 gene locus_tag LOCUS_00450 47239 47880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 47883 48908 gene locus_tag LOCUS_00460 47883 48908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 49178 49756 gene locus_tag LOCUS_00470 49178 49756 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730082.1 protein_id gnl|my_center|LOCUS_00470 50320 49805 gene locus_tag LOCUS_00480 50320 49805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 51799 50396 gene locus_tag LOCUS_00490 51799 50396 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346373.1 protein_id gnl|my_center|LOCUS_00490 51942 52148 gene locus_tag LOCUS_00500 51942 52148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 52663 54123 gene locus_tag LOCUS_00510 52663 54123 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_00510 54219 56438 gene locus_tag LOCUS_00520 gene priA 54219 56438 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_00520 56449 56949 gene locus_tag LOCUS_00530 gene def 56449 56949 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388617.1 protein_id gnl|my_center|LOCUS_00530 56954 57949 gene locus_tag LOCUS_00540 gene fmt 56954 57949 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_00540 57985 58689 gene locus_tag LOCUS_00550 57985 58689 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383773.1 protein_id gnl|my_center|LOCUS_00550 58682 60103 gene locus_tag LOCUS_00560 gene rsmB 58682 60103 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_00560 60078 61130 gene locus_tag LOCUS_00570 gene rlmN 60078 61130 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_00570 61142 61885 gene locus_tag LOCUS_00580 61142 61885 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101477.1 protein_id gnl|my_center|LOCUS_00580 61882 63990 gene locus_tag LOCUS_00590 gene pknB 61882 63990 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986841.1 protein_id gnl|my_center|LOCUS_00590 64035 64913 gene locus_tag LOCUS_00600 gene rsgA 64035 64913 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986840.1 protein_id gnl|my_center|LOCUS_00600 64914 65579 gene locus_tag LOCUS_00610 gene rpe 64914 65579 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965037.1 protein_id gnl|my_center|LOCUS_00610 65572 66225 gene locus_tag LOCUS_00620 65572 66225 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965038.1 protein_id gnl|my_center|LOCUS_00620 66338 66667 gene locus_tag LOCUS_00630 66338 66667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 66657 66971 gene locus_tag LOCUS_00640 66657 66971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 67064 68161 gene locus_tag LOCUS_00650 gene ychF 67064 68161 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_00650 68284 69243 gene locus_tag LOCUS_00660 gene lgt 68284 69243 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897834.1 protein_id gnl|my_center|LOCUS_00660 69467 69616 gene locus_tag LOCUS_00670 gene rpmG 69467 69616 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_00670 69638 69835 gene locus_tag LOCUS_00680 69638 69835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 69861 70379 gene locus_tag LOCUS_00690 gene nusG 69861 70379 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_00690 70432 70857 gene locus_tag LOCUS_00700 gene rplK 70432 70857 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_00700 71053 71745 gene locus_tag LOCUS_00710 gene rplA 71053 71745 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_00710 72125 72679 gene locus_tag LOCUS_00720 gene rplJ 72125 72679 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356426.1 protein_id gnl|my_center|LOCUS_00720 72763 73137 gene locus_tag LOCUS_00730 gene rplL 72763 73137 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357259.1 protein_id gnl|my_center|LOCUS_00730 73567 77433 gene locus_tag LOCUS_00740 gene rpoB 73567 77433 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436174.1 protein_id gnl|my_center|LOCUS_00740 77451 81149 gene locus_tag LOCUS_00750 gene rpoC 77451 81149 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966420.1 protein_id gnl|my_center|LOCUS_00750 81403 81260 gene locus_tag LOCUS_00760 81403 81260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 82216 81509 gene locus_tag LOCUS_00770 82216 81509 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462080.1 protein_id gnl|my_center|LOCUS_00770 83288 82209 gene locus_tag LOCUS_00780 83288 82209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 84516 83332 gene locus_tag LOCUS_00790 84516 83332 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_00790 85514 84513 gene locus_tag LOCUS_00800 85514 84513 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_00800 86640 85528 gene locus_tag LOCUS_00810 86640 85528 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132280311.1 protein_id gnl|my_center|LOCUS_00810 88218 86842 gene locus_tag LOCUS_00820 gene murC 88218 86842 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 protein_id gnl|my_center|LOCUS_00820 88427 89701 gene locus_tag LOCUS_00830 88427 89701 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082942.1 protein_id gnl|my_center|LOCUS_00830 89698 90816 gene locus_tag LOCUS_00840 gene glgD 89698 90816 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_00840 90914 91201 gene locus_tag LOCUS_00850 gene spoVG 90914 91201 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_00850 91398 92984 gene locus_tag LOCUS_00860 91398 92984 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015673.1 protein_id gnl|my_center|LOCUS_00860 93722 93000 gene locus_tag LOCUS_00870 93722 93000 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810083.1 protein_id gnl|my_center|LOCUS_00870 93815 95074 gene locus_tag LOCUS_00880 93815 95074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 95049 96200 gene locus_tag LOCUS_00890 95049 96200 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_00890 96197 96988 gene locus_tag LOCUS_00900 96197 96988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 97236 97400 gene locus_tag LOCUS_00910 97236 97400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 97416 98858 gene locus_tag LOCUS_00920 gene proS 97416 98858 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040972.1 protein_id gnl|my_center|LOCUS_00920 98945 99079 gene locus_tag LOCUS_00930 98945 99079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 99309 100565 gene locus_tag LOCUS_00940 99309 100565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00940 100550 101059 gene locus_tag LOCUS_00950 100550 101059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00950 101052 102773 gene locus_tag LOCUS_00960 101052 102773 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005399340.1 protein_id gnl|my_center|LOCUS_00960 102991 106533 gene locus_tag LOCUS_00970 gene nifJ 102991 106533 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_00970 >Feature sequence002 <1 1321 gene locus_tag LOCUS_00980 <1 1321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000454045.1:MATE family efflux transporter 1838 1434 gene locus_tag LOCUS_00990 1838 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386950.1 protein_id gnl|my_center|LOCUS_00990 2856 1942 gene locus_tag LOCUS_01000 2856 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 4412 2853 gene locus_tag LOCUS_01010 4412 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 5291 4425 gene locus_tag LOCUS_01020 5291 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 6423 5275 gene locus_tag LOCUS_01030 6423 5275 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_01030 8454 6472 gene locus_tag LOCUS_01040 8454 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 9884 8481 gene locus_tag LOCUS_01050 9884 8481 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274807.1 protein_id gnl|my_center|LOCUS_01050 11053 9881 gene locus_tag LOCUS_01060 11053 9881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 13439 11040 gene locus_tag LOCUS_01070 13439 11040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 15031 13463 gene locus_tag LOCUS_01080 15031 13463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 15746 15069 gene locus_tag LOCUS_01090 15746 15069 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654037.1 protein_id gnl|my_center|LOCUS_01090 16509 15814 gene locus_tag LOCUS_01100 16509 15814 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006715.1 protein_id gnl|my_center|LOCUS_01100 17090 16854 gene locus_tag LOCUS_01110 17090 16854 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869433.1 protein_id gnl|my_center|LOCUS_01110 17327 17124 gene locus_tag LOCUS_01120 17327 17124 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869002.1 protein_id gnl|my_center|LOCUS_01120 18436 17339 gene locus_tag LOCUS_01130 gene yedE 18436 17339 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680420.1 protein_id gnl|my_center|LOCUS_01130 19678 18533 gene locus_tag LOCUS_01140 19678 18533 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434244.1 protein_id gnl|my_center|LOCUS_01140 20725 19823 gene locus_tag LOCUS_01150 20725 19823 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438004.1 protein_id gnl|my_center|LOCUS_01150 21835 20786 gene locus_tag LOCUS_01160 gene selD 21835 20786 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012159590.1 protein_id gnl|my_center|LOCUS_01160 22540 21884 gene locus_tag LOCUS_01170 gene yedF 22540 21884 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681889.1 protein_id gnl|my_center|LOCUS_01170 23151 24008 gene locus_tag LOCUS_01180 23151 24008 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_01180 24663 24031 gene locus_tag LOCUS_01190 24663 24031 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387519.1 protein_id gnl|my_center|LOCUS_01190 25433 24708 gene locus_tag LOCUS_01200 25433 24708 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_01200 26145 25510 gene locus_tag LOCUS_01210 26145 25510 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_01210 26893 26291 gene locus_tag LOCUS_01220 26893 26291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 27521 27057 gene locus_tag LOCUS_01230 27521 27057 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048431.1 protein_id gnl|my_center|LOCUS_01230 28653 27589 gene locus_tag LOCUS_01240 28653 27589 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430617.1 protein_id gnl|my_center|LOCUS_01240 30404 28650 gene locus_tag LOCUS_01250 30404 28650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 31768 30425 gene locus_tag LOCUS_01260 31768 30425 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048423.1 protein_id gnl|my_center|LOCUS_01260 32207 31776 gene locus_tag LOCUS_01270 gene fabZ 32207 31776 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048424.1 protein_id gnl|my_center|LOCUS_01270 32753 32244 gene locus_tag LOCUS_01280 32753 32244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 34064 32826 gene locus_tag LOCUS_01290 gene fabF 34064 32826 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_01290 34251 34436 gene locus_tag LOCUS_01300 34251 34436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 35192 34452 gene locus_tag LOCUS_01310 gene fabG 35192 34452 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_01310 36106 35186 gene locus_tag LOCUS_01320 gene fabD 36106 35186 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_01320 37037 36099 gene locus_tag LOCUS_01330 gene fabK 37037 36099 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_01330 37342 37118 gene locus_tag LOCUS_01340 gene acpP 37342 37118 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_01340 38374 37412 gene locus_tag LOCUS_01350 38374 37412 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_01350 39106 40098 gene locus_tag LOCUS_01360 39106 40098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 40818 40180 gene locus_tag LOCUS_01370 40818 40180 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254956.1 protein_id gnl|my_center|LOCUS_01370 42102 40831 gene locus_tag LOCUS_01380 gene purD 42102 40831 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_01380 42867 42241 gene locus_tag LOCUS_01390 gene purN 42867 42241 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_01390 43886 42861 gene locus_tag LOCUS_01400 gene purM 43886 42861 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262435.1 protein_id gnl|my_center|LOCUS_01400 44425 43919 gene locus_tag LOCUS_01410 gene purE 44425 43919 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_01410 46584 44491 gene locus_tag LOCUS_01420 46584 44491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 46955 46584 gene locus_tag LOCUS_01430 46955 46584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 47406 46930 gene locus_tag LOCUS_01440 47406 46930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 47694 47545 gene locus_tag LOCUS_01450 47694 47545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 48388 47708 gene locus_tag LOCUS_01460 gene pyrE 48388 47708 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_01460 49361 48459 gene locus_tag LOCUS_01470 49361 48459 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_01470 50143 49361 gene locus_tag LOCUS_01480 50143 49361 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_01480 51125 50199 gene locus_tag LOCUS_01490 gene pyrF 51125 50199 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_01490 51601 51158 gene locus_tag LOCUS_01500 51601 51158 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805090.1 protein_id gnl|my_center|LOCUS_01500 52241 51633 gene locus_tag LOCUS_01510 52241 51633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 52980 52366 gene locus_tag LOCUS_01520 52980 52366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 55907 53139 gene locus_tag LOCUS_01530 55907 53139 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_01530 56944 56048 gene locus_tag LOCUS_01540 56944 56048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 58260 57244 gene locus_tag LOCUS_01550 58260 57244 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014369585.1 protein_id gnl|my_center|LOCUS_01550 61128 58351 gene locus_tag LOCUS_01560 61128 58351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 62273 61152 gene locus_tag LOCUS_01570 62273 61152 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 protein_id gnl|my_center|LOCUS_01570 63086 62286 gene locus_tag LOCUS_01580 63086 62286 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975126.1 protein_id gnl|my_center|LOCUS_01580 63983 63099 gene locus_tag LOCUS_01590 63983 63099 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066537.1 protein_id gnl|my_center|LOCUS_01590 65388 64117 gene locus_tag LOCUS_01600 65388 64117 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066538.1 protein_id gnl|my_center|LOCUS_01600 <66610 65417 gene locus_tag LOCUS_01610 <66610 65417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975127.1:DUF2961 domain-containing protein >Feature sequence003 693 151 gene locus_tag LOCUS_01620 693 151 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814895.1 protein_id gnl|my_center|LOCUS_01620 978 1487 gene locus_tag LOCUS_01630 978 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 1562 2899 gene locus_tag LOCUS_01640 1562 2899 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583323.1 protein_id gnl|my_center|LOCUS_01640 2850 3518 gene locus_tag LOCUS_01650 2850 3518 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367246.1 protein_id gnl|my_center|LOCUS_01650 3588 4286 gene locus_tag LOCUS_01660 3588 4286 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861605.1 protein_id gnl|my_center|LOCUS_01660 4258 6561 gene locus_tag LOCUS_01670 4258 6561 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861604.1 protein_id gnl|my_center|LOCUS_01670 7436 6564 gene locus_tag LOCUS_01680 7436 6564 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811618.1 protein_id gnl|my_center|LOCUS_01680 7584 8255 gene locus_tag LOCUS_01690 7584 8255 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808295.1 protein_id gnl|my_center|LOCUS_01690 8289 8214 gene locus_tag LOCUS_t00010 8289 8214 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9750 8374 gene locus_tag LOCUS_01700 9750 8374 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100875.1 protein_id gnl|my_center|LOCUS_01700 9928 9844 gene locus_tag LOCUS_t00020 9928 9844 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10879 12126 gene locus_tag LOCUS_01710 10879 12126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 12142 13650 gene locus_tag LOCUS_01720 12142 13650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 13854 14201 gene locus_tag LOCUS_01730 13854 14201 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461784.1 protein_id gnl|my_center|LOCUS_01730 14198 15589 gene locus_tag LOCUS_01740 14198 15589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 16302 15697 gene locus_tag LOCUS_01750 16302 15697 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426696.1 protein_id gnl|my_center|LOCUS_01750 17387 16371 gene locus_tag LOCUS_01760 17387 16371 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_01760 17570 18793 gene locus_tag LOCUS_01770 17570 18793 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_01770 19839 18856 gene locus_tag LOCUS_01780 19839 18856 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965979.1 protein_id gnl|my_center|LOCUS_01780 20167 21909 gene locus_tag LOCUS_01790 20167 21909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 22038 23336 gene locus_tag LOCUS_01800 22038 23336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 23470 25323 gene locus_tag LOCUS_01810 23470 25323 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_01810 25316 27115 gene locus_tag LOCUS_01820 25316 27115 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_01820 27112 28158 gene locus_tag LOCUS_01830 27112 28158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 28261 28821 gene locus_tag LOCUS_01840 28261 28821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 29743 29084 gene locus_tag LOCUS_01850 29743 29084 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964200.1 protein_id gnl|my_center|LOCUS_01850 29957 31672 gene locus_tag LOCUS_01860 29957 31672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 31732 33372 gene locus_tag LOCUS_01870 31732 33372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 33520 34812 gene locus_tag LOCUS_01880 33520 34812 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359868.1 protein_id gnl|my_center|LOCUS_01880 34898 35806 gene locus_tag LOCUS_01890 34898 35806 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_01890 35822 36652 gene locus_tag LOCUS_01900 35822 36652 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383582.1 protein_id gnl|my_center|LOCUS_01900 36686 38731 gene locus_tag LOCUS_01910 36686 38731 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767024.1 protein_id gnl|my_center|LOCUS_01910 39724 38795 gene locus_tag LOCUS_01920 gene arcC 39724 38795 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367131.1 protein_id gnl|my_center|LOCUS_01920 41020 39806 gene locus_tag LOCUS_01930 41020 39806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 41019 41255 gene locus_tag LOCUS_01940 41019 41255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 41572 41787 gene locus_tag LOCUS_01950 41572 41787 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002927075.1 protein_id gnl|my_center|LOCUS_01950 41778 42260 gene locus_tag LOCUS_01960 41778 42260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 42805 42398 gene locus_tag LOCUS_01970 42805 42398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 43077 42802 gene locus_tag LOCUS_01980 43077 42802 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666876.1 protein_id gnl|my_center|LOCUS_01980 43578 43204 gene locus_tag LOCUS_01990 43578 43204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 44487 44741 gene locus_tag LOCUS_02000 44487 44741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 44854 45303 gene locus_tag LOCUS_02010 gene nrdR 44854 45303 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_02010 45307 46044 gene locus_tag LOCUS_02020 gene truA 45307 46044 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986454.1 protein_id gnl|my_center|LOCUS_02020 46171 46923 gene locus_tag LOCUS_02030 46171 46923 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_02030 46985 48115 gene locus_tag LOCUS_02040 46985 48115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 48189 49136 gene locus_tag LOCUS_02050 48189 49136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 49161 50120 gene locus_tag LOCUS_02060 49161 50120 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_02060 51057 50200 gene locus_tag LOCUS_02070 51057 50200 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 protein_id gnl|my_center|LOCUS_02070 51264 52547 gene locus_tag LOCUS_02080 51264 52547 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068626.1 protein_id gnl|my_center|LOCUS_02080 52568 53440 gene locus_tag LOCUS_02090 52568 53440 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051829.1 protein_id gnl|my_center|LOCUS_02090 53440 54282 gene locus_tag LOCUS_02100 53440 54282 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051830.1 protein_id gnl|my_center|LOCUS_02100 54411 56594 gene locus_tag LOCUS_02110 54411 56594 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548136.1 protein_id gnl|my_center|LOCUS_02110 56630 58594 gene locus_tag LOCUS_02120 56630 58594 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616027.1 protein_id gnl|my_center|LOCUS_02120 58770 60101 gene locus_tag LOCUS_02130 gene glnA 58770 60101 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 protein_id gnl|my_center|LOCUS_02130 60204 60761 gene locus_tag LOCUS_02140 60204 60761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 60874 61719 gene locus_tag LOCUS_02150 gene dapF 60874 61719 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_02150 61899 62465 gene locus_tag LOCUS_02160 61899 62465 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840041.1 protein_id gnl|my_center|LOCUS_02160 62462 63481 gene locus_tag LOCUS_02170 62462 63481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 >Feature sequence004 147 2789 gene locus_tag LOCUS_02180 147 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 3035 4801 gene locus_tag LOCUS_02190 gene argS 3035 4801 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020254.1 protein_id gnl|my_center|LOCUS_02190 4827 6110 gene locus_tag LOCUS_02200 4827 6110 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964224.1 protein_id gnl|my_center|LOCUS_02200 6107 7030 gene locus_tag LOCUS_02210 6107 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 7317 11849 gene locus_tag LOCUS_02220 gene gltB 7317 11849 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_02220 11862 13421 gene locus_tag LOCUS_02230 11862 13421 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_02230 13691 14821 gene locus_tag LOCUS_02240 13691 14821 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674723.1 protein_id gnl|my_center|LOCUS_02240 15267 14899 gene locus_tag LOCUS_02250 15267 14899 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419037.1 protein_id gnl|my_center|LOCUS_02250 15481 15942 gene locus_tag LOCUS_02260 15481 15942 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948661.1 protein_id gnl|my_center|LOCUS_02260 15936 16403 gene locus_tag LOCUS_02270 gene bcp 15936 16403 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_02270 16494 17435 gene locus_tag LOCUS_02280 16494 17435 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814023.1 protein_id gnl|my_center|LOCUS_02280 17489 18025 gene locus_tag LOCUS_02290 17489 18025 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675029.1 protein_id gnl|my_center|LOCUS_02290 18127 18855 gene locus_tag LOCUS_02300 18127 18855 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369289.1 protein_id gnl|my_center|LOCUS_02300 19161 18913 gene locus_tag LOCUS_02310 19161 18913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 19444 19923 gene locus_tag LOCUS_02320 gene ybaK 19444 19923 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710860.1 protein_id gnl|my_center|LOCUS_02320 19920 20459 gene locus_tag LOCUS_02330 19920 20459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 20509 21630 gene locus_tag LOCUS_02340 20509 21630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 23327 21651 gene locus_tag LOCUS_02350 23327 21651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 24174 23344 gene locus_tag LOCUS_02360 24174 23344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 24976 24254 gene locus_tag LOCUS_02370 24976 24254 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_02370 25305 24973 gene locus_tag LOCUS_02380 25305 24973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 26739 25336 gene locus_tag LOCUS_02390 26739 25336 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_02390 27261 26839 gene locus_tag LOCUS_02400 27261 26839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 27606 27262 gene locus_tag LOCUS_02410 27606 27262 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583275.1 protein_id gnl|my_center|LOCUS_02410 27930 28424 gene locus_tag LOCUS_02420 gene nuoE 27930 28424 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_02420 28429 28989 gene locus_tag LOCUS_02430 28429 28989 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_02430 29006 29389 gene locus_tag LOCUS_02440 29006 29389 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_02440 29424 31211 gene locus_tag LOCUS_02450 gene nuoF 29424 31211 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_02450 31227 32969 gene locus_tag LOCUS_02460 31227 32969 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_02460 33235 33567 gene locus_tag LOCUS_02470 33235 33567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 33577 34395 gene locus_tag LOCUS_02480 33577 34395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 34392 35051 gene locus_tag LOCUS_02490 34392 35051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 35071 36534 gene locus_tag LOCUS_02500 35071 36534 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387654.1 protein_id gnl|my_center|LOCUS_02500 36823 37683 gene locus_tag LOCUS_02510 36823 37683 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242564.1 protein_id gnl|my_center|LOCUS_02510 38997 37717 gene locus_tag LOCUS_02520 38997 37717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 39867 39103 gene locus_tag LOCUS_02530 39867 39103 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020166.1 protein_id gnl|my_center|LOCUS_02530 41184 39895 gene locus_tag LOCUS_02540 41184 39895 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813994.1 protein_id gnl|my_center|LOCUS_02540 42779 41400 gene locus_tag LOCUS_02550 42779 41400 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_02550 43366 44385 gene locus_tag LOCUS_02560 gene pheS 43366 44385 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_02560 44438 46858 gene locus_tag LOCUS_02570 gene pheT 44438 46858 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_02570 46980 48005 gene locus_tag LOCUS_02580 gene queA 46980 48005 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_02580 48138 48839 gene locus_tag LOCUS_02590 48138 48839 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813911.1 protein_id gnl|my_center|LOCUS_02590 48896 50197 gene locus_tag LOCUS_02600 48896 50197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 50349 52286 gene locus_tag LOCUS_02610 50349 52286 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107432.1 protein_id gnl|my_center|LOCUS_02610 52475 55471 gene locus_tag LOCUS_02620 52475 55471 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_02620 55573 57132 gene locus_tag LOCUS_02630 55573 57132 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416108.1 protein_id gnl|my_center|LOCUS_02630 57243 58355 gene locus_tag LOCUS_02640 57243 58355 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247133.1 protein_id gnl|my_center|LOCUS_02640 58475 59197 gene locus_tag LOCUS_02650 58475 59197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 59786 60250 gene locus_tag LOCUS_02660 59786 60250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 >Feature sequence005 578 6 gene locus_tag LOCUS_02670 578 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 1209 718 gene locus_tag LOCUS_02680 gene trmL 1209 718 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016664.1 protein_id gnl|my_center|LOCUS_02680 2373 1213 gene locus_tag LOCUS_02690 2373 1213 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459619.1 protein_id gnl|my_center|LOCUS_02690 2891 2385 gene locus_tag LOCUS_02700 2891 2385 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_02700 3912 2914 gene locus_tag LOCUS_02710 3912 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 5638 4112 gene locus_tag LOCUS_02720 5638 4112 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986179.1 protein_id gnl|my_center|LOCUS_02720 7550 5838 gene locus_tag LOCUS_02730 7550 5838 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 protein_id gnl|my_center|LOCUS_02730 10029 8518 gene locus_tag LOCUS_02740 10029 8518 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642847.1 protein_id gnl|my_center|LOCUS_02740 10856 10089 gene locus_tag LOCUS_02750 10856 10089 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_02750 11915 10878 gene locus_tag LOCUS_02760 11915 10878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 12135 13349 gene locus_tag LOCUS_02770 12135 13349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 15652 13475 gene locus_tag LOCUS_02780 15652 13475 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111154492.1 protein_id gnl|my_center|LOCUS_02780 16523 15699 gene locus_tag LOCUS_02790 16523 15699 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921761.1 protein_id gnl|my_center|LOCUS_02790 17420 16536 gene locus_tag LOCUS_02800 17420 16536 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939305.1 protein_id gnl|my_center|LOCUS_02800 18718 17438 gene locus_tag LOCUS_02810 18718 17438 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 protein_id gnl|my_center|LOCUS_02810 18958 19815 gene locus_tag LOCUS_02820 18958 19815 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 protein_id gnl|my_center|LOCUS_02820 20468 19860 gene locus_tag LOCUS_02830 gene tadA 20468 19860 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287154.1 protein_id gnl|my_center|LOCUS_02830 20597 21730 gene locus_tag LOCUS_02840 20597 21730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 23197 21791 gene locus_tag LOCUS_02850 23197 21791 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722014.1 protein_id gnl|my_center|LOCUS_02850 24238 23321 gene locus_tag LOCUS_02860 24238 23321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 25179 24385 gene locus_tag LOCUS_02870 25179 24385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 25799 25176 gene locus_tag LOCUS_02880 25799 25176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 27421 25802 gene locus_tag LOCUS_02890 27421 25802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 27940 27680 gene locus_tag LOCUS_02900 27940 27680 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_02900 28209 27940 gene locus_tag LOCUS_02910 28209 27940 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113434.1 protein_id gnl|my_center|LOCUS_02910 28795 28379 gene locus_tag LOCUS_02920 28795 28379 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003050138.1 protein_id gnl|my_center|LOCUS_02920 30247 28841 gene locus_tag LOCUS_02930 gene atpD 30247 28841 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_02930 31144 30260 gene locus_tag LOCUS_02940 gene atpG 31144 30260 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_02940 32722 31211 gene locus_tag LOCUS_02950 gene atpA 32722 31211 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462231.1 protein_id gnl|my_center|LOCUS_02950 33251 32724 gene locus_tag LOCUS_02960 gene atpH 33251 32724 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964546.1 protein_id gnl|my_center|LOCUS_02960 33726 33241 gene locus_tag LOCUS_02970 33726 33241 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881028.1 protein_id gnl|my_center|LOCUS_02970 33994 33770 gene locus_tag LOCUS_02980 33994 33770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 34756 34097 gene locus_tag LOCUS_02990 34756 34097 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356899.1 protein_id gnl|my_center|LOCUS_02990 35156 35890 gene locus_tag LOCUS_03000 35156 35890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 36820 35828 gene locus_tag LOCUS_03010 36820 35828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389995.1 protein_id gnl|my_center|LOCUS_03010 37094 37795 gene locus_tag LOCUS_03020 37094 37795 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861401.1 protein_id gnl|my_center|LOCUS_03020 37792 38727 gene locus_tag LOCUS_03030 37792 38727 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861402.1 protein_id gnl|my_center|LOCUS_03030 38890 39570 gene locus_tag LOCUS_03040 38890 39570 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861403.1 protein_id gnl|my_center|LOCUS_03040 39567 42098 gene locus_tag LOCUS_03050 39567 42098 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861404.1 protein_id gnl|my_center|LOCUS_03050 42951 42016 gene locus_tag LOCUS_03060 42951 42016 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964117.1 protein_id gnl|my_center|LOCUS_03060 43582 42965 gene locus_tag LOCUS_03070 43582 42965 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836866.1 protein_id gnl|my_center|LOCUS_03070 44717 43671 gene locus_tag LOCUS_03080 44717 43671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 45021 45587 gene locus_tag LOCUS_03090 45021 45587 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248957.1 protein_id gnl|my_center|LOCUS_03090 46263 45739 gene locus_tag LOCUS_03100 46263 45739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 46958 46314 gene locus_tag LOCUS_03110 46958 46314 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_03110 47325 46984 gene locus_tag LOCUS_03120 47325 46984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 47501 47295 gene locus_tag LOCUS_03130 47501 47295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 47717 47508 gene locus_tag LOCUS_03140 47717 47508 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423177.1 protein_id gnl|my_center|LOCUS_03140 48036 48875 gene locus_tag LOCUS_03150 gene yaaA 48036 48875 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458998.1 protein_id gnl|my_center|LOCUS_03150 50296 48872 gene locus_tag LOCUS_03160 gene pyk 50296 48872 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_03160 50457 50819 gene locus_tag LOCUS_03170 50457 50819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 52452 50830 gene locus_tag LOCUS_03180 52452 50830 CDS product DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674224.1 protein_id gnl|my_center|LOCUS_03180 53941 52565 gene locus_tag LOCUS_03190 53941 52565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 54665 53913 gene locus_tag LOCUS_03200 54665 53913 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_03200 55048 55500 gene locus_tag LOCUS_03210 55048 55500 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894431.1 protein_id gnl|my_center|LOCUS_03210 55708 55526 gene locus_tag LOCUS_03220 55708 55526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 56805 55654 gene locus_tag LOCUS_03230 56805 55654 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_03230 56947 56792 gene locus_tag LOCUS_03240 56947 56792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 57916 57251 gene locus_tag LOCUS_03250 57916 57251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 >Feature sequence006 1 1266 gene locus_tag LOCUS_03260 1 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 1287 2732 gene locus_tag LOCUS_03270 1287 2732 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357775.1 protein_id gnl|my_center|LOCUS_03270 2732 3574 gene locus_tag LOCUS_03280 2732 3574 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113786.1 protein_id gnl|my_center|LOCUS_03280 3627 4730 gene locus_tag LOCUS_03290 3627 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 4806 6659 gene locus_tag LOCUS_03300 4806 6659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 6632 6847 gene locus_tag LOCUS_03310 6632 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 7064 8005 gene locus_tag LOCUS_03320 7064 8005 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_03320 8010 8522 gene locus_tag LOCUS_03330 8010 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 8726 10030 gene locus_tag LOCUS_03340 8726 10030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 10132 11031 gene locus_tag LOCUS_03350 10132 11031 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289132.1 protein_id gnl|my_center|LOCUS_03350 11024 11854 gene locus_tag LOCUS_03360 11024 11854 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289130.1 protein_id gnl|my_center|LOCUS_03360 12746 11940 gene locus_tag LOCUS_03370 12746 11940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 12875 15964 gene locus_tag LOCUS_03380 12875 15964 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475723.1 protein_id gnl|my_center|LOCUS_03380 16001 18082 gene locus_tag LOCUS_03390 16001 18082 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209897.1 protein_id gnl|my_center|LOCUS_03390 18252 19376 gene locus_tag LOCUS_03400 18252 19376 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390206.1 protein_id gnl|my_center|LOCUS_03400 19392 20189 gene locus_tag LOCUS_03410 19392 20189 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088270774.1 protein_id gnl|my_center|LOCUS_03410 20431 22134 gene locus_tag LOCUS_03420 20431 22134 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_03420 22464 23015 gene locus_tag LOCUS_03430 22464 23015 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433028.1 protein_id gnl|my_center|LOCUS_03430 23155 23457 gene locus_tag LOCUS_03440 23155 23457 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991611.1 protein_id gnl|my_center|LOCUS_03440 23458 23775 gene locus_tag LOCUS_03450 23458 23775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 23790 24986 gene locus_tag LOCUS_03460 23790 24986 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072763.1 protein_id gnl|my_center|LOCUS_03460 24983 27646 gene locus_tag LOCUS_03470 24983 27646 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288954.1 protein_id gnl|my_center|LOCUS_03470 29074 27752 gene locus_tag LOCUS_03480 29074 27752 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_03480 29565 37409 gene locus_tag LOCUS_03490 29565 37409 CDS product LPXTG cell wall anchor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068612.1 protein_id gnl|my_center|LOCUS_03490 37513 39057 gene locus_tag LOCUS_03500 37513 39057 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068613.1 protein_id gnl|my_center|LOCUS_03500 39109 40026 gene locus_tag LOCUS_03510 39109 40026 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390378.1 protein_id gnl|my_center|LOCUS_03510 40002 40874 gene locus_tag LOCUS_03520 40002 40874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 41493 40930 gene locus_tag LOCUS_03530 41493 40930 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294657.1 protein_id gnl|my_center|LOCUS_03530 41777 42505 gene locus_tag LOCUS_03540 41777 42505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 42844 43272 gene locus_tag LOCUS_03550 gene rplM 42844 43272 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098967.1 protein_id gnl|my_center|LOCUS_03550 43299 43691 gene locus_tag LOCUS_03560 gene rpsI 43299 43691 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_03560 44135 44956 gene locus_tag LOCUS_03570 44135 44956 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355976.1 protein_id gnl|my_center|LOCUS_03570 >Feature sequence007 237 37 gene locus_tag LOCUS_03580 237 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 1592 618 gene locus_tag LOCUS_03590 1592 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 2370 1582 gene locus_tag LOCUS_03600 2370 1582 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227804.1 protein_id gnl|my_center|LOCUS_03600 2624 2370 gene locus_tag LOCUS_03610 2624 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 4443 2896 gene locus_tag LOCUS_03620 gene rlmD 4443 2896 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105019.1 protein_id gnl|my_center|LOCUS_03620 5831 4887 gene locus_tag LOCUS_03630 5831 4887 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_03630 7158 5878 gene locus_tag LOCUS_03640 7158 5878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 7324 9699 gene locus_tag LOCUS_03650 7324 9699 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_03650 9716 10417 gene locus_tag LOCUS_03660 9716 10417 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_03660 10429 11835 gene locus_tag LOCUS_03670 10429 11835 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_03670 13184 11883 gene locus_tag LOCUS_03680 13184 11883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 13328 14851 gene locus_tag LOCUS_03690 13328 14851 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_03690 14971 15141 gene locus_tag LOCUS_03700 14971 15141 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_03700 15384 16088 gene locus_tag LOCUS_03710 15384 16088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 17473 16130 gene locus_tag LOCUS_03720 gene dnaB 17473 16130 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_03720 17937 17488 gene locus_tag LOCUS_03730 gene rplI 17937 17488 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_03730 19991 17940 gene locus_tag LOCUS_03740 19991 17940 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_03740 20862 20071 gene locus_tag LOCUS_03750 20862 20071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 22253 20973 gene locus_tag LOCUS_03760 22253 20973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 22414 22743 gene locus_tag LOCUS_03770 22414 22743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 23107 22841 gene locus_tag LOCUS_03780 gene rpsR 23107 22841 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966982.1 protein_id gnl|my_center|LOCUS_03780 23567 23124 gene locus_tag LOCUS_03790 23567 23124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 23871 23584 gene locus_tag LOCUS_03800 gene rpsF 23871 23584 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_03800 24185 23997 gene locus_tag LOCUS_03810 24185 23997 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728659.1 protein_id gnl|my_center|LOCUS_03810 25153 24251 gene locus_tag LOCUS_03820 gene srtB 25153 24251 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095595.1 protein_id gnl|my_center|LOCUS_03820 25812 25177 gene locus_tag LOCUS_03830 25812 25177 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861240.1 protein_id gnl|my_center|LOCUS_03830 27853 26342 gene locus_tag LOCUS_03840 27853 26342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 29285 27879 gene locus_tag LOCUS_03850 29285 27879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 30455 29469 gene locus_tag LOCUS_03860 30455 29469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 31369 30494 gene locus_tag LOCUS_03870 31369 30494 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721781.1 protein_id gnl|my_center|LOCUS_03870 31683 32588 gene locus_tag LOCUS_03880 31683 32588 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434205.1 protein_id gnl|my_center|LOCUS_03880 32612 34363 gene locus_tag LOCUS_03890 32612 34363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 35764 34391 gene locus_tag LOCUS_03900 35764 34391 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_03900 36401 35949 gene locus_tag LOCUS_03910 36401 35949 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_03910 37042 36626 gene locus_tag LOCUS_03920 37042 36626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 37153 37353 gene locus_tag LOCUS_03930 37153 37353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 38317 37469 gene locus_tag LOCUS_03940 38317 37469 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948612.1 protein_id gnl|my_center|LOCUS_03940 38920 38363 gene locus_tag LOCUS_03950 38920 38363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 39256 38924 gene locus_tag LOCUS_03960 39256 38924 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963892.1 protein_id gnl|my_center|LOCUS_03960 39427 40050 gene locus_tag LOCUS_03970 39427 40050 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860815.1 protein_id gnl|my_center|LOCUS_03970 40217 40444 gene locus_tag LOCUS_03980 40217 40444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 40428 40841 gene locus_tag LOCUS_03990 40428 40841 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814887.1 protein_id gnl|my_center|LOCUS_03990 43048 40874 gene locus_tag LOCUS_04000 43048 40874 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947999.1 protein_id gnl|my_center|LOCUS_04000 43912 43987 gene locus_tag LOCUS_t00030 43912 43987 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence008 630 211 gene locus_tag LOCUS_04010 630 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 998 627 gene locus_tag LOCUS_04020 998 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 3405 1021 gene locus_tag LOCUS_04030 gene fliD 3405 1021 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987024.1 protein_id gnl|my_center|LOCUS_04030 4252 3509 gene locus_tag LOCUS_04040 4252 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 5034 4249 gene locus_tag LOCUS_04050 5034 4249 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369746.1 protein_id gnl|my_center|LOCUS_04050 6357 5047 gene locus_tag LOCUS_04060 6357 5047 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262170.1 protein_id gnl|my_center|LOCUS_04060 7274 6354 gene locus_tag LOCUS_04070 7274 6354 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721810.1 protein_id gnl|my_center|LOCUS_04070 7744 7301 gene locus_tag LOCUS_04080 7744 7301 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541375.1 protein_id gnl|my_center|LOCUS_04080 8414 7761 gene locus_tag LOCUS_04090 8414 7761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 9129 8416 gene locus_tag LOCUS_04100 gene flgG 9129 8416 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197257.1 protein_id gnl|my_center|LOCUS_04100 9942 9190 gene locus_tag LOCUS_04110 gene flgF 9942 9190 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671871.1 protein_id gnl|my_center|LOCUS_04110 10753 9950 gene locus_tag LOCUS_04120 gene whiG 10753 9950 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667112.1 protein_id gnl|my_center|LOCUS_04120 12607 10787 gene locus_tag LOCUS_04130 gene flhA 12607 10787 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 protein_id gnl|my_center|LOCUS_04130 12633 12926 gene locus_tag LOCUS_04140 12633 12926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 13927 12866 gene locus_tag LOCUS_04150 gene flhB 13927 12866 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816211.1 protein_id gnl|my_center|LOCUS_04150 14759 13977 gene locus_tag LOCUS_04160 gene fliR 14759 13977 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245510.1 protein_id gnl|my_center|LOCUS_04160 15033 14770 gene locus_tag LOCUS_04170 15033 14770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 15745 15071 gene locus_tag LOCUS_04180 15745 15071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 16082 15735 gene locus_tag LOCUS_04190 16082 15735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 17351 16089 gene locus_tag LOCUS_04200 17351 16089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 17820 17374 gene locus_tag LOCUS_04210 gene flgC 17820 17374 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081561.1 protein_id gnl|my_center|LOCUS_04210 18196 17837 gene locus_tag LOCUS_04220 18196 17837 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359271.1 protein_id gnl|my_center|LOCUS_04220 19305 18250 gene locus_tag LOCUS_04230 gene fliM 19305 18250 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183958.1 protein_id gnl|my_center|LOCUS_04230 20181 19369 gene locus_tag LOCUS_04240 20181 19369 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895795.1 protein_id gnl|my_center|LOCUS_04240 21033 20194 gene locus_tag LOCUS_04250 21033 20194 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392302.1 protein_id gnl|my_center|LOCUS_04250 21236 21036 gene locus_tag LOCUS_04260 21236 21036 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556881.1 protein_id gnl|my_center|LOCUS_04260 22286 21363 gene locus_tag LOCUS_04270 22286 21363 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986954.1 protein_id gnl|my_center|LOCUS_04270 22750 22376 gene locus_tag LOCUS_04280 22750 22376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 23356 22775 gene locus_tag LOCUS_04290 23356 22775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 24665 23391 gene locus_tag LOCUS_04300 24665 23391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 25185 24724 gene locus_tag LOCUS_04310 25185 24724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 26513 25212 gene locus_tag LOCUS_04320 gene fliI 26513 25212 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_04320 27279 26533 gene locus_tag LOCUS_04330 27279 26533 CDS product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305816.1 protein_id gnl|my_center|LOCUS_04330 28294 27272 gene locus_tag LOCUS_04340 gene fliG 28294 27272 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082903.1 protein_id gnl|my_center|LOCUS_04340 29879 28275 gene locus_tag LOCUS_04350 29879 28275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 30215 29904 gene locus_tag LOCUS_04360 30215 29904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 30661 30272 gene locus_tag LOCUS_04370 gene flgB 30661 30272 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989548.1 protein_id gnl|my_center|LOCUS_04370 31017 32513 gene locus_tag LOCUS_04380 31017 32513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 32985 32614 gene locus_tag LOCUS_04390 32985 32614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 34411 32972 gene locus_tag LOCUS_04400 34411 32972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 34549 36642 gene locus_tag LOCUS_04410 34549 36642 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860851.1 protein_id gnl|my_center|LOCUS_04410 36667 37161 gene locus_tag LOCUS_04420 36667 37161 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963446.1 protein_id gnl|my_center|LOCUS_04420 37185 38003 gene locus_tag LOCUS_04430 37185 38003 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425096.1 protein_id gnl|my_center|LOCUS_04430 38032 39192 gene locus_tag LOCUS_04440 38032 39192 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389160.1 protein_id gnl|my_center|LOCUS_04440 39209 40021 gene locus_tag LOCUS_04450 39209 40021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 40753 40079 gene locus_tag LOCUS_04460 40753 40079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 <42276 40717 gene locus_tag LOCUS_04470 <42276 40717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437448.1:phosphodiesterase PdcB >Feature sequence009 93 1100 gene locus_tag LOCUS_04480 93 1100 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682287.1 protein_id gnl|my_center|LOCUS_04480 1699 1280 gene locus_tag LOCUS_04490 1699 1280 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_04490 1723 1938 gene locus_tag LOCUS_04500 1723 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 2993 2049 gene locus_tag LOCUS_04510 gene arcC 2993 2049 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037992.1 protein_id gnl|my_center|LOCUS_04510 3390 3010 gene locus_tag LOCUS_04520 3390 3010 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812106.1 protein_id gnl|my_center|LOCUS_04520 4713 3520 gene locus_tag LOCUS_04530 gene ygeW 4713 3520 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379712.1 protein_id gnl|my_center|LOCUS_04530 6570 5260 gene locus_tag LOCUS_04540 6570 5260 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362247.1 protein_id gnl|my_center|LOCUS_04540 7898 6693 gene locus_tag LOCUS_04550 gene dpaL 7898 6693 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819571.1 protein_id gnl|my_center|LOCUS_04550 8647 8000 gene locus_tag LOCUS_04560 8647 8000 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381503.1 protein_id gnl|my_center|LOCUS_04560 8921 10255 gene locus_tag LOCUS_04570 gene ssnA 8921 10255 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359625.1 protein_id gnl|my_center|LOCUS_04570 10269 11699 gene locus_tag LOCUS_04580 10269 11699 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893433.1 protein_id gnl|my_center|LOCUS_04580 11728 14721 gene locus_tag LOCUS_04590 gene ygfK 11728 14721 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387142.1 protein_id gnl|my_center|LOCUS_04590 14737 16104 gene locus_tag LOCUS_04600 gene hydA 14737 16104 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387141.1 protein_id gnl|my_center|LOCUS_04600 16104 16880 gene locus_tag LOCUS_04610 16104 16880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 16970 18385 gene locus_tag LOCUS_04620 16970 18385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 18468 19010 gene locus_tag LOCUS_04630 18468 19010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 19083 21677 gene locus_tag LOCUS_04640 gene xdh 19083 21677 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891588.1 protein_id gnl|my_center|LOCUS_04640 21677 22081 gene locus_tag LOCUS_04650 21677 22081 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356595.1 protein_id gnl|my_center|LOCUS_04650 22307 23197 gene locus_tag LOCUS_04660 gene modA 22307 23197 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021258.1 protein_id gnl|my_center|LOCUS_04660 23236 23940 gene locus_tag LOCUS_04670 gene modB 23236 23940 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888685.1 protein_id gnl|my_center|LOCUS_04670 23944 25008 gene locus_tag LOCUS_04680 23944 25008 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888694.1 protein_id gnl|my_center|LOCUS_04680 25183 26550 gene locus_tag LOCUS_04690 25183 26550 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643131.1 protein_id gnl|my_center|LOCUS_04690 27159 26848 gene locus_tag LOCUS_04700 27159 26848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 27521 27318 gene locus_tag LOCUS_04710 27521 27318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 28630 27590 gene locus_tag LOCUS_04720 28630 27590 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_04720 30177 28735 gene locus_tag LOCUS_04730 30177 28735 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963747.1 protein_id gnl|my_center|LOCUS_04730 32256 30226 gene locus_tag LOCUS_04740 32256 30226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 32406 33233 gene locus_tag LOCUS_04750 32406 33233 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286852.1 protein_id gnl|my_center|LOCUS_04750 33249 33383 gene locus_tag LOCUS_04760 33249 33383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 34736 33447 gene locus_tag LOCUS_04770 34736 33447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 35132 34884 gene locus_tag LOCUS_04780 35132 34884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 35332 36045 gene locus_tag LOCUS_04790 35332 36045 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895939.1 protein_id gnl|my_center|LOCUS_04790 36184 36480 gene locus_tag LOCUS_04800 36184 36480 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357450.1 protein_id gnl|my_center|LOCUS_04800 36712 37596 gene locus_tag LOCUS_04810 36712 37596 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_04810 37597 38667 gene locus_tag LOCUS_04820 37597 38667 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_04820 38667 39425 gene locus_tag LOCUS_04830 38667 39425 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_04830 39439 40149 gene locus_tag LOCUS_04840 39439 40149 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902265.1 protein_id gnl|my_center|LOCUS_04840 40246 40869 gene locus_tag LOCUS_04850 40246 40869 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_04850 >Feature sequence010 2464 1349 gene locus_tag LOCUS_04860 2464 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 4051 2582 gene locus_tag LOCUS_04870 4051 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 6585 4066 gene locus_tag LOCUS_04880 6585 4066 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106612643.1 protein_id gnl|my_center|LOCUS_04880 9528 6613 gene locus_tag LOCUS_04890 9528 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 12064 9602 gene locus_tag LOCUS_04900 12064 9602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 12780 12061 gene locus_tag LOCUS_04910 12780 12061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 14438 12777 gene locus_tag LOCUS_04920 14438 12777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 14994 14425 gene locus_tag LOCUS_04930 14994 14425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 15363 15064 gene locus_tag LOCUS_04940 15363 15064 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203081.1 protein_id gnl|my_center|LOCUS_04940 16429 15404 gene locus_tag LOCUS_04950 16429 15404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 18372 16441 gene locus_tag LOCUS_04960 18372 16441 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226664.1 protein_id gnl|my_center|LOCUS_04960 21150 18400 gene locus_tag LOCUS_04970 21150 18400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 21496 21131 gene locus_tag LOCUS_04980 21496 21131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 22329 21526 gene locus_tag LOCUS_04990 22329 21526 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941650.1 protein_id gnl|my_center|LOCUS_04990 23478 22351 gene locus_tag LOCUS_05000 23478 22351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 24587 23538 gene locus_tag LOCUS_05010 24587 23538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 26171 24594 gene locus_tag LOCUS_05020 26171 24594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 26614 26186 gene locus_tag LOCUS_05030 26614 26186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 26811 26614 gene locus_tag LOCUS_05040 26811 26614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039648317.1 protein_id gnl|my_center|LOCUS_05040 27170 26808 gene locus_tag LOCUS_05050 27170 26808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 27692 27189 gene locus_tag LOCUS_05060 27692 27189 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_05060 29400 27715 gene locus_tag LOCUS_05070 29400 27715 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974722.1 protein_id gnl|my_center|LOCUS_05070 29851 29462 gene locus_tag LOCUS_05080 29851 29462 CDS product DUF4280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089513.1 protein_id gnl|my_center|LOCUS_05080 31724 29892 gene locus_tag LOCUS_05090 31724 29892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 33451 31730 gene locus_tag LOCUS_05100 33451 31730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 34565 33468 gene locus_tag LOCUS_05110 34565 33468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 35422 34553 gene locus_tag LOCUS_05120 35422 34553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 37348 35426 gene locus_tag LOCUS_05130 37348 35426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 37715 37320 gene locus_tag LOCUS_05140 37715 37320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 37963 38808 gene locus_tag LOCUS_05150 37963 38808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 38837 39175 gene locus_tag LOCUS_05160 38837 39175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 39225 39950 gene locus_tag LOCUS_05170 39225 39950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 >Feature sequence011 932 258 gene locus_tag LOCUS_05180 932 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 3101 1077 gene locus_tag LOCUS_05190 3101 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 3981 3076 gene locus_tag LOCUS_05200 3981 3076 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_05200 5062 4070 gene locus_tag LOCUS_05210 5062 4070 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964851.1 protein_id gnl|my_center|LOCUS_05210 5872 5081 gene locus_tag LOCUS_05220 5872 5081 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965542.1 protein_id gnl|my_center|LOCUS_05220 6136 6996 gene locus_tag LOCUS_05230 gene pdaA 6136 6996 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438596.1 protein_id gnl|my_center|LOCUS_05230 7619 7185 gene locus_tag LOCUS_05240 7619 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 9715 8372 gene locus_tag LOCUS_05250 gene glmM 9715 8372 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521474.1 protein_id gnl|my_center|LOCUS_05250 10024 10929 gene locus_tag LOCUS_05260 10024 10929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 10926 11714 gene locus_tag LOCUS_05270 10926 11714 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 protein_id gnl|my_center|LOCUS_05270 12527 11736 gene locus_tag LOCUS_05280 12527 11736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 13717 12533 gene locus_tag LOCUS_05290 13717 12533 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_05290 14329 13727 gene locus_tag LOCUS_05300 14329 13727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 15139 14462 gene locus_tag LOCUS_05310 15139 14462 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_05310 16016 15129 gene locus_tag LOCUS_05320 gene ispE 16016 15129 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894070.1 protein_id gnl|my_center|LOCUS_05320 17619 16060 gene locus_tag LOCUS_05330 17619 16060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 18029 17631 gene locus_tag LOCUS_05340 18029 17631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 18961 19704 gene locus_tag LOCUS_05350 18961 19704 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948182.1 protein_id gnl|my_center|LOCUS_05350 19820 21838 gene locus_tag LOCUS_05360 19820 21838 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_05360 24261 21922 gene locus_tag LOCUS_05370 gene galB 24261 21922 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107279.1 protein_id gnl|my_center|LOCUS_05370 25614 24286 gene locus_tag LOCUS_05380 25614 24286 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243455.1 protein_id gnl|my_center|LOCUS_05380 27500 25710 gene locus_tag LOCUS_05390 27500 25710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 28308 27508 gene locus_tag LOCUS_05400 28308 27508 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086175.1 protein_id gnl|my_center|LOCUS_05400 29187 28312 gene locus_tag LOCUS_05410 29187 28312 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 protein_id gnl|my_center|LOCUS_05410 30806 29259 gene locus_tag LOCUS_05420 30806 29259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 32524 30803 gene locus_tag LOCUS_05430 32524 30803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 36267 32707 gene locus_tag LOCUS_05440 36267 32707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 >Feature sequence012 1436 189 gene locus_tag LOCUS_05450 1436 189 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_05450 1763 1551 gene locus_tag LOCUS_05460 1763 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 2301 1936 gene locus_tag LOCUS_05470 gene crcB 2301 1936 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253076.1 protein_id gnl|my_center|LOCUS_05470 3512 2298 gene locus_tag LOCUS_05480 3512 2298 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080839.1 protein_id gnl|my_center|LOCUS_05480 4075 3539 gene locus_tag LOCUS_05490 4075 3539 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814019.1 protein_id gnl|my_center|LOCUS_05490 5122 4289 gene locus_tag LOCUS_05500 5122 4289 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_05500 5754 5140 gene locus_tag LOCUS_05510 5754 5140 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101939.1 protein_id gnl|my_center|LOCUS_05510 7120 5771 gene locus_tag LOCUS_05520 7120 5771 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903396.1 protein_id gnl|my_center|LOCUS_05520 7887 7222 gene locus_tag LOCUS_05530 7887 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 7977 8693 gene locus_tag LOCUS_05540 7977 8693 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_05540 10161 8836 gene locus_tag LOCUS_05550 gene kbaZ 10161 8836 CDS product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209876.1 protein_id gnl|my_center|LOCUS_05550 10282 11181 gene locus_tag LOCUS_05560 10282 11181 CDS product tagatose-bisphosphate aldolase subunit GatY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861804.1 protein_id gnl|my_center|LOCUS_05560 12136 11411 gene locus_tag LOCUS_05570 12136 11411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229234.1 protein_id gnl|my_center|LOCUS_05570 12920 12339 gene locus_tag LOCUS_05580 12920 12339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 14123 12978 gene locus_tag LOCUS_05590 gene nagA 14123 12978 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386286.1 protein_id gnl|my_center|LOCUS_05590 14244 15428 gene locus_tag LOCUS_05600 14244 15428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 15788 15504 gene locus_tag LOCUS_05610 15788 15504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 17000 15819 gene locus_tag LOCUS_05620 17000 15819 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074782808.1 protein_id gnl|my_center|LOCUS_05620 17545 17117 gene locus_tag LOCUS_05630 17545 17117 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361048.1 protein_id gnl|my_center|LOCUS_05630 18235 17588 gene locus_tag LOCUS_05640 18235 17588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 19262 18342 gene locus_tag LOCUS_05650 19262 18342 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167627999.1 protein_id gnl|my_center|LOCUS_05650 20082 19252 gene locus_tag LOCUS_05660 gene agaW 20082 19252 CDS product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704758.1 protein_id gnl|my_center|LOCUS_05660 20597 20121 gene locus_tag LOCUS_05670 gene agaV 20597 20121 CDS product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387360.1 protein_id gnl|my_center|LOCUS_05670 21094 20819 gene locus_tag LOCUS_05680 21094 20819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 22085 20982 gene locus_tag LOCUS_05690 22085 20982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 22297 22085 gene locus_tag LOCUS_05700 22297 22085 CDS product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425157.1 protein_id gnl|my_center|LOCUS_05700 23401 22301 gene locus_tag LOCUS_05710 23401 22301 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659021.1 protein_id gnl|my_center|LOCUS_05710 24467 23688 gene locus_tag LOCUS_05720 24467 23688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05720 24722 24940 gene locus_tag LOCUS_05730 24722 24940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 25061 26176 gene locus_tag LOCUS_05740 gene roeA 25061 26176 CDS product diguanylate cyclase RoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082226.1 protein_id gnl|my_center|LOCUS_05740 26339 26608 gene locus_tag LOCUS_05750 26339 26608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 26638 28302 gene locus_tag LOCUS_05760 26638 28302 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_05760 28524 28201 gene locus_tag LOCUS_05770 28524 28201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 29847 28768 gene locus_tag LOCUS_05780 29847 28768 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_05780 30174 31400 gene locus_tag LOCUS_05790 30174 31400 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_05790 32639 31515 gene locus_tag LOCUS_05800 32639 31515 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966740.1 protein_id gnl|my_center|LOCUS_05800 32896 33423 gene locus_tag LOCUS_05810 32896 33423 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943873.1 protein_id gnl|my_center|LOCUS_05810 33392 34153 gene locus_tag LOCUS_05820 33392 34153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 35058 34237 gene locus_tag LOCUS_05830 35058 34237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 >Feature sequence013 1087 164 gene locus_tag LOCUS_05840 gene tsf 1087 164 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_05840 1945 1178 gene locus_tag LOCUS_05850 gene rpsB 1945 1178 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_05850 2453 2313 gene locus_tag LOCUS_05860 2453 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 3422 2568 gene locus_tag LOCUS_05870 3422 2568 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261394.1 protein_id gnl|my_center|LOCUS_05870 4354 3461 gene locus_tag LOCUS_05880 4354 3461 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017180.1 protein_id gnl|my_center|LOCUS_05880 5084 4371 gene locus_tag LOCUS_05890 5084 4371 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120330.1 protein_id gnl|my_center|LOCUS_05890 6012 5086 gene locus_tag LOCUS_05900 6012 5086 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281520.1 protein_id gnl|my_center|LOCUS_05900 6865 6038 gene locus_tag LOCUS_05910 6865 6038 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730582.1 protein_id gnl|my_center|LOCUS_05910 7767 6877 gene locus_tag LOCUS_05920 7767 6877 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003052879.1 protein_id gnl|my_center|LOCUS_05920 9243 7891 gene locus_tag LOCUS_05930 9243 7891 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672105.1 protein_id gnl|my_center|LOCUS_05930 10949 9495 gene locus_tag LOCUS_05940 gene guaB 10949 9495 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048242.1 protein_id gnl|my_center|LOCUS_05940 13415 11793 gene locus_tag LOCUS_05950 gene groL 13415 11793 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435012.1 protein_id gnl|my_center|LOCUS_05950 13778 13491 gene locus_tag LOCUS_05960 gene groES 13778 13491 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965991.1 protein_id gnl|my_center|LOCUS_05960 14311 13985 gene locus_tag LOCUS_05970 14311 13985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 15109 14330 gene locus_tag LOCUS_05980 gene codY 15109 14330 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362579.1 protein_id gnl|my_center|LOCUS_05980 17376 15307 gene locus_tag LOCUS_05990 gene topA 17376 15307 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_05990 18538 17399 gene locus_tag LOCUS_06000 gene dprA 18538 17399 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_06000 20081 18552 gene locus_tag LOCUS_06010 20081 18552 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_06010 20770 20369 gene locus_tag LOCUS_06020 20770 20369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 20885 21526 gene locus_tag LOCUS_06030 gene sigK 20885 21526 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964996.1 protein_id gnl|my_center|LOCUS_06030 22147 21503 gene locus_tag LOCUS_06040 22147 21503 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389733.1 protein_id gnl|my_center|LOCUS_06040 23356 22463 gene locus_tag LOCUS_06050 23356 22463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 23730 23353 gene locus_tag LOCUS_06060 23730 23353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 24244 23720 gene locus_tag LOCUS_06070 24244 23720 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439159.1 protein_id gnl|my_center|LOCUS_06070 25020 24403 gene locus_tag LOCUS_06080 25020 24403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 26164 25112 gene locus_tag LOCUS_06090 26164 25112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 27311 26391 gene locus_tag LOCUS_06100 27311 26391 CDS product aminoglycoside 6-adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258500.1 protein_id gnl|my_center|LOCUS_06100 27772 27308 gene locus_tag LOCUS_06110 27772 27308 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986684.1 protein_id gnl|my_center|LOCUS_06110 28532 27882 gene locus_tag LOCUS_06120 28532 27882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 29179 28571 gene locus_tag LOCUS_06130 29179 28571 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643829.1 protein_id gnl|my_center|LOCUS_06130 29599 29210 gene locus_tag LOCUS_06140 29599 29210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 29926 29720 gene locus_tag LOCUS_06150 29926 29720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 30302 29886 gene locus_tag LOCUS_06160 30302 29886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 30793 30374 gene locus_tag LOCUS_06170 30793 30374 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384928.1 protein_id gnl|my_center|LOCUS_06170 31252 30833 gene locus_tag LOCUS_06180 31252 30833 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861104.1 protein_id gnl|my_center|LOCUS_06180 31961 31413 gene locus_tag LOCUS_06190 31961 31413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 32665 32036 gene locus_tag LOCUS_06200 32665 32036 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287965.1 protein_id gnl|my_center|LOCUS_06200 >Feature sequence014 718 1716 gene locus_tag LOCUS_06210 718 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 2423 1839 gene locus_tag LOCUS_06220 2423 1839 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_06220 4831 2771 gene locus_tag LOCUS_06230 4831 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 6596 4821 gene locus_tag LOCUS_06240 gene yesM 6596 4821 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_06240 7435 6593 gene locus_tag LOCUS_06250 7435 6593 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815859.1 protein_id gnl|my_center|LOCUS_06250 8359 7523 gene locus_tag LOCUS_06260 8359 7523 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256268.1 protein_id gnl|my_center|LOCUS_06260 9252 8374 gene locus_tag LOCUS_06270 9252 8374 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530308.1 protein_id gnl|my_center|LOCUS_06270 10644 9337 gene locus_tag LOCUS_06280 10644 9337 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803812.1 protein_id gnl|my_center|LOCUS_06280 11789 10863 gene locus_tag LOCUS_06290 11789 10863 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_06290 13169 11799 gene locus_tag LOCUS_06300 13169 11799 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_06300 14311 13445 gene locus_tag LOCUS_06310 gene rsmA 14311 13445 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 protein_id gnl|my_center|LOCUS_06310 14841 14461 gene locus_tag LOCUS_06320 14841 14461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 16128 14890 gene locus_tag LOCUS_06330 16128 14890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404919.1 protein_id gnl|my_center|LOCUS_06330 17814 16153 gene locus_tag LOCUS_06340 17814 16153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 18571 17816 gene locus_tag LOCUS_06350 18571 17816 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222425.1 protein_id gnl|my_center|LOCUS_06350 19401 18628 gene locus_tag LOCUS_06360 19401 18628 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_06360 21046 19508 gene locus_tag LOCUS_06370 gene asnB 21046 19508 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860775.1 protein_id gnl|my_center|LOCUS_06370 21300 21115 gene locus_tag LOCUS_06380 21300 21115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 21551 21312 gene locus_tag LOCUS_06390 21551 21312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 21722 22582 gene locus_tag LOCUS_06400 21722 22582 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_06400 24052 22649 gene locus_tag LOCUS_06410 24052 22649 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_06410 26300 24396 gene locus_tag LOCUS_06420 26300 24396 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_06420 28026 26293 gene locus_tag LOCUS_06430 28026 26293 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_06430 28502 28023 gene locus_tag LOCUS_06440 28502 28023 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_06440 28732 29874 gene locus_tag LOCUS_06450 28732 29874 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922500.1 protein_id gnl|my_center|LOCUS_06450 29877 30992 gene locus_tag LOCUS_06460 gene glgD 29877 30992 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418641.1 protein_id gnl|my_center|LOCUS_06460 <33170 31190 gene locus_tag LOCUS_06470 <33170 31190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010905982.1:bacterial Ig-like domain-containing protein >Feature sequence015 124 588 gene locus_tag LOCUS_06480 124 588 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_06480 1299 577 gene locus_tag LOCUS_06490 1299 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 1454 2689 gene locus_tag LOCUS_06500 1454 2689 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428267.1 protein_id gnl|my_center|LOCUS_06500 2835 3752 gene locus_tag LOCUS_06510 2835 3752 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888897.1 protein_id gnl|my_center|LOCUS_06510 3831 4589 gene locus_tag LOCUS_06520 3831 4589 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965361.1 protein_id gnl|my_center|LOCUS_06520 4579 5148 gene locus_tag LOCUS_06530 gene scpB 4579 5148 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965360.1 protein_id gnl|my_center|LOCUS_06530 5253 6524 gene locus_tag LOCUS_06540 5253 6524 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541694.1 protein_id gnl|my_center|LOCUS_06540 6641 8629 gene locus_tag LOCUS_06550 6641 8629 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_06550 8798 9391 gene locus_tag LOCUS_06560 8798 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 9800 11239 gene locus_tag LOCUS_06570 9800 11239 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392670.1 protein_id gnl|my_center|LOCUS_06570 11254 12027 gene locus_tag LOCUS_06580 11254 12027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 12044 12418 gene locus_tag LOCUS_06590 12044 12418 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_06590 12443 13594 gene locus_tag LOCUS_06600 12443 13594 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_06600 13613 15028 gene locus_tag LOCUS_06610 13613 15028 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017109.1 protein_id gnl|my_center|LOCUS_06610 15253 15804 gene locus_tag LOCUS_06620 15253 15804 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_06620 15797 16867 gene locus_tag LOCUS_06630 15797 16867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 17981 16953 gene locus_tag LOCUS_06640 17981 16953 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_06640 18171 19355 gene locus_tag LOCUS_06650 18171 19355 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_06650 19352 20209 gene locus_tag LOCUS_06660 19352 20209 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944134.1 protein_id gnl|my_center|LOCUS_06660 20233 21720 gene locus_tag LOCUS_06670 20233 21720 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459733.1 protein_id gnl|my_center|LOCUS_06670 21919 22719 gene locus_tag LOCUS_06680 21919 22719 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014636209.1 protein_id gnl|my_center|LOCUS_06680 22698 23489 gene locus_tag LOCUS_06690 22698 23489 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775424.1 protein_id gnl|my_center|LOCUS_06690 23543 24574 gene locus_tag LOCUS_06700 23543 24574 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921803.1 protein_id gnl|my_center|LOCUS_06700 24713 25534 gene locus_tag LOCUS_06710 24713 25534 CDS product glucosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921804.1 protein_id gnl|my_center|LOCUS_06710 25596 26756 gene locus_tag LOCUS_06720 gene fba 25596 26756 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_06720 26768 27925 gene locus_tag LOCUS_06730 gene nagA 26768 27925 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902854.1 protein_id gnl|my_center|LOCUS_06730 28116 29945 gene locus_tag LOCUS_06740 28116 29945 CDS product aminopeptidase P family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986733.1 protein_id gnl|my_center|LOCUS_06740 29984 30991 gene locus_tag LOCUS_06750 29984 30991 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_06750 30988 32217 gene locus_tag LOCUS_06760 30988 32217 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_06760 >Feature sequence016 2 172 gene locus_tag LOCUS_06770 2 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 172 636 gene locus_tag LOCUS_06780 172 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 641 1348 gene locus_tag LOCUS_06790 641 1348 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813911.1 protein_id gnl|my_center|LOCUS_06790 1345 2682 gene locus_tag LOCUS_06800 1345 2682 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775459.1 protein_id gnl|my_center|LOCUS_06800 2921 5809 gene locus_tag LOCUS_06810 2921 5809 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_06810 5921 6538 gene locus_tag LOCUS_06820 5921 6538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 6576 9110 gene locus_tag LOCUS_06830 6576 9110 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728432.1 protein_id gnl|my_center|LOCUS_06830 9360 10295 gene locus_tag LOCUS_06840 9360 10295 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682246.1 protein_id gnl|my_center|LOCUS_06840 10418 11110 gene locus_tag LOCUS_06850 10418 11110 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083214.1 protein_id gnl|my_center|LOCUS_06850 11398 12453 gene locus_tag LOCUS_06860 11398 12453 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970202.1 protein_id gnl|my_center|LOCUS_06860 12537 13250 gene locus_tag LOCUS_06870 12537 13250 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583290.1 protein_id gnl|my_center|LOCUS_06870 13267 15714 gene locus_tag LOCUS_06880 13267 15714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 15711 16649 gene locus_tag LOCUS_06890 15711 16649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 16660 17676 gene locus_tag LOCUS_06900 16660 17676 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245542.1 protein_id gnl|my_center|LOCUS_06900 17743 18768 gene locus_tag LOCUS_06910 17743 18768 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_06910 20041 18866 gene locus_tag LOCUS_06920 20041 18866 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_06920 21753 20044 gene locus_tag LOCUS_06930 21753 20044 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986398.1 protein_id gnl|my_center|LOCUS_06930 21961 22500 gene locus_tag LOCUS_06940 21961 22500 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864755.1 protein_id gnl|my_center|LOCUS_06940 22524 24008 gene locus_tag LOCUS_06950 22524 24008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 25477 24554 gene locus_tag LOCUS_06960 25477 24554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 25454 25717 gene locus_tag LOCUS_06970 25454 25717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 27104 25725 gene locus_tag LOCUS_06980 27104 25725 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_06980 27465 28448 gene locus_tag LOCUS_06990 27465 28448 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_06990 28480 28701 gene locus_tag LOCUS_07000 28480 28701 CDS product DUF5348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610290.1 protein_id gnl|my_center|LOCUS_07000 28743 29219 gene locus_tag LOCUS_07010 28743 29219 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861118.1 protein_id gnl|my_center|LOCUS_07010 29216 31024 gene locus_tag LOCUS_07020 29216 31024 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_07020 31011 31181 gene locus_tag LOCUS_07030 31011 31181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 31531 31382 gene locus_tag LOCUS_07040 31531 31382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 31593 31733 gene locus_tag LOCUS_07050 31593 31733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 >Feature sequence017 206 385 gene locus_tag LOCUS_07060 206 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 2587 482 gene locus_tag LOCUS_07070 2587 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 3703 2705 gene locus_tag LOCUS_07080 3703 2705 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933588.1 protein_id gnl|my_center|LOCUS_07080 4337 3816 gene locus_tag LOCUS_07090 4337 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 4749 4327 gene locus_tag LOCUS_07100 4749 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 5582 7042 gene locus_tag LOCUS_07110 5582 7042 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_07110 7087 7953 gene locus_tag LOCUS_07120 7087 7953 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262870.1 protein_id gnl|my_center|LOCUS_07120 10188 8023 gene locus_tag LOCUS_07130 gene gnpA 10188 8023 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389475.1 protein_id gnl|my_center|LOCUS_07130 11082 10210 gene locus_tag LOCUS_07140 11082 10210 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776379.1 protein_id gnl|my_center|LOCUS_07140 11998 11105 gene locus_tag LOCUS_07150 11998 11105 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103759610.1 protein_id gnl|my_center|LOCUS_07150 13351 12071 gene locus_tag LOCUS_07160 13351 12071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 14327 13527 gene locus_tag LOCUS_07170 14327 13527 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359839.1 protein_id gnl|my_center|LOCUS_07170 15494 14367 gene locus_tag LOCUS_07180 15494 14367 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706698.1 protein_id gnl|my_center|LOCUS_07180 17470 15578 gene locus_tag LOCUS_07190 17470 15578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 19465 17540 gene locus_tag LOCUS_07200 19465 17540 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964869.1 protein_id gnl|my_center|LOCUS_07200 20672 19458 gene locus_tag LOCUS_07210 20672 19458 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016893.1 protein_id gnl|my_center|LOCUS_07210 22429 20669 gene locus_tag LOCUS_07220 22429 20669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 23808 22426 gene locus_tag LOCUS_07230 23808 22426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 24023 24874 gene locus_tag LOCUS_07240 24023 24874 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101360.1 protein_id gnl|my_center|LOCUS_07240 24918 25721 gene locus_tag LOCUS_07250 24918 25721 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101359.1 protein_id gnl|my_center|LOCUS_07250 25726 26100 gene locus_tag LOCUS_07260 25726 26100 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_07260 26104 26967 gene locus_tag LOCUS_07270 26104 26967 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_07270 26964 27608 gene locus_tag LOCUS_07280 26964 27608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 28972 27677 gene locus_tag LOCUS_07290 28972 27677 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_07290 29225 28995 gene locus_tag LOCUS_07300 29225 28995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 29727 29230 gene locus_tag LOCUS_07310 29727 29230 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390171.1 protein_id gnl|my_center|LOCUS_07310 >Feature sequence018 89 1027 gene locus_tag LOCUS_07320 gene spoIIIAA 89 1027 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358945.1 protein_id gnl|my_center|LOCUS_07320 1015 1533 gene locus_tag LOCUS_07330 1015 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 1547 1741 gene locus_tag LOCUS_07340 gene spoIIIAC 1547 1741 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888937.1 protein_id gnl|my_center|LOCUS_07340 1845 2231 gene locus_tag LOCUS_07350 gene spoIIIAD 1845 2231 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810912.1 protein_id gnl|my_center|LOCUS_07350 2228 3445 gene locus_tag LOCUS_07360 gene spoIIIAE 2228 3445 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358911.1 protein_id gnl|my_center|LOCUS_07360 3481 3972 gene locus_tag LOCUS_07370 3481 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 3962 4567 gene locus_tag LOCUS_07380 3962 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 4591 5202 gene locus_tag LOCUS_07390 4591 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 5457 7046 gene locus_tag LOCUS_07400 5457 7046 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_07400 7119 7502 gene locus_tag LOCUS_07410 7119 7502 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_07410 7604 8011 gene locus_tag LOCUS_07420 gene nusB 7604 8011 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_07420 8014 9246 gene locus_tag LOCUS_07430 gene xseA 8014 9246 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_07430 9246 9455 gene locus_tag LOCUS_07440 9246 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 9445 10335 gene locus_tag LOCUS_07450 9445 10335 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_07450 10347 12248 gene locus_tag LOCUS_07460 gene dxs 10347 12248 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_07460 12250 13056 gene locus_tag LOCUS_07470 12250 13056 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_07470 13074 13907 gene locus_tag LOCUS_07480 13074 13907 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_07480 13912 14370 gene locus_tag LOCUS_07490 13912 14370 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986439.1 protein_id gnl|my_center|LOCUS_07490 14379 16055 gene locus_tag LOCUS_07500 gene recN 14379 16055 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896126.1 protein_id gnl|my_center|LOCUS_07500 16191 17300 gene locus_tag LOCUS_07510 16191 17300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 17396 18190 gene locus_tag LOCUS_07520 gene spo0A 17396 18190 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965371.1 protein_id gnl|my_center|LOCUS_07520 18300 19748 gene locus_tag LOCUS_07530 gene glgA 18300 19748 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_07530 19783 20652 gene locus_tag LOCUS_07540 gene metF 19783 20652 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_07540 20701 21342 gene locus_tag LOCUS_07550 20701 21342 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986274.1 protein_id gnl|my_center|LOCUS_07550 21404 23947 gene locus_tag LOCUS_07560 21404 23947 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903830.1 protein_id gnl|my_center|LOCUS_07560 24100 25620 gene locus_tag LOCUS_07570 24100 25620 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888725.1 protein_id gnl|my_center|LOCUS_07570 26148 28790 gene locus_tag LOCUS_07580 gene alaS 26148 28790 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964985.1 protein_id gnl|my_center|LOCUS_07580 28909 29760 gene locus_tag LOCUS_07590 28909 29760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 >Feature sequence019 881 219 gene locus_tag LOCUS_07600 881 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 1135 947 gene locus_tag LOCUS_07610 1135 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 1448 1260 gene locus_tag LOCUS_07620 1448 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 2386 1490 gene locus_tag LOCUS_07630 2386 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 3154 2390 gene locus_tag LOCUS_07640 3154 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 3474 3151 gene locus_tag LOCUS_07650 3474 3151 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_07650 4833 3631 gene locus_tag LOCUS_07660 4833 3631 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_07660 5770 5498 gene locus_tag LOCUS_07670 5770 5498 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986717.1 protein_id gnl|my_center|LOCUS_07670 9381 5767 gene locus_tag LOCUS_07680 gene addA 9381 5767 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948198.1 protein_id gnl|my_center|LOCUS_07680 12950 9378 gene locus_tag LOCUS_07690 gene addB 12950 9378 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_07690 14035 15552 gene locus_tag LOCUS_07700 14035 15552 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987127.1 protein_id gnl|my_center|LOCUS_07700 16541 15609 gene locus_tag LOCUS_07710 16541 15609 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_07710 17525 16650 gene locus_tag LOCUS_07720 gene aroE 17525 16650 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989932.1 protein_id gnl|my_center|LOCUS_07720 17951 17667 gene locus_tag LOCUS_07730 17951 17667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 18851 18054 gene locus_tag LOCUS_07740 gene trpA 18851 18054 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_07740 20043 18844 gene locus_tag LOCUS_07750 gene trpB 20043 18844 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_07750 20723 20091 gene locus_tag LOCUS_07760 20723 20091 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_07760 21563 20745 gene locus_tag LOCUS_07770 gene trpC 21563 20745 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_07770 22591 21560 gene locus_tag LOCUS_07780 gene trpD 22591 21560 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_07780 23199 22618 gene locus_tag LOCUS_07790 23199 22618 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966439.1 protein_id gnl|my_center|LOCUS_07790 24662 23196 gene locus_tag LOCUS_07800 gene trpE 24662 23196 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880347.1 protein_id gnl|my_center|LOCUS_07800 26001 25060 gene locus_tag LOCUS_07810 26001 25060 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_07810 26846 25998 gene locus_tag LOCUS_07820 26846 25998 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_07820 28518 26827 gene locus_tag LOCUS_07830 gene araB 28518 26827 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951845.1 protein_id gnl|my_center|LOCUS_07830 <29310 28533 gene locus_tag LOCUS_07840 <29310 28533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081649.1:beta-fructosidase >Feature sequence020 1462 452 gene locus_tag LOCUS_07850 1462 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 3524 2289 gene locus_tag LOCUS_07860 3524 2289 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081014.1 protein_id gnl|my_center|LOCUS_07860 5614 3761 gene locus_tag LOCUS_07870 gene asnB 5614 3761 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233080.1 protein_id gnl|my_center|LOCUS_07870 6229 5651 gene locus_tag LOCUS_07880 6229 5651 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429956.1 protein_id gnl|my_center|LOCUS_07880 7132 6263 gene locus_tag LOCUS_07890 gene dpsA 7132 6263 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439770.1 protein_id gnl|my_center|LOCUS_07890 7814 7266 gene locus_tag LOCUS_07900 7814 7266 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_07900 9831 7948 gene locus_tag LOCUS_07910 9831 7948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 11258 9900 gene locus_tag LOCUS_07920 11258 9900 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966729.1 protein_id gnl|my_center|LOCUS_07920 13054 11330 gene locus_tag LOCUS_07930 13054 11330 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_07930 14173 13097 gene locus_tag LOCUS_07940 14173 13097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 15290 14214 gene locus_tag LOCUS_07950 15290 14214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 15969 15268 gene locus_tag LOCUS_07960 15969 15268 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994403.1 protein_id gnl|my_center|LOCUS_07960 16607 15966 gene locus_tag LOCUS_07970 16607 15966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 17916 16744 gene locus_tag LOCUS_07980 17916 16744 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108595.1 protein_id gnl|my_center|LOCUS_07980 19093 17906 gene locus_tag LOCUS_07990 19093 17906 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583022.1 protein_id gnl|my_center|LOCUS_07990 20120 19095 gene locus_tag LOCUS_08000 20120 19095 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080062.1 protein_id gnl|my_center|LOCUS_08000 21002 20160 gene locus_tag LOCUS_08010 21002 20160 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 protein_id gnl|my_center|LOCUS_08010 22015 21002 gene locus_tag LOCUS_08020 22015 21002 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 protein_id gnl|my_center|LOCUS_08020 23632 22247 gene locus_tag LOCUS_08030 23632 22247 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 protein_id gnl|my_center|LOCUS_08030 24938 23934 gene locus_tag LOCUS_08040 24938 23934 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_08040 25959 24940 gene locus_tag LOCUS_08050 25959 24940 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_08050 28214 26037 gene locus_tag LOCUS_08060 28214 26037 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584017.1 protein_id gnl|my_center|LOCUS_08060 >Feature sequence021 3938 24 gene locus_tag LOCUS_08070 3938 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 4361 4681 gene locus_tag LOCUS_08080 4361 4681 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393078.1 protein_id gnl|my_center|LOCUS_08080 4678 4905 gene locus_tag LOCUS_08090 4678 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 7043 5118 gene locus_tag LOCUS_08100 7043 5118 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 protein_id gnl|my_center|LOCUS_08100 7355 7137 gene locus_tag LOCUS_08110 7355 7137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08110 7531 8220 gene locus_tag LOCUS_08120 7531 8220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 9731 8280 gene locus_tag LOCUS_08130 9731 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 10120 10548 gene locus_tag LOCUS_08140 10120 10548 CDS product DUF2871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111798.1 protein_id gnl|my_center|LOCUS_08140 12109 10685 gene locus_tag LOCUS_08150 gene sacA 12109 10685 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886636.1 protein_id gnl|my_center|LOCUS_08150 14123 12168 gene locus_tag LOCUS_08160 14123 12168 CDS product PTS beta-glucoside transporter subunit IIBCA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027722.1 protein_id gnl|my_center|LOCUS_08160 15320 14304 gene locus_tag LOCUS_08170 15320 14304 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140402.1 protein_id gnl|my_center|LOCUS_08170 16942 15317 gene locus_tag LOCUS_08180 16942 15317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 18315 16939 gene locus_tag LOCUS_08190 18315 16939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 19618 18329 gene locus_tag LOCUS_08200 19618 18329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 20577 19759 gene locus_tag LOCUS_08210 gene hag 20577 19759 CDS product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 protein_id gnl|my_center|LOCUS_08210 20887 22185 gene locus_tag LOCUS_08220 20887 22185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 24325 22304 gene locus_tag LOCUS_08230 24325 22304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 24782 24363 gene locus_tag LOCUS_08240 24782 24363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 25071 24772 gene locus_tag LOCUS_08250 25071 24772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 25517 25065 gene locus_tag LOCUS_08260 gene fliW 25517 25065 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860685.1 protein_id gnl|my_center|LOCUS_08260 26202 25582 gene locus_tag LOCUS_08270 26202 25582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 27240 26242 gene locus_tag LOCUS_08280 27240 26242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 28780 27254 gene locus_tag LOCUS_08290 gene flgK 28780 27254 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460797.1 protein_id gnl|my_center|LOCUS_08290 >Feature sequence022 536 1447 gene locus_tag LOCUS_08300 536 1447 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023079930.1 protein_id gnl|my_center|LOCUS_08300 1634 3046 gene locus_tag LOCUS_08310 1634 3046 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_08310 3146 4540 gene locus_tag LOCUS_08320 3146 4540 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_08320 5785 4769 gene locus_tag LOCUS_08330 5785 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 6064 6888 gene locus_tag LOCUS_08340 6064 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 7975 8805 gene locus_tag LOCUS_08350 7975 8805 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_08350 8838 9866 gene locus_tag LOCUS_08360 8838 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 9863 10636 gene locus_tag LOCUS_08370 9863 10636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 10796 11275 gene locus_tag LOCUS_08380 10796 11275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964816.1 protein_id gnl|my_center|LOCUS_08380 11807 11361 gene locus_tag LOCUS_08390 11807 11361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 12048 12134 gene locus_tag LOCUS_t00040 12048 12134 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13837 12203 gene locus_tag LOCUS_08400 13837 12203 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633864.1 protein_id gnl|my_center|LOCUS_08400 14741 15604 gene locus_tag LOCUS_08410 14741 15604 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767761.1 protein_id gnl|my_center|LOCUS_08410 15620 17749 gene locus_tag LOCUS_08420 15620 17749 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421678.1 protein_id gnl|my_center|LOCUS_08420 17785 18834 gene locus_tag LOCUS_08430 17785 18834 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_08430 18878 20983 gene locus_tag LOCUS_08440 18878 20983 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246684.1 protein_id gnl|my_center|LOCUS_08440 20984 21655 gene locus_tag LOCUS_08450 20984 21655 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_08450 21655 22644 gene locus_tag LOCUS_08460 21655 22644 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906252.1 protein_id gnl|my_center|LOCUS_08460 22774 23661 gene locus_tag LOCUS_08470 22774 23661 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966614.1 protein_id gnl|my_center|LOCUS_08470 23774 24472 gene locus_tag LOCUS_08480 23774 24472 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460117.1 protein_id gnl|my_center|LOCUS_08480 24469 26046 gene locus_tag LOCUS_08490 24469 26046 CDS product putative ABC exporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048139.1 protein_id gnl|my_center|LOCUS_08490 26323 27852 gene locus_tag LOCUS_08500 26323 27852 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence023 360 560 gene locus_tag LOCUS_08510 360 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 753 1493 gene locus_tag LOCUS_08520 753 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 1697 1533 gene locus_tag LOCUS_08530 1697 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 1887 2543 gene locus_tag LOCUS_08540 1887 2543 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_08540 2689 2997 gene locus_tag LOCUS_08550 gene trxA 2689 2997 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968307.1 protein_id gnl|my_center|LOCUS_08550 4459 3071 gene locus_tag LOCUS_08560 4459 3071 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_08560 5536 4475 gene locus_tag LOCUS_08570 5536 4475 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562759.1 protein_id gnl|my_center|LOCUS_08570 7037 5589 gene locus_tag LOCUS_08580 7037 5589 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_08580 7203 7604 gene locus_tag LOCUS_08590 7203 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 8211 7834 gene locus_tag LOCUS_08600 8211 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 8431 9213 gene locus_tag LOCUS_08610 8431 9213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 9414 14534 gene locus_tag LOCUS_08620 9414 14534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 15120 17768 gene locus_tag LOCUS_08630 15120 17768 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_08630 17765 19984 gene locus_tag LOCUS_08640 17765 19984 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873616.1 protein_id gnl|my_center|LOCUS_08640 19981 21264 gene locus_tag LOCUS_08650 19981 21264 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_08650 21265 21399 gene locus_tag LOCUS_08660 21265 21399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 21421 22773 gene locus_tag LOCUS_08670 21421 22773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 22898 23212 gene locus_tag LOCUS_08680 gene spoIIAA 22898 23212 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418414.1 protein_id gnl|my_center|LOCUS_08680 23209 23664 gene locus_tag LOCUS_08690 gene spoIIAB 23209 23664 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_08690 23643 24359 gene locus_tag LOCUS_08700 gene sigF 23643 24359 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860953.1 protein_id gnl|my_center|LOCUS_08700 24483 24713 gene locus_tag LOCUS_08710 24483 24713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 24703 25392 gene locus_tag LOCUS_08720 24703 25392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 25343 25789 gene locus_tag LOCUS_08730 25343 25789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 26672 25776 gene locus_tag LOCUS_08740 26672 25776 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence024 402 1064 gene locus_tag LOCUS_08750 402 1064 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460086.1 protein_id gnl|my_center|LOCUS_08750 1045 2025 gene locus_tag LOCUS_08760 1045 2025 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 protein_id gnl|my_center|LOCUS_08760 2022 2807 gene locus_tag LOCUS_08770 2022 2807 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262273.1 protein_id gnl|my_center|LOCUS_08770 4136 2904 gene locus_tag LOCUS_08780 4136 2904 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021729.1 protein_id gnl|my_center|LOCUS_08780 4745 4158 gene locus_tag LOCUS_08790 4745 4158 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392451.1 protein_id gnl|my_center|LOCUS_08790 6768 4747 gene locus_tag LOCUS_08800 gene iorA 6768 4747 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021731.1 protein_id gnl|my_center|LOCUS_08800 7309 6884 gene locus_tag LOCUS_08810 7309 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 7689 7294 gene locus_tag LOCUS_08820 7689 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 10295 8280 gene locus_tag LOCUS_08830 10295 8280 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 protein_id gnl|my_center|LOCUS_08830 11172 10324 gene locus_tag LOCUS_08840 11172 10324 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532212.1 protein_id gnl|my_center|LOCUS_08840 12068 11172 gene locus_tag LOCUS_08850 12068 11172 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270459.1 protein_id gnl|my_center|LOCUS_08850 13403 12162 gene locus_tag LOCUS_08860 13403 12162 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975877.1 protein_id gnl|my_center|LOCUS_08860 15044 13521 gene locus_tag LOCUS_08870 15044 13521 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387242.1 protein_id gnl|my_center|LOCUS_08870 16864 15059 gene locus_tag LOCUS_08880 16864 15059 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_08880 17207 16986 gene locus_tag LOCUS_08890 17207 16986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 17906 17244 gene locus_tag LOCUS_08900 17906 17244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 18754 17903 gene locus_tag LOCUS_08910 18754 17903 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_08910 19129 18758 gene locus_tag LOCUS_08920 19129 18758 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566897.1 protein_id gnl|my_center|LOCUS_08920 19395 19736 gene locus_tag LOCUS_08930 19395 19736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 20277 19858 gene locus_tag LOCUS_08940 20277 19858 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289317.1 protein_id gnl|my_center|LOCUS_08940 21708 20332 gene locus_tag LOCUS_08950 gene radA 21708 20332 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_08950 22312 21899 gene locus_tag LOCUS_08960 22312 21899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 24847 22418 gene locus_tag LOCUS_08970 gene clpC 24847 22418 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971183.1 protein_id gnl|my_center|LOCUS_08970 25307 24927 gene locus_tag LOCUS_08980 25307 24927 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963919.1 protein_id gnl|my_center|LOCUS_08980 25692 25438 gene locus_tag LOCUS_08990 25692 25438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 26645 25968 gene locus_tag LOCUS_09000 26645 25968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence025 390 70 gene locus_tag LOCUS_09010 390 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 671 390 gene locus_tag LOCUS_09020 671 390 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018213496.1 protein_id gnl|my_center|LOCUS_09020 1477 734 gene locus_tag LOCUS_09030 1477 734 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814285.1 protein_id gnl|my_center|LOCUS_09030 3036 1648 gene locus_tag LOCUS_09040 gene gltA 3036 1648 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_09040 3923 3036 gene locus_tag LOCUS_09050 3923 3036 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 protein_id gnl|my_center|LOCUS_09050 5327 4146 gene locus_tag LOCUS_09060 5327 4146 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_09060 6816 5473 gene locus_tag LOCUS_09070 6816 5473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 7667 6813 gene locus_tag LOCUS_09080 gene folD 7667 6813 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722487.1 protein_id gnl|my_center|LOCUS_09080 9394 7721 gene locus_tag LOCUS_09090 9394 7721 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809743.1 protein_id gnl|my_center|LOCUS_09090 12025 9425 gene locus_tag LOCUS_09100 12025 9425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 13282 12482 gene locus_tag LOCUS_09110 13282 12482 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388341.1 protein_id gnl|my_center|LOCUS_09110 14717 13443 gene locus_tag LOCUS_09120 14717 13443 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761151.1 protein_id gnl|my_center|LOCUS_09120 15500 14748 gene locus_tag LOCUS_09130 15500 14748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 16244 15513 gene locus_tag LOCUS_09140 16244 15513 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_09140 16736 16392 gene locus_tag LOCUS_09150 16736 16392 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360269.1 protein_id gnl|my_center|LOCUS_09150 18028 16874 gene locus_tag LOCUS_09160 gene alr 18028 16874 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_09160 19585 18095 gene locus_tag LOCUS_09170 19585 18095 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_09170 20367 19723 gene locus_tag LOCUS_09180 20367 19723 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_09180 20713 22734 gene locus_tag LOCUS_09190 20713 22734 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048250.1 protein_id gnl|my_center|LOCUS_09190 23692 22829 gene locus_tag LOCUS_09200 23692 22829 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_09200 24777 23824 gene locus_tag LOCUS_09210 24777 23824 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705389.1 protein_id gnl|my_center|LOCUS_09210 25390 24833 gene locus_tag LOCUS_09220 25390 24833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 25761 25387 gene locus_tag LOCUS_09230 25761 25387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 26007 25789 gene locus_tag LOCUS_09240 26007 25789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence026 69 1469 gene locus_tag LOCUS_09250 69 1469 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_09250 1861 3270 gene locus_tag LOCUS_09260 1861 3270 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_09260 3411 3806 gene locus_tag LOCUS_09270 3411 3806 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358712.1 protein_id gnl|my_center|LOCUS_09270 4012 5895 gene locus_tag LOCUS_09280 gene cooS 4012 5895 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948938.1 protein_id gnl|my_center|LOCUS_09280 5909 6355 gene locus_tag LOCUS_09290 5909 6355 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948939.1 protein_id gnl|my_center|LOCUS_09290 6359 7579 gene locus_tag LOCUS_09300 6359 7579 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948940.1 protein_id gnl|my_center|LOCUS_09300 7820 10456 gene locus_tag LOCUS_09310 gene ppdK 7820 10456 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_09310 11853 10567 gene locus_tag LOCUS_09320 11853 10567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 12124 13326 gene locus_tag LOCUS_09330 12124 13326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 13500 14567 gene locus_tag LOCUS_09340 13500 14567 CDS product DUF4325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682079.1 protein_id gnl|my_center|LOCUS_09340 14954 14709 gene locus_tag LOCUS_09350 14954 14709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 15090 15494 gene locus_tag LOCUS_09360 15090 15494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 15658 15915 gene locus_tag LOCUS_09370 gene ptsH 15658 15915 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874410.1 protein_id gnl|my_center|LOCUS_09370 15934 16476 gene locus_tag LOCUS_09380 15934 16476 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868802.1 protein_id gnl|my_center|LOCUS_09380 16507 16854 gene locus_tag LOCUS_09390 16507 16854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 16881 18464 gene locus_tag LOCUS_09400 16881 18464 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143601.1 protein_id gnl|my_center|LOCUS_09400 18482 18862 gene locus_tag LOCUS_09410 18482 18862 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715480.1 protein_id gnl|my_center|LOCUS_09410 18901 19671 gene locus_tag LOCUS_09420 18901 19671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 19694 20113 gene locus_tag LOCUS_09430 19694 20113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 20385 22592 gene locus_tag LOCUS_09440 20385 22592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 22707 23540 gene locus_tag LOCUS_09450 22707 23540 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987040.1 protein_id gnl|my_center|LOCUS_09450 23778 23984 gene locus_tag LOCUS_09460 23778 23984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 24022 24699 gene locus_tag LOCUS_09470 24022 24699 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_09470 24717 25703 gene locus_tag LOCUS_09480 24717 25703 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence027 343 879 gene locus_tag LOCUS_09490 343 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1051 1200 gene locus_tag LOCUS_09500 1051 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 1567 2352 gene locus_tag LOCUS_09510 1567 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 2349 2861 gene locus_tag LOCUS_09520 2349 2861 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583237.1 protein_id gnl|my_center|LOCUS_09520 2918 3475 gene locus_tag LOCUS_09530 gene efp 2918 3475 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_09530 3758 4699 gene locus_tag LOCUS_09540 3758 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 4714 9123 gene locus_tag LOCUS_09550 4714 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 9295 9366 gene locus_tag LOCUS_t00050 9295 9366 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10307 9513 gene locus_tag LOCUS_09560 10307 9513 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262156.1 protein_id gnl|my_center|LOCUS_09560 10999 10301 gene locus_tag LOCUS_09570 10999 10301 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_09570 11367 10996 gene locus_tag LOCUS_09580 11367 10996 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430051.1 protein_id gnl|my_center|LOCUS_09580 12428 11520 gene locus_tag LOCUS_09590 12428 11520 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990126.1 protein_id gnl|my_center|LOCUS_09590 14613 12502 gene locus_tag LOCUS_09600 gene glgX 14613 12502 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021995.1 protein_id gnl|my_center|LOCUS_09600 15295 14675 gene locus_tag LOCUS_09610 15295 14675 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666641.1 protein_id gnl|my_center|LOCUS_09610 16080 15292 gene locus_tag LOCUS_09620 16080 15292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 16618 17577 gene locus_tag LOCUS_09630 16618 17577 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389792.1 protein_id gnl|my_center|LOCUS_09630 17601 18716 gene locus_tag LOCUS_09640 17601 18716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 18703 19848 gene locus_tag LOCUS_09650 18703 19848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 21690 20359 gene locus_tag LOCUS_09660 gene celF 21690 20359 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145750.1 protein_id gnl|my_center|LOCUS_09660 22029 22334 gene locus_tag LOCUS_09670 22029 22334 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809626.1 protein_id gnl|my_center|LOCUS_09670 22477 23850 gene locus_tag LOCUS_09680 22477 23850 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775705.1 protein_id gnl|my_center|LOCUS_09680 23932 24246 gene locus_tag LOCUS_09690 23932 24246 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722125.1 protein_id gnl|my_center|LOCUS_09690 24285 24464 gene locus_tag LOCUS_09700 24285 24464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 24485 24925 gene locus_tag LOCUS_09710 24485 24925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 24965 26050 gene locus_tag LOCUS_09720 24965 26050 CDS product DUF871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253349.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence028 1518 745 gene locus_tag LOCUS_09730 1518 745 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_09730 2279 1497 gene locus_tag LOCUS_09740 2279 1497 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931583.1 protein_id gnl|my_center|LOCUS_09740 3079 2276 gene locus_tag LOCUS_09750 gene tauC 3079 2276 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704532.1 protein_id gnl|my_center|LOCUS_09750 4254 3181 gene locus_tag LOCUS_09760 4254 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 5082 4612 gene locus_tag LOCUS_09770 gene tnpA 5082 4612 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966797.1 protein_id gnl|my_center|LOCUS_09770 8265 5632 gene locus_tag LOCUS_09780 8265 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 8999 8298 gene locus_tag LOCUS_09790 8999 8298 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_09790 9395 9237 gene locus_tag LOCUS_09800 9395 9237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 10273 9392 gene locus_tag LOCUS_09810 10273 9392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 11202 10354 gene locus_tag LOCUS_09820 11202 10354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 11624 11214 gene locus_tag LOCUS_09830 11624 11214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 12288 12112 gene locus_tag LOCUS_09840 12288 12112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 12535 12272 gene locus_tag LOCUS_09850 12535 12272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 12862 12656 gene locus_tag LOCUS_09860 12862 12656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 13052 12849 gene locus_tag LOCUS_09870 13052 12849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 13183 13049 gene locus_tag LOCUS_09880 13183 13049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 14437 13412 gene locus_tag LOCUS_09890 14437 13412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 15006 14506 gene locus_tag LOCUS_09900 15006 14506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 15236 15003 gene locus_tag LOCUS_09910 15236 15003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 15500 15300 gene locus_tag LOCUS_09920 15500 15300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 15643 16008 gene locus_tag LOCUS_09930 15643 16008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 16510 17673 gene locus_tag LOCUS_09940 16510 17673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 18040 17846 gene locus_tag LOCUS_09950 18040 17846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 18814 19779 gene locus_tag LOCUS_09960 18814 19779 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392152.1 protein_id gnl|my_center|LOCUS_09960 21220 19763 gene locus_tag LOCUS_09970 gene xylB 21220 19763 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_09970 22709 21225 gene locus_tag LOCUS_09980 22709 21225 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_09980 23426 22812 gene locus_tag LOCUS_09990 23426 22812 CDS product DUF4867 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965899.1 protein_id gnl|my_center|LOCUS_09990 24241 23708 gene locus_tag LOCUS_10000 24241 23708 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_10000 24665 24243 gene locus_tag LOCUS_10010 24665 24243 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815969.1 protein_id gnl|my_center|LOCUS_10010 24837 24622 gene locus_tag LOCUS_10020 24837 24622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 25484 24816 gene locus_tag LOCUS_10030 25484 24816 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460050.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence029 <1 903 gene locus_tag LOCUS_10040 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207939.1:GGDEF domain-containing protein 1791 913 gene locus_tag LOCUS_10050 1791 913 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_10050 2816 1932 gene locus_tag LOCUS_10060 gene dapA 2816 1932 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438799.1 protein_id gnl|my_center|LOCUS_10060 3335 4138 gene locus_tag LOCUS_10070 3335 4138 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434058.1 protein_id gnl|my_center|LOCUS_10070 4139 4681 gene locus_tag LOCUS_10080 4139 4681 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902988.1 protein_id gnl|my_center|LOCUS_10080 4678 7065 gene locus_tag LOCUS_10090 4678 7065 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 protein_id gnl|my_center|LOCUS_10090 8450 7398 gene locus_tag LOCUS_10100 gene aroB 8450 7398 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893310.1 protein_id gnl|my_center|LOCUS_10100 9491 8478 gene locus_tag LOCUS_10110 gene aroF 9491 8478 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_10110 9721 10416 gene locus_tag LOCUS_10120 gene pyrH 9721 10416 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_10120 10467 11018 gene locus_tag LOCUS_10130 gene frr 10467 11018 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_10130 11225 11932 gene locus_tag LOCUS_10140 11225 11932 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424529.1 protein_id gnl|my_center|LOCUS_10140 11935 12747 gene locus_tag LOCUS_10150 11935 12747 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_10150 12823 12987 gene locus_tag LOCUS_10160 12823 12987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 12914 14056 gene locus_tag LOCUS_10170 12914 14056 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_10170 14060 15091 gene locus_tag LOCUS_10180 gene rseP 14060 15091 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_10180 15147 16409 gene locus_tag LOCUS_10190 gene sleC 15147 16409 CDS product spore cortex-lytic germination protein SleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425119.1 protein_id gnl|my_center|LOCUS_10190 16492 17745 gene locus_tag LOCUS_10200 16492 17745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 17962 19032 gene locus_tag LOCUS_10210 gene carA 17962 19032 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_10210 19032 22232 gene locus_tag LOCUS_10220 gene carB 19032 22232 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_10220 23478 23038 gene locus_tag LOCUS_10230 23478 23038 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003828945.1 protein_id gnl|my_center|LOCUS_10230 23635 23796 gene locus_tag LOCUS_10240 23635 23796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 23865 24740 gene locus_tag LOCUS_10250 23865 24740 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438284.1 protein_id gnl|my_center|LOCUS_10250 24742 25644 gene locus_tag LOCUS_10260 24742 25644 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence030 1604 150 gene locus_tag LOCUS_10270 1604 150 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776859.1 protein_id gnl|my_center|LOCUS_10270 3164 1617 gene locus_tag LOCUS_10280 3164 1617 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_10280 4165 3230 gene locus_tag LOCUS_10290 4165 3230 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727964.1 protein_id gnl|my_center|LOCUS_10290 5134 4181 gene locus_tag LOCUS_10300 5134 4181 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_10300 5373 6467 gene locus_tag LOCUS_10310 5373 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 6464 8236 gene locus_tag LOCUS_10320 gene yesM 6464 8236 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_10320 8330 9688 gene locus_tag LOCUS_10330 8330 9688 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_10330 10058 9738 gene locus_tag LOCUS_10340 10058 9738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 11429 10146 gene locus_tag LOCUS_10350 11429 10146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 12086 11496 gene locus_tag LOCUS_10360 gene hisB 12086 11496 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964256.1 protein_id gnl|my_center|LOCUS_10360 13426 12128 gene locus_tag LOCUS_10370 gene hisD 13426 12128 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949111.1 protein_id gnl|my_center|LOCUS_10370 14091 13423 gene locus_tag LOCUS_10380 gene hisG 14091 13423 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358779.1 protein_id gnl|my_center|LOCUS_10380 15355 14108 gene locus_tag LOCUS_10390 15355 14108 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964253.1 protein_id gnl|my_center|LOCUS_10390 15963 15430 gene locus_tag LOCUS_10400 gene recU 15963 15430 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460152.1 protein_id gnl|my_center|LOCUS_10400 17017 16004 gene locus_tag LOCUS_10410 17017 16004 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_10410 17625 17047 gene locus_tag LOCUS_10420 17625 17047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 18416 17622 gene locus_tag LOCUS_10430 18416 17622 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_10430 20371 18455 gene locus_tag LOCUS_10440 20371 18455 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_10440 21084 20404 gene locus_tag LOCUS_10450 21084 20404 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_10450 21785 21078 gene locus_tag LOCUS_10460 21785 21078 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860778.1 protein_id gnl|my_center|LOCUS_10460 23188 21782 gene locus_tag LOCUS_10470 23188 21782 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_10470 23436 23203 gene locus_tag LOCUS_10480 23436 23203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 23592 24011 gene locus_tag LOCUS_10490 23592 24011 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068146.1 protein_id gnl|my_center|LOCUS_10490 24578 24348 gene locus_tag LOCUS_10500 24578 24348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence031 55 558 gene locus_tag LOCUS_10510 55 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 810 2795 gene locus_tag LOCUS_10520 gene uvrB 810 2795 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_10520 2926 5775 gene locus_tag LOCUS_10530 gene uvrA 2926 5775 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 protein_id gnl|my_center|LOCUS_10530 5978 6967 gene locus_tag LOCUS_10540 5978 6967 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966142.1 protein_id gnl|my_center|LOCUS_10540 7083 9305 gene locus_tag LOCUS_10550 7083 9305 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434402.1 protein_id gnl|my_center|LOCUS_10550 9509 10114 gene locus_tag LOCUS_10560 9509 10114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 10213 10590 gene locus_tag LOCUS_10570 10213 10590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 10587 11600 gene locus_tag LOCUS_10580 10587 11600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 11621 12481 gene locus_tag LOCUS_10590 gene cdaA 11621 12481 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966360.1 protein_id gnl|my_center|LOCUS_10590 12478 13776 gene locus_tag LOCUS_10600 12478 13776 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461864.1 protein_id gnl|my_center|LOCUS_10600 13826 14101 gene locus_tag LOCUS_10610 13826 14101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 14114 15031 gene locus_tag LOCUS_10620 14114 15031 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_10620 15149 16699 gene locus_tag LOCUS_10630 gene cps4A 15149 16699 CDS product capsular polysaccharide biosynthesis protein Cps4A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091050.1 protein_id gnl|my_center|LOCUS_10630 16745 16930 gene locus_tag LOCUS_10640 16745 16930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 17181 18875 gene locus_tag LOCUS_10650 17181 18875 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680980.1 protein_id gnl|my_center|LOCUS_10650 19132 19734 gene locus_tag LOCUS_10660 19132 19734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 19771 23886 gene locus_tag LOCUS_10670 19771 23886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence032 252 608 gene locus_tag LOCUS_10680 gene rplT 252 608 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429730.1 protein_id gnl|my_center|LOCUS_10680 769 1833 gene locus_tag LOCUS_10690 769 1833 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141484866.1 protein_id gnl|my_center|LOCUS_10690 1924 2454 gene locus_tag LOCUS_10700 1924 2454 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_10700 2435 3127 gene locus_tag LOCUS_10710 2435 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 3680 3204 gene locus_tag LOCUS_10720 3680 3204 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197479.1 protein_id gnl|my_center|LOCUS_10720 4346 3729 gene locus_tag LOCUS_10730 4346 3729 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987106.1 protein_id gnl|my_center|LOCUS_10730 4741 5778 gene locus_tag LOCUS_10740 4741 5778 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530473.1 protein_id gnl|my_center|LOCUS_10740 5853 7421 gene locus_tag LOCUS_10750 gene gguA 5853 7421 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992366.1 protein_id gnl|my_center|LOCUS_10750 7418 8362 gene locus_tag LOCUS_10760 7418 8362 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573417.1 protein_id gnl|my_center|LOCUS_10760 8363 9316 gene locus_tag LOCUS_10770 8363 9316 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209904.1 protein_id gnl|my_center|LOCUS_10770 9333 10310 gene locus_tag LOCUS_10780 9333 10310 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723635.1 protein_id gnl|my_center|LOCUS_10780 10310 11038 gene locus_tag LOCUS_10790 10310 11038 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990032.1 protein_id gnl|my_center|LOCUS_10790 11040 12539 gene locus_tag LOCUS_10800 gene xylB 11040 12539 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245233.1 protein_id gnl|my_center|LOCUS_10800 12529 13659 gene locus_tag LOCUS_10810 12529 13659 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974707.1 protein_id gnl|my_center|LOCUS_10810 13656 14753 gene locus_tag LOCUS_10820 13656 14753 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243509.1 protein_id gnl|my_center|LOCUS_10820 14762 15505 gene locus_tag LOCUS_10830 14762 15505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 15932 17323 gene locus_tag LOCUS_10840 15932 17323 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_10840 17459 17545 gene locus_tag LOCUS_t00060 17459 17545 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18185 19603 gene locus_tag LOCUS_10850 18185 19603 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666065.1 protein_id gnl|my_center|LOCUS_10850 19926 22085 gene locus_tag LOCUS_10860 gene nrdD 19926 22085 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288083.1 protein_id gnl|my_center|LOCUS_10860 22164 22706 gene locus_tag LOCUS_10870 gene nrdG 22164 22706 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905258.1 protein_id gnl|my_center|LOCUS_10870 >Feature sequence033 309 1151 gene locus_tag LOCUS_10880 309 1151 CDS product DUF2935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439363.1 protein_id gnl|my_center|LOCUS_10880 1271 1633 gene locus_tag LOCUS_10890 1271 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018213024.1 protein_id gnl|my_center|LOCUS_10890 2161 2517 gene locus_tag LOCUS_10900 2161 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 3520 2507 gene locus_tag LOCUS_10910 3520 2507 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964544.1 protein_id gnl|my_center|LOCUS_10910 4822 3536 gene locus_tag LOCUS_10920 4822 3536 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434194.1 protein_id gnl|my_center|LOCUS_10920 5032 5703 gene locus_tag LOCUS_10930 5032 5703 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_10930 5708 7168 gene locus_tag LOCUS_10940 5708 7168 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110230.1 protein_id gnl|my_center|LOCUS_10940 7314 7745 gene locus_tag LOCUS_10950 7314 7745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 7970 8638 gene locus_tag LOCUS_10960 7970 8638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 8679 8978 gene locus_tag LOCUS_10970 8679 8978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 9093 9821 gene locus_tag LOCUS_10980 9093 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 9818 11113 gene locus_tag LOCUS_10990 9818 11113 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007785170.1 protein_id gnl|my_center|LOCUS_10990 11568 11422 gene locus_tag LOCUS_11000 11568 11422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 12872 11565 gene locus_tag LOCUS_11010 12872 11565 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922710.1 protein_id gnl|my_center|LOCUS_11010 13175 13247 gene locus_tag LOCUS_t00070 13175 13247 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 13754 15634 gene locus_tag LOCUS_11020 13754 15634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 16436 15705 gene locus_tag LOCUS_11030 16436 15705 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861813.1 protein_id gnl|my_center|LOCUS_11030 16729 18729 gene locus_tag LOCUS_11040 gene treP 16729 18729 CDS product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297133.1 protein_id gnl|my_center|LOCUS_11040 18751 20415 gene locus_tag LOCUS_11050 gene treC 18751 20415 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986524.1 protein_id gnl|my_center|LOCUS_11050 20490 20684 gene locus_tag LOCUS_11060 20490 20684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 20831 22507 gene locus_tag LOCUS_11070 20831 22507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 22664 23689 gene locus_tag LOCUS_11080 22664 23689 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017159.1 protein_id gnl|my_center|LOCUS_11080 >Feature sequence034 160 1452 gene locus_tag LOCUS_11090 160 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1476 2333 gene locus_tag LOCUS_11100 1476 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 2448 3128 gene locus_tag LOCUS_11110 2448 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 3271 3735 gene locus_tag LOCUS_11120 3271 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 3636 5195 gene locus_tag LOCUS_11130 3636 5195 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015263574.1 protein_id gnl|my_center|LOCUS_11130 5267 5896 gene locus_tag LOCUS_11140 5267 5896 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048153.1 protein_id gnl|my_center|LOCUS_11140 6091 6849 gene locus_tag LOCUS_11150 gene dapB 6091 6849 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965675.1 protein_id gnl|my_center|LOCUS_11150 6936 8888 gene locus_tag LOCUS_11160 6936 8888 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_11160 9021 9389 gene locus_tag LOCUS_11170 9021 9389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 9482 10267 gene locus_tag LOCUS_11180 9482 10267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 10515 11477 gene locus_tag LOCUS_11190 10515 11477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 11543 12061 gene locus_tag LOCUS_11200 11543 12061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 12079 13575 gene locus_tag LOCUS_11210 12079 13575 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 protein_id gnl|my_center|LOCUS_11210 13600 14952 gene locus_tag LOCUS_11220 13600 14952 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_11220 14968 16071 gene locus_tag LOCUS_11230 14968 16071 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302559.1 protein_id gnl|my_center|LOCUS_11230 16188 18767 gene locus_tag LOCUS_11240 gene secA 16188 18767 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966131.1 protein_id gnl|my_center|LOCUS_11240 19006 19956 gene locus_tag LOCUS_11250 gene prfB 19006 19956 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181244843.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11250 20010 21227 gene locus_tag LOCUS_11260 20010 21227 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816736.1 protein_id gnl|my_center|LOCUS_11260 21261 22463 gene locus_tag LOCUS_11270 21261 22463 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_11270 22705 23202 gene locus_tag LOCUS_11280 gene vanZ1 22705 23202 CDS product glycopeptide resistance protein VanZ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889012.1 protein_id gnl|my_center|LOCUS_11280 23295 23104 gene locus_tag LOCUS_11290 23295 23104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 >Feature sequence035 1301 387 gene locus_tag LOCUS_11300 1301 387 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964930.1 protein_id gnl|my_center|LOCUS_11300 3573 1522 gene locus_tag LOCUS_11310 3573 1522 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393356.1 protein_id gnl|my_center|LOCUS_11310 5419 3578 gene locus_tag LOCUS_11320 gene ftsH 5419 3578 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966478.1 protein_id gnl|my_center|LOCUS_11320 5962 5435 gene locus_tag LOCUS_11330 gene hpt 5962 5435 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966479.1 protein_id gnl|my_center|LOCUS_11330 7438 5966 gene locus_tag LOCUS_11340 gene tilS 7438 5966 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 protein_id gnl|my_center|LOCUS_11340 8878 7481 gene locus_tag LOCUS_11350 8878 7481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 9458 9120 gene locus_tag LOCUS_11360 9458 9120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 9843 9511 gene locus_tag LOCUS_11370 9843 9511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 10135 9851 gene locus_tag LOCUS_11380 10135 9851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 10430 10191 gene locus_tag LOCUS_11390 10430 10191 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_11390 10792 10520 gene locus_tag LOCUS_11400 10792 10520 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043860.1 protein_id gnl|my_center|LOCUS_11400 12657 10975 gene locus_tag LOCUS_11410 12657 10975 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_11410 13791 12790 gene locus_tag LOCUS_11420 13791 12790 CDS product CotS family spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986383.1 protein_id gnl|my_center|LOCUS_11420 15195 13861 gene locus_tag LOCUS_11430 15195 13861 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_11430 16849 15203 gene locus_tag LOCUS_11440 16849 15203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 17941 16889 gene locus_tag LOCUS_11450 17941 16889 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930566.1 protein_id gnl|my_center|LOCUS_11450 19570 18179 gene locus_tag LOCUS_11460 gene asnS 19570 18179 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_11460 19990 20724 gene locus_tag LOCUS_11470 19990 20724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 21409 20771 gene locus_tag LOCUS_11480 21409 20771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 21533 22072 gene locus_tag LOCUS_11490 21533 22072 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964042.1 protein_id gnl|my_center|LOCUS_11490 22163 22091 gene locus_tag LOCUS_t00080 22163 22091 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence036 47 562 gene locus_tag LOCUS_11500 47 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 763 1053 gene locus_tag LOCUS_11510 763 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1058 1387 gene locus_tag LOCUS_11520 1058 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1483 3402 gene locus_tag LOCUS_11530 1483 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 4052 3399 gene locus_tag LOCUS_11540 4052 3399 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994403.1 protein_id gnl|my_center|LOCUS_11540 4301 5278 gene locus_tag LOCUS_11550 4301 5278 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964837.1 protein_id gnl|my_center|LOCUS_11550 5483 6874 gene locus_tag LOCUS_11560 5483 6874 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776896.1 protein_id gnl|my_center|LOCUS_11560 6958 7884 gene locus_tag LOCUS_11570 6958 7884 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776897.1 protein_id gnl|my_center|LOCUS_11570 7896 8765 gene locus_tag LOCUS_11580 7896 8765 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776898.1 protein_id gnl|my_center|LOCUS_11580 8767 10092 gene locus_tag LOCUS_11590 8767 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 10138 11058 gene locus_tag LOCUS_11600 10138 11058 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287299.1 protein_id gnl|my_center|LOCUS_11600 11262 12725 gene locus_tag LOCUS_11610 gene abnB 11262 12725 CDS product arabinan endo-1,5-alpha-L-arabinosidase AbnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244268.1 protein_id gnl|my_center|LOCUS_11610 12752 14254 gene locus_tag LOCUS_11620 gene abfB 12752 14254 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_11620 14257 14520 gene locus_tag LOCUS_11630 14257 14520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 14525 14722 gene locus_tag LOCUS_11640 14525 14722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 14679 15758 gene locus_tag LOCUS_11650 gene araR 14679 15758 CDS product arabinose utilization transcriptional regulator AraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243070.1 protein_id gnl|my_center|LOCUS_11650 15824 16519 gene locus_tag LOCUS_11660 15824 16519 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129982.1 protein_id gnl|my_center|LOCUS_11660 16583 18082 gene locus_tag LOCUS_11670 gene araA 16583 18082 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229499.1 protein_id gnl|my_center|LOCUS_11670 18157 19143 gene locus_tag LOCUS_11680 18157 19143 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_11680 19396 21000 gene locus_tag LOCUS_11690 19396 21000 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence037 212 2935 gene locus_tag LOCUS_11700 212 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 3041 3886 gene locus_tag LOCUS_11710 3041 3886 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836880.1 protein_id gnl|my_center|LOCUS_11710 4041 4295 gene locus_tag LOCUS_11720 4041 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 4642 5079 gene locus_tag LOCUS_11730 gene mraZ 4642 5079 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565149.1 protein_id gnl|my_center|LOCUS_11730 5093 6034 gene locus_tag LOCUS_11740 gene rsmH 5093 6034 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_11740 6111 6653 gene locus_tag LOCUS_11750 6111 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 6666 8690 gene locus_tag LOCUS_11760 6666 8690 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_11760 8777 10501 gene locus_tag LOCUS_11770 8777 10501 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_11770 10563 11519 gene locus_tag LOCUS_11780 gene mraY 10563 11519 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358738.1 protein_id gnl|my_center|LOCUS_11780 11524 12894 gene locus_tag LOCUS_11790 gene murD 11524 12894 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_11790 12908 13993 gene locus_tag LOCUS_11800 gene spoVE 12908 13993 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_11800 14133 14885 gene locus_tag LOCUS_11810 14133 14885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 15040 16209 gene locus_tag LOCUS_11820 gene ftsZ 15040 16209 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965000.1 protein_id gnl|my_center|LOCUS_11820 16412 17257 gene locus_tag LOCUS_11830 16412 17257 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089438.1 protein_id gnl|my_center|LOCUS_11830 17441 18820 gene locus_tag LOCUS_11840 17441 18820 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860625.1 protein_id gnl|my_center|LOCUS_11840 18860 20053 gene locus_tag LOCUS_11850 18860 20053 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901552.1 protein_id gnl|my_center|LOCUS_11850 20055 21704 gene locus_tag LOCUS_11860 20055 21704 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453968.1 protein_id gnl|my_center|LOCUS_11860 >Feature sequence038 408 695 gene locus_tag LOCUS_11870 408 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 854 1231 gene locus_tag LOCUS_11880 854 1231 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_11880 1224 2126 gene locus_tag LOCUS_11890 1224 2126 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_11890 2101 4272 gene locus_tag LOCUS_11900 2101 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 4842 4288 gene locus_tag LOCUS_11910 4842 4288 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024220.1 protein_id gnl|my_center|LOCUS_11910 5100 5951 gene locus_tag LOCUS_11920 5100 5951 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_11920 5932 6594 gene locus_tag LOCUS_11930 5932 6594 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_11930 6585 7118 gene locus_tag LOCUS_11940 6585 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 7657 8277 gene locus_tag LOCUS_11950 7657 8277 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_11950 8477 9133 gene locus_tag LOCUS_11960 8477 9133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 10058 9216 gene locus_tag LOCUS_11970 10058 9216 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963818.1 protein_id gnl|my_center|LOCUS_11970 10234 11541 gene locus_tag LOCUS_11980 gene eno 10234 11541 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727923.1 protein_id gnl|my_center|LOCUS_11980 11755 12165 gene locus_tag LOCUS_11990 11755 12165 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_11990 12178 12678 gene locus_tag LOCUS_12000 12178 12678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 12665 14320 gene locus_tag LOCUS_12010 12665 14320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 14345 14524 gene locus_tag LOCUS_12020 14345 14524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 14524 15081 gene locus_tag LOCUS_12030 14524 15081 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142413611.1 protein_id gnl|my_center|LOCUS_12030 15115 18129 gene locus_tag LOCUS_12040 15115 18129 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_12040 18150 19409 gene locus_tag LOCUS_12050 18150 19409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 19514 20413 gene locus_tag LOCUS_12060 gene era 19514 20413 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080241.1 protein_id gnl|my_center|LOCUS_12060 20567 20767 gene locus_tag LOCUS_12070 20567 20767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 20709 21449 gene locus_tag LOCUS_12080 gene recO 20709 21449 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230055.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence039 2685 754 gene locus_tag LOCUS_12090 gene lysS 2685 754 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861998.1 protein_id gnl|my_center|LOCUS_12090 3325 2840 gene locus_tag LOCUS_12100 gene greA 3325 2840 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_12100 4397 3438 gene locus_tag LOCUS_12110 gene dusB 4397 3438 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_12110 5344 4472 gene locus_tag LOCUS_12120 5344 4472 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767778.1 protein_id gnl|my_center|LOCUS_12120 6434 5367 gene locus_tag LOCUS_12130 6434 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 7940 6465 gene locus_tag LOCUS_12140 gene cls 7940 6465 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457116.1 protein_id gnl|my_center|LOCUS_12140 8504 8935 gene locus_tag LOCUS_12150 8504 8935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 9492 9019 gene locus_tag LOCUS_12160 9492 9019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 10324 9497 gene locus_tag LOCUS_12170 gene murI 10324 9497 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_12170 11411 10392 gene locus_tag LOCUS_12180 gene pfkA 11411 10392 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_12180 14973 11500 gene locus_tag LOCUS_12190 14973 11500 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_12190 15509 15267 gene locus_tag LOCUS_12200 15509 15267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 16405 15575 gene locus_tag LOCUS_12210 16405 15575 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986367.1 protein_id gnl|my_center|LOCUS_12210 19768 16511 gene locus_tag LOCUS_12220 19768 16511 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943878.1 protein_id gnl|my_center|LOCUS_12220 20132 19785 gene locus_tag LOCUS_12230 20132 19785 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994638.1 protein_id gnl|my_center|LOCUS_12230 <21109 20156 gene locus_tag LOCUS_12240 <21109 20156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679604.1:Rpn family recombination-promoting nuclease/putative transposase >Feature sequence040 330 1697 gene locus_tag LOCUS_12250 330 1697 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359868.1 protein_id gnl|my_center|LOCUS_12250 1840 2880 gene locus_tag LOCUS_12260 1840 2880 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_12260 2904 3752 gene locus_tag LOCUS_12270 2904 3752 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303949.1 protein_id gnl|my_center|LOCUS_12270 3771 4388 gene locus_tag LOCUS_12280 3771 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 4409 5029 gene locus_tag LOCUS_12290 4409 5029 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057475.1 protein_id gnl|my_center|LOCUS_12290 5062 6861 gene locus_tag LOCUS_12300 gene uidA 5062 6861 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583888.1 protein_id gnl|my_center|LOCUS_12300 6861 8576 gene locus_tag LOCUS_12310 6861 8576 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107726402.1 protein_id gnl|my_center|LOCUS_12310 8593 10767 gene locus_tag LOCUS_12320 8593 10767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 10881 11102 gene locus_tag LOCUS_12330 10881 11102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 11195 11671 gene locus_tag LOCUS_12340 11195 11671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 11717 14479 gene locus_tag LOCUS_12350 11717 14479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 16354 14561 gene locus_tag LOCUS_12360 16354 14561 CDS product BlaR1 family beta-lactam sensor/signal transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860827.1 protein_id gnl|my_center|LOCUS_12360 16737 16351 gene locus_tag LOCUS_12370 16737 16351 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417583.1 protein_id gnl|my_center|LOCUS_12370 16896 18914 gene locus_tag LOCUS_12380 16896 18914 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251368.1 protein_id gnl|my_center|LOCUS_12380 19052 19125 gene locus_tag LOCUS_t00090 19052 19125 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 19224 19296 gene locus_tag LOCUS_t00100 19224 19296 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 19323 19398 gene locus_tag LOCUS_t00110 19323 19398 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 19438 19511 gene locus_tag LOCUS_t00120 19438 19511 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 19546 19633 gene locus_tag LOCUS_t00130 19546 19633 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 20157 20372 gene locus_tag LOCUS_12390 20157 20372 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214020.1 protein_id gnl|my_center|LOCUS_12390 >Feature sequence041 6228 1486 gene locus_tag LOCUS_12400 6228 1486 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_12400 6448 6230 gene locus_tag LOCUS_12410 6448 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373720.1 protein_id gnl|my_center|LOCUS_12410 6749 6510 gene locus_tag LOCUS_12420 6749 6510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 8085 7030 gene locus_tag LOCUS_12430 gene ispG 8085 7030 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861462.1 protein_id gnl|my_center|LOCUS_12430 8734 8339 gene locus_tag LOCUS_12440 8734 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 9745 8897 gene locus_tag LOCUS_12450 9745 8897 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680113.1 protein_id gnl|my_center|LOCUS_12450 10833 9742 gene locus_tag LOCUS_12460 gene hisC 10833 9742 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949115.1 protein_id gnl|my_center|LOCUS_12460 12021 10834 gene locus_tag LOCUS_12470 12021 10834 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459580.1 protein_id gnl|my_center|LOCUS_12470 12957 12061 gene locus_tag LOCUS_12480 12957 12061 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054703570.1 protein_id gnl|my_center|LOCUS_12480 14076 12964 gene locus_tag LOCUS_12490 gene prfA 14076 12964 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_12490 15069 14104 gene locus_tag LOCUS_12500 gene prmC 15069 14104 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388509.1 protein_id gnl|my_center|LOCUS_12500 15980 15066 gene locus_tag LOCUS_12510 15980 15066 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421392.1 protein_id gnl|my_center|LOCUS_12510 16285 16085 gene locus_tag LOCUS_12520 gene rpmE 16285 16085 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_12520 16708 16427 gene locus_tag LOCUS_12530 16708 16427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 16990 16784 gene locus_tag LOCUS_12540 16990 16784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 18378 17029 gene locus_tag LOCUS_12550 18378 17029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 18853 20628 gene locus_tag LOCUS_12560 18853 20628 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence042 440 958 gene locus_tag LOCUS_12570 440 958 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966054.1 protein_id gnl|my_center|LOCUS_12570 1028 1981 gene locus_tag LOCUS_12580 1028 1981 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920869.1 protein_id gnl|my_center|LOCUS_12580 2465 1959 gene locus_tag LOCUS_12590 2465 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 2732 4852 gene locus_tag LOCUS_12600 gene htpG 2732 4852 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_12600 5694 5209 gene locus_tag LOCUS_12610 5694 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 6123 6875 gene locus_tag LOCUS_12620 6123 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 6872 7357 gene locus_tag LOCUS_12630 6872 7357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 7376 8785 gene locus_tag LOCUS_12640 7376 8785 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_12640 8794 9948 gene locus_tag LOCUS_12650 8794 9948 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_12650 9941 10705 gene locus_tag LOCUS_12660 gene rluF 9941 10705 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936377.1 protein_id gnl|my_center|LOCUS_12660 10797 12761 gene locus_tag LOCUS_12670 gene ligA 10797 12761 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015784.1 protein_id gnl|my_center|LOCUS_12670 12877 14310 gene locus_tag LOCUS_12680 gene clpX 12877 14310 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_12680 14339 15595 gene locus_tag LOCUS_12690 14339 15595 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987123.1 protein_id gnl|my_center|LOCUS_12690 15731 16756 gene locus_tag LOCUS_12700 15731 16756 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_12700 16783 17220 gene locus_tag LOCUS_12710 16783 17220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 18668 17337 gene locus_tag LOCUS_12720 gene mgtE 18668 17337 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_12720 19739 19113 gene locus_tag LOCUS_12730 19739 19113 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814029.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence043 289 1071 gene locus_tag LOCUS_12740 gene sigG 289 1071 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_12740 1193 1858 gene locus_tag LOCUS_12750 1193 1858 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937441.1 protein_id gnl|my_center|LOCUS_12750 1855 2118 gene locus_tag LOCUS_12760 1855 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 2568 2134 gene locus_tag LOCUS_12770 2568 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 2750 3466 gene locus_tag LOCUS_12780 gene rgbR 2750 3466 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_12780 3627 4403 gene locus_tag LOCUS_12790 3627 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839849.1 protein_id gnl|my_center|LOCUS_12790 4440 4637 gene locus_tag LOCUS_12800 4440 4637 CDS product DUF6485 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106005441.1 protein_id gnl|my_center|LOCUS_12800 4675 6282 gene locus_tag LOCUS_12810 4675 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 6294 6458 gene locus_tag LOCUS_12820 6294 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 6455 9274 gene locus_tag LOCUS_12830 6455 9274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 9276 12068 gene locus_tag LOCUS_12840 9276 12068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 12087 12392 gene locus_tag LOCUS_12850 12087 12392 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871778.1 protein_id gnl|my_center|LOCUS_12850 12409 13026 gene locus_tag LOCUS_12860 gene pth 12409 13026 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_12860 13065 16424 gene locus_tag LOCUS_12870 gene mfd 13065 16424 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048383.1 protein_id gnl|my_center|LOCUS_12870 16583 17722 gene locus_tag LOCUS_12880 16583 17722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 18306 17821 gene locus_tag LOCUS_12890 18306 17821 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435157.1 protein_id gnl|my_center|LOCUS_12890 19551 18349 gene locus_tag LOCUS_12900 19551 18349 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_12900 19706 20053 gene locus_tag LOCUS_12910 19706 20053 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence044 1259 72 gene locus_tag LOCUS_12920 1259 72 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088391.1 protein_id gnl|my_center|LOCUS_12920 1423 1496 gene locus_tag LOCUS_t00140 1423 1496 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1599 2879 gene locus_tag LOCUS_12930 1599 2879 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_12930 2982 3416 gene locus_tag LOCUS_12940 2982 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 3492 4340 gene locus_tag LOCUS_12950 3492 4340 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_12950 4378 4866 gene locus_tag LOCUS_12960 4378 4866 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723427.1 protein_id gnl|my_center|LOCUS_12960 4853 6061 gene locus_tag LOCUS_12970 4853 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 6052 6789 gene locus_tag LOCUS_12980 6052 6789 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943614.1 protein_id gnl|my_center|LOCUS_12980 6782 7609 gene locus_tag LOCUS_12990 6782 7609 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_12990 7704 8573 gene locus_tag LOCUS_13000 7704 8573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 9551 11269 gene locus_tag LOCUS_13010 gene ilvB 9551 11269 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458814.1 protein_id gnl|my_center|LOCUS_13010 11286 11795 gene locus_tag LOCUS_13020 gene ilvN 11286 11795 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006862451.1 protein_id gnl|my_center|LOCUS_13020 12037 12525 gene locus_tag LOCUS_13030 12037 12525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 12565 12960 gene locus_tag LOCUS_13040 12565 12960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 12961 13398 gene locus_tag LOCUS_13050 12961 13398 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964324.1 protein_id gnl|my_center|LOCUS_13050 13991 14395 gene locus_tag LOCUS_13060 13991 14395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 14434 15231 gene locus_tag LOCUS_13070 14434 15231 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105572.1 protein_id gnl|my_center|LOCUS_13070 15233 16108 gene locus_tag LOCUS_13080 gene hslO 15233 16108 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_13080 16196 18112 gene locus_tag LOCUS_13090 16196 18112 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_13090 18109 19143 gene locus_tag LOCUS_13100 18109 19143 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948644.1 protein_id gnl|my_center|LOCUS_13100 19222 19845 gene locus_tag LOCUS_13110 19222 19845 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861582.1 protein_id gnl|my_center|LOCUS_13110 >Feature sequence045 650 210 gene locus_tag LOCUS_13120 650 210 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812737.1 protein_id gnl|my_center|LOCUS_13120 2702 669 gene locus_tag LOCUS_13130 2702 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 3909 2854 gene locus_tag LOCUS_13140 3909 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 4911 3949 gene locus_tag LOCUS_13150 4911 3949 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_13150 6568 4925 gene locus_tag LOCUS_13160 6568 4925 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329642.1 protein_id gnl|my_center|LOCUS_13160 8326 6572 gene locus_tag LOCUS_13170 8326 6572 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989902.1 protein_id gnl|my_center|LOCUS_13170 10490 8436 gene locus_tag LOCUS_13180 10490 8436 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262517.1 protein_id gnl|my_center|LOCUS_13180 12469 10487 gene locus_tag LOCUS_13190 gene pulA 12469 10487 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994410.1 protein_id gnl|my_center|LOCUS_13190 13672 12800 gene locus_tag LOCUS_13200 13672 12800 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360454.1 protein_id gnl|my_center|LOCUS_13200 15054 13675 gene locus_tag LOCUS_13210 15054 13675 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113788.1 protein_id gnl|my_center|LOCUS_13210 16308 15070 gene locus_tag LOCUS_13220 16308 15070 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399406.1 protein_id gnl|my_center|LOCUS_13220 16574 17572 gene locus_tag LOCUS_13230 gene cytR 16574 17572 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421065.1 protein_id gnl|my_center|LOCUS_13230 18291 17605 gene locus_tag LOCUS_13240 18291 17605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 19197 18403 gene locus_tag LOCUS_13250 19197 18403 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044986.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence046 157 3072 gene locus_tag LOCUS_13260 gene infB 157 3072 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460393.1 protein_id gnl|my_center|LOCUS_13260 3148 3522 gene locus_tag LOCUS_13270 gene rbfA 3148 3522 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_13270 3524 4489 gene locus_tag LOCUS_13280 3524 4489 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016831.1 protein_id gnl|my_center|LOCUS_13280 4501 5427 gene locus_tag LOCUS_13290 gene truB 4501 5427 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965111.1 protein_id gnl|my_center|LOCUS_13290 5433 6326 gene locus_tag LOCUS_13300 5433 6326 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_13300 6461 6727 gene locus_tag LOCUS_13310 gene rpsO 6461 6727 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419491.1 protein_id gnl|my_center|LOCUS_13310 7019 9106 gene locus_tag LOCUS_13320 gene pnp 7019 9106 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_13320 9224 9640 gene locus_tag LOCUS_13330 9224 9640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 10598 9573 gene locus_tag LOCUS_13340 10598 9573 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986156.1 protein_id gnl|my_center|LOCUS_13340 10782 13433 gene locus_tag LOCUS_13350 gene mutS 10782 13433 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047675.1 protein_id gnl|my_center|LOCUS_13350 13506 15524 gene locus_tag LOCUS_13360 gene mutL 13506 15524 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861409.1 protein_id gnl|my_center|LOCUS_13360 15525 16466 gene locus_tag LOCUS_13370 gene miaA 15525 16466 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_13370 16556 17866 gene locus_tag LOCUS_13380 16556 17866 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_13380 17937 19157 gene locus_tag LOCUS_13390 17937 19157 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence047 179 895 gene locus_tag LOCUS_13400 179 895 CDS product genetic competence negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235392.1 protein_id gnl|my_center|LOCUS_13400 1194 985 gene locus_tag LOCUS_13410 1194 985 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809809.1 protein_id gnl|my_center|LOCUS_13410 2824 1706 gene locus_tag LOCUS_13420 2824 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 3304 3609 gene locus_tag LOCUS_13430 3304 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 3642 4184 gene locus_tag LOCUS_13440 3642 4184 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_13440 4293 4829 gene locus_tag LOCUS_13450 4293 4829 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_13450 5844 4948 gene locus_tag LOCUS_13460 5844 4948 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949138.1 protein_id gnl|my_center|LOCUS_13460 6088 7296 gene locus_tag LOCUS_13470 6088 7296 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_13470 7568 7314 gene locus_tag LOCUS_13480 7568 7314 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003394408.1 protein_id gnl|my_center|LOCUS_13480 8481 7714 gene locus_tag LOCUS_13490 8481 7714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 9576 8566 gene locus_tag LOCUS_13500 gene spoIID 9576 8566 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272786.1 protein_id gnl|my_center|LOCUS_13500 10292 9621 gene locus_tag LOCUS_13510 10292 9621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 12778 10304 gene locus_tag LOCUS_13520 12778 10304 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_13520 15951 12781 gene locus_tag LOCUS_13530 gene ileS 15951 12781 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_13530 17702 16833 gene locus_tag LOCUS_13540 17702 16833 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102407668.1 protein_id gnl|my_center|LOCUS_13540 18027 17809 gene locus_tag LOCUS_13550 18027 17809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 19101 18148 gene locus_tag LOCUS_13560 19101 18148 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015263273.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence048 659 1663 gene locus_tag LOCUS_13570 659 1663 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877170.1 protein_id gnl|my_center|LOCUS_13570 1796 3325 gene locus_tag LOCUS_13580 1796 3325 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_13580 3325 4413 gene locus_tag LOCUS_13590 3325 4413 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_13590 4415 5464 gene locus_tag LOCUS_13600 gene yjfF 4415 5464 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 protein_id gnl|my_center|LOCUS_13600 5990 7276 gene locus_tag LOCUS_13610 5990 7276 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_13610 8571 7564 gene locus_tag LOCUS_13620 8571 7564 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262368.1 protein_id gnl|my_center|LOCUS_13620 8840 9715 gene locus_tag LOCUS_13630 8840 9715 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 protein_id gnl|my_center|LOCUS_13630 9986 9747 gene locus_tag LOCUS_13640 9986 9747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 10452 11441 gene locus_tag LOCUS_13650 gene dhaK 10452 11441 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166915.1 protein_id gnl|my_center|LOCUS_13650 11459 12079 gene locus_tag LOCUS_13660 gene dhaL 11459 12079 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257203.1 protein_id gnl|my_center|LOCUS_13660 12093 12473 gene locus_tag LOCUS_13670 12093 12473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 12772 12578 gene locus_tag LOCUS_13680 12772 12578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 13155 12796 gene locus_tag LOCUS_13690 13155 12796 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399582.1 protein_id gnl|my_center|LOCUS_13690 14454 13159 gene locus_tag LOCUS_13700 14454 13159 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948740.1 protein_id gnl|my_center|LOCUS_13700 15907 14471 gene locus_tag LOCUS_13710 15907 14471 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948739.1 protein_id gnl|my_center|LOCUS_13710 16735 16025 gene locus_tag LOCUS_13720 16735 16025 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103743.1 protein_id gnl|my_center|LOCUS_13720 18250 16754 gene locus_tag LOCUS_13730 gene glpK 18250 16754 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 protein_id gnl|my_center|LOCUS_13730 <18841 18342 gene locus_tag LOCUS_13740 <18841 18342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001116197.1:glycerol-3-phosphate responsive antiterminator >Feature sequence049 977 1924 gene locus_tag LOCUS_13750 977 1924 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125980453.1 protein_id gnl|my_center|LOCUS_13750 1914 2303 gene locus_tag LOCUS_13760 1914 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 2408 3499 gene locus_tag LOCUS_13770 2408 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 3631 4977 gene locus_tag LOCUS_13780 3631 4977 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965627.1 protein_id gnl|my_center|LOCUS_13780 4978 5721 gene locus_tag LOCUS_13790 4978 5721 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101055.1 protein_id gnl|my_center|LOCUS_13790 5699 6946 gene locus_tag LOCUS_13800 5699 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 6936 8228 gene locus_tag LOCUS_13810 6936 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 8300 9694 gene locus_tag LOCUS_13820 8300 9694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 9748 11154 gene locus_tag LOCUS_13830 9748 11154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 11323 12648 gene locus_tag LOCUS_13840 11323 12648 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290101.1 protein_id gnl|my_center|LOCUS_13840 13338 12742 gene locus_tag LOCUS_13850 13338 12742 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392905.1 protein_id gnl|my_center|LOCUS_13850 13698 13342 gene locus_tag LOCUS_13860 13698 13342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 14077 14151 gene locus_tag LOCUS_t00150 14077 14151 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 14306 14863 gene locus_tag LOCUS_13870 14306 14863 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_13870 15092 16987 gene locus_tag LOCUS_13880 gene asnB 15092 16987 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288533.1 protein_id gnl|my_center|LOCUS_13880 17089 18453 gene locus_tag LOCUS_13890 gene spoVE 17089 18453 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753520.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence050 924 1463 gene locus_tag LOCUS_13900 gene moaC 924 1463 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306447.1 protein_id gnl|my_center|LOCUS_13900 1491 2063 gene locus_tag LOCUS_13910 1491 2063 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_13910 2051 3082 gene locus_tag LOCUS_13920 gene moaA 2051 3082 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371204.1 protein_id gnl|my_center|LOCUS_13920 3125 3562 gene locus_tag LOCUS_13930 3125 3562 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393623.1 protein_id gnl|my_center|LOCUS_13930 3555 4502 gene locus_tag LOCUS_13940 3555 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 4506 5456 gene locus_tag LOCUS_13950 gene prmA 4506 5456 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385115.1 protein_id gnl|my_center|LOCUS_13950 5824 6564 gene locus_tag LOCUS_13960 5824 6564 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_13960 6772 7929 gene locus_tag LOCUS_13970 6772 7929 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_13970 7979 9163 gene locus_tag LOCUS_13980 gene thiI 7979 9163 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_13980 9506 9273 gene locus_tag LOCUS_13990 9506 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 9642 10925 gene locus_tag LOCUS_14000 gene mtaB 9642 10925 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_14000 11091 11354 gene locus_tag LOCUS_14010 11091 11354 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_14010 11371 11814 gene locus_tag LOCUS_14020 gene ruvX 11371 11814 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 protein_id gnl|my_center|LOCUS_14020 11854 12114 gene locus_tag LOCUS_14030 11854 12114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 12165 12626 gene locus_tag LOCUS_14040 12165 12626 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419428.1 protein_id gnl|my_center|LOCUS_14040 12643 14313 gene locus_tag LOCUS_14050 12643 14313 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_14050 14423 15091 gene locus_tag LOCUS_14060 14423 15091 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288107.1 protein_id gnl|my_center|LOCUS_14060 15143 16384 gene locus_tag LOCUS_14070 15143 16384 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_14070 16767 16558 gene locus_tag LOCUS_14080 16767 16558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 16884 17150 gene locus_tag LOCUS_14090 16884 17150 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272532.1 protein_id gnl|my_center|LOCUS_14090 17134 17445 gene locus_tag LOCUS_14100 17134 17445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 >Feature sequence051 <1 811 gene locus_tag LOCUS_14110 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011921665.1:ABC transporter ATP-binding protein 808 1581 gene locus_tag LOCUS_14120 808 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1852 2160 gene locus_tag LOCUS_14130 1852 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 2244 4262 gene locus_tag LOCUS_14140 2244 4262 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898067.1 protein_id gnl|my_center|LOCUS_14140 4259 4744 gene locus_tag LOCUS_14150 4259 4744 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_14150 4757 5350 gene locus_tag LOCUS_14160 4757 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 5375 6346 gene locus_tag LOCUS_14170 5375 6346 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439726.1 protein_id gnl|my_center|LOCUS_14170 6339 6662 gene locus_tag LOCUS_14180 6339 6662 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292844.1 protein_id gnl|my_center|LOCUS_14180 6662 8428 gene locus_tag LOCUS_14190 6662 8428 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426762.1 protein_id gnl|my_center|LOCUS_14190 8429 9799 gene locus_tag LOCUS_14200 8429 9799 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422669.1 protein_id gnl|my_center|LOCUS_14200 10020 10676 gene locus_tag LOCUS_14210 10020 10676 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891221.1 protein_id gnl|my_center|LOCUS_14210 11646 12854 gene locus_tag LOCUS_14220 11646 12854 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_14220 12848 13990 gene locus_tag LOCUS_14230 gene glgD 12848 13990 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_14230 15019 15999 gene locus_tag LOCUS_14240 15019 15999 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062822608.1 protein_id gnl|my_center|LOCUS_14240 15996 17159 gene locus_tag LOCUS_14250 15996 17159 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964048.1 protein_id gnl|my_center|LOCUS_14250 17309 17728 gene locus_tag LOCUS_14260 gene rpsL 17309 17728 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence052 556 1782 gene locus_tag LOCUS_14270 gene coaBC 556 1782 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_14270 1915 2646 gene locus_tag LOCUS_14280 1915 2646 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287046.1 protein_id gnl|my_center|LOCUS_14280 2630 3406 gene locus_tag LOCUS_14290 2630 3406 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578368.1 protein_id gnl|my_center|LOCUS_14290 3545 4300 gene locus_tag LOCUS_14300 3545 4300 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242850.1 protein_id gnl|my_center|LOCUS_14300 5543 4437 gene locus_tag LOCUS_14310 5543 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 5840 6688 gene locus_tag LOCUS_14320 gene yidA 5840 6688 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723485.1 protein_id gnl|my_center|LOCUS_14320 6682 7509 gene locus_tag LOCUS_14330 6682 7509 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706548.1 protein_id gnl|my_center|LOCUS_14330 7607 8503 gene locus_tag LOCUS_14340 7607 8503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 8609 9322 gene locus_tag LOCUS_14350 8609 9322 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903444.1 protein_id gnl|my_center|LOCUS_14350 9306 10130 gene locus_tag LOCUS_14360 9306 10130 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261958.1 protein_id gnl|my_center|LOCUS_14360 10367 12139 gene locus_tag LOCUS_14370 10367 12139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 12320 12454 gene locus_tag LOCUS_14380 12320 12454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 13001 13621 gene locus_tag LOCUS_14390 13001 13621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 13626 14549 gene locus_tag LOCUS_14400 13626 14549 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674458.1 protein_id gnl|my_center|LOCUS_14400 14670 15371 gene locus_tag LOCUS_14410 14670 15371 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271956.1 protein_id gnl|my_center|LOCUS_14410 15394 16485 gene locus_tag LOCUS_14420 gene trpS 15394 16485 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence053 13 279 gene locus_tag LOCUS_14430 13 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 341 505 gene locus_tag LOCUS_14440 341 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1200 448 gene locus_tag LOCUS_14450 1200 448 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890775.1 protein_id gnl|my_center|LOCUS_14450 4327 1289 gene locus_tag LOCUS_14460 4327 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 5720 4344 gene locus_tag LOCUS_14470 5720 4344 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094729231.1 protein_id gnl|my_center|LOCUS_14470 7221 5821 gene locus_tag LOCUS_14480 7221 5821 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_14480 8194 7211 gene locus_tag LOCUS_14490 8194 7211 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363756.1 protein_id gnl|my_center|LOCUS_14490 8683 8309 gene locus_tag LOCUS_14500 8683 8309 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680926.1 protein_id gnl|my_center|LOCUS_14500 9408 8731 gene locus_tag LOCUS_14510 9408 8731 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868696.1 protein_id gnl|my_center|LOCUS_14510 9685 10596 gene locus_tag LOCUS_14520 9685 10596 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389548.1 protein_id gnl|my_center|LOCUS_14520 10654 11745 gene locus_tag LOCUS_14530 10654 11745 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861645.1 protein_id gnl|my_center|LOCUS_14530 13721 11766 gene locus_tag LOCUS_14540 gene metG 13721 11766 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_14540 14815 14171 gene locus_tag LOCUS_14550 14815 14171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 16979 14841 gene locus_tag LOCUS_14560 16979 14841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence054 575 1276 gene locus_tag LOCUS_14570 575 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 3449 1449 gene locus_tag LOCUS_14580 3449 1449 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989492.1 protein_id gnl|my_center|LOCUS_14580 3689 4570 gene locus_tag LOCUS_14590 3689 4570 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890955.1 protein_id gnl|my_center|LOCUS_14590 5509 4625 gene locus_tag LOCUS_14600 5509 4625 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989491.1 protein_id gnl|my_center|LOCUS_14600 6083 6958 gene locus_tag LOCUS_14610 6083 6958 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704391.1 protein_id gnl|my_center|LOCUS_14610 7036 8223 gene locus_tag LOCUS_14620 7036 8223 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455016.1 protein_id gnl|my_center|LOCUS_14620 8324 9085 gene locus_tag LOCUS_14630 gene aroD 8324 9085 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897376.1 protein_id gnl|my_center|LOCUS_14630 9156 9647 gene locus_tag LOCUS_14640 9156 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14640 9649 10941 gene locus_tag LOCUS_14650 9649 10941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14650 10961 11971 gene locus_tag LOCUS_14660 10961 11971 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310926.1 protein_id gnl|my_center|LOCUS_14660 12436 12750 gene locus_tag LOCUS_14670 12436 12750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 12762 15392 gene locus_tag LOCUS_14680 12762 15392 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_14680 15595 15395 gene locus_tag LOCUS_14690 15595 15395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 15834 15592 gene locus_tag LOCUS_14700 15834 15592 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115145.1 protein_id gnl|my_center|LOCUS_14700 16151 16885 gene locus_tag LOCUS_14710 16151 16885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence055 2106 1135 gene locus_tag LOCUS_14720 gene dcm 2106 1135 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734158.1 protein_id gnl|my_center|LOCUS_14720 2695 2201 gene locus_tag LOCUS_14730 2695 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 3132 2692 gene locus_tag LOCUS_14740 3132 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 3682 3143 gene locus_tag LOCUS_14750 3682 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 4040 3900 gene locus_tag LOCUS_14760 4040 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 4809 4378 gene locus_tag LOCUS_14770 4809 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 5113 4871 gene locus_tag LOCUS_14780 5113 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 6476 5100 gene locus_tag LOCUS_14790 6476 5100 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 protein_id gnl|my_center|LOCUS_14790 6738 6457 gene locus_tag LOCUS_14800 6738 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 9144 6877 gene locus_tag LOCUS_14810 9144 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 9576 9728 gene locus_tag LOCUS_14820 9576 9728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 9712 10095 gene locus_tag LOCUS_14830 9712 10095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 10085 11206 gene locus_tag LOCUS_14840 10085 11206 CDS product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144597911.1 protein_id gnl|my_center|LOCUS_14840 11221 11784 gene locus_tag LOCUS_14850 11221 11784 CDS product DUF2815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399690.1 protein_id gnl|my_center|LOCUS_14850 11864 12454 gene locus_tag LOCUS_14860 11864 12454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 12515 14518 gene locus_tag LOCUS_14870 12515 14518 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 protein_id gnl|my_center|LOCUS_14870 <16977 14564 gene locus_tag LOCUS_14880 <16977 14564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048121910.1:HEAT repeat domain-containing protein >Feature sequence056 4360 3482 gene locus_tag LOCUS_14890 4360 3482 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436797.1 protein_id gnl|my_center|LOCUS_14890 5035 4379 gene locus_tag LOCUS_14900 5035 4379 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418257.1 protein_id gnl|my_center|LOCUS_14900 6516 5128 gene locus_tag LOCUS_14910 6516 5128 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049163295.1 protein_id gnl|my_center|LOCUS_14910 7259 6567 gene locus_tag LOCUS_14920 7259 6567 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_14920 8307 7252 gene locus_tag LOCUS_14930 8307 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 8592 9446 gene locus_tag LOCUS_14940 8592 9446 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679655.1 protein_id gnl|my_center|LOCUS_14940 10700 9513 gene locus_tag LOCUS_14950 gene metK 10700 9513 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_14950 12426 11134 gene locus_tag LOCUS_14960 12426 11134 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_14960 13071 12505 gene locus_tag LOCUS_14970 13071 12505 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_14970 13540 13127 gene locus_tag LOCUS_14980 13540 13127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 14208 13660 gene locus_tag LOCUS_14990 14208 13660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 14372 15607 gene locus_tag LOCUS_15000 14372 15607 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462038.1 protein_id gnl|my_center|LOCUS_15000 15700 16563 gene locus_tag LOCUS_15010 15700 16563 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430012.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence057 2955 670 gene locus_tag LOCUS_15020 2955 670 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944693.1 protein_id gnl|my_center|LOCUS_15020 4377 2983 gene locus_tag LOCUS_15030 gene scfB 4377 2983 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_15030 4643 4500 gene locus_tag LOCUS_15040 gene scfA 4643 4500 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_15040 5109 4723 gene locus_tag LOCUS_15050 5109 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 5803 5261 gene locus_tag LOCUS_15060 gene spoVT 5803 5261 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_15060 7703 5949 gene locus_tag LOCUS_15070 7703 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 9616 7988 gene locus_tag LOCUS_15080 9616 7988 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_15080 9892 10533 gene locus_tag LOCUS_15090 9892 10533 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865105.1 protein_id gnl|my_center|LOCUS_15090 10602 11519 gene locus_tag LOCUS_15100 10602 11519 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546354.1 protein_id gnl|my_center|LOCUS_15100 14735 11523 gene locus_tag LOCUS_15110 14735 11523 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964141.1 protein_id gnl|my_center|LOCUS_15110 15449 14745 gene locus_tag LOCUS_15120 15449 14745 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721621.1 protein_id gnl|my_center|LOCUS_15120 15782 15901 gene locus_tag LOCUS_15130 15782 15901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 16863 15943 gene locus_tag LOCUS_15140 16863 15943 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434114.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence058 34 345 gene locus_tag LOCUS_15150 34 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 959 465 gene locus_tag LOCUS_15160 959 465 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547510.1 protein_id gnl|my_center|LOCUS_15160 1402 956 gene locus_tag LOCUS_15170 1402 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 2792 1503 gene locus_tag LOCUS_15180 gene aroA 2792 1503 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943243.1 protein_id gnl|my_center|LOCUS_15180 3901 2804 gene locus_tag LOCUS_15190 gene tyrA 3901 2804 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228123.1 protein_id gnl|my_center|LOCUS_15190 4167 6275 gene locus_tag LOCUS_15200 4167 6275 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721318.1 protein_id gnl|my_center|LOCUS_15200 6427 7629 gene locus_tag LOCUS_15210 6427 7629 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_15210 7712 9331 gene locus_tag LOCUS_15220 7712 9331 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_15220 9328 10467 gene locus_tag LOCUS_15230 9328 10467 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_15230 10467 11408 gene locus_tag LOCUS_15240 10467 11408 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_15240 11527 12306 gene locus_tag LOCUS_15250 gene udp 11527 12306 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_15250 12469 13134 gene locus_tag LOCUS_15260 gene deoC 12469 13134 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439345.1 protein_id gnl|my_center|LOCUS_15260 13148 13591 gene locus_tag LOCUS_15270 13148 13591 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357963.1 protein_id gnl|my_center|LOCUS_15270 13616 14806 gene locus_tag LOCUS_15280 gene deoB 13616 14806 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046067.1 protein_id gnl|my_center|LOCUS_15280 14916 15644 gene locus_tag LOCUS_15290 14916 15644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 16582 15749 gene locus_tag LOCUS_15300 16582 15749 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986426.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence059 593 1723 gene locus_tag LOCUS_15310 gene recA 593 1723 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_15310 1720 2343 gene locus_tag LOCUS_15320 1720 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 2425 3984 gene locus_tag LOCUS_15330 gene rny 2425 3984 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986783.1 protein_id gnl|my_center|LOCUS_15330 4200 4739 gene locus_tag LOCUS_15340 gene nudF 4200 4739 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398600.1 protein_id gnl|my_center|LOCUS_15340 4810 5349 gene locus_tag LOCUS_15350 4810 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 6624 5338 gene locus_tag LOCUS_15360 gene spoVB 6624 5338 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964335.1 protein_id gnl|my_center|LOCUS_15360 6874 7329 gene locus_tag LOCUS_15370 6874 7329 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_15370 7382 8575 gene locus_tag LOCUS_15380 gene nifS 7382 8575 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_15380 8667 9110 gene locus_tag LOCUS_15390 gene nifU 8667 9110 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438275.1 protein_id gnl|my_center|LOCUS_15390 9110 10192 gene locus_tag LOCUS_15400 gene mnmA 9110 10192 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_15400 10189 11025 gene locus_tag LOCUS_15410 10189 11025 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_15410 11223 12242 gene locus_tag LOCUS_15420 gene gap 11223 12242 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_15420 12498 13697 gene locus_tag LOCUS_15430 12498 13697 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_15430 13987 14736 gene locus_tag LOCUS_15440 gene tpiA 13987 14736 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_15440 15911 14835 gene locus_tag LOCUS_15450 15911 14835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 >Feature sequence060 55 849 gene locus_tag LOCUS_15460 55 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 2304 928 gene locus_tag LOCUS_15470 2304 928 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_15470 2633 3766 gene locus_tag LOCUS_15480 2633 3766 CDS product DUF4317 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964047.1 protein_id gnl|my_center|LOCUS_15480 4113 4568 gene locus_tag LOCUS_15490 4113 4568 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969062.1 protein_id gnl|my_center|LOCUS_15490 4565 7009 gene locus_tag LOCUS_15500 4565 7009 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 protein_id gnl|my_center|LOCUS_15500 7002 8825 gene locus_tag LOCUS_15510 7002 8825 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_15510 9225 9503 gene locus_tag LOCUS_15520 9225 9503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 9613 10584 gene locus_tag LOCUS_15530 9613 10584 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062822608.1 protein_id gnl|my_center|LOCUS_15530 10562 11242 gene locus_tag LOCUS_15540 10562 11242 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459494.1 protein_id gnl|my_center|LOCUS_15540 11239 12081 gene locus_tag LOCUS_15550 11239 12081 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943877.1 protein_id gnl|my_center|LOCUS_15550 12260 13006 gene locus_tag LOCUS_15560 12260 13006 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020493338.1 protein_id gnl|my_center|LOCUS_15560 12999 15617 gene locus_tag LOCUS_15570 12999 15617 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814229.1 protein_id gnl|my_center|LOCUS_15570 15734 16405 gene locus_tag LOCUS_15580 15734 16405 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence061 <1 1372 gene locus_tag LOCUS_15590 <1 1372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964065.1:L,D-transpeptidase family protein 1407 2546 gene locus_tag LOCUS_15600 gene tgt 1407 2546 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_15600 2663 2941 gene locus_tag LOCUS_15610 2663 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 3382 4467 gene locus_tag LOCUS_15620 gene leuB 3382 4467 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267364.1 protein_id gnl|my_center|LOCUS_15620 4502 6175 gene locus_tag LOCUS_15630 gene ilvD 4502 6175 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_15630 6259 7935 gene locus_tag LOCUS_15640 gene ilvB 6259 7935 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_15640 8007 9089 gene locus_tag LOCUS_15650 gene serC 8007 9089 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_15650 9091 10260 gene locus_tag LOCUS_15660 9091 10260 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_15660 10301 10957 gene locus_tag LOCUS_15670 10301 10957 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_15670 11017 12213 gene locus_tag LOCUS_15680 11017 12213 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_15680 12345 12983 gene locus_tag LOCUS_15690 12345 12983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 14396 13098 gene locus_tag LOCUS_15700 14396 13098 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_15700 14500 15852 gene locus_tag LOCUS_15710 gene mgtE 14500 15852 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680769.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence062 3296 1818 gene locus_tag LOCUS_15720 3296 1818 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890565.1 protein_id gnl|my_center|LOCUS_15720 3527 4222 gene locus_tag LOCUS_15730 3527 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 4309 5673 gene locus_tag LOCUS_15740 4309 5673 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_15740 6084 6011 gene locus_tag LOCUS_t00160 6084 6011 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9192 6256 gene locus_tag LOCUS_15750 9192 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 10225 9293 gene locus_tag LOCUS_15760 10225 9293 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_15760 10617 10357 gene locus_tag LOCUS_15770 10617 10357 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_15770 11573 10614 gene locus_tag LOCUS_15780 gene whiA 11573 10614 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357358.1 protein_id gnl|my_center|LOCUS_15780 12456 11578 gene locus_tag LOCUS_15790 gene rapZ 12456 11578 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_15790 13377 12460 gene locus_tag LOCUS_15800 gene murB 13377 12460 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_15800 13643 15025 gene locus_tag LOCUS_15810 13643 15025 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_15810 15301 15606 gene locus_tag LOCUS_15820 15301 15606 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811036.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence063 57 593 gene locus_tag LOCUS_15830 57 593 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_15830 617 1546 gene locus_tag LOCUS_15840 gene pyrB 617 1546 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_15840 1598 2044 gene locus_tag LOCUS_15850 1598 2044 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_15850 3155 2121 gene locus_tag LOCUS_15860 3155 2121 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_15860 4499 3651 gene locus_tag LOCUS_15870 4499 3651 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_15870 5129 4593 gene locus_tag LOCUS_15880 gene rnhA 5129 4593 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705464.1 protein_id gnl|my_center|LOCUS_15880 5932 5222 gene locus_tag LOCUS_15890 5932 5222 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815292.1 protein_id gnl|my_center|LOCUS_15890 7297 5954 gene locus_tag LOCUS_15900 7297 5954 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_15900 8135 7314 gene locus_tag LOCUS_15910 8135 7314 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016086425.1 protein_id gnl|my_center|LOCUS_15910 10333 8861 gene locus_tag LOCUS_15920 gene spoIVA 10333 8861 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944577.1 protein_id gnl|my_center|LOCUS_15920 11457 10435 gene locus_tag LOCUS_15930 11457 10435 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_15930 12121 11462 gene locus_tag LOCUS_15940 gene plsY 12121 11462 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_15940 13454 12126 gene locus_tag LOCUS_15950 gene der 13454 12126 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_15950 14853 13540 gene locus_tag LOCUS_15960 14853 13540 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965017.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence064 1350 520 gene locus_tag LOCUS_15970 1350 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 2189 1371 gene locus_tag LOCUS_15980 2189 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 2734 2195 gene locus_tag LOCUS_15990 2734 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 4572 2863 gene locus_tag LOCUS_16000 4572 2863 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_16000 6471 4585 gene locus_tag LOCUS_16010 gene nuoF 6471 4585 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393387.1 protein_id gnl|my_center|LOCUS_16010 6996 6523 gene locus_tag LOCUS_16020 gene nuoE 6996 6523 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081672.1 protein_id gnl|my_center|LOCUS_16020 7679 7302 gene locus_tag LOCUS_16030 7679 7302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 7957 8649 gene locus_tag LOCUS_16040 7957 8649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 11243 8718 gene locus_tag LOCUS_16050 11243 8718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 13437 11335 gene locus_tag LOCUS_16060 13437 11335 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_16060 13603 14208 gene locus_tag LOCUS_16070 13603 14208 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048232.1 protein_id gnl|my_center|LOCUS_16070 14350 15333 gene locus_tag LOCUS_16080 14350 15333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 >Feature sequence065 995 159 gene locus_tag LOCUS_16090 995 159 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_16090 1170 997 gene locus_tag LOCUS_16100 1170 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 2053 1193 gene locus_tag LOCUS_16110 2053 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 3534 2122 gene locus_tag LOCUS_16120 3534 2122 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100875.1 protein_id gnl|my_center|LOCUS_16120 5121 3565 gene locus_tag LOCUS_16130 5121 3565 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233752.1 protein_id gnl|my_center|LOCUS_16130 7553 5124 gene locus_tag LOCUS_16140 7553 5124 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476221.1 protein_id gnl|my_center|LOCUS_16140 9594 7669 gene locus_tag LOCUS_16150 gene ftsH 9594 7669 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_16150 12374 9759 gene locus_tag LOCUS_16160 12374 9759 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949094.1 protein_id gnl|my_center|LOCUS_16160 13989 12655 gene locus_tag LOCUS_16170 gene gdhA 13989 12655 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_16170 14411 14154 gene locus_tag LOCUS_16180 14411 14154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 14772 14380 gene locus_tag LOCUS_16190 14772 14380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 15725 14901 gene locus_tag LOCUS_16200 15725 14901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence066 508 53 gene locus_tag LOCUS_16210 508 53 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288826.1 protein_id gnl|my_center|LOCUS_16210 1628 525 gene locus_tag LOCUS_16220 gene ulaG 1628 525 CDS product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298012.1 protein_id gnl|my_center|LOCUS_16220 3927 1918 gene locus_tag LOCUS_16230 gene ftsH 3927 1918 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048280.1 protein_id gnl|my_center|LOCUS_16230 4638 6110 gene locus_tag LOCUS_16240 4638 6110 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743581.1 protein_id gnl|my_center|LOCUS_16240 6353 7966 gene locus_tag LOCUS_16250 6353 7966 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_16250 8597 8046 gene locus_tag LOCUS_16260 8597 8046 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_16260 9543 8602 gene locus_tag LOCUS_16270 9543 8602 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948398.1 protein_id gnl|my_center|LOCUS_16270 9695 9814 gene locus_tag LOCUS_16280 9695 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 10026 11747 gene locus_tag LOCUS_16290 10026 11747 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_16290 12381 11896 gene locus_tag LOCUS_16300 12381 11896 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140618.1 protein_id gnl|my_center|LOCUS_16300 12628 12374 gene locus_tag LOCUS_16310 12628 12374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 14860 12932 gene locus_tag LOCUS_16320 gene thrS 14860 12932 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_16320 15132 14983 gene locus_tag LOCUS_16330 15132 14983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence067 244 966 gene locus_tag LOCUS_16340 244 966 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902128.1 protein_id gnl|my_center|LOCUS_16340 969 2309 gene locus_tag LOCUS_16350 969 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 2505 3581 gene locus_tag LOCUS_16360 2505 3581 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_16360 3613 5235 gene locus_tag LOCUS_16370 3613 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 5237 5590 gene locus_tag LOCUS_16380 5237 5590 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_16380 5590 6186 gene locus_tag LOCUS_16390 gene recR 5590 6186 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359478.1 protein_id gnl|my_center|LOCUS_16390 6255 7370 gene locus_tag LOCUS_16400 6255 7370 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119158.1 protein_id gnl|my_center|LOCUS_16400 7620 8273 gene locus_tag LOCUS_16410 gene fsa 7620 8273 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964656.1 protein_id gnl|my_center|LOCUS_16410 8328 9164 gene locus_tag LOCUS_16420 8328 9164 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_16420 9152 10093 gene locus_tag LOCUS_16430 9152 10093 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_16430 10120 10968 gene locus_tag LOCUS_16440 10120 10968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 11343 10963 gene locus_tag LOCUS_16450 11343 10963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 11623 12804 gene locus_tag LOCUS_16460 11623 12804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 12981 14177 gene locus_tag LOCUS_16470 12981 14177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 14186 15004 gene locus_tag LOCUS_16480 14186 15004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence068 268 1044 gene locus_tag LOCUS_16490 268 1044 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321321.1 protein_id gnl|my_center|LOCUS_16490 1041 1886 gene locus_tag LOCUS_16500 1041 1886 CDS product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244034.1 protein_id gnl|my_center|LOCUS_16500 1899 2942 gene locus_tag LOCUS_16510 1899 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837545.1 protein_id gnl|my_center|LOCUS_16510 2970 3665 gene locus_tag LOCUS_16520 2970 3665 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837546.1 protein_id gnl|my_center|LOCUS_16520 3704 4531 gene locus_tag LOCUS_16530 3704 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 4628 6478 gene locus_tag LOCUS_16540 gene uvrC 4628 6478 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_16540 6575 7507 gene locus_tag LOCUS_16550 gene hprK 6575 7507 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127250.1 protein_id gnl|my_center|LOCUS_16550 7565 8503 gene locus_tag LOCUS_16560 7565 8503 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_16560 11256 8653 gene locus_tag LOCUS_16570 11256 8653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 11454 12095 gene locus_tag LOCUS_16580 11454 12095 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895825.1 protein_id gnl|my_center|LOCUS_16580 12737 12180 gene locus_tag LOCUS_16590 gene raiA 12737 12180 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_16590 13439 12825 gene locus_tag LOCUS_16600 13439 12825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775380.1 protein_id gnl|my_center|LOCUS_16600 15290 13452 gene locus_tag LOCUS_16610 gene typA 15290 13452 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964991.1 protein_id gnl|my_center|LOCUS_16610 >Feature sequence069 <1 664 gene locus_tag LOCUS_16620 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731571.1:alcohol dehydrogenase 1675 791 gene locus_tag LOCUS_16630 1675 791 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_16630 1954 2895 gene locus_tag LOCUS_16640 1954 2895 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020472.1 protein_id gnl|my_center|LOCUS_16640 2926 3531 gene locus_tag LOCUS_16650 2926 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 3601 4479 gene locus_tag LOCUS_16660 3601 4479 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787284.1 protein_id gnl|my_center|LOCUS_16660 4948 5913 gene locus_tag LOCUS_16670 4948 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 5910 6866 gene locus_tag LOCUS_16680 5910 6866 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755851.1 protein_id gnl|my_center|LOCUS_16680 8361 6958 gene locus_tag LOCUS_16690 gene uxaC 8361 6958 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187438.1 protein_id gnl|my_center|LOCUS_16690 9987 8377 gene locus_tag LOCUS_16700 9987 8377 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_16700 11057 9984 gene locus_tag LOCUS_16710 gene uxuA 11057 9984 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082566.1 protein_id gnl|my_center|LOCUS_16710 11218 12096 gene locus_tag LOCUS_16720 11218 12096 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964642.1 protein_id gnl|my_center|LOCUS_16720 13721 12111 gene locus_tag LOCUS_16730 13721 12111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 15458 13728 gene locus_tag LOCUS_16740 15458 13728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence070 357 1184 gene locus_tag LOCUS_16750 357 1184 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860957.1 protein_id gnl|my_center|LOCUS_16750 1312 2805 gene locus_tag LOCUS_16760 1312 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 2809 3447 gene locus_tag LOCUS_16770 2809 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 3404 6802 gene locus_tag LOCUS_16780 3404 6802 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392027.1 protein_id gnl|my_center|LOCUS_16780 6762 7964 gene locus_tag LOCUS_16790 6762 7964 CDS product DUF3322 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459256.1 protein_id gnl|my_center|LOCUS_16790 8076 9260 gene locus_tag LOCUS_16800 8076 9260 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_16800 9895 10536 gene locus_tag LOCUS_16810 9895 10536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16810 11416 10574 gene locus_tag LOCUS_16820 gene folK 11416 10574 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016121.1 protein_id gnl|my_center|LOCUS_16820 12305 11475 gene locus_tag LOCUS_16830 gene folP 12305 11475 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966209.1 protein_id gnl|my_center|LOCUS_16830 12793 12302 gene locus_tag LOCUS_16840 12793 12302 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966208.1 protein_id gnl|my_center|LOCUS_16840 13397 12840 gene locus_tag LOCUS_16850 gene folE 13397 12840 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380915.1 protein_id gnl|my_center|LOCUS_16850 14863 13394 gene locus_tag LOCUS_16860 14863 13394 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence071 598 1749 gene locus_tag LOCUS_16870 gene aroC 598 1749 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_16870 2100 1837 gene locus_tag LOCUS_16880 2100 1837 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681864.1 protein_id gnl|my_center|LOCUS_16880 2366 2097 gene locus_tag LOCUS_16890 2366 2097 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813972.1 protein_id gnl|my_center|LOCUS_16890 6343 2588 gene locus_tag LOCUS_16900 6343 2588 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_16900 7196 6459 gene locus_tag LOCUS_16910 7196 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 7275 8165 gene locus_tag LOCUS_16920 7275 8165 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435316.1 protein_id gnl|my_center|LOCUS_16920 10540 8168 gene locus_tag LOCUS_16930 10540 8168 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459887.1 protein_id gnl|my_center|LOCUS_16930 11558 10761 gene locus_tag LOCUS_16940 11558 10761 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016780.1 protein_id gnl|my_center|LOCUS_16940 12900 11578 gene locus_tag LOCUS_16950 12900 11578 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966615.1 protein_id gnl|my_center|LOCUS_16950 14759 12999 gene locus_tag LOCUS_16960 14759 12999 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence072 326 508 gene locus_tag LOCUS_16970 326 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 560 1840 gene locus_tag LOCUS_16980 560 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 2837 1848 gene locus_tag LOCUS_16990 2837 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 3245 3688 gene locus_tag LOCUS_17000 gene rpiB 3245 3688 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721856.1 protein_id gnl|my_center|LOCUS_17000 3688 4686 gene locus_tag LOCUS_17010 3688 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 4750 5388 gene locus_tag LOCUS_17020 gene nth 4750 5388 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198142832.1 protein_id gnl|my_center|LOCUS_17020 5416 7950 gene locus_tag LOCUS_17030 5416 7950 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861274.1 protein_id gnl|my_center|LOCUS_17030 8219 8289 gene locus_tag LOCUS_t00170 8219 8289 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8383 9033 gene locus_tag LOCUS_17040 8383 9033 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994403.1 protein_id gnl|my_center|LOCUS_17040 9030 9677 gene locus_tag LOCUS_17050 9030 9677 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389803.1 protein_id gnl|my_center|LOCUS_17050 9653 9790 gene locus_tag LOCUS_17060 9653 9790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 9802 10044 gene locus_tag LOCUS_17070 9802 10044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 10216 12342 gene locus_tag LOCUS_17080 gene rnr 10216 12342 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391084.1 protein_id gnl|my_center|LOCUS_17080 12394 12858 gene locus_tag LOCUS_17090 gene smpB 12394 12858 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583706.1 protein_id gnl|my_center|LOCUS_17090 12873 13709 gene locus_tag LOCUS_17100 gene nudC 12873 13709 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102051.1 protein_id gnl|my_center|LOCUS_17100 13740 14162 gene locus_tag LOCUS_17110 13740 14162 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence073 1187 714 gene locus_tag LOCUS_17120 1187 714 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_17120 1552 2370 gene locus_tag LOCUS_17130 gene thiM 1552 2370 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_17130 2357 3085 gene locus_tag LOCUS_17140 gene thiE 2357 3085 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_17140 3082 3744 gene locus_tag LOCUS_17150 3082 3744 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_17150 3898 4704 gene locus_tag LOCUS_17160 gene thiD 3898 4704 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_17160 4884 6410 gene locus_tag LOCUS_17170 4884 6410 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048829.1 protein_id gnl|my_center|LOCUS_17170 6403 7080 gene locus_tag LOCUS_17180 6403 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 7125 7199 gene locus_tag LOCUS_t00180 7125 7199 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7208 7282 gene locus_tag LOCUS_t00190 7208 7282 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7561 7749 gene locus_tag LOCUS_17190 7561 7749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 7785 8183 gene locus_tag LOCUS_17200 7785 8183 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_17200 8315 8506 gene locus_tag LOCUS_17210 8315 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 9292 8726 gene locus_tag LOCUS_17220 9292 8726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 9810 9526 gene locus_tag LOCUS_17230 9810 9526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 10586 9816 gene locus_tag LOCUS_17240 10586 9816 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114222.1 protein_id gnl|my_center|LOCUS_17240 11311 10583 gene locus_tag LOCUS_17250 11311 10583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 12060 11308 gene locus_tag LOCUS_17260 12060 11308 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138603.1 protein_id gnl|my_center|LOCUS_17260 12247 12957 gene locus_tag LOCUS_17270 12247 12957 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012994104.1 protein_id gnl|my_center|LOCUS_17270 12954 14354 gene locus_tag LOCUS_17280 12954 14354 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399787.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence074 284 1294 gene locus_tag LOCUS_17290 gene asnA 284 1294 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_17290 1319 1912 gene locus_tag LOCUS_17300 1319 1912 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547369.1 protein_id gnl|my_center|LOCUS_17300 2631 1966 gene locus_tag LOCUS_17310 2631 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 2898 4571 gene locus_tag LOCUS_17320 2898 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 5397 4939 gene locus_tag LOCUS_17330 5397 4939 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361333.1 protein_id gnl|my_center|LOCUS_17330 6305 5400 gene locus_tag LOCUS_17340 gene trxB 6305 5400 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_17340 8684 6309 gene locus_tag LOCUS_17350 8684 6309 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_17350 9544 8849 gene locus_tag LOCUS_17360 9544 8849 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_17360 10448 9657 gene locus_tag LOCUS_17370 gene proC 10448 9657 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048171.1 protein_id gnl|my_center|LOCUS_17370 10757 10494 gene locus_tag LOCUS_17380 10757 10494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 11042 11290 gene locus_tag LOCUS_17390 11042 11290 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_17390 11328 12407 gene locus_tag LOCUS_17400 gene hydE 11328 12407 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_17400 12514 13935 gene locus_tag LOCUS_17410 gene hydG 12514 13935 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence075 <1 818 gene locus_tag LOCUS_17420 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023515.1:phosphate acetyltransferase 842 2038 gene locus_tag LOCUS_17430 842 2038 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460506.1 protein_id gnl|my_center|LOCUS_17430 2231 3580 gene locus_tag LOCUS_17440 2231 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 3654 4181 gene locus_tag LOCUS_17450 3654 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 4185 4364 gene locus_tag LOCUS_17460 gene rpmF 4185 4364 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_17460 4474 5505 gene locus_tag LOCUS_17470 gene plsX 4474 5505 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_17470 5523 5753 gene locus_tag LOCUS_17480 gene acpP 5523 5753 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280528.1 protein_id gnl|my_center|LOCUS_17480 5827 6516 gene locus_tag LOCUS_17490 gene rncS 5827 6516 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_17490 6529 10089 gene locus_tag LOCUS_17500 gene smc 6529 10089 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_17500 10109 11050 gene locus_tag LOCUS_17510 10109 11050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 11047 12261 gene locus_tag LOCUS_17520 gene ilvA 11047 12261 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_17520 12274 12768 gene locus_tag LOCUS_17530 12274 12768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 14076 12895 gene locus_tag LOCUS_17540 14076 12895 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_17540 14632 14180 gene locus_tag LOCUS_17550 14632 14180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence076 <1 959 gene locus_tag LOCUS_17560 <1 959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002387242.1:response regulator transcription factor 1116 3383 gene locus_tag LOCUS_17570 1116 3383 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201964.1 protein_id gnl|my_center|LOCUS_17570 3593 4000 gene locus_tag LOCUS_17580 3593 4000 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262616.1 protein_id gnl|my_center|LOCUS_17580 4013 4339 gene locus_tag LOCUS_17590 4013 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 4734 4402 gene locus_tag LOCUS_17600 4734 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 5041 4877 gene locus_tag LOCUS_17610 5041 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 6057 5131 gene locus_tag LOCUS_17620 6057 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 8153 6054 gene locus_tag LOCUS_17630 8153 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 10549 8276 gene locus_tag LOCUS_17640 10549 8276 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_17640 11062 10697 gene locus_tag LOCUS_17650 11062 10697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 12709 11321 gene locus_tag LOCUS_17660 12709 11321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 13889 12780 gene locus_tag LOCUS_17670 13889 12780 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_17670 14341 14268 gene locus_tag LOCUS_t00200 14341 14268 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence077 1101 430 gene locus_tag LOCUS_17680 1101 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 1430 2419 gene locus_tag LOCUS_17690 1430 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460508.1 protein_id gnl|my_center|LOCUS_17690 3023 2442 gene locus_tag LOCUS_17700 3023 2442 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460509.1 protein_id gnl|my_center|LOCUS_17700 3517 3020 gene locus_tag LOCUS_17710 gene coaD 3517 3020 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388467.1 protein_id gnl|my_center|LOCUS_17710 4080 3511 gene locus_tag LOCUS_17720 gene rsmD 4080 3511 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_17720 4478 4272 gene locus_tag LOCUS_17730 4478 4272 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_17730 5166 4687 gene locus_tag LOCUS_17740 5166 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 5827 5156 gene locus_tag LOCUS_17750 5827 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 8064 5824 gene locus_tag LOCUS_17760 8064 5824 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476111.1 protein_id gnl|my_center|LOCUS_17760 9533 8103 gene locus_tag LOCUS_17770 gene melB 9533 8103 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028111.1 protein_id gnl|my_center|LOCUS_17770 10594 9716 gene locus_tag LOCUS_17780 10594 9716 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901419.1 protein_id gnl|my_center|LOCUS_17780 12718 10658 gene locus_tag LOCUS_17790 gene recG 12718 10658 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_17790 14523 12850 gene locus_tag LOCUS_17800 14523 12850 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence078 9 884 gene locus_tag LOCUS_17810 9 884 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222427.1 protein_id gnl|my_center|LOCUS_17810 2455 1004 gene locus_tag LOCUS_17820 gene miaB 2455 1004 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_17820 2687 2505 gene locus_tag LOCUS_17830 2687 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 3256 2657 gene locus_tag LOCUS_17840 3256 2657 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_17840 3443 3222 gene locus_tag LOCUS_17850 3443 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 4015 3623 gene locus_tag LOCUS_17860 4015 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 5773 4091 gene locus_tag LOCUS_17870 5773 4091 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_17870 6311 5817 gene locus_tag LOCUS_17880 gene ybeY 6311 5817 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964605.1 protein_id gnl|my_center|LOCUS_17880 7315 6308 gene locus_tag LOCUS_17890 7315 6308 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_17890 8561 7290 gene locus_tag LOCUS_17900 gene yqfD 8561 7290 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047998.1 protein_id gnl|my_center|LOCUS_17900 8782 8558 gene locus_tag LOCUS_17910 8782 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 9277 8981 gene locus_tag LOCUS_17920 9277 8981 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016687.1 protein_id gnl|my_center|LOCUS_17920 9796 9299 gene locus_tag LOCUS_17930 9796 9299 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058223026.1 protein_id gnl|my_center|LOCUS_17930 11573 9864 gene locus_tag LOCUS_17940 11573 9864 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775582.1 protein_id gnl|my_center|LOCUS_17940 13045 11603 gene locus_tag LOCUS_17950 13045 11603 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_17950 <14488 13157 gene locus_tag LOCUS_17960 <14488 13157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948929.1:Trk system potassium transporter TrkA >Feature sequence079 301 612 gene locus_tag LOCUS_17970 301 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 616 1662 gene locus_tag LOCUS_17980 616 1662 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250551.1 protein_id gnl|my_center|LOCUS_17980 1659 3599 gene locus_tag LOCUS_17990 1659 3599 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_17990 3642 4079 gene locus_tag LOCUS_18000 3642 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 4232 4540 gene locus_tag LOCUS_18010 4232 4540 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_18010 4754 5347 gene locus_tag LOCUS_18020 4754 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 5334 7106 gene locus_tag LOCUS_18030 5334 7106 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876586.1 protein_id gnl|my_center|LOCUS_18030 7121 8506 gene locus_tag LOCUS_18040 7121 8506 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_18040 9104 9724 gene locus_tag LOCUS_18050 9104 9724 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_18050 11636 9870 gene locus_tag LOCUS_18060 11636 9870 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775581.1 protein_id gnl|my_center|LOCUS_18060 12545 11700 gene locus_tag LOCUS_18070 12545 11700 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027122.1 protein_id gnl|my_center|LOCUS_18070 14026 12629 gene locus_tag LOCUS_18080 14026 12629 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289668.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence080 158 1771 gene locus_tag LOCUS_18090 158 1771 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064987.1 protein_id gnl|my_center|LOCUS_18090 1796 3772 gene locus_tag LOCUS_18100 1796 3772 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_18100 3788 4996 gene locus_tag LOCUS_18110 3788 4996 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609547.1 protein_id gnl|my_center|LOCUS_18110 5033 6103 gene locus_tag LOCUS_18120 5033 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 6131 6829 gene locus_tag LOCUS_18130 6131 6829 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922186.1 protein_id gnl|my_center|LOCUS_18130 6859 8079 gene locus_tag LOCUS_18140 6859 8079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 8111 9508 gene locus_tag LOCUS_18150 8111 9508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 9505 10605 gene locus_tag LOCUS_18160 9505 10605 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101286.1 protein_id gnl|my_center|LOCUS_18160 10630 11625 gene locus_tag LOCUS_18170 10630 11625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 11638 12651 gene locus_tag LOCUS_18180 11638 12651 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549884.1 protein_id gnl|my_center|LOCUS_18180 12657 14117 gene locus_tag LOCUS_18190 12657 14117 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128519551.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence081 32 457 gene locus_tag LOCUS_18200 32 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 587 880 gene locus_tag LOCUS_18210 587 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 1702 959 gene locus_tag LOCUS_18220 1702 959 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203367.1 protein_id gnl|my_center|LOCUS_18220 2439 1708 gene locus_tag LOCUS_18230 gene nagB 2439 1708 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_18230 3063 2695 gene locus_tag LOCUS_18240 3063 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 3937 3158 gene locus_tag LOCUS_18250 gene truA 3937 3158 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048349.1 protein_id gnl|my_center|LOCUS_18250 4861 4037 gene locus_tag LOCUS_18260 4861 4037 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_18260 5703 4858 gene locus_tag LOCUS_18270 5703 4858 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_18270 6539 5688 gene locus_tag LOCUS_18280 6539 5688 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_18280 7622 6753 gene locus_tag LOCUS_18290 7622 6753 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356230.1 protein_id gnl|my_center|LOCUS_18290 8850 7774 gene locus_tag LOCUS_18300 gene mglB 8850 7774 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881084.1 protein_id gnl|my_center|LOCUS_18300 9877 8903 gene locus_tag LOCUS_18310 9877 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 11796 9874 gene locus_tag LOCUS_18320 11796 9874 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_18320 13417 11786 gene locus_tag LOCUS_18330 13417 11786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence082 68 140 gene locus_tag LOCUS_t00210 68 140 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 391 230 gene locus_tag LOCUS_18340 391 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 710 2662 gene locus_tag LOCUS_18350 710 2662 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160859024.1 protein_id gnl|my_center|LOCUS_18350 2697 4136 gene locus_tag LOCUS_18360 gene speA 2697 4136 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244780.1 protein_id gnl|my_center|LOCUS_18360 4179 4757 gene locus_tag LOCUS_18370 4179 4757 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963621.1 protein_id gnl|my_center|LOCUS_18370 4880 5875 gene locus_tag LOCUS_18380 4880 5875 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_18380 5880 6785 gene locus_tag LOCUS_18390 5880 6785 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963624.1 protein_id gnl|my_center|LOCUS_18390 6775 7497 gene locus_tag LOCUS_18400 6775 7497 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_18400 7595 8440 gene locus_tag LOCUS_18410 gene rsmI 7595 8440 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_18410 9131 8478 gene locus_tag LOCUS_18420 9131 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 9766 9236 gene locus_tag LOCUS_18430 9766 9236 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947935.1 protein_id gnl|my_center|LOCUS_18430 9880 11661 gene locus_tag LOCUS_18440 9880 11661 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193735789.1 protein_id gnl|my_center|LOCUS_18440 11712 12329 gene locus_tag LOCUS_18450 gene spmA 11712 12329 CDS product spore maturation protein SpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247808.1 protein_id gnl|my_center|LOCUS_18450 12421 12494 gene locus_tag LOCUS_t00220 12421 12494 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 13540 12995 gene locus_tag LOCUS_18460 13540 12995 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814895.1 protein_id gnl|my_center|LOCUS_18460 13643 13837 gene locus_tag LOCUS_18470 13643 13837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 >Feature sequence083 738 1088 gene locus_tag LOCUS_18480 738 1088 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393779.1 protein_id gnl|my_center|LOCUS_18480 1090 2451 gene locus_tag LOCUS_18490 gene ffh 1090 2451 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_18490 2544 2789 gene locus_tag LOCUS_18500 gene rpsP 2544 2789 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_18500 2815 3042 gene locus_tag LOCUS_18510 2815 3042 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392483.1 protein_id gnl|my_center|LOCUS_18510 3351 3854 gene locus_tag LOCUS_18520 gene rimM 3351 3854 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889030.1 protein_id gnl|my_center|LOCUS_18520 3915 4745 gene locus_tag LOCUS_18530 gene trmD 3915 4745 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_18530 5210 5557 gene locus_tag LOCUS_18540 gene rplS 5210 5557 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419350.1 protein_id gnl|my_center|LOCUS_18540 5623 6285 gene locus_tag LOCUS_18550 gene lepB 5623 6285 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460443.1 protein_id gnl|my_center|LOCUS_18550 6303 7142 gene locus_tag LOCUS_18560 gene ylqF 6303 7142 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_18560 7202 7738 gene locus_tag LOCUS_18570 gene lepB 7202 7738 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_18570 7731 8492 gene locus_tag LOCUS_18580 7731 8492 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_18580 8511 8861 gene locus_tag LOCUS_18590 8511 8861 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384683.1 protein_id gnl|my_center|LOCUS_18590 8866 9714 gene locus_tag LOCUS_18600 gene pgeF 8866 9714 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_18600 9690 9830 gene locus_tag LOCUS_18610 9690 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 9827 10798 gene locus_tag LOCUS_18620 gene mscS 9827 10798 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_18620 10877 10951 gene locus_tag LOCUS_t00230 10877 10951 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11085 11255 gene locus_tag LOCUS_18630 11085 11255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 11310 11726 gene locus_tag LOCUS_18640 11310 11726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 12074 12469 gene locus_tag LOCUS_18650 12074 12469 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937904.1 protein_id gnl|my_center|LOCUS_18650 12579 13703 gene locus_tag LOCUS_18660 12579 13703 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence084 65 135 gene locus_tag LOCUS_t00240 65 135 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 183 258 gene locus_tag LOCUS_t00250 183 258 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 262 337 gene locus_tag LOCUS_t00260 262 337 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 388 459 gene locus_tag LOCUS_t00270 388 459 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 488 561 gene locus_tag LOCUS_t00280 488 561 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1010 657 gene locus_tag LOCUS_18670 1010 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 1155 997 gene locus_tag LOCUS_18680 1155 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 1737 1360 gene locus_tag LOCUS_18690 1737 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 2350 2135 gene locus_tag LOCUS_18700 2350 2135 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922422.1 protein_id gnl|my_center|LOCUS_18700 2438 3481 gene locus_tag LOCUS_18710 2438 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 3920 4000 gene locus_tag LOCUS_t00290 3920 4000 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5326 4646 gene locus_tag LOCUS_18720 5326 4646 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989471.1 protein_id gnl|my_center|LOCUS_18720 5915 5343 gene locus_tag LOCUS_18730 5915 5343 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_18730 6189 6866 gene locus_tag LOCUS_18740 6189 6866 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044679.1 protein_id gnl|my_center|LOCUS_18740 6863 8383 gene locus_tag LOCUS_18750 6863 8383 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 protein_id gnl|my_center|LOCUS_18750 8498 9904 gene locus_tag LOCUS_18760 8498 9904 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307517.1 protein_id gnl|my_center|LOCUS_18760 9905 10510 gene locus_tag LOCUS_18770 gene hisH 9905 10510 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_18770 10614 11375 gene locus_tag LOCUS_18780 gene hisF 10614 11375 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949116.1 protein_id gnl|my_center|LOCUS_18780 11477 12145 gene locus_tag LOCUS_18790 11477 12145 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732773.1 protein_id gnl|my_center|LOCUS_18790 12843 12142 gene locus_tag LOCUS_18800 12843 12142 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566878.1 protein_id gnl|my_center|LOCUS_18800 12968 13038 gene locus_tag LOCUS_t00300 12968 13038 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence085 1372 116 gene locus_tag LOCUS_18810 1372 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 1621 1418 gene locus_tag LOCUS_18820 1621 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 2208 1693 gene locus_tag LOCUS_18830 2208 1693 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948907.1 protein_id gnl|my_center|LOCUS_18830 3200 2205 gene locus_tag LOCUS_18840 gene xdhB 3200 2205 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393457.1 protein_id gnl|my_center|LOCUS_18840 5537 3240 gene locus_tag LOCUS_18850 gene xdhA 5537 3240 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 protein_id gnl|my_center|LOCUS_18850 6835 5552 gene locus_tag LOCUS_18860 6835 5552 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896806.1 protein_id gnl|my_center|LOCUS_18860 8078 7026 gene locus_tag LOCUS_18870 8078 7026 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144034111.1 protein_id gnl|my_center|LOCUS_18870 8937 8059 gene locus_tag LOCUS_18880 8937 8059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 10414 8957 gene locus_tag LOCUS_18890 10414 8957 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033065833.1 protein_id gnl|my_center|LOCUS_18890 11973 10675 gene locus_tag LOCUS_18900 11973 10675 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681529.1 protein_id gnl|my_center|LOCUS_18900 12713 11988 gene locus_tag LOCUS_18910 12713 11988 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438111.1 protein_id gnl|my_center|LOCUS_18910 <13576 12741 gene locus_tag LOCUS_18920 <13576 12741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814309.1:L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha >Feature sequence086 291 551 gene locus_tag LOCUS_18930 291 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 1003 2778 gene locus_tag LOCUS_18940 1003 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 2875 3573 gene locus_tag LOCUS_18950 gene cwlD 2875 3573 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048347.1 protein_id gnl|my_center|LOCUS_18950 3700 5157 gene locus_tag LOCUS_18960 3700 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 5154 5786 gene locus_tag LOCUS_18970 gene upp 5154 5786 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048712.1 protein_id gnl|my_center|LOCUS_18970 5805 6293 gene locus_tag LOCUS_18980 5805 6293 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_18980 6290 7135 gene locus_tag LOCUS_18990 6290 7135 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 protein_id gnl|my_center|LOCUS_18990 7180 7746 gene locus_tag LOCUS_19000 7180 7746 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966371.1 protein_id gnl|my_center|LOCUS_19000 7743 8456 gene locus_tag LOCUS_19010 7743 8456 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948182.1 protein_id gnl|my_center|LOCUS_19010 8733 10895 gene locus_tag LOCUS_19020 8733 10895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 11108 12910 gene locus_tag LOCUS_19030 11108 12910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 13113 13200 gene locus_tag LOCUS_t00310 13113 13200 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence087 221 1297 gene locus_tag LOCUS_19040 221 1297 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132280311.1 protein_id gnl|my_center|LOCUS_19040 1311 2312 gene locus_tag LOCUS_19050 1311 2312 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_19050 2309 3493 gene locus_tag LOCUS_19060 2309 3493 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_19060 3541 4620 gene locus_tag LOCUS_19070 3541 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 4613 5320 gene locus_tag LOCUS_19080 4613 5320 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722035.1 protein_id gnl|my_center|LOCUS_19080 5483 5626 gene locus_tag LOCUS_19090 5483 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 9439 5738 gene locus_tag LOCUS_19100 gene rpoC 9439 5738 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966420.1 protein_id gnl|my_center|LOCUS_19100 13320 9457 gene locus_tag LOCUS_19110 gene rpoB 13320 9457 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436174.1 protein_id gnl|my_center|LOCUS_19110 >Feature sequence088 2053 1466 gene locus_tag LOCUS_19120 2053 1466 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272229.1 protein_id gnl|my_center|LOCUS_19120 2682 2062 gene locus_tag LOCUS_19130 2682 2062 CDS product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459228.1 protein_id gnl|my_center|LOCUS_19130 2964 2752 gene locus_tag LOCUS_19140 2964 2752 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_19140 3484 3203 gene locus_tag LOCUS_19150 3484 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 4457 3486 gene locus_tag LOCUS_19160 4457 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 5232 4447 gene locus_tag LOCUS_19170 5232 4447 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_19170 5518 5273 gene locus_tag LOCUS_19180 5518 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 7173 5734 gene locus_tag LOCUS_19190 gene rlmD 7173 5734 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434581.1 protein_id gnl|my_center|LOCUS_19190 7643 7404 gene locus_tag LOCUS_19200 7643 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 8667 7720 gene locus_tag LOCUS_19210 8667 7720 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369231.1 protein_id gnl|my_center|LOCUS_19210 10518 8680 gene locus_tag LOCUS_19220 gene glmS 10518 8680 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_19220 11117 10761 gene locus_tag LOCUS_19230 gene spoVAE 11117 10761 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418423.1 protein_id gnl|my_center|LOCUS_19230 12366 11323 gene locus_tag LOCUS_19240 gene spoVAD 12366 11323 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_19240 12586 13266 gene locus_tag LOCUS_19250 12586 13266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 >Feature sequence089 915 1955 gene locus_tag LOCUS_19260 gene argC 915 1955 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851634.1 protein_id gnl|my_center|LOCUS_19260 2062 2508 gene locus_tag LOCUS_19270 2062 2508 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851934.1 protein_id gnl|my_center|LOCUS_19270 2551 3780 gene locus_tag LOCUS_19280 gene argJ 2551 3780 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082329.1 protein_id gnl|my_center|LOCUS_19280 3854 4753 gene locus_tag LOCUS_19290 gene argB 3854 4753 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864194.1 protein_id gnl|my_center|LOCUS_19290 4743 5924 gene locus_tag LOCUS_19300 4743 5924 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864195.1 protein_id gnl|my_center|LOCUS_19300 6094 6525 gene locus_tag LOCUS_19310 6094 6525 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966812.1 protein_id gnl|my_center|LOCUS_19310 6678 7379 gene locus_tag LOCUS_19320 6678 7379 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836677.1 protein_id gnl|my_center|LOCUS_19320 7404 8090 gene locus_tag LOCUS_19330 gene walR 7404 8090 CDS product cell wall metabolism DNA-binding response regulator WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244363.1 protein_id gnl|my_center|LOCUS_19330 8128 9522 gene locus_tag LOCUS_19340 8128 9522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 9533 10456 gene locus_tag LOCUS_19350 9533 10456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 10780 12792 gene locus_tag LOCUS_19360 10780 12792 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157831.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence090 <1 1814 gene locus_tag LOCUS_19370 <1 1814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_138304587.1:FUSC family protein 2924 1836 gene locus_tag LOCUS_19380 2924 1836 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_19380 3509 3183 gene locus_tag LOCUS_19390 3509 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 3811 4428 gene locus_tag LOCUS_19400 gene lexA 3811 4428 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_19400 5767 4541 gene locus_tag LOCUS_19410 5767 4541 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818556.1 protein_id gnl|my_center|LOCUS_19410 6518 5835 gene locus_tag LOCUS_19420 gene bioD 6518 5835 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986727.1 protein_id gnl|my_center|LOCUS_19420 7482 6511 gene locus_tag LOCUS_19430 gene bioB 7482 6511 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_19430 8518 7526 gene locus_tag LOCUS_19440 8518 7526 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 protein_id gnl|my_center|LOCUS_19440 8972 8640 gene locus_tag LOCUS_19450 8972 8640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 9232 8969 gene locus_tag LOCUS_19460 9232 8969 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272532.1 protein_id gnl|my_center|LOCUS_19460 9371 9186 gene locus_tag LOCUS_19470 9371 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 9690 9334 gene locus_tag LOCUS_19480 gene rsfS 9690 9334 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416416.1 protein_id gnl|my_center|LOCUS_19480 10271 9705 gene locus_tag LOCUS_19490 gene yqeK 10271 9705 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399059.1 protein_id gnl|my_center|LOCUS_19490 10888 10277 gene locus_tag LOCUS_19500 gene nadD 10888 10277 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416411.1 protein_id gnl|my_center|LOCUS_19500 11191 10898 gene locus_tag LOCUS_19510 gene yhbY 11191 10898 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 protein_id gnl|my_center|LOCUS_19510 12518 11235 gene locus_tag LOCUS_19520 gene obgE 12518 11235 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_19520 >Feature sequence091 146 667 gene locus_tag LOCUS_19530 146 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 651 806 gene locus_tag LOCUS_19540 651 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 1019 2584 gene locus_tag LOCUS_19550 1019 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 2688 2915 gene locus_tag LOCUS_19560 2688 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 3080 5008 gene locus_tag LOCUS_19570 3080 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 5126 6673 gene locus_tag LOCUS_19580 gene guaA 5126 6673 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_19580 7388 6876 gene locus_tag LOCUS_19590 7388 6876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 7573 7767 gene locus_tag LOCUS_19600 7573 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 7770 8879 gene locus_tag LOCUS_19610 7770 8879 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_19610 8870 9199 gene locus_tag LOCUS_19620 8870 9199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 9305 10303 gene locus_tag LOCUS_19630 9305 10303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 10370 10603 gene locus_tag LOCUS_19640 10370 10603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 10679 10918 gene locus_tag LOCUS_19650 10679 10918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 11071 12384 gene locus_tag LOCUS_19660 11071 12384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 >Feature sequence092 <1 917 gene locus_tag LOCUS_19670 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963395.1:acyltransferase family protein 1040 2578 gene locus_tag LOCUS_19680 gene gpmI 1040 2578 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_19680 2752 3255 gene locus_tag LOCUS_19690 gene greA 2752 3255 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818750.1 protein_id gnl|my_center|LOCUS_19690 3284 3943 gene locus_tag LOCUS_19700 3284 3943 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263190.1 protein_id gnl|my_center|LOCUS_19700 4601 4002 gene locus_tag LOCUS_19710 4601 4002 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640644.1 protein_id gnl|my_center|LOCUS_19710 5427 4714 gene locus_tag LOCUS_19720 5427 4714 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640645.1 protein_id gnl|my_center|LOCUS_19720 9735 5479 gene locus_tag LOCUS_19730 9735 5479 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484061.1 protein_id gnl|my_center|LOCUS_19730 10018 10863 gene locus_tag LOCUS_19740 10018 10863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 10889 12325 gene locus_tag LOCUS_19750 gene pyk 10889 12325 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence093 128 1219 gene locus_tag LOCUS_19760 128 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 1253 1939 gene locus_tag LOCUS_19770 gene ftsE 1253 1939 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_19770 1929 2879 gene locus_tag LOCUS_19780 gene ftsX 1929 2879 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_19780 2890 4038 gene locus_tag LOCUS_19790 2890 4038 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305385.1 protein_id gnl|my_center|LOCUS_19790 4156 5376 gene locus_tag LOCUS_19800 4156 5376 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_19800 5655 8252 gene locus_tag LOCUS_19810 gene clpB 5655 8252 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_19810 8249 9520 gene locus_tag LOCUS_19820 8249 9520 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963608.1 protein_id gnl|my_center|LOCUS_19820 9530 10543 gene locus_tag LOCUS_19830 9530 10543 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963395.1 protein_id gnl|my_center|LOCUS_19830 11036 11350 gene locus_tag LOCUS_19840 11036 11350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 11628 11774 gene locus_tag LOCUS_19850 11628 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence094 1930 497 gene locus_tag LOCUS_19860 gene purB 1930 497 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_19860 3544 2117 gene locus_tag LOCUS_19870 gene purF 3544 2117 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 protein_id gnl|my_center|LOCUS_19870 4551 3766 gene locus_tag LOCUS_19880 gene yecC 4551 3766 CDS product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816586.1 protein_id gnl|my_center|LOCUS_19880 5247 4564 gene locus_tag LOCUS_19890 5247 4564 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383057.1 protein_id gnl|my_center|LOCUS_19890 6121 5291 gene locus_tag LOCUS_19900 6121 5291 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_19900 7035 6268 gene locus_tag LOCUS_19910 7035 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 8293 7010 gene locus_tag LOCUS_19920 8293 7010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 11602 8309 gene locus_tag LOCUS_19930 11602 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence095 1525 824 gene locus_tag LOCUS_19940 1525 824 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356233.1 protein_id gnl|my_center|LOCUS_19940 3448 1556 gene locus_tag LOCUS_19950 3448 1556 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948299.1 protein_id gnl|my_center|LOCUS_19950 4289 3453 gene locus_tag LOCUS_19960 4289 3453 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_19960 5866 4289 gene locus_tag LOCUS_19970 5866 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 7046 5910 gene locus_tag LOCUS_19980 gene nspC 7046 5910 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764364.1 protein_id gnl|my_center|LOCUS_19980 8251 7049 gene locus_tag LOCUS_19990 8251 7049 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 protein_id gnl|my_center|LOCUS_19990 9183 8323 gene locus_tag LOCUS_20000 gene speB 9183 8323 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 protein_id gnl|my_center|LOCUS_20000 10039 9188 gene locus_tag LOCUS_20010 gene speE 10039 9188 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_20010 11504 10044 gene locus_tag LOCUS_20020 11504 10044 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808143.1 protein_id gnl|my_center|LOCUS_20020 >Feature sequence096 1641 271 gene locus_tag LOCUS_20030 1641 271 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048310.1 protein_id gnl|my_center|LOCUS_20030 3142 1670 gene locus_tag LOCUS_20040 3142 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 5700 3169 gene locus_tag LOCUS_20050 5700 3169 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020587.1 protein_id gnl|my_center|LOCUS_20050 6248 5838 gene locus_tag LOCUS_20060 6248 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 8093 7080 gene locus_tag LOCUS_20070 gene ruvB 8093 7080 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_20070 8783 8172 gene locus_tag LOCUS_20080 gene ruvA 8783 8172 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_20080 9350 8856 gene locus_tag LOCUS_20090 9350 8856 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641270.1 protein_id gnl|my_center|LOCUS_20090 9712 9347 gene locus_tag LOCUS_20100 9712 9347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 9945 10931 gene locus_tag LOCUS_20110 9945 10931 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_20110 >Feature sequence097 775 152 gene locus_tag LOCUS_20120 775 152 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903260.1 protein_id gnl|my_center|LOCUS_20120 911 3526 gene locus_tag LOCUS_20130 gene polA 911 3526 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896068.1 protein_id gnl|my_center|LOCUS_20130 3552 4169 gene locus_tag LOCUS_20140 3552 4169 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263264.1 protein_id gnl|my_center|LOCUS_20140 4248 4832 gene locus_tag LOCUS_20150 gene coaE 4248 4832 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475784.1 protein_id gnl|my_center|LOCUS_20150 4829 5626 gene locus_tag LOCUS_20160 4829 5626 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_20160 5645 5917 gene locus_tag LOCUS_20170 5645 5917 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_20170 5935 7314 gene locus_tag LOCUS_20180 5935 7314 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_20180 7397 8254 gene locus_tag LOCUS_20190 7397 8254 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811618.1 protein_id gnl|my_center|LOCUS_20190 8536 9222 gene locus_tag LOCUS_20200 8536 9222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 10813 9488 gene locus_tag LOCUS_20210 10813 9488 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681171.1 protein_id gnl|my_center|LOCUS_20210 >Feature sequence098 25 828 gene locus_tag LOCUS_20220 25 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 934 1674 gene locus_tag LOCUS_20230 gene cobB 934 1674 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868319.1 protein_id gnl|my_center|LOCUS_20230 1729 3186 gene locus_tag LOCUS_20240 gene gltX 1729 3186 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_20240 3189 5018 gene locus_tag LOCUS_20250 3189 5018 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860946.1 protein_id gnl|my_center|LOCUS_20250 5352 5047 gene locus_tag LOCUS_20260 5352 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 5549 6538 gene locus_tag LOCUS_20270 5549 6538 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903471.1 protein_id gnl|my_center|LOCUS_20270 6553 8421 gene locus_tag LOCUS_20280 gene glgX 6553 8421 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_20280 8418 8996 gene locus_tag LOCUS_20290 8418 8996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 9611 9132 gene locus_tag LOCUS_20300 9611 9132 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_20300 9708 10355 gene locus_tag LOCUS_20310 gene phoE 9708 10355 CDS product phosphatase PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233157.1 protein_id gnl|my_center|LOCUS_20310 >Feature sequence099 1469 417 gene locus_tag LOCUS_20320 1469 417 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890975.1 protein_id gnl|my_center|LOCUS_20320 2070 1459 gene locus_tag LOCUS_20330 2070 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 3146 2106 gene locus_tag LOCUS_20340 3146 2106 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_20340 3471 3325 gene locus_tag LOCUS_20350 3471 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 3716 4480 gene locus_tag LOCUS_20360 3716 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 5566 4490 gene locus_tag LOCUS_20370 gene mtnA 5566 4490 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948892.1 protein_id gnl|my_center|LOCUS_20370 6503 5586 gene locus_tag LOCUS_20380 6503 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 7230 6667 gene locus_tag LOCUS_20390 7230 6667 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_20390 7504 7274 gene locus_tag LOCUS_20400 7504 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 7749 7546 gene locus_tag LOCUS_20410 7749 7546 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796544.1 protein_id gnl|my_center|LOCUS_20410 8788 7766 gene locus_tag LOCUS_20420 8788 7766 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136824.1 protein_id gnl|my_center|LOCUS_20420 9493 8876 gene locus_tag LOCUS_20430 9493 8876 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986495.1 protein_id gnl|my_center|LOCUS_20430 10714 9704 gene locus_tag LOCUS_20440 10714 9704 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence100 2612 5119 gene locus_tag LOCUS_20450 2612 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 5336 5142 gene locus_tag LOCUS_20460 5336 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 5241 5633 gene locus_tag LOCUS_20470 gene gtcA 5241 5633 CDS product cell wall teichoic acid glycosylation protein GtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724105.1 protein_id gnl|my_center|LOCUS_20470 5626 6591 gene locus_tag LOCUS_20480 5626 6591 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_20480 8711 6588 gene locus_tag LOCUS_20490 8711 6588 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271984.1 protein_id gnl|my_center|LOCUS_20490 9290 8766 gene locus_tag LOCUS_20500 9290 8766 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225037.1 protein_id gnl|my_center|LOCUS_20500 11208 9964 gene locus_tag LOCUS_20510 11208 9964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence101 248 1960 gene locus_tag LOCUS_20520 gene recJ 248 1960 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943623.1 protein_id gnl|my_center|LOCUS_20520 2092 4395 gene locus_tag LOCUS_20530 2092 4395 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422921.1 protein_id gnl|my_center|LOCUS_20530 4405 5028 gene locus_tag LOCUS_20540 4405 5028 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871221.1 protein_id gnl|my_center|LOCUS_20540 5048 6688 gene locus_tag LOCUS_20550 5048 6688 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_20550 6679 7929 gene locus_tag LOCUS_20560 gene hisS 6679 7929 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_20560 7922 9706 gene locus_tag LOCUS_20570 gene aspS 7922 9706 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048075.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence102 576 485 gene locus_tag LOCUS_t00320 576 485 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1500 742 gene locus_tag LOCUS_20580 1500 742 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323503.1 protein_id gnl|my_center|LOCUS_20580 3462 1549 gene locus_tag LOCUS_20590 3462 1549 CDS product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897443.1 protein_id gnl|my_center|LOCUS_20590 4382 3477 gene locus_tag LOCUS_20600 gene pfkB 4382 3477 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_20600 4627 4541 gene locus_tag LOCUS_t00330 4627 4541 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5498 4749 gene locus_tag LOCUS_20610 gene ispD 5498 4749 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_20610 6543 5515 gene locus_tag LOCUS_20620 gene tsaD 6543 5515 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_20620 7462 6554 gene locus_tag LOCUS_20630 7462 6554 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_20630 7710 7477 gene locus_tag LOCUS_20640 7710 7477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 9070 7895 gene locus_tag LOCUS_20650 9070 7895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 9486 9067 gene locus_tag LOCUS_20660 gene tsaE 9486 9067 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048261.1 protein_id gnl|my_center|LOCUS_20660 10734 9556 gene locus_tag LOCUS_20670 10734 9556 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860970.1 protein_id gnl|my_center|LOCUS_20670 >Feature sequence103 2099 609 gene locus_tag LOCUS_20680 gene galT 2099 609 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_20680 3391 2222 gene locus_tag LOCUS_20690 3391 2222 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966242.1 protein_id gnl|my_center|LOCUS_20690 3595 4428 gene locus_tag LOCUS_20700 3595 4428 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775269.1 protein_id gnl|my_center|LOCUS_20700 4516 5289 gene locus_tag LOCUS_20710 4516 5289 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295129.1 protein_id gnl|my_center|LOCUS_20710 5532 6257 gene locus_tag LOCUS_20720 5532 6257 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_20720 6361 7680 gene locus_tag LOCUS_20730 6361 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 8217 7705 gene locus_tag LOCUS_20740 8217 7705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 9124 8210 gene locus_tag LOCUS_20750 9124 8210 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_20750 10272 9124 gene locus_tag LOCUS_20760 10272 9124 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_20760 >Feature sequence104 3034 2789 gene locus_tag LOCUS_20770 3034 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 3170 4426 gene locus_tag LOCUS_20780 3170 4426 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242735.1 protein_id gnl|my_center|LOCUS_20780 4423 5277 gene locus_tag LOCUS_20790 gene epsE 4423 5277 CDS product glycosyltransferase EpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244557.1 protein_id gnl|my_center|LOCUS_20790 5267 6604 gene locus_tag LOCUS_20800 5267 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 6582 7397 gene locus_tag LOCUS_20810 6582 7397 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_20810 7425 8564 gene locus_tag LOCUS_20820 7425 8564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 8575 10620 gene locus_tag LOCUS_20830 8575 10620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence105 797 282 gene locus_tag LOCUS_20840 797 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 1340 798 gene locus_tag LOCUS_20850 gene pgsA 1340 798 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_20850 2659 1337 gene locus_tag LOCUS_20860 gene rimO 2659 1337 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986784.1 protein_id gnl|my_center|LOCUS_20860 3011 2766 gene locus_tag LOCUS_20870 3011 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 3649 3014 gene locus_tag LOCUS_20880 gene gmk 3649 3014 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257738.1 protein_id gnl|my_center|LOCUS_20880 4668 3790 gene locus_tag LOCUS_20890 4668 3790 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_20890 4886 6619 gene locus_tag LOCUS_20900 4886 6619 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_20900 6886 7614 gene locus_tag LOCUS_20910 6886 7614 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358908.1 protein_id gnl|my_center|LOCUS_20910 9104 7806 gene locus_tag LOCUS_20920 9104 7806 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_20920 10287 9157 gene locus_tag LOCUS_20930 gene pheA 10287 9157 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence106 <1 589 gene locus_tag LOCUS_20940 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682246.1:Rpn family recombination-promoting nuclease/putative transposase 876 2492 gene locus_tag LOCUS_20950 876 2492 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966722.1 protein_id gnl|my_center|LOCUS_20950 2637 3974 gene locus_tag LOCUS_20960 2637 3974 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972116.1 protein_id gnl|my_center|LOCUS_20960 4039 4938 gene locus_tag LOCUS_20970 4039 4938 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972115.1 protein_id gnl|my_center|LOCUS_20970 4942 5778 gene locus_tag LOCUS_20980 4942 5778 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803810.1 protein_id gnl|my_center|LOCUS_20980 5875 7677 gene locus_tag LOCUS_20990 5875 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 7707 9269 gene locus_tag LOCUS_21000 7707 9269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 9271 10335 gene locus_tag LOCUS_21010 9271 10335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence107 2014 1499 gene locus_tag LOCUS_21020 2014 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 2267 2007 gene locus_tag LOCUS_21030 2267 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 2916 3593 gene locus_tag LOCUS_21040 2916 3593 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238594.1 protein_id gnl|my_center|LOCUS_21040 3586 4962 gene locus_tag LOCUS_21050 3586 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 5041 5763 gene locus_tag LOCUS_21060 5041 5763 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_21060 5756 6451 gene locus_tag LOCUS_21070 5756 6451 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_21070 6563 8617 gene locus_tag LOCUS_21080 6563 8617 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814523.1 protein_id gnl|my_center|LOCUS_21080 9320 9108 gene locus_tag LOCUS_21090 9320 9108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 10050 9694 gene locus_tag LOCUS_21100 10050 9694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 10162 10362 gene locus_tag LOCUS_21110 10162 10362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence108 597 1148 gene locus_tag LOCUS_21120 597 1148 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_21120 1210 1398 gene locus_tag LOCUS_21130 1210 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 1674 2963 gene locus_tag LOCUS_21140 gene tig 1674 2963 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729253.1 protein_id gnl|my_center|LOCUS_21140 3043 3624 gene locus_tag LOCUS_21150 gene clpP 3043 3624 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_21150 3645 4919 gene locus_tag LOCUS_21160 gene clpX 3645 4919 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_21160 5076 7394 gene locus_tag LOCUS_21170 gene lon 5076 7394 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435613.1 protein_id gnl|my_center|LOCUS_21170 7408 8019 gene locus_tag LOCUS_21180 gene yihA 7408 8019 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_21180 8091 9218 gene locus_tag LOCUS_21190 gene ytvI 8091 9218 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392554.1 protein_id gnl|my_center|LOCUS_21190 9416 10048 gene locus_tag LOCUS_21200 9416 10048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 10124 10205 gene locus_tag LOCUS_t00340 10124 10205 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence109 709 1014 gene locus_tag LOCUS_21210 709 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 1018 3108 gene locus_tag LOCUS_21220 1018 3108 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_21220 3329 3892 gene locus_tag LOCUS_21230 gene ahpC 3329 3892 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817384.1 protein_id gnl|my_center|LOCUS_21230 3960 5609 gene locus_tag LOCUS_21240 3960 5609 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810050.1 protein_id gnl|my_center|LOCUS_21240 6457 5780 gene locus_tag LOCUS_21250 6457 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 6526 6870 gene locus_tag LOCUS_21260 6526 6870 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459853.1 protein_id gnl|my_center|LOCUS_21260 7042 7200 gene locus_tag LOCUS_21270 7042 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 7210 7347 gene locus_tag LOCUS_21280 7210 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 7411 7337 gene locus_tag LOCUS_t00350 7411 7337 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7575 7955 gene locus_tag LOCUS_21290 7575 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 9596 8118 gene locus_tag LOCUS_21300 9596 8118 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence110 15 647 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcatgcctcgcaagaggcatgtgagtagaaat 1103 2017 gene locus_tag LOCUS_21310 1103 2017 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 protein_id gnl|my_center|LOCUS_21310 2096 2989 gene locus_tag LOCUS_21320 gene pstC 2096 2989 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814831.1 protein_id gnl|my_center|LOCUS_21320 2982 3842 gene locus_tag LOCUS_21330 gene pstA 2982 3842 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427927.1 protein_id gnl|my_center|LOCUS_21330 3856 4605 gene locus_tag LOCUS_21340 gene pstB 3856 4605 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_21340 4609 5262 gene locus_tag LOCUS_21350 gene phoU 4609 5262 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_21350 5350 6024 gene locus_tag LOCUS_21360 5350 6024 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_21360 6021 7370 gene locus_tag LOCUS_21370 6021 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 7883 7566 gene locus_tag LOCUS_21380 7883 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 8440 7880 gene locus_tag LOCUS_21390 8440 7880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21390 8962 9210 gene locus_tag LOCUS_21400 8962 9210 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546699.1 protein_id gnl|my_center|LOCUS_21400 9224 9433 gene locus_tag LOCUS_21410 9224 9433 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_21410 >Feature sequence111 62 976 gene locus_tag LOCUS_21420 62 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 1175 1438 gene locus_tag LOCUS_21430 1175 1438 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812614.1 protein_id gnl|my_center|LOCUS_21430 1774 2325 gene locus_tag LOCUS_21440 1774 2325 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_21440 2303 3058 gene locus_tag LOCUS_21450 2303 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 3048 3935 gene locus_tag LOCUS_21460 3048 3935 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810599.1 protein_id gnl|my_center|LOCUS_21460 3919 5133 gene locus_tag LOCUS_21470 3919 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 5985 6212 gene locus_tag LOCUS_21480 5985 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 6209 8254 gene locus_tag LOCUS_21490 gene feoB 6209 8254 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044821.1 protein_id gnl|my_center|LOCUS_21490 9189 8347 gene locus_tag LOCUS_21500 gene truA 9189 8347 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986454.1 protein_id gnl|my_center|LOCUS_21500 >Feature sequence112 <1 1086 gene locus_tag LOCUS_21510 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002302559.1:LacI family DNA-binding transcriptional regulator 1686 1114 gene locus_tag LOCUS_21520 1686 1114 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879640.1 protein_id gnl|my_center|LOCUS_21520 3543 1921 gene locus_tag LOCUS_21530 gene ptsP 3543 1921 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_21530 3822 3565 gene locus_tag LOCUS_21540 3822 3565 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_21540 4833 3886 gene locus_tag LOCUS_21550 gene cysK 4833 3886 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_21550 6119 4836 gene locus_tag LOCUS_21560 6119 4836 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_21560 6563 6126 gene locus_tag LOCUS_21570 6563 6126 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461668.1 protein_id gnl|my_center|LOCUS_21570 7078 6641 gene locus_tag LOCUS_21580 7078 6641 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460328.1 protein_id gnl|my_center|LOCUS_21580 7345 7542 gene locus_tag LOCUS_21590 7345 7542 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966272.1 protein_id gnl|my_center|LOCUS_21590 8268 7819 gene locus_tag LOCUS_21600 8268 7819 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931805.1 protein_id gnl|my_center|LOCUS_21600 9618 8287 gene locus_tag LOCUS_21610 9618 8287 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_21610 >Feature sequence113 1790 336 gene locus_tag LOCUS_21620 1790 336 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289243.1 protein_id gnl|my_center|LOCUS_21620 3738 1852 gene locus_tag LOCUS_21630 3738 1852 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027425.1 protein_id gnl|my_center|LOCUS_21630 4701 3865 gene locus_tag LOCUS_21640 4701 3865 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439998.1 protein_id gnl|my_center|LOCUS_21640 5718 4927 gene locus_tag LOCUS_21650 5718 4927 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438780.1 protein_id gnl|my_center|LOCUS_21650 7362 5824 gene locus_tag LOCUS_21660 7362 5824 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861882.1 protein_id gnl|my_center|LOCUS_21660 8066 7458 gene locus_tag LOCUS_21670 8066 7458 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066132.1 protein_id gnl|my_center|LOCUS_21670 8462 8809 gene locus_tag LOCUS_21680 8462 8809 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_21680 <9801 8910 gene locus_tag LOCUS_21690 <9801 8910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015945405.1:putative DNA binding domain-containing protein >Feature sequence114 <1 727 gene locus_tag LOCUS_21700 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462283.1:ATP-binding protein 956 882 gene locus_tag LOCUS_t00360 956 882 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1045 971 gene locus_tag LOCUS_t00370 1045 971 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1261 1842 gene locus_tag LOCUS_21710 1261 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 1845 2408 gene locus_tag LOCUS_21720 gene ispF 1845 2408 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_21720 2405 3679 gene locus_tag LOCUS_21730 2405 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 4600 5286 gene locus_tag LOCUS_21740 gene cysE 4600 5286 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476500.1 protein_id gnl|my_center|LOCUS_21740 5273 6679 gene locus_tag LOCUS_21750 gene cysS 5273 6679 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_21750 6664 7230 gene locus_tag LOCUS_21760 6664 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 7214 8002 gene locus_tag LOCUS_21770 gene rlmB 7214 8002 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_21770 8103 8723 gene locus_tag LOCUS_21780 8103 8723 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387193.1 protein_id gnl|my_center|LOCUS_21780 8772 9632 gene locus_tag LOCUS_21790 8772 9632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence115 1189 452 gene locus_tag LOCUS_21800 gene pflA 1189 452 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289264.1 protein_id gnl|my_center|LOCUS_21800 3600 1342 gene locus_tag LOCUS_21810 gene pflB 3600 1342 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_21810 5145 3808 gene locus_tag LOCUS_21820 5145 3808 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_21820 5590 5126 gene locus_tag LOCUS_21830 5590 5126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 6900 5728 gene locus_tag LOCUS_21840 6900 5728 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231837.1 protein_id gnl|my_center|LOCUS_21840 7656 6928 gene locus_tag LOCUS_21850 gene bioW 7656 6928 CDS product 6-carboxyhexanoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968009.1 protein_id gnl|my_center|LOCUS_21850 8207 7653 gene locus_tag LOCUS_21860 8207 7653 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200956.1 protein_id gnl|my_center|LOCUS_21860 8564 9049 gene locus_tag LOCUS_21870 8564 9049 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203239.1 protein_id gnl|my_center|LOCUS_21870 9568 9245 gene locus_tag LOCUS_21880 9568 9245 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032497467.1 protein_id gnl|my_center|LOCUS_21880 >Feature sequence116 2147 456 gene locus_tag LOCUS_21890 2147 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807777.1 protein_id gnl|my_center|LOCUS_21890 4505 2430 gene locus_tag LOCUS_21900 gene fusA 4505 2430 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_21900 6465 4690 gene locus_tag LOCUS_21910 gene cydC 6465 4690 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667625.1 protein_id gnl|my_center|LOCUS_21910 8237 6462 gene locus_tag LOCUS_21920 8237 6462 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995243.1 protein_id gnl|my_center|LOCUS_21920 8679 8278 gene locus_tag LOCUS_21930 8679 8278 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263753.1 protein_id gnl|my_center|LOCUS_21930 9118 8672 gene locus_tag LOCUS_21940 9118 8672 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986162.1 protein_id gnl|my_center|LOCUS_21940 >Feature sequence117 43 1716 gene locus_tag LOCUS_21950 43 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 2086 3174 gene locus_tag LOCUS_21960 2086 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 3171 3758 gene locus_tag LOCUS_21970 gene yfcE 3171 3758 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158446.1 protein_id gnl|my_center|LOCUS_21970 3734 4705 gene locus_tag LOCUS_21980 3734 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 4722 5957 gene locus_tag LOCUS_21990 4722 5957 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 protein_id gnl|my_center|LOCUS_21990 6031 8475 gene locus_tag LOCUS_22000 6031 8475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 8987 8481 gene locus_tag LOCUS_22010 8987 8481 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence118 56 472 gene locus_tag LOCUS_22020 56 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 481 1110 gene locus_tag LOCUS_22030 481 1110 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_22030 1221 2654 gene locus_tag LOCUS_22040 gene argH 1221 2654 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_22040 2808 3893 gene locus_tag LOCUS_22050 gene asd 2808 3893 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051614.1 protein_id gnl|my_center|LOCUS_22050 3994 5292 gene locus_tag LOCUS_22060 gene leuC 3994 5292 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_22060 5292 5783 gene locus_tag LOCUS_22070 gene leuD 5292 5783 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_22070 5848 7179 gene locus_tag LOCUS_22080 5848 7179 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048319.1 protein_id gnl|my_center|LOCUS_22080 7358 8845 gene locus_tag LOCUS_22090 gene thrC 7358 8845 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_22090 8938 9282 gene locus_tag LOCUS_22100 8938 9282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 >Feature sequence119 1 2634 gene locus_tag LOCUS_22110 gene mutS 1 2634 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_22110 2658 4703 gene locus_tag LOCUS_22120 gene mutL 2658 4703 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378991.1 protein_id gnl|my_center|LOCUS_22120 4704 5657 gene locus_tag LOCUS_22130 gene miaA 4704 5657 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_22130 5736 7046 gene locus_tag LOCUS_22140 5736 7046 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_22140 7144 8361 gene locus_tag LOCUS_22150 7144 8361 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_22150 >Feature sequence120 <1 1204 gene locus_tag LOCUS_22160 <1 1204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002285916.1:leucine--tRNA ligase 1527 1333 gene locus_tag LOCUS_22170 1527 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 2060 2419 gene locus_tag LOCUS_22180 2060 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 2477 2740 gene locus_tag LOCUS_22190 2477 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 2890 4494 gene locus_tag LOCUS_22200 2890 4494 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_22200 4646 7567 gene locus_tag LOCUS_22210 4646 7567 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_22210 7641 8537 gene locus_tag LOCUS_22220 gene era 7641 8537 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080241.1 protein_id gnl|my_center|LOCUS_22220 >Feature sequence121 2278 872 gene locus_tag LOCUS_22230 2278 872 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_22230 3048 2347 gene locus_tag LOCUS_22240 3048 2347 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_22240 5492 3117 gene locus_tag LOCUS_22250 5492 3117 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_22250 5629 6909 gene locus_tag LOCUS_22260 5629 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 6929 7873 gene locus_tag LOCUS_22270 6929 7873 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_22270 >Feature sequence122 1374 1090 gene locus_tag LOCUS_22280 gene rpmA 1374 1090 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916187.1 protein_id gnl|my_center|LOCUS_22280 1712 1380 gene locus_tag LOCUS_22290 1712 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2034 1726 gene locus_tag LOCUS_22300 gene rplU 2034 1726 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229668.1 protein_id gnl|my_center|LOCUS_22300 2598 2194 gene locus_tag LOCUS_22310 2598 2194 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 protein_id gnl|my_center|LOCUS_22310 3939 2620 gene locus_tag LOCUS_22320 3939 2620 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_22320 5280 4048 gene locus_tag LOCUS_22330 5280 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 6054 5356 gene locus_tag LOCUS_22340 6054 5356 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964567.1 protein_id gnl|my_center|LOCUS_22340 7903 6044 gene locus_tag LOCUS_22350 7903 6044 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_22350 >Feature sequence123 338 1087 gene locus_tag LOCUS_22360 338 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 1394 1140 gene locus_tag LOCUS_22370 1394 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 1487 2302 gene locus_tag LOCUS_22380 1487 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2758 2408 gene locus_tag LOCUS_22390 2758 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 3111 2758 gene locus_tag LOCUS_22400 3111 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 5143 3251 gene locus_tag LOCUS_22410 5143 3251 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 protein_id gnl|my_center|LOCUS_22410 5825 5325 gene locus_tag LOCUS_22420 5825 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 6734 5829 gene locus_tag LOCUS_22430 6734 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 7998 6886 gene locus_tag LOCUS_22440 gene ugpC 7998 6886 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_22440 >Feature sequence124 464 631 gene locus_tag LOCUS_22450 464 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 632 1228 gene locus_tag LOCUS_22460 632 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 1706 2929 gene locus_tag LOCUS_22470 gene tyrS 1706 2929 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_22470 2964 4190 gene locus_tag LOCUS_22480 gene hydF 2964 4190 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392791.1 protein_id gnl|my_center|LOCUS_22480 4226 5239 gene locus_tag LOCUS_22490 4226 5239 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051462.1 protein_id gnl|my_center|LOCUS_22490 6031 5201 gene locus_tag LOCUS_22500 6031 5201 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_22500 6301 6486 gene locus_tag LOCUS_22510 6301 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 6672 7847 gene locus_tag LOCUS_22520 6672 7847 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546117.1 protein_id gnl|my_center|LOCUS_22520 7829 8341 gene locus_tag LOCUS_22530 7829 8341 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544978.1 protein_id gnl|my_center|LOCUS_22530 >Feature sequence125 124 1233 gene locus_tag LOCUS_22540 gene rpsA 124 1233 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986222.1 protein_id gnl|my_center|LOCUS_22540 1500 2819 gene locus_tag LOCUS_22550 gene rsxC 1500 2819 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_22550 2836 3768 gene locus_tag LOCUS_22560 2836 3768 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_22560 3768 4382 gene locus_tag LOCUS_22570 3768 4382 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902280.1 protein_id gnl|my_center|LOCUS_22570 4375 5226 gene locus_tag LOCUS_22580 4375 5226 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948148.1 protein_id gnl|my_center|LOCUS_22580 5227 5832 gene locus_tag LOCUS_22590 gene rsxA 5227 5832 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_22590 5846 6640 gene locus_tag LOCUS_22600 5846 6640 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_22600 7842 6907 gene locus_tag LOCUS_22610 7842 6907 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964760.1 protein_id gnl|my_center|LOCUS_22610 >Feature sequence126 1715 789 gene locus_tag LOCUS_22620 1715 789 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068551.1 protein_id gnl|my_center|LOCUS_22620 2252 1740 gene locus_tag LOCUS_22630 2252 1740 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459551.1 protein_id gnl|my_center|LOCUS_22630 2509 3456 gene locus_tag LOCUS_22640 2509 3456 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257547.1 protein_id gnl|my_center|LOCUS_22640 3957 3598 gene locus_tag LOCUS_22650 3957 3598 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_22650 4217 4429 gene locus_tag LOCUS_22660 4217 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 4534 6531 gene locus_tag LOCUS_22670 gene feoB 4534 6531 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948746.1 protein_id gnl|my_center|LOCUS_22670 6614 6994 gene locus_tag LOCUS_22680 6614 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 7013 7300 gene locus_tag LOCUS_22690 7013 7300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 7455 7949 gene locus_tag LOCUS_22700 7455 7949 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948566.1 protein_id gnl|my_center|LOCUS_22700 >Feature sequence127 1701 511 gene locus_tag LOCUS_22710 1701 511 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948034.1 protein_id gnl|my_center|LOCUS_22710 2734 1859 gene locus_tag LOCUS_22720 2734 1859 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059810.1 protein_id gnl|my_center|LOCUS_22720 2972 3769 gene locus_tag LOCUS_22730 gene proB 2972 3769 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723561.1 protein_id gnl|my_center|LOCUS_22730 4743 3904 gene locus_tag LOCUS_22740 gene mutM 4743 3904 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_22740 5671 4772 gene locus_tag LOCUS_22750 5671 4772 CDS product radical SAM mobile pair protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679438.1 protein_id gnl|my_center|LOCUS_22750 6590 5652 gene locus_tag LOCUS_22760 6590 5652 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814554.1 protein_id gnl|my_center|LOCUS_22760 7048 6587 gene locus_tag LOCUS_22770 7048 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 7319 7119 gene locus_tag LOCUS_22780 7319 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 >Feature sequence128 1307 288 gene locus_tag LOCUS_22790 1307 288 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_22790 3702 1588 gene locus_tag LOCUS_22800 3702 1588 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_22800 4879 4016 gene locus_tag LOCUS_22810 gene fba 4879 4016 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_22810 5280 5825 gene locus_tag LOCUS_22820 5280 5825 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_22820 6089 7459 gene locus_tag LOCUS_22830 6089 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence129 73 243 gene locus_tag LOCUS_22840 73 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 182 1573 gene locus_tag LOCUS_22850 182 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 1661 2041 gene locus_tag LOCUS_22860 1661 2041 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_22860 2108 2749 gene locus_tag LOCUS_22870 2108 2749 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459534.1 protein_id gnl|my_center|LOCUS_22870 2746 3246 gene locus_tag LOCUS_22880 2746 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 3328 4266 gene locus_tag LOCUS_22890 3328 4266 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799698.1 protein_id gnl|my_center|LOCUS_22890 5416 4304 gene locus_tag LOCUS_22900 5416 4304 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812397.1 protein_id gnl|my_center|LOCUS_22900 6052 5594 gene locus_tag LOCUS_22910 6052 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 >Feature sequence130 19 1800 gene locus_tag LOCUS_22920 gene dnaG 19 1800 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_22920 1852 2967 gene locus_tag LOCUS_22930 gene rpoD 1852 2967 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_22930 3161 4009 gene locus_tag LOCUS_22940 3161 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 3999 4781 gene locus_tag LOCUS_22950 3999 4781 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_22950 4794 6464 gene locus_tag LOCUS_22960 4794 6464 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963991.1 protein_id gnl|my_center|LOCUS_22960 >Feature sequence131 70 531 gene locus_tag LOCUS_22970 gene spoVAC 70 531 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944604.1 protein_id gnl|my_center|LOCUS_22970 2473 539 gene locus_tag LOCUS_22980 2473 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 3967 2486 gene locus_tag LOCUS_22990 gene malQ 3967 2486 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_22990 6306 4051 gene locus_tag LOCUS_23000 gene glgP 6306 4051 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950158.1 protein_id gnl|my_center|LOCUS_23000 >Feature sequence132 541 1863 gene locus_tag LOCUS_23010 541 1863 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021185.1 protein_id gnl|my_center|LOCUS_23010 2175 1864 gene locus_tag LOCUS_23020 2175 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 2653 2180 gene locus_tag LOCUS_23030 2653 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 2839 3561 gene locus_tag LOCUS_23040 2839 3561 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889536.1 protein_id gnl|my_center|LOCUS_23040 6789 3637 gene locus_tag LOCUS_23050 6789 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 >Feature sequence133 809 2053 gene locus_tag LOCUS_23060 809 2053 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163760282.1 protein_id gnl|my_center|LOCUS_23060 2053 2856 gene locus_tag LOCUS_23070 2053 2856 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_23070 3584 2991 gene locus_tag LOCUS_23080 3584 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 3857 3630 gene locus_tag LOCUS_23090 3857 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 5888 3918 gene locus_tag LOCUS_23100 gene ligA 5888 3918 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965961.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence134 <1 1501 gene locus_tag LOCUS_23110 <1 1501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964594.1:molecular chaperone DnaK 1589 2776 gene locus_tag LOCUS_23120 gene dnaJ 1589 2776 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703154.1 protein_id gnl|my_center|LOCUS_23120 3200 2967 gene locus_tag LOCUS_23130 3200 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 3387 3728 gene locus_tag LOCUS_23140 3387 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 3860 5359 gene locus_tag LOCUS_23150 gene pap 3860 5359 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869086.1 protein_id gnl|my_center|LOCUS_23150 5390 6391 gene locus_tag LOCUS_23160 5390 6391 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_23160 >Feature sequence135 1475 384 gene locus_tag LOCUS_23170 1475 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 1998 1465 gene locus_tag LOCUS_23180 1998 1465 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355429.1 protein_id gnl|my_center|LOCUS_23180 2188 2712 gene locus_tag LOCUS_23190 2188 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 3394 5826 gene locus_tag LOCUS_23200 gene leuS 3394 5826 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 protein_id gnl|my_center|LOCUS_23200 6047 6487 gene locus_tag LOCUS_23210 6047 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 >Feature sequence136 971 1954 gene locus_tag LOCUS_23220 gene holA 971 1954 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362655.1 protein_id gnl|my_center|LOCUS_23220 1994 3808 gene locus_tag LOCUS_23230 gene lepA 1994 3808 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_23230 3819 5156 gene locus_tag LOCUS_23240 gene hemW 3819 5156 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964591.1 protein_id gnl|my_center|LOCUS_23240 5304 5765 gene locus_tag LOCUS_23250 5304 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence137 1959 3920 gene locus_tag LOCUS_23260 gene glgB 1959 3920 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141306.1 protein_id gnl|my_center|LOCUS_23260 3983 6082 gene locus_tag LOCUS_23270 3983 6082 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_23270 >Feature sequence138 626 72 gene locus_tag LOCUS_23280 gene lepB 626 72 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392487.1 protein_id gnl|my_center|LOCUS_23280 2048 1149 gene locus_tag LOCUS_23290 2048 1149 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460597.1 protein_id gnl|my_center|LOCUS_23290 2968 2114 gene locus_tag LOCUS_23300 2968 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 3878 2961 gene locus_tag LOCUS_23310 3878 2961 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004846624.1 protein_id gnl|my_center|LOCUS_23310 4762 4067 gene locus_tag LOCUS_23320 4762 4067 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202796158.1 protein_id gnl|my_center|LOCUS_23320 5013 5963 gene locus_tag LOCUS_23330 5013 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 >Feature sequence139 <1 817 gene locus_tag LOCUS_23340 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682246.1:Rpn family recombination-promoting nuclease/putative transposase 2250 997 gene locus_tag LOCUS_23350 2250 997 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861243.1 protein_id gnl|my_center|LOCUS_23350 3614 2382 gene locus_tag LOCUS_23360 3614 2382 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_23360 3836 4936 gene locus_tag LOCUS_23370 gene glf 3836 4936 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_23370 5201 5869 gene locus_tag LOCUS_23380 5201 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 >Feature sequence140 <1 863 gene locus_tag LOCUS_23390 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017143394.1:permease 1022 1729 gene locus_tag LOCUS_23400 1022 1729 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939837.1 protein_id gnl|my_center|LOCUS_23400 1732 3003 gene locus_tag LOCUS_23410 1732 3003 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027623.1 protein_id gnl|my_center|LOCUS_23410 3158 3319 gene locus_tag LOCUS_23420 3158 3319 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_23420 3380 3565 gene locus_tag LOCUS_23430 3380 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 3547 4926 gene locus_tag LOCUS_23440 3547 4926 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_23440 5034 5477 gene locus_tag LOCUS_23450 5034 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 5663 6013 gene locus_tag LOCUS_23460 5663 6013 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393074.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence141 365 1126 gene locus_tag LOCUS_23470 365 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 1129 1740 gene locus_tag LOCUS_23480 1129 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 2933 1749 gene locus_tag LOCUS_23490 2933 1749 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461803.1 protein_id gnl|my_center|LOCUS_23490 4537 2939 gene locus_tag LOCUS_23500 4537 2939 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510938.1 protein_id gnl|my_center|LOCUS_23500 4708 5550 gene locus_tag LOCUS_23510 4708 5550 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948775.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence142 2241 697 gene locus_tag LOCUS_23520 2241 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 4006 2258 gene locus_tag LOCUS_23530 4006 2258 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015253363.1 protein_id gnl|my_center|LOCUS_23530 <5621 4143 gene locus_tag LOCUS_23540 <5621 4143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_111696793.1:sulfatase-like hydrolase/transferase >Feature sequence143 270 2207 gene locus_tag LOCUS_23550 gene gyrB 270 2207 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815132.1 protein_id gnl|my_center|LOCUS_23550 2316 4835 gene locus_tag LOCUS_23560 gene gyrA 2316 4835 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_23560 >Feature sequence144 477 2399 gene locus_tag LOCUS_23570 gene gyrB 477 2399 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_23570 2495 4738 gene locus_tag LOCUS_23580 gene gyrA 2495 4738 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence145 1066 329 gene locus_tag LOCUS_23590 1066 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 1351 3003 gene locus_tag LOCUS_23600 1351 3003 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_23600 3021 3632 gene locus_tag LOCUS_23610 3021 3632 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_23610 3749 5047 gene locus_tag LOCUS_23620 gene eno 3749 5047 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964032.1 protein_id gnl|my_center|LOCUS_23620 >Feature sequence146 647 228 gene locus_tag LOCUS_23630 647 228 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877456.1 protein_id gnl|my_center|LOCUS_23630 1319 744 gene locus_tag LOCUS_23640 1319 744 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_23640 3067 1322 gene locus_tag LOCUS_23650 gene iorA 3067 1322 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_23650 4379 3069 gene locus_tag LOCUS_23660 4379 3069 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393761.1 protein_id gnl|my_center|LOCUS_23660 <5169 4546 gene locus_tag LOCUS_23670 <5169 4546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001196184.1:C39 family peptidase >Feature sequence147 29 2632 gene locus_tag LOCUS_23680 gene clpB 29 2632 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_23680 2685 3965 gene locus_tag LOCUS_23690 2685 3965 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963608.1 protein_id gnl|my_center|LOCUS_23690 3943 4959 gene locus_tag LOCUS_23700 3943 4959 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963395.1 protein_id gnl|my_center|LOCUS_23700 >Feature sequence148 <1 641 gene locus_tag LOCUS_23710 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010905982.1:bacterial Ig-like domain-containing protein 832 2163 gene locus_tag LOCUS_23720 832 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 2236 3159 gene locus_tag LOCUS_23730 2236 3159 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_23730 3331 4347 gene locus_tag LOCUS_23740 gene galE 3331 4347 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_23740 >Feature sequence149 <1 2296 gene locus_tag LOCUS_23750 <1 2296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000808183.1:PBP1A family penicillin-binding protein 3786 2572 gene locus_tag LOCUS_23760 3786 2572 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072530700.1 protein_id gnl|my_center|LOCUS_23760 <4716 3985 gene locus_tag LOCUS_23770 <4716 3985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965901.1:ROK family glucokinase >Feature sequence150 65 244 gene locus_tag LOCUS_23780 65 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 219 452 gene locus_tag LOCUS_23790 219 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 1235 540 gene locus_tag LOCUS_23800 1235 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 3459 1357 gene locus_tag LOCUS_23810 3459 1357 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860878.1 protein_id gnl|my_center|LOCUS_23810 4201 3446 gene locus_tag LOCUS_23820 4201 3446 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895631.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence151 488 1162 gene locus_tag LOCUS_23830 488 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 1424 1182 gene locus_tag LOCUS_23840 1424 1182 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357396.1 protein_id gnl|my_center|LOCUS_23840 1757 2833 gene locus_tag LOCUS_23850 1757 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 >Feature sequence152 1032 424 gene locus_tag LOCUS_23860 1032 424 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964199.1 protein_id gnl|my_center|LOCUS_23860 1196 3544 gene locus_tag LOCUS_23870 gene pcrA 1196 3544 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225356248.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence153 266 102 gene locus_tag LOCUS_23880 266 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 1142 759 gene locus_tag LOCUS_23890 1142 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 1693 1621 gene locus_tag LOCUS_t00380 1693 1621 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3505 1916 gene locus_tag LOCUS_23900 3505 1916 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198738.1 protein_id gnl|my_center|LOCUS_23900 3773 3612 gene locus_tag LOCUS_23910 3773 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 <4469 3862 gene locus_tag LOCUS_23920 <4469 3862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398646.1:tRNA (guanosine(46)-N7)-methyltransferase TrmB >Feature sequence154 1320 301 gene locus_tag LOCUS_23930 gene ilvC 1320 301 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081338.1 protein_id gnl|my_center|LOCUS_23930 1842 1345 gene locus_tag LOCUS_23940 gene ilvN 1842 1345 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_23940 3877 2030 gene locus_tag LOCUS_23950 3877 2030 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460031.1 protein_id gnl|my_center|LOCUS_23950 >Feature sequence155 505 2247 gene locus_tag LOCUS_23960 505 2247 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_23960 3970 2849 gene locus_tag LOCUS_23970 3970 2849 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775575.1 protein_id gnl|my_center|LOCUS_23970 >Feature sequence156 566 2233 gene locus_tag LOCUS_23980 566 2233 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_23980 2325 3776 gene locus_tag LOCUS_23990 2325 3776 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891874.1 protein_id gnl|my_center|LOCUS_23990 >Feature sequence157 3137 1785 gene locus_tag LOCUS_24000 3137 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 3291 3539 gene locus_tag LOCUS_24010 3291 3539 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214020.1 protein_id gnl|my_center|LOCUS_24010 >Feature sequence158 108 491 gene locus_tag LOCUS_24020 108 491 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430051.1 protein_id gnl|my_center|LOCUS_24020 475 1173 gene locus_tag LOCUS_24030 475 1173 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_24030 1167 1955 gene locus_tag LOCUS_24040 1167 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922087.1 protein_id gnl|my_center|LOCUS_24040 2151 2080 gene locus_tag LOCUS_t00390 2151 2080 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3790 2357 gene locus_tag LOCUS_24050 3790 2357 CDS product ISLre2-like element ISMoth2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393717.1 protein_id gnl|my_center|LOCUS_24050 >Feature sequence159 607 278 gene locus_tag LOCUS_24060 607 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 1424 618 gene locus_tag LOCUS_24070 1424 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 2692 1424 gene locus_tag LOCUS_24080 2692 1424 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144956692.1 protein_id gnl|my_center|LOCUS_24080 2846 3349 gene locus_tag LOCUS_24090 2846 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence160 60 338 gene locus_tag LOCUS_24100 60 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 338 1690 gene locus_tag LOCUS_24110 gene secY 338 1690 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_24110 1833 2477 gene locus_tag LOCUS_24120 1833 2477 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966391.1 protein_id gnl|my_center|LOCUS_24120 2483 2734 gene locus_tag LOCUS_24130 2483 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 2772 2990 gene locus_tag LOCUS_24140 gene infA 2772 2990 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029884.1 protein_id gnl|my_center|LOCUS_24140 >Feature sequence161 1414 140 gene locus_tag LOCUS_24150 1414 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 1664 1834 gene locus_tag LOCUS_24160 1664 1834 CDS product antitoxin VbhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272462.1 protein_id gnl|my_center|LOCUS_24160 1839 2102 gene locus_tag LOCUS_24170 1839 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 2190 2357 gene locus_tag LOCUS_24180 2190 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 3048 2350 gene locus_tag LOCUS_24190 3048 2350 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895627.1 protein_id gnl|my_center|LOCUS_24190 >Feature sequence162 2077 668 gene locus_tag LOCUS_24200 gene ngcE 2077 668 CDS product N-acetylglucosamine/diacetylchitobiose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776381.1 protein_id gnl|my_center|LOCUS_24200 <3731 2397 gene locus_tag LOCUS_24210 <3731 2397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020940.1:sodium-dependent transporter >Feature sequence163 335 201 gene locus_tag LOCUS_24220 335 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 334 1047 gene locus_tag LOCUS_24230 334 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 1355 2707 gene locus_tag LOCUS_24240 1355 2707 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_24240 >Feature sequence164 147 73 gene locus_tag LOCUS_t00400 147 73 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 823 338 gene locus_tag LOCUS_24250 823 338 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645445.1 protein_id gnl|my_center|LOCUS_24250 1434 820 gene locus_tag LOCUS_24260 1434 820 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357527.1 protein_id gnl|my_center|LOCUS_24260 2645 1479 gene locus_tag LOCUS_24270 2645 1479 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521224.1 protein_id gnl|my_center|LOCUS_24270 2993 2790 gene locus_tag LOCUS_24280 2993 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence165 1255 473 gene locus_tag LOCUS_24290 1255 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 1356 2435 gene locus_tag LOCUS_24300 1356 2435 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_24300 >Feature sequence166 1171 389 gene locus_tag LOCUS_24310 1171 389 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_24310 1724 1296 gene locus_tag LOCUS_24320 1724 1296 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902921.1 protein_id gnl|my_center|LOCUS_24320 2384 1785 gene locus_tag LOCUS_24330 2384 1785 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence167 <1 1618 gene locus_tag LOCUS_24340 <1 1618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288004.1:response regulator 2705 1623 gene locus_tag LOCUS_24350 gene araR 2705 1623 CDS product arabinose utilization transcriptional regulator AraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243070.1 protein_id gnl|my_center|LOCUS_24350 >Feature sequence168 308 1912 gene locus_tag LOCUS_24360 308 1912 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_24360 2051 2329 gene locus_tag LOCUS_24370 2051 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 2367 2501 gene locus_tag LOCUS_24380 2367 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380