>Feature sequence001 20 367 gene locus_tag LOCUS_00010 20 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 394 1338 gene locus_tag LOCUS_00020 394 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1335 2741 gene locus_tag LOCUS_00030 1335 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2762 2995 gene locus_tag LOCUS_00040 gene acpP 2762 2995 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154310.1 protein_id gnl|my_center|LOCUS_00040 3025 4533 gene locus_tag LOCUS_00050 3025 4533 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_00050 4832 6136 gene locus_tag LOCUS_00060 4832 6136 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047742.1 protein_id gnl|my_center|LOCUS_00060 6130 7794 gene locus_tag LOCUS_00070 6130 7794 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047743.1 protein_id gnl|my_center|LOCUS_00070 7791 8909 gene locus_tag LOCUS_00080 7791 8909 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966934.1 protein_id gnl|my_center|LOCUS_00080 9016 10080 gene locus_tag LOCUS_00090 9016 10080 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798095.1 protein_id gnl|my_center|LOCUS_00090 10429 11658 gene locus_tag LOCUS_00100 10429 11658 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114397.1 protein_id gnl|my_center|LOCUS_00100 11709 12629 gene locus_tag LOCUS_00110 11709 12629 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114399.1 protein_id gnl|my_center|LOCUS_00110 12626 13447 gene locus_tag LOCUS_00120 12626 13447 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114402.1 protein_id gnl|my_center|LOCUS_00120 13552 16545 gene locus_tag LOCUS_00130 gene ebgA 13552 16545 CDS product beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706828.1 protein_id gnl|my_center|LOCUS_00130 16563 18875 gene locus_tag LOCUS_00140 16563 18875 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886611.1 protein_id gnl|my_center|LOCUS_00140 18892 19758 gene locus_tag LOCUS_00150 18892 19758 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004121002.1 protein_id gnl|my_center|LOCUS_00150 19772 20410 gene locus_tag LOCUS_00160 gene pgmB 19772 20410 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114408.1 protein_id gnl|my_center|LOCUS_00160 20407 21462 gene locus_tag LOCUS_00170 20407 21462 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065828.1 protein_id gnl|my_center|LOCUS_00170 21562 22560 gene locus_tag LOCUS_00180 21562 22560 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379303.1 protein_id gnl|my_center|LOCUS_00180 22902 23504 gene locus_tag LOCUS_00190 22902 23504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 23697 24278 gene locus_tag LOCUS_00200 23697 24278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 24399 25346 gene locus_tag LOCUS_00210 gene aroE 24399 25346 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102190.1 protein_id gnl|my_center|LOCUS_00210 25355 25540 gene locus_tag LOCUS_00220 25355 25540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25997 25665 gene locus_tag LOCUS_00230 25997 25665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 26382 25978 gene locus_tag LOCUS_00240 26382 25978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 27358 26477 gene locus_tag LOCUS_00250 27358 26477 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_00250 27560 28147 gene locus_tag LOCUS_00260 27560 28147 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818015.1 protein_id gnl|my_center|LOCUS_00260 28147 29136 gene locus_tag LOCUS_00270 28147 29136 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567680.1 protein_id gnl|my_center|LOCUS_00270 29153 29731 gene locus_tag LOCUS_00280 29153 29731 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966771.1 protein_id gnl|my_center|LOCUS_00280 29820 30239 gene locus_tag LOCUS_00290 29820 30239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 30244 31131 gene locus_tag LOCUS_00300 30244 31131 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101944.1 protein_id gnl|my_center|LOCUS_00300 33081 31393 gene locus_tag LOCUS_00310 33081 31393 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_00310 34718 33489 gene locus_tag LOCUS_00320 34718 33489 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272444.1 protein_id gnl|my_center|LOCUS_00320 34997 37096 gene locus_tag LOCUS_00330 34997 37096 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_00330 37297 39321 gene locus_tag LOCUS_00340 37297 39321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 39991 39410 gene locus_tag LOCUS_00350 39991 39410 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965893.1 protein_id gnl|my_center|LOCUS_00350 40248 41648 gene locus_tag LOCUS_00360 40248 41648 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095593.1 protein_id gnl|my_center|LOCUS_00360 41663 42679 gene locus_tag LOCUS_00370 41663 42679 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815867.1 protein_id gnl|my_center|LOCUS_00370 42861 43883 gene locus_tag LOCUS_00380 42861 43883 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_00380 44060 45004 gene locus_tag LOCUS_00390 44060 45004 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002940642.1 protein_id gnl|my_center|LOCUS_00390 45004 45807 gene locus_tag LOCUS_00400 45004 45807 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_00400 46098 46985 gene locus_tag LOCUS_00410 46098 46985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 47267 48391 gene locus_tag LOCUS_00420 47267 48391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 48381 49409 gene locus_tag LOCUS_00430 gene isdE 48381 49409 CDS product heme ABC transporter substrate-binding protein IsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922615.1 protein_id gnl|my_center|LOCUS_00430 49422 50486 gene locus_tag LOCUS_00440 49422 50486 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036831.1 protein_id gnl|my_center|LOCUS_00440 50476 51273 gene locus_tag LOCUS_00450 50476 51273 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922614.1 protein_id gnl|my_center|LOCUS_00450 51284 51676 gene locus_tag LOCUS_00460 51284 51676 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682353.1 protein_id gnl|my_center|LOCUS_00460 51669 53423 gene locus_tag LOCUS_00470 51669 53423 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995243.1 protein_id gnl|my_center|LOCUS_00470 53420 55111 gene locus_tag LOCUS_00480 gene cydC 53420 55111 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667625.1 protein_id gnl|my_center|LOCUS_00480 55131 55487 gene locus_tag LOCUS_00490 55131 55487 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_00490 55655 58126 gene locus_tag LOCUS_00500 55655 58126 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476221.1 protein_id gnl|my_center|LOCUS_00500 58368 60170 gene locus_tag LOCUS_00510 58368 60170 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986475.1 protein_id gnl|my_center|LOCUS_00510 60249 60470 gene locus_tag LOCUS_00520 60249 60470 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358284.1 protein_id gnl|my_center|LOCUS_00520 60473 61222 gene locus_tag LOCUS_00530 60473 61222 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545472.1 protein_id gnl|my_center|LOCUS_00530 61219 62193 gene locus_tag LOCUS_00540 gene moaA 61219 62193 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371204.1 protein_id gnl|my_center|LOCUS_00540 62196 62636 gene locus_tag LOCUS_00550 62196 62636 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545911.1 protein_id gnl|my_center|LOCUS_00550 62700 63638 gene locus_tag LOCUS_00560 62700 63638 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986485.1 protein_id gnl|my_center|LOCUS_00560 63654 64340 gene locus_tag LOCUS_00570 63654 64340 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986484.1 protein_id gnl|my_center|LOCUS_00570 64327 65034 gene locus_tag LOCUS_00580 gene yecC 64327 65034 CDS product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272995.1 protein_id gnl|my_center|LOCUS_00580 65053 66285 gene locus_tag LOCUS_00590 65053 66285 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542268.1 protein_id gnl|my_center|LOCUS_00590 66295 68205 gene locus_tag LOCUS_00600 66295 68205 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986480.1 protein_id gnl|my_center|LOCUS_00600 68231 68692 gene locus_tag LOCUS_00610 68231 68692 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986477.1 protein_id gnl|my_center|LOCUS_00610 69085 70206 gene locus_tag LOCUS_00620 gene ribD 69085 70206 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905672.1 protein_id gnl|my_center|LOCUS_00620 70187 70849 gene locus_tag LOCUS_00630 70187 70849 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_00630 70864 72063 gene locus_tag LOCUS_00640 70864 72063 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456640.1 protein_id gnl|my_center|LOCUS_00640 72145 72615 gene locus_tag LOCUS_00650 gene ribE 72145 72615 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099502.1 protein_id gnl|my_center|LOCUS_00650 72750 74897 gene locus_tag LOCUS_00660 72750 74897 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438236.1 protein_id gnl|my_center|LOCUS_00660 74917 75591 gene locus_tag LOCUS_00670 74917 75591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 75661 75876 gene locus_tag LOCUS_00680 75661 75876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 75879 76130 gene locus_tag LOCUS_00690 75879 76130 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080272.1 protein_id gnl|my_center|LOCUS_00690 76621 77736 gene locus_tag LOCUS_00700 76621 77736 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682022.1 protein_id gnl|my_center|LOCUS_00700 77752 78816 gene locus_tag LOCUS_00710 77752 78816 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669987.1 protein_id gnl|my_center|LOCUS_00710 78813 79571 gene locus_tag LOCUS_00720 78813 79571 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682019.1 protein_id gnl|my_center|LOCUS_00720 80448 79561 gene locus_tag LOCUS_00730 80448 79561 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736179.1 protein_id gnl|my_center|LOCUS_00730 80607 82022 gene locus_tag LOCUS_00740 80607 82022 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346373.1 protein_id gnl|my_center|LOCUS_00740 82186 85755 gene locus_tag LOCUS_00750 82186 85755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 86509 85820 gene locus_tag LOCUS_00760 86509 85820 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234892.1 protein_id gnl|my_center|LOCUS_00760 86883 86506 gene locus_tag LOCUS_00770 86883 86506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 >Feature sequence002 810 82 gene locus_tag LOCUS_00780 810 82 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662263.1 protein_id gnl|my_center|LOCUS_00780 1070 831 gene locus_tag LOCUS_00790 1070 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 3501 1216 gene locus_tag LOCUS_00800 3501 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 4378 3605 gene locus_tag LOCUS_00810 4378 3605 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948811.1 protein_id gnl|my_center|LOCUS_00810 5291 4371 gene locus_tag LOCUS_00820 5291 4371 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016023.1 protein_id gnl|my_center|LOCUS_00820 6347 5322 gene locus_tag LOCUS_00830 6347 5322 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948809.1 protein_id gnl|my_center|LOCUS_00830 9072 6832 gene locus_tag LOCUS_00840 9072 6832 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776044.1 protein_id gnl|my_center|LOCUS_00840 9963 9196 gene locus_tag LOCUS_00850 9963 9196 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687382.1 protein_id gnl|my_center|LOCUS_00850 11059 9968 gene locus_tag LOCUS_00860 gene phnW 11059 9968 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002326249.1 protein_id gnl|my_center|LOCUS_00860 12096 11089 gene locus_tag LOCUS_00870 12096 11089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 13725 12100 gene locus_tag LOCUS_00880 13725 12100 CDS product putative 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861730.1 protein_id gnl|my_center|LOCUS_00880 14500 13730 gene locus_tag LOCUS_00890 14500 13730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 15552 14665 gene locus_tag LOCUS_00900 15552 14665 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003822980.1 protein_id gnl|my_center|LOCUS_00900 17086 15755 gene locus_tag LOCUS_00910 17086 15755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 17307 17089 gene locus_tag LOCUS_00920 17307 17089 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829211.1 protein_id gnl|my_center|LOCUS_00920 17775 17323 gene locus_tag LOCUS_00930 17775 17323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 18246 17974 gene locus_tag LOCUS_00940 18246 17974 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_00940 18512 18249 gene locus_tag LOCUS_00950 18512 18249 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113434.1 protein_id gnl|my_center|LOCUS_00950 18742 19860 gene locus_tag LOCUS_00960 18742 19860 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659021.1 protein_id gnl|my_center|LOCUS_00960 19862 20773 gene locus_tag LOCUS_00970 19862 20773 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948544.1 protein_id gnl|my_center|LOCUS_00970 20770 21555 gene locus_tag LOCUS_00980 20770 21555 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948543.1 protein_id gnl|my_center|LOCUS_00980 21674 22405 gene locus_tag LOCUS_00990 21674 22405 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861321.1 protein_id gnl|my_center|LOCUS_00990 22402 24834 gene locus_tag LOCUS_01000 22402 24834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 26862 25081 gene locus_tag LOCUS_01010 26862 25081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 27603 26974 gene locus_tag LOCUS_01020 27603 26974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 28828 27560 gene locus_tag LOCUS_01030 28828 27560 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861862.1 protein_id gnl|my_center|LOCUS_01030 29696 28809 gene locus_tag LOCUS_01040 29696 28809 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433732.1 protein_id gnl|my_center|LOCUS_01040 30934 29798 gene locus_tag LOCUS_01050 30934 29798 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021366129.1 protein_id gnl|my_center|LOCUS_01050 31593 30922 gene locus_tag LOCUS_01060 31593 30922 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860834.1 protein_id gnl|my_center|LOCUS_01060 31831 32766 gene locus_tag LOCUS_01070 31831 32766 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_01070 32923 33045 gene locus_tag LOCUS_01080 32923 33045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 33526 33104 gene locus_tag LOCUS_01090 33526 33104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 34607 33861 gene locus_tag LOCUS_01100 34607 33861 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186843528.1 protein_id gnl|my_center|LOCUS_01100 36064 34922 gene locus_tag LOCUS_01110 36064 34922 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169508.1 protein_id gnl|my_center|LOCUS_01110 37773 36328 gene locus_tag LOCUS_01120 37773 36328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 37967 38275 gene locus_tag LOCUS_01130 37967 38275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 38291 38479 gene locus_tag LOCUS_01140 38291 38479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 38731 39384 gene locus_tag LOCUS_01150 38731 39384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01150 39294 40031 gene locus_tag LOCUS_01160 39294 40031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 40049 40933 gene locus_tag LOCUS_01170 40049 40933 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860758.1 protein_id gnl|my_center|LOCUS_01170 41147 41995 gene locus_tag LOCUS_01180 41147 41995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 42581 42312 gene locus_tag LOCUS_01190 42581 42312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 42904 42695 gene locus_tag LOCUS_01200 42904 42695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 44055 42901 gene locus_tag LOCUS_01210 44055 42901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 44205 45083 gene locus_tag LOCUS_01220 44205 45083 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_01220 45533 45171 gene locus_tag LOCUS_01230 45533 45171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 46126 45554 gene locus_tag LOCUS_01240 46126 45554 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_01240 46736 46185 gene locus_tag LOCUS_01250 46736 46185 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764887.1 protein_id gnl|my_center|LOCUS_01250 46881 47213 gene locus_tag LOCUS_01260 46881 47213 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420359.1 protein_id gnl|my_center|LOCUS_01260 48530 47358 gene locus_tag LOCUS_01270 48530 47358 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764888.1 protein_id gnl|my_center|LOCUS_01270 48699 49610 gene locus_tag LOCUS_01280 48699 49610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 50028 49684 gene locus_tag LOCUS_01290 50028 49684 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459853.1 protein_id gnl|my_center|LOCUS_01290 50248 50610 gene locus_tag LOCUS_01300 50248 50610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 50716 52101 gene locus_tag LOCUS_01310 50716 52101 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100875.1 protein_id gnl|my_center|LOCUS_01310 52601 52131 gene locus_tag LOCUS_01320 52601 52131 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272550.1 protein_id gnl|my_center|LOCUS_01320 >Feature sequence003 1371 322 gene locus_tag LOCUS_01330 1371 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 1589 1368 gene locus_tag LOCUS_01340 1589 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 1950 1627 gene locus_tag LOCUS_01350 1950 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 2727 1981 gene locus_tag LOCUS_01360 gene istB 2727 1981 CDS product IS21-like element ISRsp2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167668023.1 protein_id gnl|my_center|LOCUS_01360 4273 2717 gene locus_tag LOCUS_01370 gene istA 4273 2717 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_01370 4460 5218 gene locus_tag LOCUS_01380 4460 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 5218 6504 gene locus_tag LOCUS_01390 5218 6504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 6822 7517 gene locus_tag LOCUS_01400 6822 7517 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479233.1 protein_id gnl|my_center|LOCUS_01400 7792 7541 gene locus_tag LOCUS_01410 7792 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 7899 8216 gene locus_tag LOCUS_01420 7899 8216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 8455 9591 gene locus_tag LOCUS_01430 8455 9591 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054278179.1 protein_id gnl|my_center|LOCUS_01430 9925 10467 gene locus_tag LOCUS_01440 9925 10467 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_01440 10671 11171 gene locus_tag LOCUS_01450 10671 11171 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810593.1 protein_id gnl|my_center|LOCUS_01450 11173 11931 gene locus_tag LOCUS_01460 11173 11931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 11915 12796 gene locus_tag LOCUS_01470 11915 12796 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_01470 12796 14007 gene locus_tag LOCUS_01480 12796 14007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 14284 14421 gene locus_tag LOCUS_01490 14284 14421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 14591 16270 gene locus_tag LOCUS_01500 14591 16270 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964065.1 protein_id gnl|my_center|LOCUS_01500 16414 16980 gene locus_tag LOCUS_01510 16414 16980 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130266.1 protein_id gnl|my_center|LOCUS_01510 17081 18499 gene locus_tag LOCUS_01520 17081 18499 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948739.1 protein_id gnl|my_center|LOCUS_01520 18535 19824 gene locus_tag LOCUS_01530 18535 19824 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948740.1 protein_id gnl|my_center|LOCUS_01530 19824 20192 gene locus_tag LOCUS_01540 19824 20192 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399582.1 protein_id gnl|my_center|LOCUS_01540 20219 21046 gene locus_tag LOCUS_01550 20219 21046 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627865.1 protein_id gnl|my_center|LOCUS_01550 21068 21775 gene locus_tag LOCUS_01560 gene sfsA 21068 21775 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_01560 21769 22821 gene locus_tag LOCUS_01570 gene mutY 21769 22821 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243838.1 protein_id gnl|my_center|LOCUS_01570 22823 23839 gene locus_tag LOCUS_01580 22823 23839 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_01580 24055 25464 gene locus_tag LOCUS_01590 24055 25464 CDS product acyclic terpene utilization AtuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124259.1 protein_id gnl|my_center|LOCUS_01590 25451 25771 gene locus_tag LOCUS_01600 25451 25771 CDS product DUF4387 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817378.1 protein_id gnl|my_center|LOCUS_01600 25784 26710 gene locus_tag LOCUS_01610 25784 26710 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803821.1 protein_id gnl|my_center|LOCUS_01610 26727 27596 gene locus_tag LOCUS_01620 26727 27596 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357901.1 protein_id gnl|my_center|LOCUS_01620 27593 28300 gene locus_tag LOCUS_01630 27593 28300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 28297 30093 gene locus_tag LOCUS_01640 28297 30093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 30090 31559 gene locus_tag LOCUS_01650 30090 31559 CDS product DUF3502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161603547.1 protein_id gnl|my_center|LOCUS_01650 31570 32556 gene locus_tag LOCUS_01660 31570 32556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 32652 34757 gene locus_tag LOCUS_01670 32652 34757 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537441.1 protein_id gnl|my_center|LOCUS_01670 34776 35888 gene locus_tag LOCUS_01680 34776 35888 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295249.1 protein_id gnl|my_center|LOCUS_01680 35899 36792 gene locus_tag LOCUS_01690 gene rbsK 35899 36792 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693668.1 protein_id gnl|my_center|LOCUS_01690 36807 37505 gene locus_tag LOCUS_01700 36807 37505 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460218.1 protein_id gnl|my_center|LOCUS_01700 38200 37550 gene locus_tag LOCUS_01710 38200 37550 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713757.1 protein_id gnl|my_center|LOCUS_01710 39124 38285 gene locus_tag LOCUS_01720 39124 38285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 40065 39142 gene locus_tag LOCUS_01730 40065 39142 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379732.1 protein_id gnl|my_center|LOCUS_01730 40211 40681 gene locus_tag LOCUS_01740 40211 40681 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964912.1 protein_id gnl|my_center|LOCUS_01740 41648 40857 gene locus_tag LOCUS_01750 gene cwlC 41648 40857 CDS product sporulation-specific N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244862.1 protein_id gnl|my_center|LOCUS_01750 42031 43272 gene locus_tag LOCUS_01760 42031 43272 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461712.1 protein_id gnl|my_center|LOCUS_01760 43290 43646 gene locus_tag LOCUS_01770 43290 43646 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461711.1 protein_id gnl|my_center|LOCUS_01770 43871 44494 gene locus_tag LOCUS_01780 43871 44494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 44662 45516 gene locus_tag LOCUS_01790 44662 45516 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_01790 45506 46138 gene locus_tag LOCUS_01800 45506 46138 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963967.1 protein_id gnl|my_center|LOCUS_01800 46129 46668 gene locus_tag LOCUS_01810 46129 46668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 46682 47581 gene locus_tag LOCUS_01820 46682 47581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 47729 48787 gene locus_tag LOCUS_01830 gene citC 47729 48787 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016310.1 protein_id gnl|my_center|LOCUS_01830 48777 50231 gene locus_tag LOCUS_01840 gene citG 48777 50231 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668027.1 protein_id gnl|my_center|LOCUS_01840 50215 51168 gene locus_tag LOCUS_01850 50215 51168 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965544.1 protein_id gnl|my_center|LOCUS_01850 51209 51787 gene locus_tag LOCUS_01860 51209 51787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 >Feature sequence004 687 154 gene locus_tag LOCUS_01870 687 154 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_01870 2648 771 gene locus_tag LOCUS_01880 2648 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 3589 2645 gene locus_tag LOCUS_01890 3589 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 4994 3636 gene locus_tag LOCUS_01900 4994 3636 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966729.1 protein_id gnl|my_center|LOCUS_01900 6792 5068 gene locus_tag LOCUS_01910 6792 5068 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_01910 7939 6863 gene locus_tag LOCUS_01920 7939 6863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 9042 7999 gene locus_tag LOCUS_01930 9042 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 9712 9020 gene locus_tag LOCUS_01940 9712 9020 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994403.1 protein_id gnl|my_center|LOCUS_01940 10396 9764 gene locus_tag LOCUS_01950 10396 9764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 11695 10514 gene locus_tag LOCUS_01960 11695 10514 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108595.1 protein_id gnl|my_center|LOCUS_01960 12872 11685 gene locus_tag LOCUS_01970 12872 11685 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583022.1 protein_id gnl|my_center|LOCUS_01970 13900 12875 gene locus_tag LOCUS_01980 13900 12875 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080062.1 protein_id gnl|my_center|LOCUS_01980 14773 13931 gene locus_tag LOCUS_01990 14773 13931 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 protein_id gnl|my_center|LOCUS_01990 15795 14770 gene locus_tag LOCUS_02000 15795 14770 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 protein_id gnl|my_center|LOCUS_02000 17240 15855 gene locus_tag LOCUS_02010 17240 15855 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 protein_id gnl|my_center|LOCUS_02010 18588 17581 gene locus_tag LOCUS_02020 18588 17581 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_02020 19612 18590 gene locus_tag LOCUS_02030 19612 18590 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_02030 21834 19651 gene locus_tag LOCUS_02040 21834 19651 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584017.1 protein_id gnl|my_center|LOCUS_02040 22074 22643 gene locus_tag LOCUS_02050 22074 22643 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163262681.1 protein_id gnl|my_center|LOCUS_02050 22647 23693 gene locus_tag LOCUS_02060 22647 23693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 24592 23774 gene locus_tag LOCUS_02070 gene folK 24592 23774 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016121.1 protein_id gnl|my_center|LOCUS_02070 25406 24600 gene locus_tag LOCUS_02080 gene folP 25406 24600 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966209.1 protein_id gnl|my_center|LOCUS_02080 25961 25425 gene locus_tag LOCUS_02090 25961 25425 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966208.1 protein_id gnl|my_center|LOCUS_02090 26466 25909 gene locus_tag LOCUS_02100 gene folE 26466 25909 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380915.1 protein_id gnl|my_center|LOCUS_02100 26596 26459 gene locus_tag LOCUS_02110 26596 26459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 28581 26767 gene locus_tag LOCUS_02120 28581 26767 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143606.1 protein_id gnl|my_center|LOCUS_02120 30308 28584 gene locus_tag LOCUS_02130 30308 28584 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814218.1 protein_id gnl|my_center|LOCUS_02130 30788 30345 gene locus_tag LOCUS_02140 30788 30345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 31752 30943 gene locus_tag LOCUS_02150 31752 30943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 32297 31758 gene locus_tag LOCUS_02160 32297 31758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 33466 32444 gene locus_tag LOCUS_02170 33466 32444 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948644.1 protein_id gnl|my_center|LOCUS_02170 34530 33463 gene locus_tag LOCUS_02180 34530 33463 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379414.1 protein_id gnl|my_center|LOCUS_02180 35198 34527 gene locus_tag LOCUS_02190 gene modB 35198 34527 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553595.1 protein_id gnl|my_center|LOCUS_02190 36109 35198 gene locus_tag LOCUS_02200 gene modA 36109 35198 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860975.1 protein_id gnl|my_center|LOCUS_02200 36962 36273 gene locus_tag LOCUS_02210 36962 36273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 37290 36889 gene locus_tag LOCUS_02220 37290 36889 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356595.1 protein_id gnl|my_center|LOCUS_02220 38531 37287 gene locus_tag LOCUS_02230 38531 37287 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135545807.1 protein_id gnl|my_center|LOCUS_02230 40186 38528 gene locus_tag LOCUS_02240 40186 38528 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812866.1 protein_id gnl|my_center|LOCUS_02240 41356 40220 gene locus_tag LOCUS_02250 41356 40220 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392916.1 protein_id gnl|my_center|LOCUS_02250 42422 41343 gene locus_tag LOCUS_02260 42422 41343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 41941 42037 gene locus_tag LOCUS_t00010 41941 42037 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 42847 42419 gene locus_tag LOCUS_02270 42847 42419 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938847.1 protein_id gnl|my_center|LOCUS_02270 43433 42834 gene locus_tag LOCUS_02280 43433 42834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 43648 43430 gene locus_tag LOCUS_02290 43648 43430 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938849.1 protein_id gnl|my_center|LOCUS_02290 45891 43660 gene locus_tag LOCUS_02300 45891 43660 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459976.1 protein_id gnl|my_center|LOCUS_02300 48756 46009 gene locus_tag LOCUS_02310 48756 46009 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938851.1 protein_id gnl|my_center|LOCUS_02310 48916 49161 gene locus_tag LOCUS_02320 48916 49161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 49285 50313 gene locus_tag LOCUS_02330 49285 50313 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144034111.1 protein_id gnl|my_center|LOCUS_02330 50310 50519 gene locus_tag LOCUS_02340 50310 50519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 50861 50610 gene locus_tag LOCUS_02350 50861 50610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 >Feature sequence005 105 986 gene locus_tag LOCUS_02360 105 986 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_02360 1065 1364 gene locus_tag LOCUS_02370 1065 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 1336 3699 gene locus_tag LOCUS_02380 1336 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 3901 5151 gene locus_tag LOCUS_02390 3901 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 5508 5317 gene locus_tag LOCUS_02400 5508 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 6043 6363 gene locus_tag LOCUS_02410 6043 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 6365 6799 gene locus_tag LOCUS_02420 6365 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 6923 8038 gene locus_tag LOCUS_02430 gene nirJ2 6923 8038 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966080.1 protein_id gnl|my_center|LOCUS_02430 8327 8689 gene locus_tag LOCUS_02440 8327 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 8693 9094 gene locus_tag LOCUS_02450 8693 9094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 9187 10293 gene locus_tag LOCUS_02460 gene nirJ2 9187 10293 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460177.1 protein_id gnl|my_center|LOCUS_02460 10295 11164 gene locus_tag LOCUS_02470 10295 11164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 11252 13042 gene locus_tag LOCUS_02480 11252 13042 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107086.1 protein_id gnl|my_center|LOCUS_02480 13053 13532 gene locus_tag LOCUS_02490 13053 13532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 13601 14365 gene locus_tag LOCUS_02500 13601 14365 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110492.1 protein_id gnl|my_center|LOCUS_02500 14383 15264 gene locus_tag LOCUS_02510 14383 15264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 15268 16725 gene locus_tag LOCUS_02520 15268 16725 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068360.1 protein_id gnl|my_center|LOCUS_02520 16727 18226 gene locus_tag LOCUS_02530 16727 18226 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068360.1 protein_id gnl|my_center|LOCUS_02530 18238 19191 gene locus_tag LOCUS_02540 18238 19191 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390188.1 protein_id gnl|my_center|LOCUS_02540 19297 19115 gene locus_tag LOCUS_02550 19297 19115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 19378 20145 gene locus_tag LOCUS_02560 19378 20145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 20310 21776 gene locus_tag LOCUS_02570 20310 21776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 21940 23679 gene locus_tag LOCUS_02580 21940 23679 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181877.1 protein_id gnl|my_center|LOCUS_02580 23876 25060 gene locus_tag LOCUS_02590 23876 25060 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142191.1 protein_id gnl|my_center|LOCUS_02590 25023 26237 gene locus_tag LOCUS_02600 25023 26237 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261147.1 protein_id gnl|my_center|LOCUS_02600 26252 27256 gene locus_tag LOCUS_02610 26252 27256 CDS product stealth family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225420236.1 protein_id gnl|my_center|LOCUS_02610 27279 28538 gene locus_tag LOCUS_02620 27279 28538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 28535 29995 gene locus_tag LOCUS_02630 28535 29995 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292875.1 protein_id gnl|my_center|LOCUS_02630 29985 31070 gene locus_tag LOCUS_02640 29985 31070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 31077 32573 gene locus_tag LOCUS_02650 31077 32573 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055169.1 protein_id gnl|my_center|LOCUS_02650 32570 32815 gene locus_tag LOCUS_02660 32570 32815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 32848 34290 gene locus_tag LOCUS_02670 32848 34290 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060458416.1 protein_id gnl|my_center|LOCUS_02670 35792 34374 gene locus_tag LOCUS_02680 35792 34374 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228733.1 protein_id gnl|my_center|LOCUS_02680 36066 37904 gene locus_tag LOCUS_02690 gene glmS 36066 37904 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_02690 38121 39494 gene locus_tag LOCUS_02700 38121 39494 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_02700 41098 39491 gene locus_tag LOCUS_02710 41098 39491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 42890 41076 gene locus_tag LOCUS_02720 42890 41076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 43103 44377 gene locus_tag LOCUS_02730 43103 44377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 44469 45347 gene locus_tag LOCUS_02740 44469 45347 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 protein_id gnl|my_center|LOCUS_02740 45358 46212 gene locus_tag LOCUS_02750 45358 46212 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082987.1 protein_id gnl|my_center|LOCUS_02750 46232 47344 gene locus_tag LOCUS_02760 46232 47344 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_02760 >Feature sequence006 <1 1277 gene locus_tag LOCUS_02770 <1 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009888359.1:threonine--tRNA ligase 1364 1681 gene locus_tag LOCUS_02780 1364 1681 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812124.1 protein_id gnl|my_center|LOCUS_02780 3072 1801 gene locus_tag LOCUS_02790 3072 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 3247 4641 gene locus_tag LOCUS_02800 3247 4641 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476670.1 protein_id gnl|my_center|LOCUS_02800 4759 6564 gene locus_tag LOCUS_02810 gene uidA 4759 6564 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945924.1 protein_id gnl|my_center|LOCUS_02810 7490 6657 gene locus_tag LOCUS_02820 7490 6657 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929855.1 protein_id gnl|my_center|LOCUS_02820 8429 7503 gene locus_tag LOCUS_02830 8429 7503 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939305.1 protein_id gnl|my_center|LOCUS_02830 9750 8470 gene locus_tag LOCUS_02840 9750 8470 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 protein_id gnl|my_center|LOCUS_02840 11137 9818 gene locus_tag LOCUS_02850 11137 9818 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_02850 13157 11253 gene locus_tag LOCUS_02860 13157 11253 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068161.1 protein_id gnl|my_center|LOCUS_02860 13299 14282 gene locus_tag LOCUS_02870 13299 14282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 14466 15257 gene locus_tag LOCUS_02880 14466 15257 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_02880 15270 16526 gene locus_tag LOCUS_02890 15270 16526 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860860.1 protein_id gnl|my_center|LOCUS_02890 16594 17622 gene locus_tag LOCUS_02900 16594 17622 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948306.1 protein_id gnl|my_center|LOCUS_02900 19095 17740 gene locus_tag LOCUS_02910 19095 17740 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262172.1 protein_id gnl|my_center|LOCUS_02910 19434 20018 gene locus_tag LOCUS_02920 gene infC 19434 20018 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048135.1 protein_id gnl|my_center|LOCUS_02920 20049 20246 gene locus_tag LOCUS_02930 gene rpmI 20049 20246 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_02930 20308 20664 gene locus_tag LOCUS_02940 gene rplT 20308 20664 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429730.1 protein_id gnl|my_center|LOCUS_02940 20825 22519 gene locus_tag LOCUS_02950 20825 22519 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_02950 23639 22599 gene locus_tag LOCUS_02960 23639 22599 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897671.1 protein_id gnl|my_center|LOCUS_02960 24265 25587 gene locus_tag LOCUS_02970 24265 25587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 25666 26880 gene locus_tag LOCUS_02980 25666 26880 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812931.1 protein_id gnl|my_center|LOCUS_02980 26908 28326 gene locus_tag LOCUS_02990 26908 28326 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_02990 28336 29127 gene locus_tag LOCUS_03000 28336 29127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 29133 30011 gene locus_tag LOCUS_03010 gene aroE 29133 30011 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593105.1 protein_id gnl|my_center|LOCUS_03010 30935 29991 gene locus_tag LOCUS_03020 30935 29991 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068551.1 protein_id gnl|my_center|LOCUS_03020 31219 31689 gene locus_tag LOCUS_03030 31219 31689 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861494.1 protein_id gnl|my_center|LOCUS_03030 31694 33862 gene locus_tag LOCUS_03040 31694 33862 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 protein_id gnl|my_center|LOCUS_03040 33855 35693 gene locus_tag LOCUS_03050 33855 35693 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_03050 38173 35840 gene locus_tag LOCUS_03060 38173 35840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 38746 38189 gene locus_tag LOCUS_03070 38746 38189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 40260 39304 gene locus_tag LOCUS_03080 40260 39304 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989474.1 protein_id gnl|my_center|LOCUS_03080 40639 41649 gene locus_tag LOCUS_03090 gene aroF 40639 41649 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_03090 41761 43947 gene locus_tag LOCUS_03100 gene topB 41761 43947 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047293.1 protein_id gnl|my_center|LOCUS_03100 44145 45506 gene locus_tag LOCUS_03110 44145 45506 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_03110 45570 46082 gene locus_tag LOCUS_03120 45570 46082 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583237.1 protein_id gnl|my_center|LOCUS_03120 >Feature sequence007 567 974 gene locus_tag LOCUS_03130 567 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 1035 3029 gene locus_tag LOCUS_03140 1035 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 3047 5098 gene locus_tag LOCUS_03150 3047 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 5080 5229 gene locus_tag LOCUS_03160 5080 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 5198 5866 gene locus_tag LOCUS_03170 5198 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 5887 6390 gene locus_tag LOCUS_03180 5887 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 6275 9022 gene locus_tag LOCUS_03190 6275 9022 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_03190 9132 9683 gene locus_tag LOCUS_03200 9132 9683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 9658 10386 gene locus_tag LOCUS_03210 9658 10386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 10482 10694 gene locus_tag LOCUS_03220 10482 10694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 10753 11601 gene locus_tag LOCUS_03230 10753 11601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 11645 12649 gene locus_tag LOCUS_03240 11645 12649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 12696 14525 gene locus_tag LOCUS_03250 12696 14525 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965270.1 protein_id gnl|my_center|LOCUS_03250 14547 14861 gene locus_tag LOCUS_03260 14547 14861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 14981 15934 gene locus_tag LOCUS_03270 14981 15934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 16024 16206 gene locus_tag LOCUS_03280 16024 16206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 16152 16511 gene locus_tag LOCUS_03290 16152 16511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 16486 17139 gene locus_tag LOCUS_03300 16486 17139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 17151 17792 gene locus_tag LOCUS_03310 17151 17792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 17794 18324 gene locus_tag LOCUS_03320 17794 18324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 18404 18649 gene locus_tag LOCUS_03330 18404 18649 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925387.1 protein_id gnl|my_center|LOCUS_03330 19048 19617 gene locus_tag LOCUS_03340 19048 19617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 19580 20842 gene locus_tag LOCUS_03350 19580 20842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 20877 21398 gene locus_tag LOCUS_03360 20877 21398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 21427 21981 gene locus_tag LOCUS_03370 21427 21981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 22001 22990 gene locus_tag LOCUS_03380 22001 22990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 23005 23379 gene locus_tag LOCUS_03390 23005 23379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 23393 25354 gene locus_tag LOCUS_03400 23393 25354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 25445 26773 gene locus_tag LOCUS_03410 25445 26773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 27039 32597 gene locus_tag LOCUS_03420 27039 32597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 32739 33443 gene locus_tag LOCUS_03430 32739 33443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 34207 33509 gene locus_tag LOCUS_03440 34207 33509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 34410 35318 gene locus_tag LOCUS_03450 34410 35318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 36205 35810 gene locus_tag LOCUS_03460 36205 35810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 37323 36214 gene locus_tag LOCUS_03470 37323 36214 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020613.1 protein_id gnl|my_center|LOCUS_03470 38076 38222 gene locus_tag LOCUS_03480 38076 38222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 38816 39145 gene locus_tag LOCUS_03490 38816 39145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 >Feature sequence008 2712 58 gene locus_tag LOCUS_03500 2712 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 3329 2733 gene locus_tag LOCUS_03510 3329 2733 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_03510 4585 3374 gene locus_tag LOCUS_03520 4585 3374 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_03520 5403 4849 gene locus_tag LOCUS_03530 5403 4849 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434848.1 protein_id gnl|my_center|LOCUS_03530 6835 5483 gene locus_tag LOCUS_03540 gene gabT 6835 5483 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093009.1 protein_id gnl|my_center|LOCUS_03540 7074 8288 gene locus_tag LOCUS_03550 7074 8288 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195010.1 protein_id gnl|my_center|LOCUS_03550 8503 9405 gene locus_tag LOCUS_03560 8503 9405 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435316.1 protein_id gnl|my_center|LOCUS_03560 9550 11931 gene locus_tag LOCUS_03570 9550 11931 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964652.1 protein_id gnl|my_center|LOCUS_03570 13601 12123 gene locus_tag LOCUS_03580 gene xylB 13601 12123 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170324985.1 protein_id gnl|my_center|LOCUS_03580 14638 13634 gene locus_tag LOCUS_03590 14638 13634 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068666.1 protein_id gnl|my_center|LOCUS_03590 17491 15155 gene locus_tag LOCUS_03600 17491 15155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 17856 17494 gene locus_tag LOCUS_03610 17856 17494 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814133.1 protein_id gnl|my_center|LOCUS_03610 18020 18973 gene locus_tag LOCUS_03620 18020 18973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 19809 18976 gene locus_tag LOCUS_03630 gene iolI 19809 18976 CDS product 2-keto-myo-inositol isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244546.1 protein_id gnl|my_center|LOCUS_03630 20936 19935 gene locus_tag LOCUS_03640 20936 19935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 21067 21327 gene locus_tag LOCUS_03650 21067 21327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 21314 22246 gene locus_tag LOCUS_03660 21314 22246 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945539.1 protein_id gnl|my_center|LOCUS_03660 22423 22797 gene locus_tag LOCUS_03670 22423 22797 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384878.1 protein_id gnl|my_center|LOCUS_03670 22799 23677 gene locus_tag LOCUS_03680 22799 23677 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986585.1 protein_id gnl|my_center|LOCUS_03680 23658 24296 gene locus_tag LOCUS_03690 23658 24296 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440185.1 protein_id gnl|my_center|LOCUS_03690 25820 24360 gene locus_tag LOCUS_03700 25820 24360 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830011.1 protein_id gnl|my_center|LOCUS_03700 27787 25832 gene locus_tag LOCUS_03710 27787 25832 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963745.1 protein_id gnl|my_center|LOCUS_03710 27951 28781 gene locus_tag LOCUS_03720 27951 28781 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775269.1 protein_id gnl|my_center|LOCUS_03720 29743 28844 gene locus_tag LOCUS_03730 gene iolE 29743 28844 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471986.1 protein_id gnl|my_center|LOCUS_03730 30771 29755 gene locus_tag LOCUS_03740 gene iolG 30771 29755 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398990.1 protein_id gnl|my_center|LOCUS_03740 31937 30786 gene locus_tag LOCUS_03750 31937 30786 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158673.1 protein_id gnl|my_center|LOCUS_03750 32745 31960 gene locus_tag LOCUS_03760 32745 31960 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900828.1 protein_id gnl|my_center|LOCUS_03760 34690 32759 gene locus_tag LOCUS_03770 gene iolD 34690 32759 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195356.1 protein_id gnl|my_center|LOCUS_03770 35750 34716 gene locus_tag LOCUS_03780 gene iolC 35750 34716 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243753.1 protein_id gnl|my_center|LOCUS_03780 37278 35767 gene locus_tag LOCUS_03790 37278 35767 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368538.1 protein_id gnl|my_center|LOCUS_03790 >Feature sequence009 511 2325 gene locus_tag LOCUS_03800 gene lepA 511 2325 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416556.1 protein_id gnl|my_center|LOCUS_03800 2343 3488 gene locus_tag LOCUS_03810 gene hemW 2343 3488 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099423.1 protein_id gnl|my_center|LOCUS_03810 3600 4019 gene locus_tag LOCUS_03820 3600 4019 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 protein_id gnl|my_center|LOCUS_03820 4161 7001 gene locus_tag LOCUS_03830 gene uvrA 4161 7001 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 protein_id gnl|my_center|LOCUS_03830 7082 8074 gene locus_tag LOCUS_03840 7082 8074 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966142.1 protein_id gnl|my_center|LOCUS_03840 8095 10326 gene locus_tag LOCUS_03850 8095 10326 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_03850 10326 11045 gene locus_tag LOCUS_03860 10326 11045 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_03860 11188 11619 gene locus_tag LOCUS_03870 11188 11619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 11616 12677 gene locus_tag LOCUS_03880 11616 12677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 12768 13658 gene locus_tag LOCUS_03890 gene cdaA 12768 13658 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_03890 13636 14934 gene locus_tag LOCUS_03900 13636 14934 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287822.1 protein_id gnl|my_center|LOCUS_03900 14957 15220 gene locus_tag LOCUS_03910 14957 15220 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949584.1 protein_id gnl|my_center|LOCUS_03910 15327 16031 gene locus_tag LOCUS_03920 15327 16031 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943112.1 protein_id gnl|my_center|LOCUS_03920 16028 16342 gene locus_tag LOCUS_03930 16028 16342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 16449 17264 gene locus_tag LOCUS_03940 16449 17264 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356900.1 protein_id gnl|my_center|LOCUS_03940 17276 18550 gene locus_tag LOCUS_03950 17276 18550 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103412.1 protein_id gnl|my_center|LOCUS_03950 18569 20800 gene locus_tag LOCUS_03960 18569 20800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 20804 23290 gene locus_tag LOCUS_03970 20804 23290 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289076.1 protein_id gnl|my_center|LOCUS_03970 23304 25712 gene locus_tag LOCUS_03980 23304 25712 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378512.1 protein_id gnl|my_center|LOCUS_03980 26998 25766 gene locus_tag LOCUS_03990 26998 25766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 27168 28994 gene locus_tag LOCUS_04000 27168 28994 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289076.1 protein_id gnl|my_center|LOCUS_04000 29006 29962 gene locus_tag LOCUS_04010 29006 29962 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877828.1 protein_id gnl|my_center|LOCUS_04010 30061 31458 gene locus_tag LOCUS_04020 30061 31458 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_04020 31476 32681 gene locus_tag LOCUS_04030 31476 32681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 32768 33685 gene locus_tag LOCUS_04040 gene rfbN 32768 33685 CDS product O antigen biosynthesis rhamnosyltransferase RfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 protein_id gnl|my_center|LOCUS_04040 33784 35448 gene locus_tag LOCUS_04050 33784 35448 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290101.1 protein_id gnl|my_center|LOCUS_04050 35610 37043 gene locus_tag LOCUS_04060 gene clpX 35610 37043 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880858.1 protein_id gnl|my_center|LOCUS_04060 >Feature sequence010 <1 936 gene locus_tag LOCUS_04070 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963751.1:ABC transporter substrate-binding protein 1061 1801 gene locus_tag LOCUS_04080 1061 1801 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_04080 1788 2597 gene locus_tag LOCUS_04090 1788 2597 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627865.1 protein_id gnl|my_center|LOCUS_04090 2711 3961 gene locus_tag LOCUS_04100 2711 3961 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054321935.1 protein_id gnl|my_center|LOCUS_04100 4046 5416 gene locus_tag LOCUS_04110 4046 5416 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786787.1 protein_id gnl|my_center|LOCUS_04110 5517 6521 gene locus_tag LOCUS_04120 5517 6521 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814186.1 protein_id gnl|my_center|LOCUS_04120 6534 6926 gene locus_tag LOCUS_04130 6534 6926 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814175.1 protein_id gnl|my_center|LOCUS_04130 7726 6851 gene locus_tag LOCUS_04140 gene nhoA 7726 6851 CDS product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096510.1 protein_id gnl|my_center|LOCUS_04140 7862 9589 gene locus_tag LOCUS_04150 7862 9589 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_04150 9589 11436 gene locus_tag LOCUS_04160 9589 11436 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_04160 11441 11869 gene locus_tag LOCUS_04170 11441 11869 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963521.1 protein_id gnl|my_center|LOCUS_04170 12482 13654 gene locus_tag LOCUS_04180 12482 13654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 13667 14386 gene locus_tag LOCUS_04190 13667 14386 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_04190 14428 15954 gene locus_tag LOCUS_04200 14428 15954 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_04200 15957 16190 gene locus_tag LOCUS_04210 15957 16190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 16202 17797 gene locus_tag LOCUS_04220 16202 17797 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_04220 17813 18880 gene locus_tag LOCUS_04230 17813 18880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 18970 19485 gene locus_tag LOCUS_04240 18970 19485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 20966 19785 gene locus_tag LOCUS_04250 20966 19785 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_04250 21360 22415 gene locus_tag LOCUS_04260 21360 22415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 22630 24090 gene locus_tag LOCUS_04270 22630 24090 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704601.1 protein_id gnl|my_center|LOCUS_04270 24102 24695 gene locus_tag LOCUS_04280 24102 24695 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098488.1 protein_id gnl|my_center|LOCUS_04280 24673 25032 gene locus_tag LOCUS_04290 24673 25032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 25019 25447 gene locus_tag LOCUS_04300 25019 25447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 25463 26782 gene locus_tag LOCUS_04310 25463 26782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 26779 28308 gene locus_tag LOCUS_04320 26779 28308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 28399 30003 gene locus_tag LOCUS_04330 28399 30003 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_04330 30017 31087 gene locus_tag LOCUS_04340 30017 31087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 31866 31117 gene locus_tag LOCUS_04350 31866 31117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 32003 34285 gene locus_tag LOCUS_04360 32003 34285 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_04360 36866 34377 gene locus_tag LOCUS_04370 36866 34377 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_04370 >Feature sequence011 118 1233 gene locus_tag LOCUS_04380 gene cbiG 118 1233 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948632.1 protein_id gnl|my_center|LOCUS_04380 1226 1957 gene locus_tag LOCUS_04390 gene cobJ 1226 1957 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903755.1 protein_id gnl|my_center|LOCUS_04390 1950 3932 gene locus_tag LOCUS_04400 1950 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 3935 5320 gene locus_tag LOCUS_04410 3935 5320 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943636.1 protein_id gnl|my_center|LOCUS_04410 5317 6366 gene locus_tag LOCUS_04420 gene cobT 5317 6366 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_04420 6376 6915 gene locus_tag LOCUS_04430 gene cobU 6376 6915 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680310.1 protein_id gnl|my_center|LOCUS_04430 6912 7685 gene locus_tag LOCUS_04440 gene cobS 6912 7685 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460078.1 protein_id gnl|my_center|LOCUS_04440 7670 8056 gene locus_tag LOCUS_04450 7670 8056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 8049 8654 gene locus_tag LOCUS_04460 8049 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 8647 9627 gene locus_tag LOCUS_04470 gene cbiB 8647 9627 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491348.1 protein_id gnl|my_center|LOCUS_04470 9638 10690 gene locus_tag LOCUS_04480 gene cobD 9638 10690 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926914.1 protein_id gnl|my_center|LOCUS_04480 10710 12218 gene locus_tag LOCUS_04490 10710 12218 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437761.1 protein_id gnl|my_center|LOCUS_04490 12243 12902 gene locus_tag LOCUS_04500 12243 12902 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948611.1 protein_id gnl|my_center|LOCUS_04500 12931 14082 gene locus_tag LOCUS_04510 12931 14082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 15160 14198 gene locus_tag LOCUS_04520 15160 14198 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016517.1 protein_id gnl|my_center|LOCUS_04520 15270 15578 gene locus_tag LOCUS_04530 15270 15578 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439843.1 protein_id gnl|my_center|LOCUS_04530 15578 16738 gene locus_tag LOCUS_04540 15578 16738 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439842.1 protein_id gnl|my_center|LOCUS_04540 16779 18065 gene locus_tag LOCUS_04550 16779 18065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 18080 19801 gene locus_tag LOCUS_04560 18080 19801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 20028 20795 gene locus_tag LOCUS_04570 20028 20795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 21315 20896 gene locus_tag LOCUS_04580 21315 20896 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249520.1 protein_id gnl|my_center|LOCUS_04580 21992 21402 gene locus_tag LOCUS_04590 21992 21402 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_04590 22134 22592 gene locus_tag LOCUS_04600 22134 22592 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459931.1 protein_id gnl|my_center|LOCUS_04600 22596 22961 gene locus_tag LOCUS_04610 22596 22961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 24847 23183 gene locus_tag LOCUS_04620 24847 23183 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_04620 25667 24975 gene locus_tag LOCUS_04630 25667 24975 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860894.1 protein_id gnl|my_center|LOCUS_04630 26580 25669 gene locus_tag LOCUS_04640 26580 25669 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860893.1 protein_id gnl|my_center|LOCUS_04640 27575 26655 gene locus_tag LOCUS_04650 27575 26655 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895668.1 protein_id gnl|my_center|LOCUS_04650 28268 27576 gene locus_tag LOCUS_04660 28268 27576 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895666.1 protein_id gnl|my_center|LOCUS_04660 28541 29431 gene locus_tag LOCUS_04670 28541 29431 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_04670 31580 29535 gene locus_tag LOCUS_04680 gene feoB 31580 29535 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044821.1 protein_id gnl|my_center|LOCUS_04680 31806 31573 gene locus_tag LOCUS_04690 31806 31573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 32625 33446 gene locus_tag LOCUS_04700 32625 33446 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211250.1 protein_id gnl|my_center|LOCUS_04700 33466 34527 gene locus_tag LOCUS_04710 33466 34527 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_04710 34541 35440 gene locus_tag LOCUS_04720 34541 35440 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020423.1 protein_id gnl|my_center|LOCUS_04720 35485 35631 gene locus_tag LOCUS_04730 35485 35631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 35741 36682 gene locus_tag LOCUS_04740 35741 36682 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854796.1 protein_id gnl|my_center|LOCUS_04740 >Feature sequence012 3304 275 gene locus_tag LOCUS_04750 3304 275 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475723.1 protein_id gnl|my_center|LOCUS_04750 4078 3323 gene locus_tag LOCUS_04760 4078 3323 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948182.1 protein_id gnl|my_center|LOCUS_04760 4748 4155 gene locus_tag LOCUS_04770 4748 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 7246 4757 gene locus_tag LOCUS_04780 gene gyrA 7246 4757 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_04780 9206 7281 gene locus_tag LOCUS_04790 gene gyrB 9206 7281 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815132.1 protein_id gnl|my_center|LOCUS_04790 10353 9268 gene locus_tag LOCUS_04800 gene recF 10353 9268 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359456.1 protein_id gnl|my_center|LOCUS_04800 10586 10377 gene locus_tag LOCUS_04810 10586 10377 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941132.1 protein_id gnl|my_center|LOCUS_04810 11749 10637 gene locus_tag LOCUS_04820 gene dnaN 11749 10637 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_04820 13386 12025 gene locus_tag LOCUS_04830 gene dnaA 13386 12025 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 protein_id gnl|my_center|LOCUS_04830 13646 13786 gene locus_tag LOCUS_04840 13646 13786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 14117 14251 gene locus_tag LOCUS_04850 14117 14251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 14317 14688 gene locus_tag LOCUS_04860 gene rnpA 14317 14688 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_04860 14660 14869 gene locus_tag LOCUS_04870 gene yidD 14660 14869 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966997.1 protein_id gnl|my_center|LOCUS_04870 14906 16186 gene locus_tag LOCUS_04880 14906 16186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 16206 17063 gene locus_tag LOCUS_04890 16206 17063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 17203 17066 gene locus_tag LOCUS_04900 17203 17066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 17175 18548 gene locus_tag LOCUS_04910 gene mnmE 17175 18548 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898860.1 protein_id gnl|my_center|LOCUS_04910 18642 20540 gene locus_tag LOCUS_04920 gene mnmG 18642 20540 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_04920 20540 21283 gene locus_tag LOCUS_04930 gene rsmG 20540 21283 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243029.1 protein_id gnl|my_center|LOCUS_04930 21308 22696 gene locus_tag LOCUS_04940 21308 22696 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895854.1 protein_id gnl|my_center|LOCUS_04940 23010 24014 gene locus_tag LOCUS_04950 23010 24014 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_04950 24017 24880 gene locus_tag LOCUS_04960 24017 24880 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679924.1 protein_id gnl|my_center|LOCUS_04960 24917 26443 gene locus_tag LOCUS_04970 24917 26443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 26445 27911 gene locus_tag LOCUS_04980 26445 27911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 29049 28096 gene locus_tag LOCUS_04990 29049 28096 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057729.1 protein_id gnl|my_center|LOCUS_04990 29167 29370 gene locus_tag LOCUS_05000 29167 29370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 29466 30236 gene locus_tag LOCUS_05010 gene soj 29466 30236 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_05010 30233 31156 gene locus_tag LOCUS_05020 30233 31156 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_05020 31178 31702 gene locus_tag LOCUS_05030 31178 31702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 31752 33038 gene locus_tag LOCUS_05040 gene serS 31752 33038 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_05040 33053 33934 gene locus_tag LOCUS_05050 33053 33934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 34204 34932 gene locus_tag LOCUS_05060 gene sigI 34204 34932 CDS product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002082432.1 protein_id gnl|my_center|LOCUS_05060 >Feature sequence013 80 199 gene locus_tag LOCUS_05070 80 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 328 705 gene locus_tag LOCUS_05080 328 705 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368678.1 protein_id gnl|my_center|LOCUS_05080 856 1023 gene locus_tag LOCUS_05090 856 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 1037 1432 gene locus_tag LOCUS_05100 1037 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 1842 2123 gene locus_tag LOCUS_05110 1842 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 2220 2372 gene locus_tag LOCUS_05120 2220 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 2369 4042 gene locus_tag LOCUS_05130 2369 4042 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_05130 5235 4261 gene locus_tag LOCUS_05140 5235 4261 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475686.1 protein_id gnl|my_center|LOCUS_05140 5731 5309 gene locus_tag LOCUS_05150 5731 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 5976 5728 gene locus_tag LOCUS_05160 5976 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 7123 6089 gene locus_tag LOCUS_05170 gene mglB 7123 6089 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816741.1 protein_id gnl|my_center|LOCUS_05170 8108 7137 gene locus_tag LOCUS_05180 8108 7137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 9963 8095 gene locus_tag LOCUS_05190 9963 8095 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_05190 11563 9953 gene locus_tag LOCUS_05200 11563 9953 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304851.1 protein_id gnl|my_center|LOCUS_05200 11709 11536 gene locus_tag LOCUS_05210 11709 11536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 13387 11738 gene locus_tag LOCUS_05220 13387 11738 CDS product galactoside ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680065.1 protein_id gnl|my_center|LOCUS_05220 14942 13434 gene locus_tag LOCUS_05230 14942 13434 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680067.1 protein_id gnl|my_center|LOCUS_05230 16358 15054 gene locus_tag LOCUS_05240 16358 15054 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674469.1 protein_id gnl|my_center|LOCUS_05240 16627 17727 gene locus_tag LOCUS_05250 16627 17727 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949069.1 protein_id gnl|my_center|LOCUS_05250 17770 18660 gene locus_tag LOCUS_05260 17770 18660 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564323.1 protein_id gnl|my_center|LOCUS_05260 18676 19551 gene locus_tag LOCUS_05270 18676 19551 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355144.1 protein_id gnl|my_center|LOCUS_05270 19548 21146 gene locus_tag LOCUS_05280 19548 21146 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601692.1 protein_id gnl|my_center|LOCUS_05280 21228 22064 gene locus_tag LOCUS_05290 21228 22064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 23473 22157 gene locus_tag LOCUS_05300 gene yrkQ 23473 22157 CDS product two-component system sensor histidine kinase YrkQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246194.1 protein_id gnl|my_center|LOCUS_05300 24170 23454 gene locus_tag LOCUS_05310 gene yrkP 24170 23454 CDS product two-component response regulator YrkP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229895.1 protein_id gnl|my_center|LOCUS_05310 25209 24163 gene locus_tag LOCUS_05320 25209 24163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 26818 25196 gene locus_tag LOCUS_05330 26818 25196 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473139.1 protein_id gnl|my_center|LOCUS_05330 27048 26821 gene locus_tag LOCUS_05340 27048 26821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 28222 27020 gene locus_tag LOCUS_05350 28222 27020 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225872.1 protein_id gnl|my_center|LOCUS_05350 29733 28219 gene locus_tag LOCUS_05360 29733 28219 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_05360 30222 29743 gene locus_tag LOCUS_05370 30222 29743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 31448 30714 gene locus_tag LOCUS_05380 gene nagB 31448 30714 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868991.1 protein_id gnl|my_center|LOCUS_05380 32393 31536 gene locus_tag LOCUS_05390 32393 31536 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261394.1 protein_id gnl|my_center|LOCUS_05390 >Feature sequence014 2218 230 gene locus_tag LOCUS_05400 2218 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 6570 2419 gene locus_tag LOCUS_05410 6570 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 7330 6764 gene locus_tag LOCUS_05420 7330 6764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 8994 8047 gene locus_tag LOCUS_05430 8994 8047 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_05430 9675 9013 gene locus_tag LOCUS_05440 9675 9013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 10661 9699 gene locus_tag LOCUS_05450 10661 9699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 12037 10673 gene locus_tag LOCUS_05460 12037 10673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 13937 12039 gene locus_tag LOCUS_05470 13937 12039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 14596 13934 gene locus_tag LOCUS_05480 14596 13934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 15869 14616 gene locus_tag LOCUS_05490 15869 14616 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073148.1 protein_id gnl|my_center|LOCUS_05490 16992 15862 gene locus_tag LOCUS_05500 gene rffA 16992 15862 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099273.1 protein_id gnl|my_center|LOCUS_05500 18490 17015 gene locus_tag LOCUS_05510 18490 17015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 20285 18756 gene locus_tag LOCUS_05520 20285 18756 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128519551.1 protein_id gnl|my_center|LOCUS_05520 21316 20303 gene locus_tag LOCUS_05530 21316 20303 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549884.1 protein_id gnl|my_center|LOCUS_05530 22328 21321 gene locus_tag LOCUS_05540 22328 21321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 23462 22344 gene locus_tag LOCUS_05550 23462 22344 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_05550 24980 23463 gene locus_tag LOCUS_05560 24980 23463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 26080 24977 gene locus_tag LOCUS_05570 gene glf 26080 24977 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_05570 27189 26119 gene locus_tag LOCUS_05580 27189 26119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 28405 27191 gene locus_tag LOCUS_05590 28405 27191 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582958.1 protein_id gnl|my_center|LOCUS_05590 29118 28420 gene locus_tag LOCUS_05600 29118 28420 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922186.1 protein_id gnl|my_center|LOCUS_05600 30327 29122 gene locus_tag LOCUS_05610 30327 29122 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609547.1 protein_id gnl|my_center|LOCUS_05610 31555 30440 gene locus_tag LOCUS_05620 31555 30440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 >Feature sequence015 388 191 gene locus_tag LOCUS_05630 388 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 797 357 gene locus_tag LOCUS_05640 797 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05640 1571 816 gene locus_tag LOCUS_05650 1571 816 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583591.1 protein_id gnl|my_center|LOCUS_05650 2799 1738 gene locus_tag LOCUS_05660 2799 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 4990 2876 gene locus_tag LOCUS_05670 4990 2876 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966944.1 protein_id gnl|my_center|LOCUS_05670 6210 5047 gene locus_tag LOCUS_05680 gene tig 6210 5047 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355556.1 protein_id gnl|my_center|LOCUS_05680 6369 6830 gene locus_tag LOCUS_05690 6369 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 7380 6922 gene locus_tag LOCUS_05700 7380 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 8203 7382 gene locus_tag LOCUS_05710 gene murI 8203 7382 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_05710 8934 8272 gene locus_tag LOCUS_05720 gene spoIIR 8934 8272 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425996.1 protein_id gnl|my_center|LOCUS_05720 10621 8963 gene locus_tag LOCUS_05730 10621 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 12116 10608 gene locus_tag LOCUS_05740 12116 10608 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541476.1 protein_id gnl|my_center|LOCUS_05740 12928 12263 gene locus_tag LOCUS_05750 12928 12263 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_05750 13803 12931 gene locus_tag LOCUS_05760 gene ispE 13803 12931 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772104.1 protein_id gnl|my_center|LOCUS_05760 15573 14014 gene locus_tag LOCUS_05770 15573 14014 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947967.1 protein_id gnl|my_center|LOCUS_05770 16035 15589 gene locus_tag LOCUS_05780 16035 15589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 16196 16933 gene locus_tag LOCUS_05790 16196 16933 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964283.1 protein_id gnl|my_center|LOCUS_05790 17698 16994 gene locus_tag LOCUS_05800 17698 16994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 17909 18805 gene locus_tag LOCUS_05810 17909 18805 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890955.1 protein_id gnl|my_center|LOCUS_05810 20132 18765 gene locus_tag LOCUS_05820 20132 18765 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_05820 21177 20146 gene locus_tag LOCUS_05830 21177 20146 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562759.1 protein_id gnl|my_center|LOCUS_05830 22608 21205 gene locus_tag LOCUS_05840 22608 21205 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964065.1 protein_id gnl|my_center|LOCUS_05840 24045 22759 gene locus_tag LOCUS_05850 24045 22759 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_05850 26801 24216 gene locus_tag LOCUS_05860 26801 24216 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948276.1 protein_id gnl|my_center|LOCUS_05860 27021 27887 gene locus_tag LOCUS_05870 27021 27887 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_05870 27902 28915 gene locus_tag LOCUS_05880 27902 28915 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549977.1 protein_id gnl|my_center|LOCUS_05880 28944 29213 gene locus_tag LOCUS_05890 28944 29213 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221875345.1 protein_id gnl|my_center|LOCUS_05890 29235 30344 gene locus_tag LOCUS_05900 gene aroC 29235 30344 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258378.1 protein_id gnl|my_center|LOCUS_05900 >Feature sequence016 193 1212 gene locus_tag LOCUS_05910 gene pheS 193 1212 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_05910 1227 3644 gene locus_tag LOCUS_05920 gene pheT 1227 3644 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_05920 3641 4249 gene locus_tag LOCUS_05930 3641 4249 CDS product phosphoserine phosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858827.1 protein_id gnl|my_center|LOCUS_05930 4263 5288 gene locus_tag LOCUS_05940 gene queA 4263 5288 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_05940 6775 5444 gene locus_tag LOCUS_05950 6775 5444 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436703.1 protein_id gnl|my_center|LOCUS_05950 7038 8171 gene locus_tag LOCUS_05960 7038 8171 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869908.1 protein_id gnl|my_center|LOCUS_05960 8241 9776 gene locus_tag LOCUS_05970 8241 9776 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461578.1 protein_id gnl|my_center|LOCUS_05970 11125 9848 gene locus_tag LOCUS_05980 gene aroA 11125 9848 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943243.1 protein_id gnl|my_center|LOCUS_05980 12231 11134 gene locus_tag LOCUS_05990 gene tyrA 12231 11134 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228123.1 protein_id gnl|my_center|LOCUS_05990 12494 14581 gene locus_tag LOCUS_06000 gene fusA 12494 14581 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_06000 14664 14736 gene locus_tag LOCUS_t00020 14664 14736 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 15143 14745 gene locus_tag LOCUS_06010 15143 14745 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_06010 15682 15383 gene locus_tag LOCUS_06020 15682 15383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 16328 16918 gene locus_tag LOCUS_06030 16328 16918 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547369.1 protein_id gnl|my_center|LOCUS_06030 17502 16993 gene locus_tag LOCUS_06040 gene lspA 17502 16993 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968544.1 protein_id gnl|my_center|LOCUS_06040 18139 17495 gene locus_tag LOCUS_06050 18139 17495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 18391 20100 gene locus_tag LOCUS_06060 18391 20100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 21668 20178 gene locus_tag LOCUS_06070 21668 20178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 22481 21801 gene locus_tag LOCUS_06080 22481 21801 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666310.1 protein_id gnl|my_center|LOCUS_06080 24047 22500 gene locus_tag LOCUS_06090 24047 22500 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_06090 26064 24070 gene locus_tag LOCUS_06100 gene ligA 26064 24070 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_06100 26889 26140 gene locus_tag LOCUS_06110 26889 26140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 28036 26882 gene locus_tag LOCUS_06120 28036 26882 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_06120 29457 28048 gene locus_tag LOCUS_06130 29457 28048 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_06130 30018 29533 gene locus_tag LOCUS_06140 30018 29533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 30782 30015 gene locus_tag LOCUS_06150 30782 30015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence017 962 171 gene locus_tag LOCUS_06160 962 171 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966631.1 protein_id gnl|my_center|LOCUS_06160 1089 1331 gene locus_tag LOCUS_06170 1089 1331 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869433.1 protein_id gnl|my_center|LOCUS_06170 1372 1989 gene locus_tag LOCUS_06180 gene yedF 1372 1989 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356602.1 protein_id gnl|my_center|LOCUS_06180 2009 2824 gene locus_tag LOCUS_06190 gene yqeB 2009 2824 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437839.1 protein_id gnl|my_center|LOCUS_06190 2821 4125 gene locus_tag LOCUS_06200 gene mocA 2821 4125 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393499.1 protein_id gnl|my_center|LOCUS_06200 4480 4989 gene locus_tag LOCUS_06210 4480 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 5060 6439 gene locus_tag LOCUS_06220 5060 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 6457 7353 gene locus_tag LOCUS_06230 6457 7353 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861296.1 protein_id gnl|my_center|LOCUS_06230 7331 9475 gene locus_tag LOCUS_06240 7331 9475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 10015 9536 gene locus_tag LOCUS_06250 10015 9536 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_06250 10249 11004 gene locus_tag LOCUS_06260 10249 11004 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023383.1 protein_id gnl|my_center|LOCUS_06260 11081 12085 gene locus_tag LOCUS_06270 gene trpS 11081 12085 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454934.1 protein_id gnl|my_center|LOCUS_06270 12104 12598 gene locus_tag LOCUS_06280 12104 12598 CDS product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028617.1 protein_id gnl|my_center|LOCUS_06280 12834 13304 gene locus_tag LOCUS_06290 12834 13304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 13436 14170 gene locus_tag LOCUS_06300 13436 14170 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481692.1 protein_id gnl|my_center|LOCUS_06300 14145 15740 gene locus_tag LOCUS_06310 14145 15740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 15760 16986 gene locus_tag LOCUS_06320 15760 16986 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404919.1 protein_id gnl|my_center|LOCUS_06320 17943 17050 gene locus_tag LOCUS_06330 17943 17050 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886481.1 protein_id gnl|my_center|LOCUS_06330 19817 17949 gene locus_tag LOCUS_06340 19817 17949 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948299.1 protein_id gnl|my_center|LOCUS_06340 20632 19817 gene locus_tag LOCUS_06350 20632 19817 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808911.1 protein_id gnl|my_center|LOCUS_06350 21698 20625 gene locus_tag LOCUS_06360 21698 20625 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437017.1 protein_id gnl|my_center|LOCUS_06360 21944 23005 gene locus_tag LOCUS_06370 21944 23005 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989516.1 protein_id gnl|my_center|LOCUS_06370 23308 24249 gene locus_tag LOCUS_06380 23308 24249 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054371.1 protein_id gnl|my_center|LOCUS_06380 24281 25123 gene locus_tag LOCUS_06390 24281 25123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 25139 26575 gene locus_tag LOCUS_06400 gene pyk 25139 26575 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_06400 26635 27300 gene locus_tag LOCUS_06410 26635 27300 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485135.1 protein_id gnl|my_center|LOCUS_06410 27484 28761 gene locus_tag LOCUS_06420 27484 28761 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856534.1 protein_id gnl|my_center|LOCUS_06420 28913 28995 gene locus_tag LOCUS_t00030 28913 28995 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence018 1961 54 gene locus_tag LOCUS_06430 1961 54 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251368.1 protein_id gnl|my_center|LOCUS_06430 3334 1976 gene locus_tag LOCUS_06440 3334 1976 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_06440 3542 4345 gene locus_tag LOCUS_06450 3542 4345 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074017151.1 protein_id gnl|my_center|LOCUS_06450 4342 5025 gene locus_tag LOCUS_06460 4342 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 5164 5391 gene locus_tag LOCUS_06470 5164 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 5880 7844 gene locus_tag LOCUS_06480 gene metG 5880 7844 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_06480 8143 10749 gene locus_tag LOCUS_06490 8143 10749 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949094.1 protein_id gnl|my_center|LOCUS_06490 10810 11967 gene locus_tag LOCUS_06500 10810 11967 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964048.1 protein_id gnl|my_center|LOCUS_06500 11957 12721 gene locus_tag LOCUS_06510 11957 12721 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_06510 13778 12807 gene locus_tag LOCUS_06520 13778 12807 CDS product reverse transcriptase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046082755.1 protein_id gnl|my_center|LOCUS_06520 14189 15745 gene locus_tag LOCUS_06530 14189 15745 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 protein_id gnl|my_center|LOCUS_06530 15906 16496 gene locus_tag LOCUS_06540 15906 16496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 16512 17870 gene locus_tag LOCUS_06550 16512 17870 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_06550 17968 19872 gene locus_tag LOCUS_06560 gene glgB 17968 19872 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141306.1 protein_id gnl|my_center|LOCUS_06560 20024 20740 gene locus_tag LOCUS_06570 20024 20740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 20786 20911 gene locus_tag LOCUS_06580 20786 20911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 20933 21271 gene locus_tag LOCUS_06590 20933 21271 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075358.1 protein_id gnl|my_center|LOCUS_06590 21511 21660 gene locus_tag LOCUS_06600 21511 21660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 23563 21842 gene locus_tag LOCUS_06610 23563 21842 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948081.1 protein_id gnl|my_center|LOCUS_06610 24384 23605 gene locus_tag LOCUS_06620 24384 23605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06620 24964 24287 gene locus_tag LOCUS_06630 24964 24287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06630 25256 25939 gene locus_tag LOCUS_06640 25256 25939 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287585.1 protein_id gnl|my_center|LOCUS_06640 26080 26859 gene locus_tag LOCUS_06650 26080 26859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 >Feature sequence019 2124 178 gene locus_tag LOCUS_06660 2124 178 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966678.1 protein_id gnl|my_center|LOCUS_06660 2985 2155 gene locus_tag LOCUS_06670 gene rhaD 2985 2155 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209103.1 protein_id gnl|my_center|LOCUS_06670 3694 3035 gene locus_tag LOCUS_06680 3694 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 5248 3803 gene locus_tag LOCUS_06690 5248 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 5727 5245 gene locus_tag LOCUS_06700 5727 5245 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439159.1 protein_id gnl|my_center|LOCUS_06700 5979 6332 gene locus_tag LOCUS_06710 5979 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 6215 6805 gene locus_tag LOCUS_06720 6215 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 6802 6945 gene locus_tag LOCUS_06730 6802 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06730 6979 7773 gene locus_tag LOCUS_06740 6979 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06740 7724 8713 gene locus_tag LOCUS_06750 7724 8713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 9324 8794 gene locus_tag LOCUS_06760 9324 8794 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947935.1 protein_id gnl|my_center|LOCUS_06760 9571 9419 gene locus_tag LOCUS_06770 9571 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 9830 9558 gene locus_tag LOCUS_06780 9830 9558 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369771.1 protein_id gnl|my_center|LOCUS_06780 10973 10152 gene locus_tag LOCUS_06790 10973 10152 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965994.1 protein_id gnl|my_center|LOCUS_06790 12314 10974 gene locus_tag LOCUS_06800 12314 10974 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_06800 12681 12331 gene locus_tag LOCUS_06810 12681 12331 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814177.1 protein_id gnl|my_center|LOCUS_06810 12803 13198 gene locus_tag LOCUS_06820 12803 13198 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965859.1 protein_id gnl|my_center|LOCUS_06820 15132 13282 gene locus_tag LOCUS_06830 gene recQ 15132 13282 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965975.1 protein_id gnl|my_center|LOCUS_06830 15379 15723 gene locus_tag LOCUS_06840 15379 15723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 16206 15775 gene locus_tag LOCUS_06850 16206 15775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 16889 16329 gene locus_tag LOCUS_06860 16889 16329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 17388 16882 gene locus_tag LOCUS_06870 17388 16882 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_06870 17632 17393 gene locus_tag LOCUS_06880 17632 17393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 20193 17773 gene locus_tag LOCUS_06890 20193 17773 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861587.1 protein_id gnl|my_center|LOCUS_06890 20864 20190 gene locus_tag LOCUS_06900 20864 20190 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454838.1 protein_id gnl|my_center|LOCUS_06900 22211 20973 gene locus_tag LOCUS_06910 22211 20973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 22912 22208 gene locus_tag LOCUS_06920 22912 22208 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861589.1 protein_id gnl|my_center|LOCUS_06920 24147 23101 gene locus_tag LOCUS_06930 24147 23101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 24895 24164 gene locus_tag LOCUS_06940 24895 24164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 26648 24921 gene locus_tag LOCUS_06950 26648 24921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 >Feature sequence020 850 521 gene locus_tag LOCUS_06960 850 521 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045612791.1 protein_id gnl|my_center|LOCUS_06960 1081 3729 gene locus_tag LOCUS_06970 gene mrfA 1081 3729 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 protein_id gnl|my_center|LOCUS_06970 3710 5851 gene locus_tag LOCUS_06980 3710 5851 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880482.1 protein_id gnl|my_center|LOCUS_06980 5853 6218 gene locus_tag LOCUS_06990 5853 6218 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058130.1 protein_id gnl|my_center|LOCUS_06990 6238 7080 gene locus_tag LOCUS_07000 gene yidA 6238 7080 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048269.1 protein_id gnl|my_center|LOCUS_07000 7370 10933 gene locus_tag LOCUS_07010 7370 10933 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721622.1 protein_id gnl|my_center|LOCUS_07010 11342 11148 gene locus_tag LOCUS_07020 11342 11148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 13192 11360 gene locus_tag LOCUS_07030 13192 11360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860733.1 protein_id gnl|my_center|LOCUS_07030 14115 13183 gene locus_tag LOCUS_07040 14115 13183 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434205.1 protein_id gnl|my_center|LOCUS_07040 15139 14147 gene locus_tag LOCUS_07050 15139 14147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 16113 15262 gene locus_tag LOCUS_07060 16113 15262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_07060 16990 16118 gene locus_tag LOCUS_07070 16990 16118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_07070 17885 16977 gene locus_tag LOCUS_07080 17885 16977 CDS product NAD-dependent deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191954.1 protein_id gnl|my_center|LOCUS_07080 17989 18432 gene locus_tag LOCUS_07090 17989 18432 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476083.1 protein_id gnl|my_center|LOCUS_07090 18458 19321 gene locus_tag LOCUS_07100 18458 19321 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389614.1 protein_id gnl|my_center|LOCUS_07100 19681 19328 gene locus_tag LOCUS_07110 19681 19328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 19840 20343 gene locus_tag LOCUS_07120 19840 20343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 20629 20847 gene locus_tag LOCUS_07130 20629 20847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 20956 22956 gene locus_tag LOCUS_07140 20956 22956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 22979 23293 gene locus_tag LOCUS_07150 22979 23293 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940054.1 protein_id gnl|my_center|LOCUS_07150 24263 23349 gene locus_tag LOCUS_07160 24263 23349 CDS product radical SAM mobile pair protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679438.1 protein_id gnl|my_center|LOCUS_07160 24940 24251 gene locus_tag LOCUS_07170 24940 24251 CDS product radical SAM mobile pair protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679436.1 protein_id gnl|my_center|LOCUS_07170 25586 24960 gene locus_tag LOCUS_07180 25586 24960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 >Feature sequence021 174 91 gene locus_tag LOCUS_t00040 174 91 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1139 270 gene locus_tag LOCUS_07190 1139 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 3830 1155 gene locus_tag LOCUS_07200 3830 1155 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548204.1 protein_id gnl|my_center|LOCUS_07200 5328 3823 gene locus_tag LOCUS_07210 gene glpK 5328 3823 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861192.1 protein_id gnl|my_center|LOCUS_07210 5480 6748 gene locus_tag LOCUS_07220 gene sleC 5480 6748 CDS product spore cortex-lytic germination protein SleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425119.1 protein_id gnl|my_center|LOCUS_07220 7135 8175 gene locus_tag LOCUS_07230 7135 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 10067 8334 gene locus_tag LOCUS_07240 10067 8334 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_07240 11803 10064 gene locus_tag LOCUS_07250 11803 10064 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_07250 11915 12787 gene locus_tag LOCUS_07260 11915 12787 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965690.1 protein_id gnl|my_center|LOCUS_07260 12853 14289 gene locus_tag LOCUS_07270 12853 14289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 14320 14784 gene locus_tag LOCUS_07280 14320 14784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 15004 14934 gene locus_tag LOCUS_t00050 15004 14934 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15890 15066 gene locus_tag LOCUS_07290 gene glcT 15890 15066 CDS product ptsGHI operon transcription antiterminator GlcT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967114.1 protein_id gnl|my_center|LOCUS_07290 18127 15932 gene locus_tag LOCUS_07300 gene ptsG 18127 15932 CDS product glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948935.1 protein_id gnl|my_center|LOCUS_07300 19649 18366 gene locus_tag LOCUS_07310 gene rseP 19649 18366 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680259.1 protein_id gnl|my_center|LOCUS_07310 20793 19651 gene locus_tag LOCUS_07320 20793 19651 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_07320 21673 20861 gene locus_tag LOCUS_07330 21673 20861 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_07330 22382 21675 gene locus_tag LOCUS_07340 gene uppS 22382 21675 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384345.1 protein_id gnl|my_center|LOCUS_07340 23007 22450 gene locus_tag LOCUS_07350 gene frr 23007 22450 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986799.1 protein_id gnl|my_center|LOCUS_07350 23752 23057 gene locus_tag LOCUS_07360 gene pyrH 23752 23057 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_07360 25307 23940 gene locus_tag LOCUS_07370 25307 23940 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_07370 >Feature sequence022 52 540 gene locus_tag LOCUS_07380 52 540 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_07380 705 3251 gene locus_tag LOCUS_07390 705 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 3266 4135 gene locus_tag LOCUS_07400 gene rsmA 3266 4135 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 protein_id gnl|my_center|LOCUS_07400 5520 4354 gene locus_tag LOCUS_07410 5520 4354 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891380.1 protein_id gnl|my_center|LOCUS_07410 5622 6653 gene locus_tag LOCUS_07420 5622 6653 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967658.1 protein_id gnl|my_center|LOCUS_07420 7034 6696 gene locus_tag LOCUS_07430 7034 6696 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435155.1 protein_id gnl|my_center|LOCUS_07430 7841 7170 gene locus_tag LOCUS_07440 7841 7170 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723980.1 protein_id gnl|my_center|LOCUS_07440 9033 7975 gene locus_tag LOCUS_07450 9033 7975 CDS product PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903941.1 protein_id gnl|my_center|LOCUS_07450 9755 9048 gene locus_tag LOCUS_07460 9755 9048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 9912 11570 gene locus_tag LOCUS_07470 9912 11570 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_07470 11584 12168 gene locus_tag LOCUS_07480 11584 12168 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_07480 12165 12662 gene locus_tag LOCUS_07490 12165 12662 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_07490 12858 14150 gene locus_tag LOCUS_07500 12858 14150 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966804.1 protein_id gnl|my_center|LOCUS_07500 14422 15618 gene locus_tag LOCUS_07510 gene metK 14422 15618 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_07510 15942 15703 gene locus_tag LOCUS_07520 15942 15703 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811908.1 protein_id gnl|my_center|LOCUS_07520 17427 16060 gene locus_tag LOCUS_07530 17427 16060 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_07530 17641 19140 gene locus_tag LOCUS_07540 17641 19140 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963640.1 protein_id gnl|my_center|LOCUS_07540 19133 19822 gene locus_tag LOCUS_07550 19133 19822 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_07550 19929 21395 gene locus_tag LOCUS_07560 19929 21395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 21395 21982 gene locus_tag LOCUS_07570 21395 21982 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963621.1 protein_id gnl|my_center|LOCUS_07570 22069 23058 gene locus_tag LOCUS_07580 22069 23058 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_07580 23060 23944 gene locus_tag LOCUS_07590 23060 23944 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963624.1 protein_id gnl|my_center|LOCUS_07590 23960 24712 gene locus_tag LOCUS_07600 23960 24712 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_07600 >Feature sequence023 157 765 gene locus_tag LOCUS_07610 157 765 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426696.1 protein_id gnl|my_center|LOCUS_07610 3057 877 gene locus_tag LOCUS_07620 gene glgX 3057 877 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021995.1 protein_id gnl|my_center|LOCUS_07620 3193 4752 gene locus_tag LOCUS_07630 3193 4752 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963421.1 protein_id gnl|my_center|LOCUS_07630 5526 4825 gene locus_tag LOCUS_07640 5526 4825 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869499.1 protein_id gnl|my_center|LOCUS_07640 6424 5804 gene locus_tag LOCUS_07650 6424 5804 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_07650 8388 7213 gene locus_tag LOCUS_07660 8388 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 9130 8375 gene locus_tag LOCUS_07670 9130 8375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 9872 9153 gene locus_tag LOCUS_07680 gene rgbR 9872 9153 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_07680 10162 10839 gene locus_tag LOCUS_07690 10162 10839 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948485.1 protein_id gnl|my_center|LOCUS_07690 10966 11913 gene locus_tag LOCUS_07700 10966 11913 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986750.1 protein_id gnl|my_center|LOCUS_07700 11906 12763 gene locus_tag LOCUS_07710 11906 12763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 12858 13679 gene locus_tag LOCUS_07720 12858 13679 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948489.1 protein_id gnl|my_center|LOCUS_07720 13808 14332 gene locus_tag LOCUS_07730 13808 14332 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897366.1 protein_id gnl|my_center|LOCUS_07730 16613 14583 gene locus_tag LOCUS_07740 16613 14583 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138304587.1 protein_id gnl|my_center|LOCUS_07740 17257 16610 gene locus_tag LOCUS_07750 17257 16610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 17466 18476 gene locus_tag LOCUS_07760 17466 18476 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986736.1 protein_id gnl|my_center|LOCUS_07760 19571 18732 gene locus_tag LOCUS_07770 19571 18732 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066690.1 protein_id gnl|my_center|LOCUS_07770 20054 19743 gene locus_tag LOCUS_07780 20054 19743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 21328 20051 gene locus_tag LOCUS_07790 21328 20051 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461660.1 protein_id gnl|my_center|LOCUS_07790 22080 21493 gene locus_tag LOCUS_07800 22080 21493 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582974.1 protein_id gnl|my_center|LOCUS_07800 22877 22098 gene locus_tag LOCUS_07810 22877 22098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 23638 22874 gene locus_tag LOCUS_07820 gene larB 23638 22874 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_07820 24639 23731 gene locus_tag LOCUS_07830 24639 23731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 >Feature sequence024 417 1409 gene locus_tag LOCUS_07840 417 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 1410 2024 gene locus_tag LOCUS_07850 1410 2024 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101939.1 protein_id gnl|my_center|LOCUS_07850 2104 2691 gene locus_tag LOCUS_07860 2104 2691 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775494.1 protein_id gnl|my_center|LOCUS_07860 2795 3688 gene locus_tag LOCUS_07870 2795 3688 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434205.1 protein_id gnl|my_center|LOCUS_07870 3681 5453 gene locus_tag LOCUS_07880 3681 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860733.1 protein_id gnl|my_center|LOCUS_07880 6223 5456 gene locus_tag LOCUS_07890 6223 5456 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114222.1 protein_id gnl|my_center|LOCUS_07890 6948 6220 gene locus_tag LOCUS_07900 6948 6220 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994320.1 protein_id gnl|my_center|LOCUS_07900 7700 6945 gene locus_tag LOCUS_07910 7700 6945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138603.1 protein_id gnl|my_center|LOCUS_07910 7858 8559 gene locus_tag LOCUS_07920 7858 8559 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012994104.1 protein_id gnl|my_center|LOCUS_07920 8563 9966 gene locus_tag LOCUS_07930 8563 9966 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399787.1 protein_id gnl|my_center|LOCUS_07930 10039 10710 gene locus_tag LOCUS_07940 10039 10710 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903427.1 protein_id gnl|my_center|LOCUS_07940 10707 11726 gene locus_tag LOCUS_07950 10707 11726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 11812 12567 gene locus_tag LOCUS_07960 11812 12567 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431374.1 protein_id gnl|my_center|LOCUS_07960 12564 14474 gene locus_tag LOCUS_07970 12564 14474 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861796.1 protein_id gnl|my_center|LOCUS_07970 15486 14458 gene locus_tag LOCUS_07980 15486 14458 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582593.1 protein_id gnl|my_center|LOCUS_07980 15833 17506 gene locus_tag LOCUS_07990 gene malL 15833 17506 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415176.1 protein_id gnl|my_center|LOCUS_07990 17655 18971 gene locus_tag LOCUS_08000 17655 18971 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015138.1 protein_id gnl|my_center|LOCUS_08000 19067 20137 gene locus_tag LOCUS_08010 19067 20137 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 protein_id gnl|my_center|LOCUS_08010 20127 20996 gene locus_tag LOCUS_08020 20127 20996 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_08020 21646 21086 gene locus_tag LOCUS_08030 21646 21086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 22621 21737 gene locus_tag LOCUS_08040 22621 21737 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453971.1 protein_id gnl|my_center|LOCUS_08040 22754 22894 gene locus_tag LOCUS_08050 22754 22894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 23535 23026 gene locus_tag LOCUS_08060 gene ilvN 23535 23026 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006862451.1 protein_id gnl|my_center|LOCUS_08060 <24979 23548 gene locus_tag LOCUS_08070 <24979 23548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458814.1:biosynthetic-type acetolactate synthase large subunit >Feature sequence025 59 715 gene locus_tag LOCUS_08080 gene phoU 59 715 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_08080 725 1402 gene locus_tag LOCUS_08090 725 1402 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_08090 1399 3060 gene locus_tag LOCUS_08100 1399 3060 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_08100 3280 4122 gene locus_tag LOCUS_08110 3280 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 4134 5825 gene locus_tag LOCUS_08120 4134 5825 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776847.1 protein_id gnl|my_center|LOCUS_08120 5830 6666 gene locus_tag LOCUS_08130 5830 6666 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776846.1 protein_id gnl|my_center|LOCUS_08130 6682 7479 gene locus_tag LOCUS_08140 6682 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 7522 8280 gene locus_tag LOCUS_08150 7522 8280 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947474.1 protein_id gnl|my_center|LOCUS_08150 8277 9101 gene locus_tag LOCUS_08160 8277 9101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 10583 10212 gene locus_tag LOCUS_08170 10583 10212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 11156 10596 gene locus_tag LOCUS_08180 11156 10596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 11778 11413 gene locus_tag LOCUS_08190 11778 11413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 13531 12224 gene locus_tag LOCUS_08200 13531 12224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 13977 14225 gene locus_tag LOCUS_08210 13977 14225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 15227 14610 gene locus_tag LOCUS_08220 15227 14610 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_08220 16649 15264 gene locus_tag LOCUS_08230 16649 15264 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_08230 18429 16663 gene locus_tag LOCUS_08240 18429 16663 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_08240 19009 18422 gene locus_tag LOCUS_08250 19009 18422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 19334 19026 gene locus_tag LOCUS_08260 19334 19026 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_08260 19795 19358 gene locus_tag LOCUS_08270 19795 19358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 21794 19836 gene locus_tag LOCUS_08280 21794 19836 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_08280 22855 21815 gene locus_tag LOCUS_08290 22855 21815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 23171 22860 gene locus_tag LOCUS_08300 23171 22860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 23382 24035 gene locus_tag LOCUS_08310 gene trmB 23382 24035 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239380.1 protein_id gnl|my_center|LOCUS_08310 24106 24255 gene locus_tag LOCUS_08320 24106 24255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 >Feature sequence026 <1 1894 gene locus_tag LOCUS_08330 <1 1894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869356.1:urocanate hydratase 1911 3167 gene locus_tag LOCUS_08340 gene hutI 1911 3167 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108451.1 protein_id gnl|my_center|LOCUS_08340 3218 4108 gene locus_tag LOCUS_08350 gene ftcD 3218 4108 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765436.1 protein_id gnl|my_center|LOCUS_08350 4144 4776 gene locus_tag LOCUS_08360 4144 4776 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203598.1 protein_id gnl|my_center|LOCUS_08360 4804 5076 gene locus_tag LOCUS_08370 gene citD 4804 5076 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098682.1 protein_id gnl|my_center|LOCUS_08370 5073 5948 gene locus_tag LOCUS_08380 5073 5948 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679317.1 protein_id gnl|my_center|LOCUS_08380 5945 7354 gene locus_tag LOCUS_08390 gene citF 5945 7354 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272879.1 protein_id gnl|my_center|LOCUS_08390 7386 7820 gene locus_tag LOCUS_08400 gene glmS 7386 7820 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816944.1 protein_id gnl|my_center|LOCUS_08400 7838 9226 gene locus_tag LOCUS_08410 gene glmL 7838 9226 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945203.1 protein_id gnl|my_center|LOCUS_08410 9210 10658 gene locus_tag LOCUS_08420 9210 10658 CDS product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460941.1 protein_id gnl|my_center|LOCUS_08420 11220 12464 gene locus_tag LOCUS_08430 11220 12464 CDS product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680089.1 protein_id gnl|my_center|LOCUS_08430 12561 13505 gene locus_tag LOCUS_08440 12561 13505 CDS product alanine-tRNA synthetase second additional domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816923.1 protein_id gnl|my_center|LOCUS_08440 13530 14375 gene locus_tag LOCUS_08450 13530 14375 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519031.1 protein_id gnl|my_center|LOCUS_08450 14411 14950 gene locus_tag LOCUS_08460 14411 14950 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_08460 15184 15798 gene locus_tag LOCUS_08470 15184 15798 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_08470 16479 19586 gene locus_tag LOCUS_08480 16479 19586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 19628 19852 gene locus_tag LOCUS_08490 19628 19852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 19941 20669 gene locus_tag LOCUS_08500 19941 20669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 20671 20967 gene locus_tag LOCUS_08510 20671 20967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 20964 22175 gene locus_tag LOCUS_08520 20964 22175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 22192 22554 gene locus_tag LOCUS_08530 22192 22554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 22592 23443 gene locus_tag LOCUS_08540 22592 23443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence027 <1 2543 gene locus_tag LOCUS_08550 <1 2543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964985.1:alanine--tRNA ligase 2681 2857 gene locus_tag LOCUS_08560 gene rpsU 2681 2857 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_08560 2958 4493 gene locus_tag LOCUS_08570 gene cls 2958 4493 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461555.1 protein_id gnl|my_center|LOCUS_08570 4557 5729 gene locus_tag LOCUS_08580 4557 5729 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428267.1 protein_id gnl|my_center|LOCUS_08580 5847 7202 gene locus_tag LOCUS_08590 5847 7202 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643131.1 protein_id gnl|my_center|LOCUS_08590 7304 8119 gene locus_tag LOCUS_08600 7304 8119 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989897.1 protein_id gnl|my_center|LOCUS_08600 8116 9048 gene locus_tag LOCUS_08610 8116 9048 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583074.1 protein_id gnl|my_center|LOCUS_08610 9050 10000 gene locus_tag LOCUS_08620 9050 10000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08620 10171 11394 gene locus_tag LOCUS_08630 10171 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 11440 12195 gene locus_tag LOCUS_08640 11440 12195 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965361.1 protein_id gnl|my_center|LOCUS_08640 12201 12770 gene locus_tag LOCUS_08650 gene scpB 12201 12770 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965360.1 protein_id gnl|my_center|LOCUS_08650 12887 14125 gene locus_tag LOCUS_08660 12887 14125 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_08660 14166 14684 gene locus_tag LOCUS_08670 14166 14684 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681932.1 protein_id gnl|my_center|LOCUS_08670 14698 15471 gene locus_tag LOCUS_08680 14698 15471 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295276.1 protein_id gnl|my_center|LOCUS_08680 15530 17413 gene locus_tag LOCUS_08690 gene cooS 15530 17413 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948938.1 protein_id gnl|my_center|LOCUS_08690 17430 17876 gene locus_tag LOCUS_08700 17430 17876 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948939.1 protein_id gnl|my_center|LOCUS_08700 17879 19117 gene locus_tag LOCUS_08710 17879 19117 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948940.1 protein_id gnl|my_center|LOCUS_08710 19514 20737 gene locus_tag LOCUS_08720 gene tyrS 19514 20737 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_08720 21614 23134 gene locus_tag LOCUS_08730 gene ltrA 21614 23134 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048122254.1 protein_id gnl|my_center|LOCUS_08730 23334 23615 gene locus_tag LOCUS_08740 23334 23615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08740 >Feature sequence028 <1 1444 gene locus_tag LOCUS_08750 <1 1444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964594.1:molecular chaperone DnaK 1520 2683 gene locus_tag LOCUS_08760 gene dnaJ 1520 2683 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565745.1 protein_id gnl|my_center|LOCUS_08760 2867 3784 gene locus_tag LOCUS_08770 2867 3784 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966232.1 protein_id gnl|my_center|LOCUS_08770 3847 4833 gene locus_tag LOCUS_08780 gene prmA 3847 4833 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861555.1 protein_id gnl|my_center|LOCUS_08780 4843 5583 gene locus_tag LOCUS_08790 4843 5583 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_08790 5587 6741 gene locus_tag LOCUS_08800 5587 6741 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 protein_id gnl|my_center|LOCUS_08800 6787 7968 gene locus_tag LOCUS_08810 gene thiI 6787 7968 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_08810 8252 8019 gene locus_tag LOCUS_08820 8252 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 8410 9723 gene locus_tag LOCUS_08830 gene mtaB 8410 9723 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964598.1 protein_id gnl|my_center|LOCUS_08830 9847 10116 gene locus_tag LOCUS_08840 9847 10116 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025772973.1 protein_id gnl|my_center|LOCUS_08840 10121 10555 gene locus_tag LOCUS_08850 gene ruvX 10121 10555 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 protein_id gnl|my_center|LOCUS_08850 10651 10917 gene locus_tag LOCUS_08860 10651 10917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 11012 12679 gene locus_tag LOCUS_08870 11012 12679 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_08870 12683 13024 gene locus_tag LOCUS_08880 12683 13024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 13040 13537 gene locus_tag LOCUS_08890 13040 13537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 13534 14175 gene locus_tag LOCUS_08900 13534 14175 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438166.1 protein_id gnl|my_center|LOCUS_08900 14189 15415 gene locus_tag LOCUS_08910 14189 15415 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_08910 16100 15483 gene locus_tag LOCUS_08920 gene sigK 16100 15483 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428359.1 protein_id gnl|my_center|LOCUS_08920 16315 17841 gene locus_tag LOCUS_08930 16315 17841 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_08930 17862 18746 gene locus_tag LOCUS_08940 gene dprA 17862 18746 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047859.1 protein_id gnl|my_center|LOCUS_08940 18748 20844 gene locus_tag LOCUS_08950 gene topA 18748 20844 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_08950 20870 21070 gene locus_tag LOCUS_08960 20870 21070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 21160 21948 gene locus_tag LOCUS_08970 gene codY 21160 21948 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362579.1 protein_id gnl|my_center|LOCUS_08970 22254 22538 gene locus_tag LOCUS_08980 22254 22538 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_08980 >Feature sequence029 3 809 gene locus_tag LOCUS_08990 3 809 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430617.1 protein_id gnl|my_center|LOCUS_08990 1506 2264 gene locus_tag LOCUS_09000 1506 2264 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963877.1 protein_id gnl|my_center|LOCUS_09000 2452 3900 gene locus_tag LOCUS_09010 gene gltX 2452 3900 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_09010 3935 5791 gene locus_tag LOCUS_09020 3935 5791 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860946.1 protein_id gnl|my_center|LOCUS_09020 5788 6399 gene locus_tag LOCUS_09030 5788 6399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 6441 7412 gene locus_tag LOCUS_09040 gene spoIIIAA 6441 7412 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358945.1 protein_id gnl|my_center|LOCUS_09040 7406 7924 gene locus_tag LOCUS_09050 7406 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 7974 8156 gene locus_tag LOCUS_09060 gene spoIIIAC 7974 8156 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888937.1 protein_id gnl|my_center|LOCUS_09060 8168 8554 gene locus_tag LOCUS_09070 gene spoIIIAD 8168 8554 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359080.1 protein_id gnl|my_center|LOCUS_09070 8566 9759 gene locus_tag LOCUS_09080 8566 9759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 9773 10087 gene locus_tag LOCUS_09090 9773 10087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 10084 10563 gene locus_tag LOCUS_09100 10084 10563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 10576 11313 gene locus_tag LOCUS_09110 10576 11313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 11413 13005 gene locus_tag LOCUS_09120 11413 13005 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_09120 13116 13496 gene locus_tag LOCUS_09130 13116 13496 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_09130 13597 14004 gene locus_tag LOCUS_09140 gene nusB 13597 14004 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_09140 14001 15212 gene locus_tag LOCUS_09150 gene xseA 14001 15212 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965382.1 protein_id gnl|my_center|LOCUS_09150 15216 15440 gene locus_tag LOCUS_09160 15216 15440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 15430 16320 gene locus_tag LOCUS_09170 15430 16320 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_09170 16334 18190 gene locus_tag LOCUS_09180 gene dxs 16334 18190 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393020.1 protein_id gnl|my_center|LOCUS_09180 18191 18997 gene locus_tag LOCUS_09190 18191 18997 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_09190 19000 19860 gene locus_tag LOCUS_09200 19000 19860 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_09200 19871 20323 gene locus_tag LOCUS_09210 19871 20323 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_09210 20344 22029 gene locus_tag LOCUS_09220 gene recN 20344 22029 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896126.1 protein_id gnl|my_center|LOCUS_09220 22129 23322 gene locus_tag LOCUS_09230 gene spoIVB 22129 23322 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_09230 >Feature sequence030 879 172 gene locus_tag LOCUS_09240 gene ispD 879 172 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048363.1 protein_id gnl|my_center|LOCUS_09240 1909 884 gene locus_tag LOCUS_09250 gene tsaD 1909 884 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_09250 2831 1920 gene locus_tag LOCUS_09260 2831 1920 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_09260 3140 2892 gene locus_tag LOCUS_09270 3140 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 3704 3255 gene locus_tag LOCUS_09280 gene rimI 3704 3255 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434429.1 protein_id gnl|my_center|LOCUS_09280 4404 3682 gene locus_tag LOCUS_09290 gene tsaB 4404 3682 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048262.1 protein_id gnl|my_center|LOCUS_09290 4860 4417 gene locus_tag LOCUS_09300 gene tsaE 4860 4417 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048261.1 protein_id gnl|my_center|LOCUS_09300 4988 5506 gene locus_tag LOCUS_09310 4988 5506 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 protein_id gnl|my_center|LOCUS_09310 6185 5529 gene locus_tag LOCUS_09320 6185 5529 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303217.1 protein_id gnl|my_center|LOCUS_09320 6351 8936 gene locus_tag LOCUS_09330 6351 8936 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808183.1 protein_id gnl|my_center|LOCUS_09330 9961 9020 gene locus_tag LOCUS_09340 9961 9020 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_09340 10905 9964 gene locus_tag LOCUS_09350 gene hprK 10905 9964 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_09350 12857 10989 gene locus_tag LOCUS_09360 gene uvrC 12857 10989 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_09360 14935 12953 gene locus_tag LOCUS_09370 gene ftsH 14935 12953 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048280.1 protein_id gnl|my_center|LOCUS_09370 15158 16633 gene locus_tag LOCUS_09380 15158 16633 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_09380 17707 16691 gene locus_tag LOCUS_09390 gene galE 17707 16691 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996539.1 protein_id gnl|my_center|LOCUS_09390 18539 17820 gene locus_tag LOCUS_09400 18539 17820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 19831 18536 gene locus_tag LOCUS_09410 19831 18536 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442178.1 protein_id gnl|my_center|LOCUS_09410 20558 19854 gene locus_tag LOCUS_09420 20558 19854 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068640.1 protein_id gnl|my_center|LOCUS_09420 21978 20623 gene locus_tag LOCUS_09430 21978 20623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 22649 21975 gene locus_tag LOCUS_09440 22649 21975 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_09440 23221 22718 gene locus_tag LOCUS_09450 gene greA 23221 22718 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965725.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence031 685 924 gene locus_tag LOCUS_09460 685 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 942 2060 gene locus_tag LOCUS_09470 gene prfB 942 2060 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177451831.1 protein_id gnl|my_center|LOCUS_09470 2139 2582 gene locus_tag LOCUS_09480 gene thrR 2139 2582 CDS product transcriptional regulator ThrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222630.1 protein_id gnl|my_center|LOCUS_09480 2598 3815 gene locus_tag LOCUS_09490 2598 3815 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986281.1 protein_id gnl|my_center|LOCUS_09490 3829 5034 gene locus_tag LOCUS_09500 3829 5034 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_09500 5952 5101 gene locus_tag LOCUS_09510 5952 5101 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895974.1 protein_id gnl|my_center|LOCUS_09510 6126 7304 gene locus_tag LOCUS_09520 6126 7304 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_09520 7301 8377 gene locus_tag LOCUS_09530 7301 8377 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392002.1 protein_id gnl|my_center|LOCUS_09530 8381 9742 gene locus_tag LOCUS_09540 8381 9742 CDS product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712231.1 protein_id gnl|my_center|LOCUS_09540 10620 9868 gene locus_tag LOCUS_09550 10620 9868 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986299.1 protein_id gnl|my_center|LOCUS_09550 10757 11182 gene locus_tag LOCUS_09560 10757 11182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 11812 11186 gene locus_tag LOCUS_09570 11812 11186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 11988 14141 gene locus_tag LOCUS_09580 11988 14141 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947999.1 protein_id gnl|my_center|LOCUS_09580 14203 16011 gene locus_tag LOCUS_09590 14203 16011 CDS product aminopeptidase P family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986733.1 protein_id gnl|my_center|LOCUS_09590 16224 16727 gene locus_tag LOCUS_09600 16224 16727 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363192.1 protein_id gnl|my_center|LOCUS_09600 16720 18453 gene locus_tag LOCUS_09610 16720 18453 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_09610 18446 20338 gene locus_tag LOCUS_09620 18446 20338 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_09620 21386 20451 gene locus_tag LOCUS_09630 gene speB 21386 20451 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055970141.1 protein_id gnl|my_center|LOCUS_09630 21560 22006 gene locus_tag LOCUS_09640 21560 22006 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421494.1 protein_id gnl|my_center|LOCUS_09640 22329 22964 gene locus_tag LOCUS_09650 22329 22964 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence032 2488 1871 gene locus_tag LOCUS_09660 2488 1871 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305518.1 protein_id gnl|my_center|LOCUS_09660 2731 3192 gene locus_tag LOCUS_09670 2731 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 3180 3815 gene locus_tag LOCUS_09680 3180 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 3796 5175 gene locus_tag LOCUS_09690 3796 5175 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_09690 6110 5262 gene locus_tag LOCUS_09700 6110 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 6475 6203 gene locus_tag LOCUS_09710 6475 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 6934 6479 gene locus_tag LOCUS_09720 6934 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 7418 6996 gene locus_tag LOCUS_09730 7418 6996 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391820.1 protein_id gnl|my_center|LOCUS_09730 7593 8735 gene locus_tag LOCUS_09740 7593 8735 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262240.1 protein_id gnl|my_center|LOCUS_09740 9819 8764 gene locus_tag LOCUS_09750 9819 8764 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595034.1 protein_id gnl|my_center|LOCUS_09750 10382 9927 gene locus_tag LOCUS_09760 10382 9927 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033125641.1 protein_id gnl|my_center|LOCUS_09760 10521 11282 gene locus_tag LOCUS_09770 10521 11282 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789184.1 protein_id gnl|my_center|LOCUS_09770 12025 11285 gene locus_tag LOCUS_09780 12025 11285 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963959.1 protein_id gnl|my_center|LOCUS_09780 12117 12869 gene locus_tag LOCUS_09790 12117 12869 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890403.1 protein_id gnl|my_center|LOCUS_09790 13258 12926 gene locus_tag LOCUS_09800 13258 12926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 13470 13264 gene locus_tag LOCUS_09810 13470 13264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 13876 13439 gene locus_tag LOCUS_09820 13876 13439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 15862 14000 gene locus_tag LOCUS_09830 15862 14000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 17545 16142 gene locus_tag LOCUS_09840 17545 16142 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_09840 18158 17538 gene locus_tag LOCUS_09850 18158 17538 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986661.1 protein_id gnl|my_center|LOCUS_09850 18344 19240 gene locus_tag LOCUS_09860 18344 19240 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_09860 20412 19231 gene locus_tag LOCUS_09870 20412 19231 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476131.1 protein_id gnl|my_center|LOCUS_09870 21032 20460 gene locus_tag LOCUS_09880 21032 20460 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_09880 21595 21029 gene locus_tag LOCUS_09890 21595 21029 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_09890 21702 22598 gene locus_tag LOCUS_09900 21702 22598 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359341.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence033 1042 113 gene locus_tag LOCUS_09910 1042 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1391 1065 gene locus_tag LOCUS_09920 1391 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 2894 1446 gene locus_tag LOCUS_09930 2894 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 3493 2930 gene locus_tag LOCUS_09940 3493 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 4442 3525 gene locus_tag LOCUS_09950 4442 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 5587 4469 gene locus_tag LOCUS_09960 5587 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 6302 5598 gene locus_tag LOCUS_09970 6302 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 7469 6357 gene locus_tag LOCUS_09980 7469 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 8560 7820 gene locus_tag LOCUS_09990 8560 7820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 9705 8602 gene locus_tag LOCUS_10000 9705 8602 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389640.1 protein_id gnl|my_center|LOCUS_10000 10749 9799 gene locus_tag LOCUS_10010 10749 9799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 11729 11025 gene locus_tag LOCUS_10020 11729 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 13110 11908 gene locus_tag LOCUS_10030 13110 11908 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_10030 13708 13124 gene locus_tag LOCUS_10040 13708 13124 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946141.1 protein_id gnl|my_center|LOCUS_10040 14592 13705 gene locus_tag LOCUS_10050 14592 13705 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861083.1 protein_id gnl|my_center|LOCUS_10050 15481 14609 gene locus_tag LOCUS_10060 15481 14609 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048407.1 protein_id gnl|my_center|LOCUS_10060 15710 16555 gene locus_tag LOCUS_10070 15710 16555 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289459.1 protein_id gnl|my_center|LOCUS_10070 17930 17043 gene locus_tag LOCUS_10080 17930 17043 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_10080 20369 17961 gene locus_tag LOCUS_10090 20369 17961 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_10090 21060 20422 gene locus_tag LOCUS_10100 21060 20422 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390042.1 protein_id gnl|my_center|LOCUS_10100 22231 21089 gene locus_tag LOCUS_10110 22231 21089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 >Feature sequence034 939 235 gene locus_tag LOCUS_10120 939 235 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454566.1 protein_id gnl|my_center|LOCUS_10120 3807 1156 gene locus_tag LOCUS_10130 3807 1156 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814229.1 protein_id gnl|my_center|LOCUS_10130 4486 3812 gene locus_tag LOCUS_10140 4486 3812 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020493338.1 protein_id gnl|my_center|LOCUS_10140 5567 4641 gene locus_tag LOCUS_10150 5567 4641 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897088.1 protein_id gnl|my_center|LOCUS_10150 6244 5570 gene locus_tag LOCUS_10160 6244 5570 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897090.1 protein_id gnl|my_center|LOCUS_10160 9303 6256 gene locus_tag LOCUS_10170 9303 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 9522 10988 gene locus_tag LOCUS_10180 9522 10988 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054291.1 protein_id gnl|my_center|LOCUS_10180 11011 12303 gene locus_tag LOCUS_10190 gene vcrM 11011 12303 CDS product sodium-coupled multidrug efflux MATE transporter VcrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981941.1 protein_id gnl|my_center|LOCUS_10190 13454 12306 gene locus_tag LOCUS_10200 13454 12306 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296167.1 protein_id gnl|my_center|LOCUS_10200 14574 13441 gene locus_tag LOCUS_10210 14574 13441 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681919.1 protein_id gnl|my_center|LOCUS_10210 15521 14586 gene locus_tag LOCUS_10220 15521 14586 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389792.1 protein_id gnl|my_center|LOCUS_10220 15816 16928 gene locus_tag LOCUS_10230 15816 16928 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289599.1 protein_id gnl|my_center|LOCUS_10230 16906 17541 gene locus_tag LOCUS_10240 16906 17541 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666641.1 protein_id gnl|my_center|LOCUS_10240 17753 17556 gene locus_tag LOCUS_10250 17753 17556 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461361.1 protein_id gnl|my_center|LOCUS_10250 18051 17755 gene locus_tag LOCUS_10260 18051 17755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 18207 19307 gene locus_tag LOCUS_10270 18207 19307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 19394 21250 gene locus_tag LOCUS_10280 19394 21250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 <21881 21318 gene locus_tag LOCUS_10290 <21881 21318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964962.1:phosphoribosylformylglycinamidine synthase >Feature sequence035 701 489 gene locus_tag LOCUS_10300 701 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1988 891 gene locus_tag LOCUS_10310 gene ychF 1988 891 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_10310 2667 2017 gene locus_tag LOCUS_10320 2667 2017 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965038.1 protein_id gnl|my_center|LOCUS_10320 3322 2639 gene locus_tag LOCUS_10330 gene rpe 3322 2639 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965037.1 protein_id gnl|my_center|LOCUS_10330 4247 3327 gene locus_tag LOCUS_10340 gene rsgA 4247 3327 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_10340 6570 4426 gene locus_tag LOCUS_10350 gene pknB 6570 4426 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986841.1 protein_id gnl|my_center|LOCUS_10350 7307 6564 gene locus_tag LOCUS_10360 7307 6564 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101477.1 protein_id gnl|my_center|LOCUS_10360 8355 7309 gene locus_tag LOCUS_10370 gene rlmN 8355 7309 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_10370 9713 8343 gene locus_tag LOCUS_10380 gene rsmB 9713 8343 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_10380 10693 9758 gene locus_tag LOCUS_10390 gene fmt 10693 9758 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_10390 11172 10690 gene locus_tag LOCUS_10400 gene def 11172 10690 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_10400 13472 11247 gene locus_tag LOCUS_10410 gene priA 13472 11247 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_10410 14942 13473 gene locus_tag LOCUS_10420 14942 13473 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_10420 15167 15036 gene locus_tag LOCUS_10430 15167 15036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 16165 15230 gene locus_tag LOCUS_10440 16165 15230 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966723.1 protein_id gnl|my_center|LOCUS_10440 16653 16249 gene locus_tag LOCUS_10450 16653 16249 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861681.1 protein_id gnl|my_center|LOCUS_10450 19231 16637 gene locus_tag LOCUS_10460 19231 16637 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288728.1 protein_id gnl|my_center|LOCUS_10460 20189 19206 gene locus_tag LOCUS_10470 20189 19206 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_10470 21480 20152 gene locus_tag LOCUS_10480 21480 20152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 >Feature sequence036 643 77 gene locus_tag LOCUS_10490 643 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 773 1669 gene locus_tag LOCUS_10500 773 1669 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538278.1 protein_id gnl|my_center|LOCUS_10500 3467 1776 gene locus_tag LOCUS_10510 3467 1776 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_10510 3611 3536 gene locus_tag LOCUS_t00060 3611 3536 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3832 4506 gene locus_tag LOCUS_10520 3832 4506 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949104.1 protein_id gnl|my_center|LOCUS_10520 4531 5103 gene locus_tag LOCUS_10530 4531 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 5597 5190 gene locus_tag LOCUS_10540 5597 5190 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_10540 5795 6802 gene locus_tag LOCUS_10550 gene asnA 5795 6802 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_10550 6830 8956 gene locus_tag LOCUS_10560 6830 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 10421 9054 gene locus_tag LOCUS_10570 10421 9054 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_10570 10606 11427 gene locus_tag LOCUS_10580 10606 11427 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434058.1 protein_id gnl|my_center|LOCUS_10580 11417 11896 gene locus_tag LOCUS_10590 11417 11896 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902988.1 protein_id gnl|my_center|LOCUS_10590 11893 14187 gene locus_tag LOCUS_10600 11893 14187 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 protein_id gnl|my_center|LOCUS_10600 14180 15448 gene locus_tag LOCUS_10610 14180 15448 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682090.1 protein_id gnl|my_center|LOCUS_10610 16692 15454 gene locus_tag LOCUS_10620 16692 15454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 16858 18123 gene locus_tag LOCUS_10630 gene hisD 16858 18123 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861261.1 protein_id gnl|my_center|LOCUS_10630 18350 19852 gene locus_tag LOCUS_10640 18350 19852 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287386.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence037 2119 479 gene locus_tag LOCUS_10650 2119 479 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_10650 2808 2125 gene locus_tag LOCUS_10660 2808 2125 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416528.1 protein_id gnl|my_center|LOCUS_10660 4448 2940 gene locus_tag LOCUS_10670 4448 2940 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 protein_id gnl|my_center|LOCUS_10670 5127 4453 gene locus_tag LOCUS_10680 5127 4453 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044679.1 protein_id gnl|my_center|LOCUS_10680 5657 5306 gene locus_tag LOCUS_tm00010 5657 5306 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 5830 6912 gene locus_tag LOCUS_10690 5830 6912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 7505 7002 gene locus_tag LOCUS_10700 7505 7002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 7726 9564 gene locus_tag LOCUS_10710 7726 9564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 9586 9825 gene locus_tag LOCUS_10720 9586 9825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 10997 10041 gene locus_tag LOCUS_10730 10997 10041 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048144.1 protein_id gnl|my_center|LOCUS_10730 12003 10990 gene locus_tag LOCUS_10740 12003 10990 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099510.1 protein_id gnl|my_center|LOCUS_10740 13006 12008 gene locus_tag LOCUS_10750 13006 12008 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048146.1 protein_id gnl|my_center|LOCUS_10750 13967 13014 gene locus_tag LOCUS_10760 gene oppB 13967 13014 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245554.1 protein_id gnl|my_center|LOCUS_10760 15849 14146 gene locus_tag LOCUS_10770 15849 14146 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823468.1 protein_id gnl|my_center|LOCUS_10770 17745 16072 gene locus_tag LOCUS_10780 17745 16072 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008568.1 protein_id gnl|my_center|LOCUS_10780 18249 17779 gene locus_tag LOCUS_10790 gene smpB 18249 17779 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_10790 20472 18268 gene locus_tag LOCUS_10800 gene rnr 20472 18268 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_10800 >Feature sequence038 457 1302 gene locus_tag LOCUS_10810 gene araQ 457 1302 CDS product arabinose ABC transporter permease AraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229508.1 protein_id gnl|my_center|LOCUS_10810 1408 3837 gene locus_tag LOCUS_10820 1408 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 4421 3876 gene locus_tag LOCUS_10830 4421 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 4680 5258 gene locus_tag LOCUS_10840 4680 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 5236 6693 gene locus_tag LOCUS_10850 5236 6693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 7315 8508 gene locus_tag LOCUS_10860 7315 8508 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_10860 8616 9020 gene locus_tag LOCUS_10870 8616 9020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 9034 10155 gene locus_tag LOCUS_10880 gene nirJ2 9034 10155 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966080.1 protein_id gnl|my_center|LOCUS_10880 10136 10480 gene locus_tag LOCUS_10890 10136 10480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 10484 11365 gene locus_tag LOCUS_10900 10484 11365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 11362 11502 gene locus_tag LOCUS_10910 11362 11502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 11667 12512 gene locus_tag LOCUS_10920 11667 12512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 12571 13056 gene locus_tag LOCUS_10930 12571 13056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 14924 13182 gene locus_tag LOCUS_10940 14924 13182 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_10940 15890 15051 gene locus_tag LOCUS_10950 15890 15051 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531164.1 protein_id gnl|my_center|LOCUS_10950 16176 16373 gene locus_tag LOCUS_10960 16176 16373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 16503 17216 gene locus_tag LOCUS_10970 gene azlC 16503 17216 CDS product azaleucine resistance protein AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969035.1 protein_id gnl|my_center|LOCUS_10970 17213 17539 gene locus_tag LOCUS_10980 gene azlD 17213 17539 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_10980 17583 18494 gene locus_tag LOCUS_10990 17583 18494 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068666.1 protein_id gnl|my_center|LOCUS_10990 19312 18662 gene locus_tag LOCUS_11000 19312 18662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 20169 19300 gene locus_tag LOCUS_11010 20169 19300 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897173.1 protein_id gnl|my_center|LOCUS_11010 20545 20171 gene locus_tag LOCUS_11020 20545 20171 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence039 <1 1373 gene locus_tag LOCUS_11030 <1 1373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002917858.1:4-alpha-glucanotransferase 1404 2435 gene locus_tag LOCUS_11040 1404 2435 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973786.1 protein_id gnl|my_center|LOCUS_11040 2499 4763 gene locus_tag LOCUS_11050 gene glgP 2499 4763 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950133.1 protein_id gnl|my_center|LOCUS_11050 4873 6210 gene locus_tag LOCUS_11060 4873 6210 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_11060 6224 7195 gene locus_tag LOCUS_11070 6224 7195 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723973.1 protein_id gnl|my_center|LOCUS_11070 8964 7264 gene locus_tag LOCUS_11080 8964 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 9114 10166 gene locus_tag LOCUS_11090 9114 10166 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356164.1 protein_id gnl|my_center|LOCUS_11090 10172 10366 gene locus_tag LOCUS_11100 10172 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 10679 12631 gene locus_tag LOCUS_11110 10679 12631 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026882.1 protein_id gnl|my_center|LOCUS_11110 12704 14059 gene locus_tag LOCUS_11120 12704 14059 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399072.1 protein_id gnl|my_center|LOCUS_11120 14208 15101 gene locus_tag LOCUS_11130 14208 15101 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229507.1 protein_id gnl|my_center|LOCUS_11130 15103 15966 gene locus_tag LOCUS_11140 gene araQ 15103 15966 CDS product arabinose ABC transporter permease AraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229508.1 protein_id gnl|my_center|LOCUS_11140 17033 16107 gene locus_tag LOCUS_11150 17033 16107 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287299.1 protein_id gnl|my_center|LOCUS_11150 17260 18774 gene locus_tag LOCUS_11160 gene abfA 17260 18774 CDS product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence040 544 1551 gene locus_tag LOCUS_11170 544 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1771 2733 gene locus_tag LOCUS_11180 1771 2733 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_11180 3304 2834 gene locus_tag LOCUS_11190 3304 2834 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053897.1 protein_id gnl|my_center|LOCUS_11190 4883 3381 gene locus_tag LOCUS_11200 4883 3381 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 protein_id gnl|my_center|LOCUS_11200 6418 4937 gene locus_tag LOCUS_11210 6418 4937 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763047.1 protein_id gnl|my_center|LOCUS_11210 6504 7502 gene locus_tag LOCUS_11220 gene ccpA 6504 7502 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229285.1 protein_id gnl|my_center|LOCUS_11220 7523 8560 gene locus_tag LOCUS_11230 7523 8560 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288260.1 protein_id gnl|my_center|LOCUS_11230 8563 8685 gene locus_tag LOCUS_11240 8563 8685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 8780 9064 gene locus_tag LOCUS_11250 8780 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11250 9080 10387 gene locus_tag LOCUS_11260 9080 10387 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_11260 10529 11944 gene locus_tag LOCUS_11270 gene uxaC 10529 11944 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_11270 13134 12007 gene locus_tag LOCUS_11280 13134 12007 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583054.1 protein_id gnl|my_center|LOCUS_11280 13340 14521 gene locus_tag LOCUS_11290 13340 14521 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966572.1 protein_id gnl|my_center|LOCUS_11290 14584 15318 gene locus_tag LOCUS_11300 14584 15318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 16103 15468 gene locus_tag LOCUS_11310 16103 15468 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964647.1 protein_id gnl|my_center|LOCUS_11310 16370 16107 gene locus_tag LOCUS_11320 16370 16107 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392904.1 protein_id gnl|my_center|LOCUS_11320 16813 18633 gene locus_tag LOCUS_11330 16813 18633 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861293.1 protein_id gnl|my_center|LOCUS_11330 18648 19832 gene locus_tag LOCUS_11340 gene spoVE 18648 19832 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence041 158 880 gene locus_tag LOCUS_11350 158 880 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895939.1 protein_id gnl|my_center|LOCUS_11350 1075 1365 gene locus_tag LOCUS_11360 1075 1365 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830443.1 protein_id gnl|my_center|LOCUS_11360 1559 2074 gene locus_tag LOCUS_11370 1559 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 2094 2762 gene locus_tag LOCUS_11380 2094 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 2781 4115 gene locus_tag LOCUS_11390 2781 4115 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679363.1 protein_id gnl|my_center|LOCUS_11390 4130 4828 gene locus_tag LOCUS_11400 4130 4828 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066132.1 protein_id gnl|my_center|LOCUS_11400 4849 5514 gene locus_tag LOCUS_11410 4849 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 6210 5608 gene locus_tag LOCUS_11420 6210 5608 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964199.1 protein_id gnl|my_center|LOCUS_11420 6670 8277 gene locus_tag LOCUS_11430 6670 8277 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_11430 8436 10646 gene locus_tag LOCUS_11440 gene pcrA 8436 10646 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989805.1 protein_id gnl|my_center|LOCUS_11440 10812 11051 gene locus_tag LOCUS_11450 10812 11051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 11142 12536 gene locus_tag LOCUS_11460 gene rlmD 11142 12536 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434581.1 protein_id gnl|my_center|LOCUS_11460 13333 13515 gene locus_tag LOCUS_11470 13333 13515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 13889 14212 gene locus_tag LOCUS_11480 13889 14212 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944876.1 protein_id gnl|my_center|LOCUS_11480 14315 14629 gene locus_tag LOCUS_11490 14315 14629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 14787 15308 gene locus_tag LOCUS_11500 14787 15308 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966820.1 protein_id gnl|my_center|LOCUS_11500 15393 16859 gene locus_tag LOCUS_11510 15393 16859 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_11510 16856 17461 gene locus_tag LOCUS_11520 16856 17461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 17465 18667 gene locus_tag LOCUS_11530 17465 18667 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090011.1 protein_id gnl|my_center|LOCUS_11530 19310 18837 gene locus_tag LOCUS_11540 19310 18837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 19458 19835 gene locus_tag LOCUS_11550 19458 19835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence042 2073 1540 gene locus_tag LOCUS_11560 2073 1540 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429542.1 protein_id gnl|my_center|LOCUS_11560 3394 2063 gene locus_tag LOCUS_11570 3394 2063 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921845.1 protein_id gnl|my_center|LOCUS_11570 4214 3477 gene locus_tag LOCUS_11580 gene kdsB 4214 3477 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030749.1 protein_id gnl|my_center|LOCUS_11580 5026 4229 gene locus_tag LOCUS_11590 5026 4229 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975445.1 protein_id gnl|my_center|LOCUS_11590 5838 5041 gene locus_tag LOCUS_11600 5838 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 7409 5835 gene locus_tag LOCUS_11610 7409 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 10090 7406 gene locus_tag LOCUS_11620 10090 7406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 10626 10087 gene locus_tag LOCUS_11630 10626 10087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 12205 10628 gene locus_tag LOCUS_11640 12205 10628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 13576 12221 gene locus_tag LOCUS_11650 13576 12221 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965627.1 protein_id gnl|my_center|LOCUS_11650 15665 13602 gene locus_tag LOCUS_11660 15665 13602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 16426 15662 gene locus_tag LOCUS_11670 16426 15662 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461000.1 protein_id gnl|my_center|LOCUS_11670 17193 16438 gene locus_tag LOCUS_11680 17193 16438 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_11680 17381 18742 gene locus_tag LOCUS_11690 17381 18742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 18764 19654 gene locus_tag LOCUS_11700 18764 19654 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence043 122 1585 gene locus_tag LOCUS_11710 122 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1700 3079 gene locus_tag LOCUS_11720 1700 3079 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_11720 4075 3221 gene locus_tag LOCUS_11730 4075 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11730 4779 3991 gene locus_tag LOCUS_11740 4779 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11740 5056 4793 gene locus_tag LOCUS_11750 5056 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 6566 5064 gene locus_tag LOCUS_11760 gene abfB 6566 5064 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_11760 7194 6568 gene locus_tag LOCUS_11770 7194 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 9322 7220 gene locus_tag LOCUS_11780 9322 7220 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_11780 10239 9343 gene locus_tag LOCUS_11790 10239 9343 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_11790 11208 10252 gene locus_tag LOCUS_11800 11208 10252 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_11800 12942 11278 gene locus_tag LOCUS_11810 12942 11278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 14661 13075 gene locus_tag LOCUS_11820 14661 13075 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922520.1 protein_id gnl|my_center|LOCUS_11820 16441 14675 gene locus_tag LOCUS_11830 16441 14675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 17682 16498 gene locus_tag LOCUS_11840 17682 16498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 18194 17862 gene locus_tag LOCUS_11850 18194 17862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 18429 18641 gene locus_tag LOCUS_11860 18429 18641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 18992 18708 gene locus_tag LOCUS_11870 18992 18708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 19215 18973 gene locus_tag LOCUS_11880 19215 18973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence044 883 89 gene locus_tag LOCUS_11890 gene proC 883 89 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048171.1 protein_id gnl|my_center|LOCUS_11890 1005 1490 gene locus_tag LOCUS_11900 1005 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1594 1854 gene locus_tag LOCUS_11910 1594 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1982 3016 gene locus_tag LOCUS_11920 1982 3016 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_11920 3575 3114 gene locus_tag LOCUS_11930 3575 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 3713 4318 gene locus_tag LOCUS_11940 3713 4318 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_11940 4458 5771 gene locus_tag LOCUS_11950 gene tig 4458 5771 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_11950 5808 6389 gene locus_tag LOCUS_11960 gene clpP 5808 6389 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_11960 6474 7778 gene locus_tag LOCUS_11970 gene clpX 6474 7778 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_11970 7811 10141 gene locus_tag LOCUS_11980 gene lon 7811 10141 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435613.1 protein_id gnl|my_center|LOCUS_11980 10157 10756 gene locus_tag LOCUS_11990 gene yihA 10157 10756 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_11990 10773 11957 gene locus_tag LOCUS_12000 10773 11957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 12010 12855 gene locus_tag LOCUS_12010 12010 12855 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_12010 12846 13703 gene locus_tag LOCUS_12020 12846 13703 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_12020 13700 14500 gene locus_tag LOCUS_12030 13700 14500 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860635.1 protein_id gnl|my_center|LOCUS_12030 14521 15264 gene locus_tag LOCUS_12040 gene truA 14521 15264 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_12040 16136 15261 gene locus_tag LOCUS_12050 16136 15261 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435320.1 protein_id gnl|my_center|LOCUS_12050 16331 16837 gene locus_tag LOCUS_12060 16331 16837 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_12060 16856 17119 gene locus_tag LOCUS_12070 16856 17119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 17442 17242 gene locus_tag LOCUS_12080 17442 17242 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563620.1 protein_id gnl|my_center|LOCUS_12080 17736 19019 gene locus_tag LOCUS_12090 gene pyrC 17736 19019 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108375.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence045 962 156 gene locus_tag LOCUS_12100 962 156 CDS product heparan-alpha-glucosaminide N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458912.1 protein_id gnl|my_center|LOCUS_12100 2007 1015 gene locus_tag LOCUS_12110 gene bsh 2007 1015 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317802.1 protein_id gnl|my_center|LOCUS_12110 3834 2173 gene locus_tag LOCUS_12120 gene malL 3834 2173 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415176.1 protein_id gnl|my_center|LOCUS_12120 3987 4265 gene locus_tag LOCUS_12130 3987 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 5857 4343 gene locus_tag LOCUS_12140 gene hutH 5857 4343 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925153.1 protein_id gnl|my_center|LOCUS_12140 7426 5885 gene locus_tag LOCUS_12150 gene hutH 7426 5885 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925153.1 protein_id gnl|my_center|LOCUS_12150 9041 7419 gene locus_tag LOCUS_12160 9041 7419 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868946.1 protein_id gnl|my_center|LOCUS_12160 9403 11082 gene locus_tag LOCUS_12170 gene rocR 9403 11082 CDS product arginine utilization regulatory protein RocR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244510.1 protein_id gnl|my_center|LOCUS_12170 12429 11089 gene locus_tag LOCUS_12180 gene rpoN 12429 11089 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170876203.1 protein_id gnl|my_center|LOCUS_12180 13640 12471 gene locus_tag LOCUS_12190 13640 12471 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964224.1 protein_id gnl|my_center|LOCUS_12190 14935 13637 gene locus_tag LOCUS_12200 14935 13637 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_12200 15740 14916 gene locus_tag LOCUS_12210 15740 14916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 16613 15810 gene locus_tag LOCUS_12220 16613 15810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 17226 16687 gene locus_tag LOCUS_12230 17226 16687 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462052.1 protein_id gnl|my_center|LOCUS_12230 18162 17290 gene locus_tag LOCUS_12240 18162 17290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence046 2569 761 gene locus_tag LOCUS_12250 gene ftsH 2569 761 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966478.1 protein_id gnl|my_center|LOCUS_12250 3126 2605 gene locus_tag LOCUS_12260 gene hpt 3126 2605 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_12260 4486 3119 gene locus_tag LOCUS_12270 gene tilS 4486 3119 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_12270 5984 4497 gene locus_tag LOCUS_12280 5984 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 6486 6103 gene locus_tag LOCUS_12290 6486 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 7213 6929 gene locus_tag LOCUS_12300 7213 6929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 7524 7285 gene locus_tag LOCUS_12310 7524 7285 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287407.1 protein_id gnl|my_center|LOCUS_12310 7806 7531 gene locus_tag LOCUS_12320 7806 7531 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905402.1 protein_id gnl|my_center|LOCUS_12320 8893 7913 gene locus_tag LOCUS_12330 8893 7913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 10276 8960 gene locus_tag LOCUS_12340 10276 8960 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_12340 11717 10278 gene locus_tag LOCUS_12350 gene proS 11717 10278 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450718.1 protein_id gnl|my_center|LOCUS_12350 13840 12158 gene locus_tag LOCUS_12360 13840 12158 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_12360 14459 13974 gene locus_tag LOCUS_12370 14459 13974 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_12370 15105 14476 gene locus_tag LOCUS_12380 gene upp 15105 14476 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894672.1 protein_id gnl|my_center|LOCUS_12380 15581 15147 gene locus_tag LOCUS_12390 gene rpiB 15581 15147 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966164.1 protein_id gnl|my_center|LOCUS_12390 16648 15581 gene locus_tag LOCUS_12400 16648 15581 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557336.1 protein_id gnl|my_center|LOCUS_12400 17401 16691 gene locus_tag LOCUS_12410 gene cwlD 17401 16691 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048347.1 protein_id gnl|my_center|LOCUS_12410 18367 17516 gene locus_tag LOCUS_12420 18367 17516 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051830.1 protein_id gnl|my_center|LOCUS_12420 <19223 18367 gene locus_tag LOCUS_12430 <19223 18367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051829.1:sugar ABC transporter permease >Feature sequence047 270 590 gene locus_tag LOCUS_12440 270 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 897 1805 gene locus_tag LOCUS_12450 897 1805 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434205.1 protein_id gnl|my_center|LOCUS_12450 1810 3561 gene locus_tag LOCUS_12460 1810 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860733.1 protein_id gnl|my_center|LOCUS_12460 3912 3637 gene locus_tag LOCUS_12470 3912 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 4114 5595 gene locus_tag LOCUS_12480 4114 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965677.1 protein_id gnl|my_center|LOCUS_12480 7601 5601 gene locus_tag LOCUS_12490 7601 5601 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986650.1 protein_id gnl|my_center|LOCUS_12490 8358 7591 gene locus_tag LOCUS_12500 8358 7591 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_12500 9545 8526 gene locus_tag LOCUS_12510 9545 8526 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_12510 10210 9542 gene locus_tag LOCUS_12520 10210 9542 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024933199.1 protein_id gnl|my_center|LOCUS_12520 10555 10382 gene locus_tag LOCUS_12530 10555 10382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 13217 10611 gene locus_tag LOCUS_12540 gene clpB 13217 10611 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_12540 14186 13572 gene locus_tag LOCUS_12550 14186 13572 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_12550 17129 14319 gene locus_tag LOCUS_12560 17129 14319 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989971.1 protein_id gnl|my_center|LOCUS_12560 17378 17944 gene locus_tag LOCUS_12570 17378 17944 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890731.1 protein_id gnl|my_center|LOCUS_12570 18677 17946 gene locus_tag LOCUS_12580 18677 17946 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence048 1799 1098 gene locus_tag LOCUS_12590 1799 1098 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048140.1 protein_id gnl|my_center|LOCUS_12590 2013 5231 gene locus_tag LOCUS_12600 gene carB 2013 5231 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_12600 5314 6228 gene locus_tag LOCUS_12610 5314 6228 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_12610 7005 6346 gene locus_tag LOCUS_12620 7005 6346 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963740.1 protein_id gnl|my_center|LOCUS_12620 7483 7010 gene locus_tag LOCUS_12630 7483 7010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 8247 7480 gene locus_tag LOCUS_12640 gene yaaA 8247 7480 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458998.1 protein_id gnl|my_center|LOCUS_12640 8419 9081 gene locus_tag LOCUS_12650 8419 9081 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582846.1 protein_id gnl|my_center|LOCUS_12650 9428 9129 gene locus_tag LOCUS_12660 9428 9129 CDS product cysteine-rich small domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437519.1 protein_id gnl|my_center|LOCUS_12660 10589 9444 gene locus_tag LOCUS_12670 10589 9444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 10862 12223 gene locus_tag LOCUS_12680 10862 12223 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_12680 12777 12286 gene locus_tag LOCUS_12690 12777 12286 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890795.1 protein_id gnl|my_center|LOCUS_12690 13386 12784 gene locus_tag LOCUS_12700 13386 12784 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_12700 13946 13434 gene locus_tag LOCUS_12710 13946 13434 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900176.1 protein_id gnl|my_center|LOCUS_12710 14942 14088 gene locus_tag LOCUS_12720 gene nadC 14942 14088 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360683.1 protein_id gnl|my_center|LOCUS_12720 16246 14939 gene locus_tag LOCUS_12730 16246 14939 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016070.1 protein_id gnl|my_center|LOCUS_12730 17167 16259 gene locus_tag LOCUS_12740 gene nadA 17167 16259 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016069.1 protein_id gnl|my_center|LOCUS_12740 17464 18621 gene locus_tag LOCUS_12750 17464 18621 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434490.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence049 1464 2999 gene locus_tag LOCUS_12760 gene hutH 1464 2999 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032916282.1 protein_id gnl|my_center|LOCUS_12760 3082 4416 gene locus_tag LOCUS_12770 3082 4416 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113204.1 protein_id gnl|my_center|LOCUS_12770 4848 4528 gene locus_tag LOCUS_12780 4848 4528 CDS product SugE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021723289.1 protein_id gnl|my_center|LOCUS_12780 5113 5277 gene locus_tag LOCUS_12790 5113 5277 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_12790 6293 5370 gene locus_tag LOCUS_12800 6293 5370 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439497.1 protein_id gnl|my_center|LOCUS_12800 6440 8077 gene locus_tag LOCUS_12810 6440 8077 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439500.1 protein_id gnl|my_center|LOCUS_12810 8122 9075 gene locus_tag LOCUS_12820 8122 9075 CDS product 4Fe-4S-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430299.1 protein_id gnl|my_center|LOCUS_12820 9207 10040 gene locus_tag LOCUS_12830 gene dapF 9207 10040 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_12830 10088 11428 gene locus_tag LOCUS_12840 10088 11428 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_12840 11460 11693 gene locus_tag LOCUS_12850 11460 11693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 11683 13674 gene locus_tag LOCUS_12860 gene feoB 11683 13674 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044821.1 protein_id gnl|my_center|LOCUS_12860 13771 15573 gene locus_tag LOCUS_12870 13771 15573 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 protein_id gnl|my_center|LOCUS_12870 15577 16233 gene locus_tag LOCUS_12880 gene nth 15577 16233 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_12880 16230 16940 gene locus_tag LOCUS_12890 16230 16940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 17097 18083 gene locus_tag LOCUS_12900 17097 18083 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_12900 18098 18598 gene locus_tag LOCUS_12910 18098 18598 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814644.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence050 35 748 gene locus_tag LOCUS_12920 35 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1078 716 gene locus_tag LOCUS_12930 1078 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1795 3246 gene locus_tag LOCUS_12940 1795 3246 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987157.1 protein_id gnl|my_center|LOCUS_12940 3338 4006 gene locus_tag LOCUS_12950 3338 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 4058 4891 gene locus_tag LOCUS_12960 4058 4891 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417310.1 protein_id gnl|my_center|LOCUS_12960 4888 6282 gene locus_tag LOCUS_12970 4888 6282 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_12970 6282 7022 gene locus_tag LOCUS_12980 6282 7022 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285969.1 protein_id gnl|my_center|LOCUS_12980 6991 7656 gene locus_tag LOCUS_12990 6991 7656 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_12990 7653 9554 gene locus_tag LOCUS_13000 7653 9554 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_13000 9567 10337 gene locus_tag LOCUS_13010 9567 10337 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_13010 10334 10954 gene locus_tag LOCUS_13020 10334 10954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 10963 11970 gene locus_tag LOCUS_13030 10963 11970 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_13030 11967 12494 gene locus_tag LOCUS_13040 gene lepB 11967 12494 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392487.1 protein_id gnl|my_center|LOCUS_13040 12507 13040 gene locus_tag LOCUS_13050 gene recU 12507 13040 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460152.1 protein_id gnl|my_center|LOCUS_13050 12962 13177 gene locus_tag LOCUS_13060 12962 13177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 14292 13261 gene locus_tag LOCUS_13070 14292 13261 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945452.1 protein_id gnl|my_center|LOCUS_13070 14681 14307 gene locus_tag LOCUS_13080 14681 14307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 14856 15074 gene locus_tag LOCUS_13090 14856 15074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13090 15100 16983 gene locus_tag LOCUS_13100 15100 16983 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379416.1 protein_id gnl|my_center|LOCUS_13100 17109 17489 gene locus_tag LOCUS_13110 17109 17489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 17531 18475 gene locus_tag LOCUS_13120 17531 18475 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937903.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence051 68 397 gene locus_tag LOCUS_13130 68 397 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197242566.1 protein_id gnl|my_center|LOCUS_13130 708 1901 gene locus_tag LOCUS_13140 708 1901 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908499.1 protein_id gnl|my_center|LOCUS_13140 1891 2763 gene locus_tag LOCUS_13150 1891 2763 CDS product aminoglycoside 6-adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258548.1 protein_id gnl|my_center|LOCUS_13150 3237 2764 gene locus_tag LOCUS_13160 3237 2764 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_13160 4342 3302 gene locus_tag LOCUS_13170 4342 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 4561 5217 gene locus_tag LOCUS_13180 4561 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 5229 5714 gene locus_tag LOCUS_13190 5229 5714 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_13190 5704 6144 gene locus_tag LOCUS_13200 5704 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 6349 6720 gene locus_tag LOCUS_13210 6349 6720 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_13210 6723 7574 gene locus_tag LOCUS_13220 6723 7574 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_13220 7571 8224 gene locus_tag LOCUS_13230 7571 8224 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459560.1 protein_id gnl|my_center|LOCUS_13230 8239 8460 gene locus_tag LOCUS_13240 8239 8460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 8591 8863 gene locus_tag LOCUS_13250 8591 8863 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889969.1 protein_id gnl|my_center|LOCUS_13250 8856 9494 gene locus_tag LOCUS_13260 8856 9494 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435225.1 protein_id gnl|my_center|LOCUS_13260 9739 10545 gene locus_tag LOCUS_13270 9739 10545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 10542 11330 gene locus_tag LOCUS_13280 10542 11330 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774940.1 protein_id gnl|my_center|LOCUS_13280 11336 11524 gene locus_tag LOCUS_13290 11336 11524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 11460 12170 gene locus_tag LOCUS_13300 11460 12170 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170564.1 protein_id gnl|my_center|LOCUS_13300 13121 12210 gene locus_tag LOCUS_13310 13121 12210 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262870.1 protein_id gnl|my_center|LOCUS_13310 14895 13150 gene locus_tag LOCUS_13320 14895 13150 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_13320 14972 15937 gene locus_tag LOCUS_13330 14972 15937 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_13330 15952 16224 gene locus_tag LOCUS_13340 15952 16224 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 protein_id gnl|my_center|LOCUS_13340 16217 16849 gene locus_tag LOCUS_13350 gene gmk 16217 16849 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131468.1 protein_id gnl|my_center|LOCUS_13350 16852 17106 gene locus_tag LOCUS_13360 gene rpoZ 16852 17106 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388622.1 protein_id gnl|my_center|LOCUS_13360 17182 18522 gene locus_tag LOCUS_13370 gene rimO 17182 18522 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986784.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence052 1366 449 gene locus_tag LOCUS_13380 1366 449 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963750.1 protein_id gnl|my_center|LOCUS_13380 2235 1366 gene locus_tag LOCUS_13390 2235 1366 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963749.1 protein_id gnl|my_center|LOCUS_13390 3380 2235 gene locus_tag LOCUS_13400 gene ugpC 3380 2235 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_13400 3806 3651 gene locus_tag LOCUS_13410 3806 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 4195 5019 gene locus_tag LOCUS_13420 4195 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 5012 5497 gene locus_tag LOCUS_13430 5012 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 5527 6939 gene locus_tag LOCUS_13440 5527 6939 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_13440 6988 8403 gene locus_tag LOCUS_13450 6988 8403 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_13450 8586 9770 gene locus_tag LOCUS_13460 8586 9770 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868916.1 protein_id gnl|my_center|LOCUS_13460 9791 11188 gene locus_tag LOCUS_13470 9791 11188 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 protein_id gnl|my_center|LOCUS_13470 12264 11308 gene locus_tag LOCUS_13480 12264 11308 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963416.1 protein_id gnl|my_center|LOCUS_13480 12415 13596 gene locus_tag LOCUS_13490 12415 13596 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948530.1 protein_id gnl|my_center|LOCUS_13490 13752 14648 gene locus_tag LOCUS_13500 gene rfbA 13752 14648 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857520.1 protein_id gnl|my_center|LOCUS_13500 14677 15696 gene locus_tag LOCUS_13510 gene rfbB 14677 15696 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_13510 15709 16644 gene locus_tag LOCUS_13520 gene rfbD 15709 16644 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664667.1 protein_id gnl|my_center|LOCUS_13520 16661 17263 gene locus_tag LOCUS_13530 gene rfbC 16661 17263 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence053 595 819 gene locus_tag LOCUS_13540 595 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 704 1084 gene locus_tag LOCUS_13550 704 1084 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805188.1 protein_id gnl|my_center|LOCUS_13550 1077 1958 gene locus_tag LOCUS_13560 1077 1958 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560935.1 protein_id gnl|my_center|LOCUS_13560 1960 2640 gene locus_tag LOCUS_13570 1960 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 2653 3360 gene locus_tag LOCUS_13580 2653 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 3464 5119 gene locus_tag LOCUS_13590 3464 5119 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_13590 7764 5227 gene locus_tag LOCUS_13600 7764 5227 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_13600 8101 7790 gene locus_tag LOCUS_13610 8101 7790 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461875.1 protein_id gnl|my_center|LOCUS_13610 8347 9807 gene locus_tag LOCUS_13620 8347 9807 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387166.1 protein_id gnl|my_center|LOCUS_13620 9809 11065 gene locus_tag LOCUS_13630 9809 11065 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436123.1 protein_id gnl|my_center|LOCUS_13630 11122 12624 gene locus_tag LOCUS_13640 11122 12624 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861709.1 protein_id gnl|my_center|LOCUS_13640 12621 13361 gene locus_tag LOCUS_13650 12621 13361 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436119.1 protein_id gnl|my_center|LOCUS_13650 13342 14679 gene locus_tag LOCUS_13660 gene dsdA 13342 14679 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658347.1 protein_id gnl|my_center|LOCUS_13660 14877 15728 gene locus_tag LOCUS_13670 14877 15728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 15745 17235 gene locus_tag LOCUS_13680 gene thrC 15745 17235 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_13680 17270 18046 gene locus_tag LOCUS_13690 17270 18046 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_13690 >Feature sequence054 43 312 gene locus_tag LOCUS_13700 43 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 296 574 gene locus_tag LOCUS_13710 296 574 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613391.1 protein_id gnl|my_center|LOCUS_13710 630 959 gene locus_tag LOCUS_13720 630 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 998 1612 gene locus_tag LOCUS_13730 998 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1637 2056 gene locus_tag LOCUS_13740 1637 2056 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861104.1 protein_id gnl|my_center|LOCUS_13740 2116 2256 gene locus_tag LOCUS_13750 2116 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 2411 2560 gene locus_tag LOCUS_13760 2411 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 2754 2921 gene locus_tag LOCUS_13770 2754 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 2964 3593 gene locus_tag LOCUS_13780 2964 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 5842 3644 gene locus_tag LOCUS_13790 5842 3644 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860821.1 protein_id gnl|my_center|LOCUS_13790 6528 5848 gene locus_tag LOCUS_13800 6528 5848 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888282.1 protein_id gnl|my_center|LOCUS_13800 7787 6600 gene locus_tag LOCUS_13810 7787 6600 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860822.1 protein_id gnl|my_center|LOCUS_13810 8461 7784 gene locus_tag LOCUS_13820 8461 7784 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434705.1 protein_id gnl|my_center|LOCUS_13820 8752 9168 gene locus_tag LOCUS_13830 8752 9168 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861328.1 protein_id gnl|my_center|LOCUS_13830 9213 9836 gene locus_tag LOCUS_13840 9213 9836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 10020 10526 gene locus_tag LOCUS_13850 10020 10526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 10592 10930 gene locus_tag LOCUS_13860 10592 10930 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964324.1 protein_id gnl|my_center|LOCUS_13860 10983 11663 gene locus_tag LOCUS_13870 10983 11663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 11688 12212 gene locus_tag LOCUS_13880 11688 12212 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965782.1 protein_id gnl|my_center|LOCUS_13880 12286 13020 gene locus_tag LOCUS_13890 12286 13020 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369289.1 protein_id gnl|my_center|LOCUS_13890 13091 13714 gene locus_tag LOCUS_13900 13091 13714 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891568.1 protein_id gnl|my_center|LOCUS_13900 13745 14305 gene locus_tag LOCUS_13910 13745 14305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 14454 14954 gene locus_tag LOCUS_13920 14454 14954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966118.1 protein_id gnl|my_center|LOCUS_13920 15217 15366 gene locus_tag LOCUS_13930 15217 15366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 15416 17161 gene locus_tag LOCUS_13940 15416 17161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence055 270 3737 gene locus_tag LOCUS_13950 270 3737 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459292.1 protein_id gnl|my_center|LOCUS_13950 3743 4267 gene locus_tag LOCUS_13960 3743 4267 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058223026.1 protein_id gnl|my_center|LOCUS_13960 4254 4790 gene locus_tag LOCUS_13970 4254 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 4849 5124 gene locus_tag LOCUS_13980 4849 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 5138 6367 gene locus_tag LOCUS_13990 gene yqfD 5138 6367 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047998.1 protein_id gnl|my_center|LOCUS_13990 6360 7367 gene locus_tag LOCUS_14000 6360 7367 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_14000 7371 7871 gene locus_tag LOCUS_14010 gene ybeY 7371 7871 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964605.1 protein_id gnl|my_center|LOCUS_14010 7961 8437 gene locus_tag LOCUS_14020 7961 8437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 8542 9396 gene locus_tag LOCUS_14030 gene proB 8542 9396 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_14030 9416 9637 gene locus_tag LOCUS_14040 9416 9637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 9615 10166 gene locus_tag LOCUS_14050 9615 10166 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642751.1 protein_id gnl|my_center|LOCUS_14050 10447 11235 gene locus_tag LOCUS_14060 10447 11235 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965836.1 protein_id gnl|my_center|LOCUS_14060 11252 12442 gene locus_tag LOCUS_14070 11252 12442 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948689.1 protein_id gnl|my_center|LOCUS_14070 12448 13887 gene locus_tag LOCUS_14080 12448 13887 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965834.1 protein_id gnl|my_center|LOCUS_14080 13877 15052 gene locus_tag LOCUS_14090 13877 15052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 15084 16433 gene locus_tag LOCUS_14100 15084 16433 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989199.1 protein_id gnl|my_center|LOCUS_14100 16525 17031 gene locus_tag LOCUS_14110 16525 17031 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902172.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence056 1173 331 gene locus_tag LOCUS_14120 1173 331 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027122.1 protein_id gnl|my_center|LOCUS_14120 2589 1336 gene locus_tag LOCUS_14130 2589 1336 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015512063.1 protein_id gnl|my_center|LOCUS_14130 3310 2954 gene locus_tag LOCUS_14140 3310 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 4548 3520 gene locus_tag LOCUS_14150 4548 3520 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948346.1 protein_id gnl|my_center|LOCUS_14150 6755 4710 gene locus_tag LOCUS_14160 6755 4710 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459160.1 protein_id gnl|my_center|LOCUS_14160 7513 6752 gene locus_tag LOCUS_14170 7513 6752 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923535.1 protein_id gnl|my_center|LOCUS_14170 8596 7604 gene locus_tag LOCUS_14180 8596 7604 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 protein_id gnl|my_center|LOCUS_14180 9278 8607 gene locus_tag LOCUS_14190 9278 8607 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_14190 9805 9515 gene locus_tag LOCUS_14200 9805 9515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 11397 9820 gene locus_tag LOCUS_14210 11397 9820 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901104.1 protein_id gnl|my_center|LOCUS_14210 12171 11416 gene locus_tag LOCUS_14220 12171 11416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 12984 12193 gene locus_tag LOCUS_14230 12984 12193 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016906.1 protein_id gnl|my_center|LOCUS_14230 13853 12981 gene locus_tag LOCUS_14240 13853 12981 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990759.1 protein_id gnl|my_center|LOCUS_14240 14797 13850 gene locus_tag LOCUS_14250 14797 13850 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016909.1 protein_id gnl|my_center|LOCUS_14250 16672 14978 gene locus_tag LOCUS_14260 16672 14978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence057 <1 1820 gene locus_tag LOCUS_14270 <1 1820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003226808.1:DNA topoisomerase (ATP-hydrolyzing) subunit B 1831 4080 gene locus_tag LOCUS_14280 gene gyrA 1831 4080 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_14280 4092 5312 gene locus_tag LOCUS_14290 4092 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 5479 5943 gene locus_tag LOCUS_14300 5479 5943 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_14300 5961 7133 gene locus_tag LOCUS_14310 gene nusA 5961 7133 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_14310 7143 7421 gene locus_tag LOCUS_14320 7143 7421 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419469.1 protein_id gnl|my_center|LOCUS_14320 7408 7728 gene locus_tag LOCUS_14330 7408 7728 CDS product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419470.1 protein_id gnl|my_center|LOCUS_14330 7743 10451 gene locus_tag LOCUS_14340 7743 10451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 10473 10868 gene locus_tag LOCUS_14350 gene rbfA 10473 10868 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_14350 10849 11817 gene locus_tag LOCUS_14360 10849 11817 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_14360 11814 12710 gene locus_tag LOCUS_14370 gene truB 11814 12710 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965111.1 protein_id gnl|my_center|LOCUS_14370 12726 13649 gene locus_tag LOCUS_14380 12726 13649 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_14380 13909 14619 gene locus_tag LOCUS_14390 gene rgbR 13909 14619 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_14390 14635 15369 gene locus_tag LOCUS_14400 14635 15369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 15372 16706 gene locus_tag LOCUS_14410 15372 16706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 16837 17103 gene locus_tag LOCUS_14420 gene rpsO 16837 17103 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632621.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence058 211 912 gene locus_tag LOCUS_14430 211 912 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287046.1 protein_id gnl|my_center|LOCUS_14430 896 1663 gene locus_tag LOCUS_14440 896 1663 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578368.1 protein_id gnl|my_center|LOCUS_14440 2236 2081 gene locus_tag LOCUS_14450 2236 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 2445 3743 gene locus_tag LOCUS_14460 gene eno 2445 3743 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964032.1 protein_id gnl|my_center|LOCUS_14460 3756 4319 gene locus_tag LOCUS_14470 gene ahpC 3756 4319 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810052.1 protein_id gnl|my_center|LOCUS_14470 4319 5959 gene locus_tag LOCUS_14480 4319 5959 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810050.1 protein_id gnl|my_center|LOCUS_14480 7933 6056 gene locus_tag LOCUS_14490 7933 6056 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 protein_id gnl|my_center|LOCUS_14490 8512 8237 gene locus_tag LOCUS_14500 8512 8237 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_14500 8656 9057 gene locus_tag LOCUS_14510 8656 9057 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434285.1 protein_id gnl|my_center|LOCUS_14510 9082 9897 gene locus_tag LOCUS_14520 9082 9897 CDS product acyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321472.1 protein_id gnl|my_center|LOCUS_14520 10641 9916 gene locus_tag LOCUS_14530 10641 9916 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459709.1 protein_id gnl|my_center|LOCUS_14530 10827 11246 gene locus_tag LOCUS_14540 10827 11246 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004309783.1 protein_id gnl|my_center|LOCUS_14540 11917 11321 gene locus_tag LOCUS_14550 11917 11321 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_14550 12178 13701 gene locus_tag LOCUS_14560 12178 13701 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064987.1 protein_id gnl|my_center|LOCUS_14560 14563 13784 gene locus_tag LOCUS_14570 gene sigG 14563 13784 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_14570 14824 16350 gene locus_tag LOCUS_14580 14824 16350 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_14580 16347 17081 gene locus_tag LOCUS_14590 16347 17081 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666310.1 protein_id gnl|my_center|LOCUS_14590 >Feature sequence059 1122 472 gene locus_tag LOCUS_14600 gene grpE 1122 472 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392710.1 protein_id gnl|my_center|LOCUS_14600 2189 1140 gene locus_tag LOCUS_14610 gene hrcA 2189 1140 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_14610 4425 2437 gene locus_tag LOCUS_14620 gene uvrB 4425 2437 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_14620 5161 4673 gene locus_tag LOCUS_14630 5161 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 7215 5482 gene locus_tag LOCUS_14640 7215 5482 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_14640 9035 7293 gene locus_tag LOCUS_14650 9035 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 10432 9134 gene locus_tag LOCUS_14660 10432 9134 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_14660 11419 10442 gene locus_tag LOCUS_14670 11419 10442 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544125.1 protein_id gnl|my_center|LOCUS_14670 12455 11406 gene locus_tag LOCUS_14680 12455 11406 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966904.1 protein_id gnl|my_center|LOCUS_14680 13331 12465 gene locus_tag LOCUS_14690 13331 12465 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989353.1 protein_id gnl|my_center|LOCUS_14690 14287 13337 gene locus_tag LOCUS_14700 14287 13337 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948861.1 protein_id gnl|my_center|LOCUS_14700 15974 14361 gene locus_tag LOCUS_14710 15974 14361 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724033.1 protein_id gnl|my_center|LOCUS_14710 16163 16786 gene locus_tag LOCUS_14720 16163 16786 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975126.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence060 1008 535 gene locus_tag LOCUS_14730 1008 535 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_14730 3764 1233 gene locus_tag LOCUS_14740 3764 1233 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861274.1 protein_id gnl|my_center|LOCUS_14740 4511 3828 gene locus_tag LOCUS_14750 4511 3828 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_14750 5178 4531 gene locus_tag LOCUS_14760 5178 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 5876 5310 gene locus_tag LOCUS_14770 gene cyaB 5876 5310 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869738.1 protein_id gnl|my_center|LOCUS_14770 6972 5896 gene locus_tag LOCUS_14780 6972 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 8448 7162 gene locus_tag LOCUS_14790 8448 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 9501 8497 gene locus_tag LOCUS_14800 9501 8497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 10292 9603 gene locus_tag LOCUS_14810 10292 9603 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276738.1 protein_id gnl|my_center|LOCUS_14810 12442 10358 gene locus_tag LOCUS_14820 12442 10358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 13205 12432 gene locus_tag LOCUS_14830 13205 12432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_14830 13801 13520 gene locus_tag LOCUS_14840 13801 13520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 14267 13941 gene locus_tag LOCUS_14850 14267 13941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 15051 14290 gene locus_tag LOCUS_14860 15051 14290 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016616.1 protein_id gnl|my_center|LOCUS_14860 15365 15520 gene locus_tag LOCUS_14870 15365 15520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 15584 16081 gene locus_tag LOCUS_14880 15584 16081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14880 16112 16462 gene locus_tag LOCUS_14890 16112 16462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 16960 16490 gene locus_tag LOCUS_14900 16960 16490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 >Feature sequence061 94 1512 gene locus_tag LOCUS_14910 gene hydG 94 1512 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_14910 1532 2755 gene locus_tag LOCUS_14920 gene hydF 1532 2755 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_14920 3762 2752 gene locus_tag LOCUS_14930 3762 2752 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582593.1 protein_id gnl|my_center|LOCUS_14930 3942 6323 gene locus_tag LOCUS_14940 3942 6323 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582331.1 protein_id gnl|my_center|LOCUS_14940 7060 6395 gene locus_tag LOCUS_14950 7060 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 7196 7660 gene locus_tag LOCUS_14960 7196 7660 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948369.1 protein_id gnl|my_center|LOCUS_14960 7647 8711 gene locus_tag LOCUS_14970 7647 8711 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861575.1 protein_id gnl|my_center|LOCUS_14970 10924 8762 gene locus_tag LOCUS_14980 10924 8762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 11841 10921 gene locus_tag LOCUS_14990 11841 10921 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966017.1 protein_id gnl|my_center|LOCUS_14990 12697 11843 gene locus_tag LOCUS_15000 12697 11843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 12851 12681 gene locus_tag LOCUS_15010 12851 12681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 12998 12870 gene locus_tag LOCUS_15020 12998 12870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15020 13771 13085 gene locus_tag LOCUS_15030 13771 13085 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964178.1 protein_id gnl|my_center|LOCUS_15030 14218 13832 gene locus_tag LOCUS_15040 14218 13832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 14744 14436 gene locus_tag LOCUS_15050 14744 14436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15050 14866 14741 gene locus_tag LOCUS_15060 14866 14741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 15074 15002 gene locus_tag LOCUS_t00070 15074 15002 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16028 15174 gene locus_tag LOCUS_15070 16028 15174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 16438 16025 gene locus_tag LOCUS_15080 16438 16025 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_15080 16978 16523 gene locus_tag LOCUS_15090 16978 16523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 >Feature sequence062 61 813 gene locus_tag LOCUS_15100 61 813 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_15100 813 1730 gene locus_tag LOCUS_15110 813 1730 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_15110 1795 2736 gene locus_tag LOCUS_15120 1795 2736 CDS product alanine-tRNA synthetase second additional domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816923.1 protein_id gnl|my_center|LOCUS_15120 2887 3027 gene locus_tag LOCUS_15130 2887 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 3050 3415 gene locus_tag LOCUS_15140 3050 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 3611 4837 gene locus_tag LOCUS_15150 3611 4837 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964082.1 protein_id gnl|my_center|LOCUS_15150 5019 5231 gene locus_tag LOCUS_15160 5019 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 5344 7341 gene locus_tag LOCUS_15170 gene feoB 5344 7341 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903695.1 protein_id gnl|my_center|LOCUS_15170 7418 7792 gene locus_tag LOCUS_15180 7418 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 8607 7801 gene locus_tag LOCUS_15190 8607 7801 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815800.1 protein_id gnl|my_center|LOCUS_15190 9154 8594 gene locus_tag LOCUS_15200 9154 8594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 9306 9470 gene locus_tag LOCUS_15210 9306 9470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 10077 9496 gene locus_tag LOCUS_15220 10077 9496 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121273.1 protein_id gnl|my_center|LOCUS_15220 10225 10776 gene locus_tag LOCUS_15230 10225 10776 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071745902.1 protein_id gnl|my_center|LOCUS_15230 10796 11740 gene locus_tag LOCUS_15240 10796 11740 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140504.1 protein_id gnl|my_center|LOCUS_15240 11809 13431 gene locus_tag LOCUS_15250 11809 13431 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965259.1 protein_id gnl|my_center|LOCUS_15250 13788 14783 gene locus_tag LOCUS_15260 13788 14783 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016441.1 protein_id gnl|my_center|LOCUS_15260 14854 15501 gene locus_tag LOCUS_15270 14854 15501 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_15270 15559 16941 gene locus_tag LOCUS_15280 gene argH 15559 16941 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence063 253 1077 gene locus_tag LOCUS_15290 253 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 2461 1247 gene locus_tag LOCUS_15300 2461 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 2618 2463 gene locus_tag LOCUS_15310 2618 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 2868 3401 gene locus_tag LOCUS_15320 2868 3401 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107760.1 protein_id gnl|my_center|LOCUS_15320 3649 3966 gene locus_tag LOCUS_15330 3649 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 3985 4197 gene locus_tag LOCUS_15340 3985 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 4209 4460 gene locus_tag LOCUS_15350 4209 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 5595 4408 gene locus_tag LOCUS_15360 5595 4408 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399531.1 protein_id gnl|my_center|LOCUS_15360 5755 6699 gene locus_tag LOCUS_15370 5755 6699 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_15370 6791 7477 gene locus_tag LOCUS_15380 6791 7477 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948494.1 protein_id gnl|my_center|LOCUS_15380 7486 8523 gene locus_tag LOCUS_15390 7486 8523 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963773.1 protein_id gnl|my_center|LOCUS_15390 8594 9277 gene locus_tag LOCUS_15400 8594 9277 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399472.1 protein_id gnl|my_center|LOCUS_15400 9274 11601 gene locus_tag LOCUS_15410 9274 11601 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963776.1 protein_id gnl|my_center|LOCUS_15410 11714 12397 gene locus_tag LOCUS_15420 11714 12397 CDS product DUF5714 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673563.1 protein_id gnl|my_center|LOCUS_15420 12603 13094 gene locus_tag LOCUS_15430 12603 13094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 15320 13254 gene locus_tag LOCUS_15440 15320 13254 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_15440 15516 16397 gene locus_tag LOCUS_15450 15516 16397 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence064 1117 1638 gene locus_tag LOCUS_15460 1117 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 2185 1739 gene locus_tag LOCUS_15470 2185 1739 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_15470 2468 2884 gene locus_tag LOCUS_15480 2468 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 2962 4146 gene locus_tag LOCUS_15490 2962 4146 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681116.1 protein_id gnl|my_center|LOCUS_15490 4143 6596 gene locus_tag LOCUS_15500 4143 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 6693 8084 gene locus_tag LOCUS_15510 gene asnS 6693 8084 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948326.1 protein_id gnl|my_center|LOCUS_15510 8095 9153 gene locus_tag LOCUS_15520 8095 9153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 9150 10646 gene locus_tag LOCUS_15530 9150 10646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 11026 10808 gene locus_tag LOCUS_15540 11026 10808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 12351 11152 gene locus_tag LOCUS_15550 12351 11152 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_15550 13343 12354 gene locus_tag LOCUS_15560 13343 12354 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_15560 14368 13361 gene locus_tag LOCUS_15570 14368 13361 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132280311.1 protein_id gnl|my_center|LOCUS_15570 16065 14686 gene locus_tag LOCUS_15580 gene murC 16065 14686 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence065 96 728 gene locus_tag LOCUS_15590 96 728 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108273.1 protein_id gnl|my_center|LOCUS_15590 731 958 gene locus_tag LOCUS_15600 731 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1239 925 gene locus_tag LOCUS_15610 1239 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 2232 1255 gene locus_tag LOCUS_15620 2232 1255 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053899.1 protein_id gnl|my_center|LOCUS_15620 2670 2302 gene locus_tag LOCUS_15630 2670 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 3746 2694 gene locus_tag LOCUS_15640 3746 2694 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109299.1 protein_id gnl|my_center|LOCUS_15640 5679 3766 gene locus_tag LOCUS_15650 5679 3766 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_15650 6580 5699 gene locus_tag LOCUS_15660 gene hslO 6580 5699 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_15660 7374 6604 gene locus_tag LOCUS_15670 7374 6604 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_15670 7587 8306 gene locus_tag LOCUS_15680 7587 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 8502 8738 gene locus_tag LOCUS_15690 8502 8738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 8801 9391 gene locus_tag LOCUS_15700 8801 9391 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550094.1 protein_id gnl|my_center|LOCUS_15700 9421 11304 gene locus_tag LOCUS_15710 9421 11304 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164717.1 protein_id gnl|my_center|LOCUS_15710 12568 11561 gene locus_tag LOCUS_15720 12568 11561 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814186.1 protein_id gnl|my_center|LOCUS_15720 14182 12572 gene locus_tag LOCUS_15730 14182 12572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 15560 14154 gene locus_tag LOCUS_15740 15560 14154 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420847.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence066 2 916 gene locus_tag LOCUS_15750 gene pyrB 2 916 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_15750 910 1347 gene locus_tag LOCUS_15760 910 1347 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965941.1 protein_id gnl|my_center|LOCUS_15760 1561 2880 gene locus_tag LOCUS_15770 1561 2880 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986280.1 protein_id gnl|my_center|LOCUS_15770 2900 3343 gene locus_tag LOCUS_15780 2900 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 3354 3767 gene locus_tag LOCUS_15790 3354 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 3893 4264 gene locus_tag LOCUS_15800 3893 4264 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_15800 4261 5163 gene locus_tag LOCUS_15810 4261 5163 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_15810 5138 7237 gene locus_tag LOCUS_15820 5138 7237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 7373 8284 gene locus_tag LOCUS_15830 7373 8284 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970438.1 protein_id gnl|my_center|LOCUS_15830 8394 9563 gene locus_tag LOCUS_15840 8394 9563 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966242.1 protein_id gnl|my_center|LOCUS_15840 9594 11084 gene locus_tag LOCUS_15850 gene galT 9594 11084 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_15850 11204 13855 gene locus_tag LOCUS_15860 gene polA 11204 13855 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964413.1 protein_id gnl|my_center|LOCUS_15860 13881 14483 gene locus_tag LOCUS_15870 gene coaE 13881 14483 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310474.1 protein_id gnl|my_center|LOCUS_15870 14470 15267 gene locus_tag LOCUS_15880 14470 15267 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_15880 15283 15555 gene locus_tag LOCUS_15890 15283 15555 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053740.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence067 1651 185 gene locus_tag LOCUS_15900 1651 185 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_15900 2308 1691 gene locus_tag LOCUS_15910 2308 1691 CDS product DUF4867 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965899.1 protein_id gnl|my_center|LOCUS_15910 2954 2412 gene locus_tag LOCUS_15920 2954 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 3097 4026 gene locus_tag LOCUS_15930 3097 4026 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966513.1 protein_id gnl|my_center|LOCUS_15930 4032 4544 gene locus_tag LOCUS_15940 4032 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 5060 4611 gene locus_tag LOCUS_15950 gene nrdR 5060 4611 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_15950 6235 5072 gene locus_tag LOCUS_15960 6235 5072 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_15960 6405 7436 gene locus_tag LOCUS_15970 6405 7436 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680378.1 protein_id gnl|my_center|LOCUS_15970 7738 8670 gene locus_tag LOCUS_15980 gene arcC 7738 8670 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680441.1 protein_id gnl|my_center|LOCUS_15980 9236 8763 gene locus_tag LOCUS_15990 9236 8763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15990 10018 9233 gene locus_tag LOCUS_16000 10018 9233 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_16000 10982 10107 gene locus_tag LOCUS_16010 10982 10107 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 protein_id gnl|my_center|LOCUS_16010 14190 10993 gene locus_tag LOCUS_16020 gene carB 14190 10993 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_16020 15263 14190 gene locus_tag LOCUS_16030 gene carA 15263 14190 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence068 106 1632 gene locus_tag LOCUS_16040 106 1632 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_16040 1636 2727 gene locus_tag LOCUS_16050 1636 2727 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_16050 2746 3687 gene locus_tag LOCUS_16060 2746 3687 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_16060 3745 5019 gene locus_tag LOCUS_16070 3745 5019 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896806.1 protein_id gnl|my_center|LOCUS_16070 5041 5772 gene locus_tag LOCUS_16080 5041 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 5786 6598 gene locus_tag LOCUS_16090 5786 6598 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986426.1 protein_id gnl|my_center|LOCUS_16090 6603 7568 gene locus_tag LOCUS_16100 gene add 6603 7568 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368573.1 protein_id gnl|my_center|LOCUS_16100 7570 8241 gene locus_tag LOCUS_16110 gene deoC 7570 8241 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453154.1 protein_id gnl|my_center|LOCUS_16110 8574 9695 gene locus_tag LOCUS_16120 8574 9695 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113569.1 protein_id gnl|my_center|LOCUS_16120 9813 10250 gene locus_tag LOCUS_16130 9813 10250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 10297 10968 gene locus_tag LOCUS_16140 10297 10968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 11173 12717 gene locus_tag LOCUS_16150 gene guaA 11173 12717 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_16150 13671 12793 gene locus_tag LOCUS_16160 13671 12793 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814137.1 protein_id gnl|my_center|LOCUS_16160 14328 13783 gene locus_tag LOCUS_16170 14328 13783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 14503 14697 gene locus_tag LOCUS_16180 14503 14697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395994.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence069 219 452 gene locus_tag LOCUS_16190 219 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 2527 818 gene locus_tag LOCUS_16200 2527 818 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966827.1 protein_id gnl|my_center|LOCUS_16200 3806 2535 gene locus_tag LOCUS_16210 gene hemL 3806 2535 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398699.1 protein_id gnl|my_center|LOCUS_16210 4792 3806 gene locus_tag LOCUS_16220 gene hemB 4792 3806 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016407.1 protein_id gnl|my_center|LOCUS_16220 6378 4879 gene locus_tag LOCUS_16230 gene cobA 6378 4879 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_16230 7289 6393 gene locus_tag LOCUS_16240 gene hemC 7289 6393 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842596.1 protein_id gnl|my_center|LOCUS_16240 7749 7291 gene locus_tag LOCUS_16250 7749 7291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 8989 7760 gene locus_tag LOCUS_16260 gene hemA 8989 7760 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392764.1 protein_id gnl|my_center|LOCUS_16260 9501 10259 gene locus_tag LOCUS_16270 9501 10259 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812271.1 protein_id gnl|my_center|LOCUS_16270 10263 10568 gene locus_tag LOCUS_16280 10263 10568 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812269.1 protein_id gnl|my_center|LOCUS_16280 10621 11397 gene locus_tag LOCUS_16290 gene cbiQ 10621 11397 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812266.1 protein_id gnl|my_center|LOCUS_16290 11394 13058 gene locus_tag LOCUS_16300 11394 13058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 13830 13144 gene locus_tag LOCUS_16310 13830 13144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 14391 13849 gene locus_tag LOCUS_16320 14391 13849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 14952 14416 gene locus_tag LOCUS_16330 14952 14416 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence070 1442 72 gene locus_tag LOCUS_16340 1442 72 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422669.1 protein_id gnl|my_center|LOCUS_16340 3209 1443 gene locus_tag LOCUS_16350 3209 1443 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426762.1 protein_id gnl|my_center|LOCUS_16350 3550 3230 gene locus_tag LOCUS_16360 3550 3230 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986934.1 protein_id gnl|my_center|LOCUS_16360 4520 3543 gene locus_tag LOCUS_16370 4520 3543 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439726.1 protein_id gnl|my_center|LOCUS_16370 5141 4548 gene locus_tag LOCUS_16380 5141 4548 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422659.1 protein_id gnl|my_center|LOCUS_16380 5673 5197 gene locus_tag LOCUS_16390 5673 5197 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_16390 7706 5670 gene locus_tag LOCUS_16400 7706 5670 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898067.1 protein_id gnl|my_center|LOCUS_16400 8184 7741 gene locus_tag LOCUS_16410 8184 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 9452 8229 gene locus_tag LOCUS_16420 9452 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 10604 9591 gene locus_tag LOCUS_16430 10604 9591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 11356 10676 gene locus_tag LOCUS_16440 11356 10676 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_16440 14914 12620 gene locus_tag LOCUS_16450 14914 12620 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence071 105 1901 gene locus_tag LOCUS_16460 gene aspS 105 1901 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965567.1 protein_id gnl|my_center|LOCUS_16460 3090 1984 gene locus_tag LOCUS_16470 3090 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 3436 4761 gene locus_tag LOCUS_16480 3436 4761 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775008.1 protein_id gnl|my_center|LOCUS_16480 4772 6718 gene locus_tag LOCUS_16490 4772 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 6732 7988 gene locus_tag LOCUS_16500 6732 7988 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244568.1 protein_id gnl|my_center|LOCUS_16500 8719 8084 gene locus_tag LOCUS_16510 8719 8084 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861240.1 protein_id gnl|my_center|LOCUS_16510 8850 9725 gene locus_tag LOCUS_16520 8850 9725 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228320.1 protein_id gnl|my_center|LOCUS_16520 9730 11496 gene locus_tag LOCUS_16530 gene argS 9730 11496 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020254.1 protein_id gnl|my_center|LOCUS_16530 11664 13616 gene locus_tag LOCUS_16540 11664 13616 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948262.1 protein_id gnl|my_center|LOCUS_16540 13613 14437 gene locus_tag LOCUS_16550 13613 14437 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966200.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence072 1 75 gene locus_tag LOCUS_t00080 1 75 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1052 129 gene locus_tag LOCUS_16560 1052 129 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963688.1 protein_id gnl|my_center|LOCUS_16560 1204 1803 gene locus_tag LOCUS_16570 1204 1803 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764887.1 protein_id gnl|my_center|LOCUS_16570 1838 2344 gene locus_tag LOCUS_16580 1838 2344 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797556.1 protein_id gnl|my_center|LOCUS_16580 2349 2984 gene locus_tag LOCUS_16590 2349 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 3283 4128 gene locus_tag LOCUS_16600 3283 4128 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439998.1 protein_id gnl|my_center|LOCUS_16600 4248 6188 gene locus_tag LOCUS_16610 4248 6188 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861834.1 protein_id gnl|my_center|LOCUS_16610 6199 7626 gene locus_tag LOCUS_16620 6199 7626 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021359802.1 protein_id gnl|my_center|LOCUS_16620 7842 8351 gene locus_tag LOCUS_16630 7842 8351 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816840.1 protein_id gnl|my_center|LOCUS_16630 8378 8992 gene locus_tag LOCUS_16640 8378 8992 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814119.1 protein_id gnl|my_center|LOCUS_16640 8985 9521 gene locus_tag LOCUS_16650 8985 9521 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668728.1 protein_id gnl|my_center|LOCUS_16650 9518 10552 gene locus_tag LOCUS_16660 9518 10552 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896952.1 protein_id gnl|my_center|LOCUS_16660 10776 12722 gene locus_tag LOCUS_16670 10776 12722 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963745.1 protein_id gnl|my_center|LOCUS_16670 12734 14152 gene locus_tag LOCUS_16680 gene sacA 12734 14152 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886636.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence073 1407 61 gene locus_tag LOCUS_16690 gene ffh 1407 61 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362591.1 protein_id gnl|my_center|LOCUS_16690 1755 1411 gene locus_tag LOCUS_16700 1755 1411 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830102.1 protein_id gnl|my_center|LOCUS_16700 2638 1820 gene locus_tag LOCUS_16710 gene larE 2638 1820 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584116.1 protein_id gnl|my_center|LOCUS_16710 3785 2628 gene locus_tag LOCUS_16720 gene larC 3785 2628 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_16720 3922 5046 gene locus_tag LOCUS_16730 3922 5046 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_16730 6338 5127 gene locus_tag LOCUS_16740 gene ilvA 6338 5127 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_16740 7313 6369 gene locus_tag LOCUS_16750 7313 6369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16750 10883 7323 gene locus_tag LOCUS_16760 gene smc 10883 7323 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_16760 11584 10874 gene locus_tag LOCUS_16770 gene rnc 11584 10874 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_16770 11891 11661 gene locus_tag LOCUS_16780 gene acpP 11891 11661 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965054.1 protein_id gnl|my_center|LOCUS_16780 12932 11904 gene locus_tag LOCUS_16790 gene plsX 12932 11904 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_16790 13646 13065 gene locus_tag LOCUS_16800 13646 13065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 14021 13836 gene locus_tag LOCUS_16810 gene rpmF 14021 13836 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_16810 14552 14025 gene locus_tag LOCUS_16820 14552 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence074 768 3302 gene locus_tag LOCUS_16830 768 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 3972 3388 gene locus_tag LOCUS_16840 3972 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 4531 3953 gene locus_tag LOCUS_16850 4531 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 5201 4704 gene locus_tag LOCUS_16860 5201 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 5497 6804 gene locus_tag LOCUS_16870 gene thiC 5497 6804 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047970.1 protein_id gnl|my_center|LOCUS_16870 8210 6882 gene locus_tag LOCUS_16880 gene dnaB 8210 6882 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_16880 8678 8232 gene locus_tag LOCUS_16890 gene rplI 8678 8232 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_16890 10720 8675 gene locus_tag LOCUS_16900 10720 8675 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_16900 11184 10921 gene locus_tag LOCUS_16910 gene rpsR 11184 10921 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966982.1 protein_id gnl|my_center|LOCUS_16910 11600 11217 gene locus_tag LOCUS_16920 gene ssbA 11600 11217 CDS product single-stranded DNA-binding protein SsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609607.1 protein_id gnl|my_center|LOCUS_16920 12040 11753 gene locus_tag LOCUS_16930 gene rpsF 12040 11753 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_16930 12367 12179 gene locus_tag LOCUS_16940 12367 12179 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_16940 13109 12381 gene locus_tag LOCUS_16950 13109 12381 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_16950 13917 13135 gene locus_tag LOCUS_16960 gene srtB 13917 13135 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989918.1 protein_id gnl|my_center|LOCUS_16960 14336 13935 gene locus_tag LOCUS_16970 14336 13935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence075 2171 645 gene locus_tag LOCUS_16980 2171 645 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723174.1 protein_id gnl|my_center|LOCUS_16980 3891 2143 gene locus_tag LOCUS_16990 3891 2143 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731998.1 protein_id gnl|my_center|LOCUS_16990 4648 3977 gene locus_tag LOCUS_17000 4648 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 7794 4669 gene locus_tag LOCUS_17010 7794 4669 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989870.1 protein_id gnl|my_center|LOCUS_17010 8944 7904 gene locus_tag LOCUS_17020 8944 7904 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094661859.1 protein_id gnl|my_center|LOCUS_17020 10263 8971 gene locus_tag LOCUS_17030 10263 8971 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369315.1 protein_id gnl|my_center|LOCUS_17030 11768 10392 gene locus_tag LOCUS_17040 11768 10392 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_17040 13137 11830 gene locus_tag LOCUS_17050 13137 11830 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_17050 <14170 13235 gene locus_tag LOCUS_17060 <14170 13235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235901447.1:LysR family transcriptional regulator >Feature sequence076 <1 879 gene locus_tag LOCUS_17070 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791971.1:phosphoenolpyruvate carboxykinase (ATP) 2627 1227 gene locus_tag LOCUS_17080 2627 1227 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052123.1 protein_id gnl|my_center|LOCUS_17080 3440 2661 gene locus_tag LOCUS_17090 gene thiD 3440 2661 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_17090 4072 3437 gene locus_tag LOCUS_17100 4072 3437 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_17100 4719 4078 gene locus_tag LOCUS_17110 gene thiE 4719 4078 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_17110 5530 4706 gene locus_tag LOCUS_17120 gene thiM 5530 4706 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_17120 6115 5750 gene locus_tag LOCUS_17130 6115 5750 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_17130 6549 6127 gene locus_tag LOCUS_17140 6549 6127 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943273.1 protein_id gnl|my_center|LOCUS_17140 6691 7863 gene locus_tag LOCUS_17150 6691 7863 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_17150 8319 7927 gene locus_tag LOCUS_17160 8319 7927 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966724.1 protein_id gnl|my_center|LOCUS_17160 8867 8316 gene locus_tag LOCUS_17170 8867 8316 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922059.1 protein_id gnl|my_center|LOCUS_17170 9740 9030 gene locus_tag LOCUS_17180 9740 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 11179 9827 gene locus_tag LOCUS_17190 11179 9827 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110230.1 protein_id gnl|my_center|LOCUS_17190 11850 11176 gene locus_tag LOCUS_17200 11850 11176 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_17200 13120 11873 gene locus_tag LOCUS_17210 13120 11873 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948284.1 protein_id gnl|my_center|LOCUS_17210 <14027 13275 gene locus_tag LOCUS_17220 <14027 13275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860935.1:anaerobic carbon-monoxide dehydrogenase catalytic subunit >Feature sequence077 269 457 gene locus_tag LOCUS_17230 gene rpmB 269 457 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091970.1 protein_id gnl|my_center|LOCUS_17230 717 580 gene locus_tag LOCUS_17240 717 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1192 782 gene locus_tag LOCUS_17250 1192 782 CDS product spore germination protein GerW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461818.1 protein_id gnl|my_center|LOCUS_17250 2115 1213 gene locus_tag LOCUS_17260 2115 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2452 2120 gene locus_tag LOCUS_17270 2452 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 3994 2480 gene locus_tag LOCUS_17280 gene pap 3994 2480 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065389.1 protein_id gnl|my_center|LOCUS_17280 4538 4086 gene locus_tag LOCUS_17290 4538 4086 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416968.1 protein_id gnl|my_center|LOCUS_17290 6170 4680 gene locus_tag LOCUS_17300 6170 4680 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048310.1 protein_id gnl|my_center|LOCUS_17300 7482 6145 gene locus_tag LOCUS_17310 7482 6145 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963827.1 protein_id gnl|my_center|LOCUS_17310 9698 7491 gene locus_tag LOCUS_17320 9698 7491 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048131.1 protein_id gnl|my_center|LOCUS_17320 10181 9774 gene locus_tag LOCUS_17330 10181 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 11238 10249 gene locus_tag LOCUS_17340 gene ruvB 11238 10249 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_17340 11909 11298 gene locus_tag LOCUS_17350 gene ruvA 11909 11298 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_17350 12397 11906 gene locus_tag LOCUS_17360 12397 11906 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399375.1 protein_id gnl|my_center|LOCUS_17360 12778 12410 gene locus_tag LOCUS_17370 12778 12410 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416526.1 protein_id gnl|my_center|LOCUS_17370 <13793 13091 gene locus_tag LOCUS_17380 <13793 13091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869100.1:Fe-S cluster domain-containing protein >Feature sequence078 767 360 gene locus_tag LOCUS_17390 767 360 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965922.1 protein_id gnl|my_center|LOCUS_17390 1137 2942 gene locus_tag LOCUS_17400 1137 2942 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616027.1 protein_id gnl|my_center|LOCUS_17400 3200 3862 gene locus_tag LOCUS_17410 3200 3862 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964200.1 protein_id gnl|my_center|LOCUS_17410 4749 3928 gene locus_tag LOCUS_17420 4749 3928 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286852.1 protein_id gnl|my_center|LOCUS_17420 4900 5700 gene locus_tag LOCUS_17430 4900 5700 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965542.1 protein_id gnl|my_center|LOCUS_17430 5716 7899 gene locus_tag LOCUS_17440 5716 7899 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584017.1 protein_id gnl|my_center|LOCUS_17440 7903 9087 gene locus_tag LOCUS_17450 7903 9087 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860963.1 protein_id gnl|my_center|LOCUS_17450 9222 10073 gene locus_tag LOCUS_17460 9222 10073 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228638.1 protein_id gnl|my_center|LOCUS_17460 10370 10912 gene locus_tag LOCUS_17470 gene spoVT 10370 10912 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359411.1 protein_id gnl|my_center|LOCUS_17470 12617 11154 gene locus_tag LOCUS_17480 12617 11154 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_17480 13253 12705 gene locus_tag LOCUS_17490 13253 12705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 >Feature sequence079 603 79 gene locus_tag LOCUS_17500 603 79 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251052.1 protein_id gnl|my_center|LOCUS_17500 1388 816 gene locus_tag LOCUS_17510 1388 816 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948791.1 protein_id gnl|my_center|LOCUS_17510 1656 1895 gene locus_tag LOCUS_17520 1656 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 1967 2317 gene locus_tag LOCUS_17530 1967 2317 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272202.1 protein_id gnl|my_center|LOCUS_17530 2372 3214 gene locus_tag LOCUS_17540 2372 3214 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_17540 3711 3938 gene locus_tag LOCUS_17550 3711 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 4126 6492 gene locus_tag LOCUS_17560 4126 6492 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948260.1 protein_id gnl|my_center|LOCUS_17560 6601 6975 gene locus_tag LOCUS_17570 6601 6975 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385301.1 protein_id gnl|my_center|LOCUS_17570 7087 7449 gene locus_tag LOCUS_17580 7087 7449 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860652.1 protein_id gnl|my_center|LOCUS_17580 7469 7771 gene locus_tag LOCUS_17590 7469 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 9034 7859 gene locus_tag LOCUS_17600 9034 7859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 10013 9111 gene locus_tag LOCUS_17610 10013 9111 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435316.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence080 233 2107 gene locus_tag LOCUS_17620 gene nuoF 233 2107 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817338.1 protein_id gnl|my_center|LOCUS_17620 2120 3808 gene locus_tag LOCUS_17630 2120 3808 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_17630 4435 3848 gene locus_tag LOCUS_17640 4435 3848 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_17640 5094 4438 gene locus_tag LOCUS_17650 5094 4438 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_17650 6259 5192 gene locus_tag LOCUS_17660 6259 5192 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_17660 7518 6283 gene locus_tag LOCUS_17670 7518 6283 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462038.1 protein_id gnl|my_center|LOCUS_17670 8848 7679 gene locus_tag LOCUS_17680 8848 7679 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_17680 9927 8845 gene locus_tag LOCUS_17690 gene serC 9927 8845 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_17690 11767 10082 gene locus_tag LOCUS_17700 gene ilvB 11767 10082 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_17700 <13446 11788 gene locus_tag LOCUS_17710 <13446 11788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393742.1:dihydroxy-acid dehydratase >Feature sequence081 1128 16 gene locus_tag LOCUS_17720 1128 16 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_17720 1341 2333 gene locus_tag LOCUS_17730 1341 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 2898 2653 gene locus_tag LOCUS_17740 2898 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17740 3427 3137 gene locus_tag LOCUS_17750 3427 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17750 3612 3406 gene locus_tag LOCUS_17760 3612 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 5090 3759 gene locus_tag LOCUS_17770 5090 3759 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109460.1 protein_id gnl|my_center|LOCUS_17770 6736 5255 gene locus_tag LOCUS_17780 6736 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 8422 6938 gene locus_tag LOCUS_17790 8422 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 8949 8488 gene locus_tag LOCUS_17800 8949 8488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 10061 8976 gene locus_tag LOCUS_17810 10061 8976 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814186.1 protein_id gnl|my_center|LOCUS_17810 10732 10124 gene locus_tag LOCUS_17820 10732 10124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 11776 10754 gene locus_tag LOCUS_17830 11776 10754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 13157 11781 gene locus_tag LOCUS_17840 gene melB 13157 11781 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028072.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence082 <1 1146 gene locus_tag LOCUS_17850 <1 1146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948041.1:malate dehydrogenase 1777 2532 gene locus_tag LOCUS_17860 1777 2532 CDS product LamB/YcsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851457.1 protein_id gnl|my_center|LOCUS_17860 2710 4062 gene locus_tag LOCUS_17870 2710 4062 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387350.1 protein_id gnl|my_center|LOCUS_17870 4173 5354 gene locus_tag LOCUS_17880 4173 5354 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249503.1 protein_id gnl|my_center|LOCUS_17880 6349 5423 gene locus_tag LOCUS_17890 6349 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 6471 7151 gene locus_tag LOCUS_17900 6471 7151 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066872391.1 protein_id gnl|my_center|LOCUS_17900 7209 8480 gene locus_tag LOCUS_17910 gene gdhA 7209 8480 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080520.1 protein_id gnl|my_center|LOCUS_17910 8526 9251 gene locus_tag LOCUS_17920 gene pxpB 8526 9251 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494307.1 protein_id gnl|my_center|LOCUS_17920 9266 10210 gene locus_tag LOCUS_17930 9266 10210 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896290.1 protein_id gnl|my_center|LOCUS_17930 10249 11214 gene locus_tag LOCUS_17940 10249 11214 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271954.1 protein_id gnl|my_center|LOCUS_17940 11368 11544 gene locus_tag LOCUS_17950 11368 11544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 11510 13186 gene locus_tag LOCUS_17960 11510 13186 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_17960 13228 13362 gene locus_tag LOCUS_17970 13228 13362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence083 895 449 gene locus_tag LOCUS_17980 895 449 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_17980 1696 1058 gene locus_tag LOCUS_17990 1696 1058 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254956.1 protein_id gnl|my_center|LOCUS_17990 1790 1966 gene locus_tag LOCUS_18000 1790 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 2812 1994 gene locus_tag LOCUS_18010 2812 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 3175 4644 gene locus_tag LOCUS_18020 3175 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 4921 4721 gene locus_tag LOCUS_18030 4921 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 4993 5481 gene locus_tag LOCUS_18040 gene ybaK 4993 5481 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437064.1 protein_id gnl|my_center|LOCUS_18040 6091 5471 gene locus_tag LOCUS_18050 6091 5471 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721280.1 protein_id gnl|my_center|LOCUS_18050 7517 6180 gene locus_tag LOCUS_18060 7517 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 7961 7536 gene locus_tag LOCUS_18070 7961 7536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 9242 8412 gene locus_tag LOCUS_18080 9242 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 10626 9256 gene locus_tag LOCUS_18090 10626 9256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 10820 10653 gene locus_tag LOCUS_18100 10820 10653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 11985 10849 gene locus_tag LOCUS_18110 11985 10849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 12835 12062 gene locus_tag LOCUS_18120 12835 12062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence084 1408 539 gene locus_tag LOCUS_18130 gene rapZ 1408 539 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_18130 2331 1417 gene locus_tag LOCUS_18140 gene murB 2331 1417 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_18140 3106 2339 gene locus_tag LOCUS_18150 3106 2339 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_18150 3616 3260 gene locus_tag LOCUS_18160 gene spoVAE 3616 3260 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811048.1 protein_id gnl|my_center|LOCUS_18160 4641 3628 gene locus_tag LOCUS_18170 gene spoVAD 4641 3628 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403641.1 protein_id gnl|my_center|LOCUS_18170 5120 4641 gene locus_tag LOCUS_18180 gene spoVAC 5120 4641 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944604.1 protein_id gnl|my_center|LOCUS_18180 5583 5173 gene locus_tag LOCUS_18190 5583 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 6197 5580 gene locus_tag LOCUS_18200 6197 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 7016 6303 gene locus_tag LOCUS_18210 gene sigF 7016 6303 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860953.1 protein_id gnl|my_center|LOCUS_18210 7468 7025 gene locus_tag LOCUS_18220 gene spoIIAB 7468 7025 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_18220 7816 7481 gene locus_tag LOCUS_18230 gene spoIIAA 7816 7481 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_18230 9415 7925 gene locus_tag LOCUS_18240 9415 7925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 9576 9427 gene locus_tag LOCUS_18250 9576 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 10870 9569 gene locus_tag LOCUS_18260 10870 9569 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_18260 12934 11057 gene locus_tag LOCUS_18270 12934 11057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence085 328 26 gene locus_tag LOCUS_18280 328 26 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016687.1 protein_id gnl|my_center|LOCUS_18280 1537 518 gene locus_tag LOCUS_18290 1537 518 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567947.1 protein_id gnl|my_center|LOCUS_18290 5921 1539 gene locus_tag LOCUS_18300 5921 1539 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382252.1 protein_id gnl|my_center|LOCUS_18300 7031 6084 gene locus_tag LOCUS_18310 7031 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 7198 7028 gene locus_tag LOCUS_18320 7198 7028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 8205 7333 gene locus_tag LOCUS_18330 8205 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 8368 9624 gene locus_tag LOCUS_18340 8368 9624 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788846.1 protein_id gnl|my_center|LOCUS_18340 10060 9704 gene locus_tag LOCUS_18350 10060 9704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018213024.1 protein_id gnl|my_center|LOCUS_18350 10982 10128 gene locus_tag LOCUS_18360 10982 10128 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_18360 11449 10997 gene locus_tag LOCUS_18370 gene bcp 11449 10997 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_18370 12076 11519 gene locus_tag LOCUS_18380 12076 11519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 <13145 12092 gene locus_tag LOCUS_18390 <13145 12092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017864221.1:citrate/2-methylcitrate synthase >Feature sequence086 75 3 gene locus_tag LOCUS_t00090 75 3 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1599 241 gene locus_tag LOCUS_18400 1599 241 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861576.1 protein_id gnl|my_center|LOCUS_18400 3213 1627 gene locus_tag LOCUS_18410 3213 1627 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890719.1 protein_id gnl|my_center|LOCUS_18410 3753 3271 gene locus_tag LOCUS_18420 3753 3271 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897702.1 protein_id gnl|my_center|LOCUS_18420 4732 3962 gene locus_tag LOCUS_18430 4732 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 5236 4793 gene locus_tag LOCUS_18440 5236 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 6327 5380 gene locus_tag LOCUS_18450 6327 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 7056 8111 gene locus_tag LOCUS_18460 7056 8111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 8593 8177 gene locus_tag LOCUS_18470 8593 8177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322028.1 protein_id gnl|my_center|LOCUS_18470 9119 8586 gene locus_tag LOCUS_18480 9119 8586 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436147.1 protein_id gnl|my_center|LOCUS_18480 10134 9250 gene locus_tag LOCUS_18490 10134 9250 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_18490 12856 10244 gene locus_tag LOCUS_18500 gene glgB 12856 10244 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence087 1483 596 gene locus_tag LOCUS_18510 1483 596 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 protein_id gnl|my_center|LOCUS_18510 4303 1775 gene locus_tag LOCUS_18520 4303 1775 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438328.1 protein_id gnl|my_center|LOCUS_18520 5215 4337 gene locus_tag LOCUS_18530 5215 4337 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657697.1 protein_id gnl|my_center|LOCUS_18530 6009 5311 gene locus_tag LOCUS_18540 6009 5311 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388341.1 protein_id gnl|my_center|LOCUS_18540 6794 6063 gene locus_tag LOCUS_18550 6794 6063 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_18550 8113 6764 gene locus_tag LOCUS_18560 8113 6764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 8698 8351 gene locus_tag LOCUS_18570 gene ndoA 8698 8351 CDS product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156187.1 protein_id gnl|my_center|LOCUS_18570 9972 8824 gene locus_tag LOCUS_18580 gene alr 9972 8824 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963814.1 protein_id gnl|my_center|LOCUS_18580 11474 9969 gene locus_tag LOCUS_18590 11474 9969 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_18590 12211 11561 gene locus_tag LOCUS_18600 12211 11561 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_18600 >Feature sequence088 715 92 gene locus_tag LOCUS_18610 715 92 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812798.1 protein_id gnl|my_center|LOCUS_18610 1779 727 gene locus_tag LOCUS_18620 1779 727 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052107.1 protein_id gnl|my_center|LOCUS_18620 2516 2088 gene locus_tag LOCUS_18630 2516 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 3405 2566 gene locus_tag LOCUS_18640 3405 2566 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890830.1 protein_id gnl|my_center|LOCUS_18640 3554 4099 gene locus_tag LOCUS_18650 3554 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 4124 4978 gene locus_tag LOCUS_18660 gene nudC 4124 4978 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102051.1 protein_id gnl|my_center|LOCUS_18660 5397 5071 gene locus_tag LOCUS_18670 5397 5071 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943036.1 protein_id gnl|my_center|LOCUS_18670 5635 7005 gene locus_tag LOCUS_18680 5635 7005 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966858.1 protein_id gnl|my_center|LOCUS_18680 9219 7132 gene locus_tag LOCUS_18690 gene htpG 9219 7132 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_18690 10009 9362 gene locus_tag LOCUS_18700 10009 9362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 10355 10092 gene locus_tag LOCUS_18710 10355 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 11093 10416 gene locus_tag LOCUS_18720 11093 10416 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680765.1 protein_id gnl|my_center|LOCUS_18720 11684 11100 gene locus_tag LOCUS_18730 11684 11100 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_18730 12270 11848 gene locus_tag LOCUS_18740 12270 11848 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_18740 12857 12306 gene locus_tag LOCUS_18750 12857 12306 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence089 1320 88 gene locus_tag LOCUS_18760 1320 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 1657 1307 gene locus_tag LOCUS_18770 1657 1307 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461784.1 protein_id gnl|my_center|LOCUS_18770 2006 3364 gene locus_tag LOCUS_18780 gene trkA 2006 3364 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_18780 3379 4821 gene locus_tag LOCUS_18790 3379 4821 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_18790 5594 4932 gene locus_tag LOCUS_18800 5594 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 8408 5709 gene locus_tag LOCUS_18810 8408 5709 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_18810 10029 8500 gene locus_tag LOCUS_18820 10029 8500 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861147.1 protein_id gnl|my_center|LOCUS_18820 10311 10138 gene locus_tag LOCUS_18830 10311 10138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 11290 10820 gene locus_tag LOCUS_18840 11290 10820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 11773 12129 gene locus_tag LOCUS_18850 11773 12129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 12735 12301 gene locus_tag LOCUS_18860 12735 12301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 >Feature sequence090 1163 135 gene locus_tag LOCUS_18870 1163 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 1638 1141 gene locus_tag LOCUS_18880 1638 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 2849 1635 gene locus_tag LOCUS_18890 2849 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 3540 2833 gene locus_tag LOCUS_18900 3540 2833 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964567.1 protein_id gnl|my_center|LOCUS_18900 5389 3524 gene locus_tag LOCUS_18910 5389 3524 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099491.1 protein_id gnl|my_center|LOCUS_18910 7009 5516 gene locus_tag LOCUS_18920 7009 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 9214 7196 gene locus_tag LOCUS_18930 9214 7196 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814523.1 protein_id gnl|my_center|LOCUS_18930 9929 9234 gene locus_tag LOCUS_18940 9929 9234 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_18940 10644 9922 gene locus_tag LOCUS_18950 10644 9922 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_18950 11987 10728 gene locus_tag LOCUS_18960 11987 10728 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814514.1 protein_id gnl|my_center|LOCUS_18960 12657 11980 gene locus_tag LOCUS_18970 12657 11980 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238594.1 protein_id gnl|my_center|LOCUS_18970 >Feature sequence091 32 1099 gene locus_tag LOCUS_18980 32 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 1222 1647 gene locus_tag LOCUS_18990 1222 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 1969 1754 gene locus_tag LOCUS_19000 1969 1754 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948188.1 protein_id gnl|my_center|LOCUS_19000 2110 3630 gene locus_tag LOCUS_19010 2110 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 3658 4353 gene locus_tag LOCUS_19020 3658 4353 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893687.1 protein_id gnl|my_center|LOCUS_19020 4377 5000 gene locus_tag LOCUS_19030 4377 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 5001 5762 gene locus_tag LOCUS_19040 5001 5762 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286624.1 protein_id gnl|my_center|LOCUS_19040 5778 6887 gene locus_tag LOCUS_19050 gene aroB 5778 6887 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207828.1 protein_id gnl|my_center|LOCUS_19050 6892 7410 gene locus_tag LOCUS_19060 gene lspA 6892 7410 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364048.1 protein_id gnl|my_center|LOCUS_19060 7407 8330 gene locus_tag LOCUS_19070 7407 8330 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_19070 8442 9083 gene locus_tag LOCUS_19080 8442 9083 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_19080 9871 9143 gene locus_tag LOCUS_19090 9871 9143 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_19090 10065 10532 gene locus_tag LOCUS_19100 gene dtd 10065 10532 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691419.1 protein_id gnl|my_center|LOCUS_19100 10700 11764 gene locus_tag LOCUS_19110 10700 11764 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_19110 <12867 11841 gene locus_tag LOCUS_19120 <12867 11841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011817010.1:glycoside hydrolase family 31 protein >Feature sequence092 94 399 gene locus_tag LOCUS_19130 94 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 577 984 gene locus_tag LOCUS_19140 577 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 1145 1522 gene locus_tag LOCUS_19150 1145 1522 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_19150 1524 2390 gene locus_tag LOCUS_19160 1524 2390 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_19160 2387 3046 gene locus_tag LOCUS_19170 2387 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 3164 4675 gene locus_tag LOCUS_19180 3164 4675 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904147.1 protein_id gnl|my_center|LOCUS_19180 4830 6791 gene locus_tag LOCUS_19190 4830 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 6793 7416 gene locus_tag LOCUS_19200 6793 7416 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436912.1 protein_id gnl|my_center|LOCUS_19200 7456 8334 gene locus_tag LOCUS_19210 7456 8334 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436920.1 protein_id gnl|my_center|LOCUS_19210 8543 9421 gene locus_tag LOCUS_19220 8543 9421 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811658.1 protein_id gnl|my_center|LOCUS_19220 9411 10307 gene locus_tag LOCUS_19230 9411 10307 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_19230 10319 10861 gene locus_tag LOCUS_19240 10319 10861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 11008 11697 gene locus_tag LOCUS_19250 11008 11697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 11700 12140 gene locus_tag LOCUS_19260 11700 12140 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972158.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence093 3414 1549 gene locus_tag LOCUS_19270 3414 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 3749 3411 gene locus_tag LOCUS_19280 3749 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 4459 4208 gene locus_tag LOCUS_19290 4459 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 4908 4567 gene locus_tag LOCUS_19300 4908 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 5233 5075 gene locus_tag LOCUS_19310 5233 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 5625 5212 gene locus_tag LOCUS_19320 5625 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19320 5860 5675 gene locus_tag LOCUS_19330 5860 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 6162 5845 gene locus_tag LOCUS_19340 6162 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 7831 6305 gene locus_tag LOCUS_19350 7831 6305 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002035938.1 protein_id gnl|my_center|LOCUS_19350 9529 7862 gene locus_tag LOCUS_19360 9529 7862 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_19360 10338 9556 gene locus_tag LOCUS_19370 10338 9556 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_19370 10996 10328 gene locus_tag LOCUS_19380 10996 10328 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889262.1 protein_id gnl|my_center|LOCUS_19380 12166 11042 gene locus_tag LOCUS_19390 gene rpoD 12166 11042 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence094 165 25 gene locus_tag LOCUS_19400 165 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 2448 325 gene locus_tag LOCUS_19410 2448 325 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_19410 4282 2675 gene locus_tag LOCUS_19420 4282 2675 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_19420 5026 4505 gene locus_tag LOCUS_19430 5026 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 5960 5004 gene locus_tag LOCUS_19440 5960 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 6044 7108 gene locus_tag LOCUS_19450 6044 7108 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_19450 7660 7109 gene locus_tag LOCUS_19460 7660 7109 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195473.1 protein_id gnl|my_center|LOCUS_19460 8086 7679 gene locus_tag LOCUS_19470 8086 7679 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723834.1 protein_id gnl|my_center|LOCUS_19470 8242 8970 gene locus_tag LOCUS_19480 8242 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 9585 8911 gene locus_tag LOCUS_19490 9585 8911 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475813.1 protein_id gnl|my_center|LOCUS_19490 10142 10420 gene locus_tag LOCUS_19500 10142 10420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 10417 11427 gene locus_tag LOCUS_19510 10417 11427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence095 491 2344 gene locus_tag LOCUS_19520 gene asnB 491 2344 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333979.1 protein_id gnl|my_center|LOCUS_19520 2443 2715 gene locus_tag LOCUS_19530 2443 2715 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356545.1 protein_id gnl|my_center|LOCUS_19530 2736 3362 gene locus_tag LOCUS_19540 2736 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 3918 3313 gene locus_tag LOCUS_19550 3918 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 4306 4064 gene locus_tag LOCUS_19560 4306 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 6465 4384 gene locus_tag LOCUS_19570 gene pflB 6465 4384 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195472.1 protein_id gnl|my_center|LOCUS_19570 7446 6745 gene locus_tag LOCUS_19580 7446 6745 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994403.1 protein_id gnl|my_center|LOCUS_19580 8758 7463 gene locus_tag LOCUS_19590 8758 7463 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_19590 8982 11219 gene locus_tag LOCUS_19600 8982 11219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 11276 11650 gene locus_tag LOCUS_19610 11276 11650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 11766 11906 gene locus_tag LOCUS_19620 gene scfA 11766 11906 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence096 70 324 gene locus_tag LOCUS_19630 70 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 338 1147 gene locus_tag LOCUS_19640 338 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 1164 1373 gene locus_tag LOCUS_19650 1164 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 1276 1815 gene locus_tag LOCUS_19660 1276 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 1982 3844 gene locus_tag LOCUS_19670 1982 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 4236 5492 gene locus_tag LOCUS_19680 4236 5492 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_19680 5496 6182 gene locus_tag LOCUS_19690 5496 6182 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016982.1 protein_id gnl|my_center|LOCUS_19690 6773 6309 gene locus_tag LOCUS_19700 6773 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 7071 6781 gene locus_tag LOCUS_19710 7071 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 7533 7174 gene locus_tag LOCUS_19720 7533 7174 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356630.1 protein_id gnl|my_center|LOCUS_19720 7961 7614 gene locus_tag LOCUS_19730 7961 7614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 8217 7948 gene locus_tag LOCUS_19740 8217 7948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 9197 9466 gene locus_tag LOCUS_19750 9197 9466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 9472 10587 gene locus_tag LOCUS_19760 9472 10587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 10574 10984 gene locus_tag LOCUS_19770 10574 10984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 10985 11863 gene locus_tag LOCUS_19780 10985 11863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 >Feature sequence097 <1 589 gene locus_tag LOCUS_19790 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705392.1:aldo/keto reductase 617 1315 gene locus_tag LOCUS_19800 617 1315 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254163.1 protein_id gnl|my_center|LOCUS_19800 1540 1872 gene locus_tag LOCUS_19810 1540 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 1958 2293 gene locus_tag LOCUS_19820 1958 2293 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461299.1 protein_id gnl|my_center|LOCUS_19820 2274 3623 gene locus_tag LOCUS_19830 2274 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 3774 5114 gene locus_tag LOCUS_19840 gene brnQ 3774 5114 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048240.1 protein_id gnl|my_center|LOCUS_19840 5141 6748 gene locus_tag LOCUS_19850 5141 6748 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016558.1 protein_id gnl|my_center|LOCUS_19850 6769 7863 gene locus_tag LOCUS_19860 6769 7863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462288.1 protein_id gnl|my_center|LOCUS_19860 8070 8567 gene locus_tag LOCUS_19870 8070 8567 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_19870 9216 8587 gene locus_tag LOCUS_19880 9216 8587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 9395 10165 gene locus_tag LOCUS_19890 9395 10165 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_19890 10350 10781 gene locus_tag LOCUS_19900 10350 10781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 10841 11170 gene locus_tag LOCUS_19910 10841 11170 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461299.1 protein_id gnl|my_center|LOCUS_19910 11242 11781 gene locus_tag LOCUS_19920 11242 11781 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634004.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence098 3004 1286 gene locus_tag LOCUS_19930 3004 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 4091 3660 gene locus_tag LOCUS_19940 4091 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 4756 4313 gene locus_tag LOCUS_19950 4756 4313 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_19950 6032 5556 gene locus_tag LOCUS_19960 6032 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 7461 6130 gene locus_tag LOCUS_19970 7461 6130 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966626.1 protein_id gnl|my_center|LOCUS_19970 8626 7718 gene locus_tag LOCUS_19980 8626 7718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 9008 8859 gene locus_tag LOCUS_19990 9008 8859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 11570 9090 gene locus_tag LOCUS_20000 11570 9090 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814229.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence099 2686 848 gene locus_tag LOCUS_20010 2686 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 3078 2716 gene locus_tag LOCUS_20020 3078 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 5732 3099 gene locus_tag LOCUS_20030 5732 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 7009 5741 gene locus_tag LOCUS_20040 7009 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 8336 7080 gene locus_tag LOCUS_20050 8336 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 8692 9630 gene locus_tag LOCUS_20060 8692 9630 CDS product IS982 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179067.1 protein_id gnl|my_center|LOCUS_20060 9561 9767 gene locus_tag LOCUS_20070 9561 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 11416 9764 gene locus_tag LOCUS_20080 11416 9764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807777.1 protein_id gnl|my_center|LOCUS_20080 >Feature sequence100 15 2348 gene locus_tag LOCUS_20090 15 2348 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861604.1 protein_id gnl|my_center|LOCUS_20090 2927 2409 gene locus_tag LOCUS_20100 2927 2409 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814019.1 protein_id gnl|my_center|LOCUS_20100 4341 2992 gene locus_tag LOCUS_20110 4341 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 6151 4505 gene locus_tag LOCUS_20120 6151 4505 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_20120 8006 6357 gene locus_tag LOCUS_20130 gene treC 8006 6357 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986524.1 protein_id gnl|my_center|LOCUS_20130 9983 8019 gene locus_tag LOCUS_20140 gene treP 9983 8019 CDS product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262352.1 protein_id gnl|my_center|LOCUS_20140 10135 10869 gene locus_tag LOCUS_20150 10135 10869 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861813.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence101 16 729 gene locus_tag LOCUS_20160 16 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 797 1981 gene locus_tag LOCUS_20170 797 1981 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_20170 2186 3172 gene locus_tag LOCUS_20180 2186 3172 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_20180 3182 4060 gene locus_tag LOCUS_20190 3182 4060 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364453.1 protein_id gnl|my_center|LOCUS_20190 4380 5342 gene locus_tag LOCUS_20200 4380 5342 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361636.1 protein_id gnl|my_center|LOCUS_20200 6860 5445 gene locus_tag LOCUS_20210 6860 5445 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_20210 7101 7865 gene locus_tag LOCUS_20220 7101 7865 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_20220 7870 8919 gene locus_tag LOCUS_20230 gene selD 7870 8919 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012159590.1 protein_id gnl|my_center|LOCUS_20230 8951 10093 gene locus_tag LOCUS_20240 8951 10093 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811901.1 protein_id gnl|my_center|LOCUS_20240 10107 11372 gene locus_tag LOCUS_20250 10107 11372 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461660.1 protein_id gnl|my_center|LOCUS_20250 >Feature sequence102 2539 821 gene locus_tag LOCUS_20260 2539 821 CDS product DUF262 and DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094324403.1 protein_id gnl|my_center|LOCUS_20260 4199 2562 gene locus_tag LOCUS_20270 gene rlmD 4199 2562 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 protein_id gnl|my_center|LOCUS_20270 5258 4314 gene locus_tag LOCUS_20280 5258 4314 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_20280 6635 5274 gene locus_tag LOCUS_20290 6635 5274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 6852 9230 gene locus_tag LOCUS_20300 6852 9230 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048130.1 protein_id gnl|my_center|LOCUS_20300 9242 9946 gene locus_tag LOCUS_20310 9242 9946 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_20310 9943 11364 gene locus_tag LOCUS_20320 9943 11364 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_20320 >Feature sequence103 32 607 gene locus_tag LOCUS_20330 32 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 608 1297 gene locus_tag LOCUS_20340 608 1297 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837546.1 protein_id gnl|my_center|LOCUS_20340 1945 1430 gene locus_tag LOCUS_20350 1945 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2182 2961 gene locus_tag LOCUS_20360 2182 2961 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_20360 2971 3135 gene locus_tag LOCUS_20370 2971 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 3303 3425 gene locus_tag LOCUS_20380 3303 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 3436 3990 gene locus_tag LOCUS_20390 gene ispF 3436 3990 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947931.1 protein_id gnl|my_center|LOCUS_20390 4356 5690 gene locus_tag LOCUS_20400 gene gdhA 4356 5690 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_20400 5814 5972 gene locus_tag LOCUS_20410 5814 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 6120 6881 gene locus_tag LOCUS_20420 gene cysE 6120 6881 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_20420 6868 8274 gene locus_tag LOCUS_20430 gene cysS 6868 8274 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_20430 8259 8708 gene locus_tag LOCUS_20440 8259 8708 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293091.1 protein_id gnl|my_center|LOCUS_20440 8683 9432 gene locus_tag LOCUS_20450 gene rlmB 8683 9432 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_20450 9447 10040 gene locus_tag LOCUS_20460 gene sigH 9447 10040 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942746.1 protein_id gnl|my_center|LOCUS_20460 10076 11020 gene locus_tag LOCUS_20470 10076 11020 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906252.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence104 1905 1303 gene locus_tag LOCUS_20480 1905 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 2990 1920 gene locus_tag LOCUS_20490 gene recA 2990 1920 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428218.1 protein_id gnl|my_center|LOCUS_20490 3630 3373 gene locus_tag LOCUS_20500 3630 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 3828 3643 gene locus_tag LOCUS_20510 3828 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815107.1 protein_id gnl|my_center|LOCUS_20510 5893 3896 gene locus_tag LOCUS_20520 5893 3896 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986650.1 protein_id gnl|my_center|LOCUS_20520 6650 5883 gene locus_tag LOCUS_20530 6650 5883 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_20530 7768 6719 gene locus_tag LOCUS_20540 7768 6719 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_20540 8433 7765 gene locus_tag LOCUS_20550 8433 7765 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_20550 9940 8495 gene locus_tag LOCUS_20560 gene glgA 9940 8495 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_20560 10859 10065 gene locus_tag LOCUS_20570 gene spo0A 10859 10065 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226427.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence105 427 687 gene locus_tag LOCUS_20580 427 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 859 710 gene locus_tag LOCUS_20590 859 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 1136 849 gene locus_tag LOCUS_20600 1136 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 3053 1140 gene locus_tag LOCUS_20610 3053 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 5101 3053 gene locus_tag LOCUS_20620 5101 3053 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869119.1 protein_id gnl|my_center|LOCUS_20620 5439 6138 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgtgtcaacgccctaaacgggctttcttcatttctac 7889 6540 gene locus_tag LOCUS_20630 7889 6540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 9060 8731 gene locus_tag LOCUS_20640 9060 8731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 9942 9223 gene locus_tag LOCUS_20650 9942 9223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 10165 9986 gene locus_tag LOCUS_20660 10165 9986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 10342 10172 gene locus_tag LOCUS_20670 10342 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 10583 10269 gene locus_tag LOCUS_20680 10583 10269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 >Feature sequence106 1653 235 gene locus_tag LOCUS_20690 1653 235 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433878.1 protein_id gnl|my_center|LOCUS_20690 1914 3179 gene locus_tag LOCUS_20700 1914 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 3311 5269 gene locus_tag LOCUS_20710 3311 5269 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966678.1 protein_id gnl|my_center|LOCUS_20710 5925 5359 gene locus_tag LOCUS_20720 5925 5359 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581032.1 protein_id gnl|my_center|LOCUS_20720 6080 7156 gene locus_tag LOCUS_20730 6080 7156 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438474.1 protein_id gnl|my_center|LOCUS_20730 7175 8338 gene locus_tag LOCUS_20740 7175 8338 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861193.1 protein_id gnl|my_center|LOCUS_20740 8342 10474 gene locus_tag LOCUS_20750 8342 10474 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373408.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence107 51 2726 gene locus_tag LOCUS_20760 gene mutS 51 2726 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047675.1 protein_id gnl|my_center|LOCUS_20760 2733 4769 gene locus_tag LOCUS_20770 gene mutL 2733 4769 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020571.1 protein_id gnl|my_center|LOCUS_20770 4779 5723 gene locus_tag LOCUS_20780 gene miaA 4779 5723 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_20780 5724 7016 gene locus_tag LOCUS_20790 5724 7016 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_20790 7025 8245 gene locus_tag LOCUS_20800 7025 8245 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_20800 8239 9846 gene locus_tag LOCUS_20810 8239 9846 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966358.1 protein_id gnl|my_center|LOCUS_20810 9925 10611 gene locus_tag LOCUS_20820 gene radC 9925 10611 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013377.1 protein_id gnl|my_center|LOCUS_20820 >Feature sequence108 <1 508 gene locus_tag LOCUS_20830 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392083.1:chaperonin GroEL 672 1175 gene locus_tag LOCUS_20840 672 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 1235 2689 gene locus_tag LOCUS_20850 gene guaB 1235 2689 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264088.1 protein_id gnl|my_center|LOCUS_20850 2800 3510 gene locus_tag LOCUS_20860 2800 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 3507 5759 gene locus_tag LOCUS_20870 gene yicI 3507 5759 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582725.1 protein_id gnl|my_center|LOCUS_20870 7033 6167 gene locus_tag LOCUS_20880 7033 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922087.1 protein_id gnl|my_center|LOCUS_20880 7725 7027 gene locus_tag LOCUS_20890 7725 7027 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_20890 8093 7722 gene locus_tag LOCUS_20900 8093 7722 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816592.1 protein_id gnl|my_center|LOCUS_20900 8351 9064 gene locus_tag LOCUS_20910 8351 9064 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091542811.1 protein_id gnl|my_center|LOCUS_20910 10430 9120 gene locus_tag LOCUS_20920 gene abgB 10430 9120 CDS product p-aminobenzoyl-glutamate hydrolase subunit AbgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156420.1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence109 106 1872 gene locus_tag LOCUS_20930 106 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860733.1 protein_id gnl|my_center|LOCUS_20930 1885 2574 gene locus_tag LOCUS_20940 1885 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 2720 3808 gene locus_tag LOCUS_20950 2720 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 3847 4533 gene locus_tag LOCUS_20960 gene ftsE 3847 4533 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_20960 4523 5434 gene locus_tag LOCUS_20970 gene ftsX 4523 5434 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963820.1 protein_id gnl|my_center|LOCUS_20970 5546 6739 gene locus_tag LOCUS_20980 5546 6739 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357628.1 protein_id gnl|my_center|LOCUS_20980 6761 7345 gene locus_tag LOCUS_20990 6761 7345 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294657.1 protein_id gnl|my_center|LOCUS_20990 7342 7959 gene locus_tag LOCUS_21000 gene plsY 7342 7959 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880403.1 protein_id gnl|my_center|LOCUS_21000 7962 9077 gene locus_tag LOCUS_21010 7962 9077 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_21010 9159 10352 gene locus_tag LOCUS_21020 9159 10352 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459580.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence110 849 418 gene locus_tag LOCUS_21030 849 418 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775319.1 protein_id gnl|my_center|LOCUS_21030 1083 931 gene locus_tag LOCUS_21040 1083 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2011 1145 gene locus_tag LOCUS_21050 2011 1145 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787284.1 protein_id gnl|my_center|LOCUS_21050 2590 2195 gene locus_tag LOCUS_21060 2590 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 3103 2696 gene locus_tag LOCUS_21070 3103 2696 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436247.1 protein_id gnl|my_center|LOCUS_21070 3476 3087 gene locus_tag LOCUS_21080 3476 3087 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436247.1 protein_id gnl|my_center|LOCUS_21080 4930 4052 gene locus_tag LOCUS_21090 4930 4052 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433732.1 protein_id gnl|my_center|LOCUS_21090 5606 4935 gene locus_tag LOCUS_21100 5606 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 6670 5603 gene locus_tag LOCUS_21110 6670 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 7969 6791 gene locus_tag LOCUS_21120 7969 6791 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021366129.1 protein_id gnl|my_center|LOCUS_21120 8643 7957 gene locus_tag LOCUS_21130 8643 7957 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860834.1 protein_id gnl|my_center|LOCUS_21130 <10481 8723 gene locus_tag LOCUS_21140 <10481 8723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459544.1:ABC transporter ATP-binding protein >Feature sequence111 911 69 gene locus_tag LOCUS_21150 gene dapF 911 69 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_21150 1113 2153 gene locus_tag LOCUS_21160 1113 2153 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461701.1 protein_id gnl|my_center|LOCUS_21160 3211 2219 gene locus_tag LOCUS_21170 3211 2219 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_21170 7413 3208 gene locus_tag LOCUS_21180 7413 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 9118 7394 gene locus_tag LOCUS_21190 9118 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 10276 9359 gene locus_tag LOCUS_21200 10276 9359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence112 1688 300 gene locus_tag LOCUS_21210 1688 300 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_21210 1994 1782 gene locus_tag LOCUS_21220 1994 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 3019 2117 gene locus_tag LOCUS_21230 3019 2117 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296994.1 protein_id gnl|my_center|LOCUS_21230 4362 3034 gene locus_tag LOCUS_21240 4362 3034 CDS product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082995.1 protein_id gnl|my_center|LOCUS_21240 4790 5449 gene locus_tag LOCUS_21250 4790 5449 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_21250 5851 5534 gene locus_tag LOCUS_21260 5851 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 6028 6654 gene locus_tag LOCUS_21270 gene lexA 6028 6654 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 protein_id gnl|my_center|LOCUS_21270 7070 6714 gene locus_tag LOCUS_21280 gene rsfS 7070 6714 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416416.1 protein_id gnl|my_center|LOCUS_21280 7668 7060 gene locus_tag LOCUS_21290 gene yqeK 7668 7060 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_21290 8296 7658 gene locus_tag LOCUS_21300 gene nadD 8296 7658 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360011.1 protein_id gnl|my_center|LOCUS_21300 8653 8363 gene locus_tag LOCUS_21310 gene yhbY 8653 8363 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226133.1 protein_id gnl|my_center|LOCUS_21310 9955 8663 gene locus_tag LOCUS_21320 gene obgE 9955 8663 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence113 341 1273 gene locus_tag LOCUS_21330 gene metA 341 1273 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764097.1 protein_id gnl|my_center|LOCUS_21330 1456 3567 gene locus_tag LOCUS_21340 1456 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 3698 4063 gene locus_tag LOCUS_21350 gene crcB 3698 4063 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927153.1 protein_id gnl|my_center|LOCUS_21350 4223 4753 gene locus_tag LOCUS_21360 4223 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 5055 5582 gene locus_tag LOCUS_21370 5055 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 5654 6151 gene locus_tag LOCUS_21380 gene queF 5654 6151 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218613.1 protein_id gnl|my_center|LOCUS_21380 6163 6852 gene locus_tag LOCUS_21390 gene queC 6163 6852 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_21390 6997 7395 gene locus_tag LOCUS_21400 6997 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 9082 7472 gene locus_tag LOCUS_21410 9082 7472 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_21410 <10197 9106 gene locus_tag LOCUS_21420 <10197 9106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082566.1:mannonate dehydratase >Feature sequence114 2133 739 gene locus_tag LOCUS_21430 2133 739 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_21430 2982 2239 gene locus_tag LOCUS_21440 gene recO 2982 2239 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775744.1 protein_id gnl|my_center|LOCUS_21440 3887 2982 gene locus_tag LOCUS_21450 gene era 3887 2982 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080241.1 protein_id gnl|my_center|LOCUS_21450 6819 3901 gene locus_tag LOCUS_21460 6819 3901 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_21460 7605 6958 gene locus_tag LOCUS_21470 7605 6958 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259756.1 protein_id gnl|my_center|LOCUS_21470 7957 9279 gene locus_tag LOCUS_21480 7957 9279 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809868.1 protein_id gnl|my_center|LOCUS_21480 9794 9567 gene locus_tag LOCUS_21490 9794 9567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 >Feature sequence115 2244 1660 gene locus_tag LOCUS_21500 2244 1660 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429956.1 protein_id gnl|my_center|LOCUS_21500 3131 2235 gene locus_tag LOCUS_21510 gene dpsA 3131 2235 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439770.1 protein_id gnl|my_center|LOCUS_21510 4198 3128 gene locus_tag LOCUS_21520 4198 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 5826 4195 gene locus_tag LOCUS_21530 5826 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 6678 5833 gene locus_tag LOCUS_21540 6678 5833 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814246.1 protein_id gnl|my_center|LOCUS_21540 7636 6680 gene locus_tag LOCUS_21550 7636 6680 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814244.1 protein_id gnl|my_center|LOCUS_21550 9875 7578 gene locus_tag LOCUS_21560 9875 7578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 >Feature sequence116 239 2068 gene locus_tag LOCUS_21570 gene typA 239 2068 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_21570 2490 5108 gene locus_tag LOCUS_21580 gene adhE 2490 5108 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861762.1 protein_id gnl|my_center|LOCUS_21580 5384 6547 gene locus_tag LOCUS_21590 5384 6547 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940860.1 protein_id gnl|my_center|LOCUS_21590 7794 6625 gene locus_tag LOCUS_21600 7794 6625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 8452 7892 gene locus_tag LOCUS_21610 8452 7892 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_21610 8834 8634 gene locus_tag LOCUS_21620 8834 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 8992 8822 gene locus_tag LOCUS_21630 8992 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 9372 8968 gene locus_tag LOCUS_21640 9372 8968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 9971 9714 gene locus_tag LOCUS_21650 9971 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 >Feature sequence117 140 529 gene locus_tag LOCUS_21660 140 529 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723189.1 protein_id gnl|my_center|LOCUS_21660 532 1134 gene locus_tag LOCUS_21670 532 1134 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291702.1 protein_id gnl|my_center|LOCUS_21670 1226 2155 gene locus_tag LOCUS_21680 1226 2155 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_21680 2229 3575 gene locus_tag LOCUS_21690 gene glmM 2229 3575 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521474.1 protein_id gnl|my_center|LOCUS_21690 3595 4626 gene locus_tag LOCUS_21700 3595 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 4701 5960 gene locus_tag LOCUS_21710 4701 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 7271 6045 gene locus_tag LOCUS_21720 7271 6045 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_21720 7650 8690 gene locus_tag LOCUS_21730 gene argC 7650 8690 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851634.1 protein_id gnl|my_center|LOCUS_21730 8719 9954 gene locus_tag LOCUS_21740 gene argJ 8719 9954 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965687.1 protein_id gnl|my_center|LOCUS_21740 >Feature sequence118 476 2059 gene locus_tag LOCUS_21750 476 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2092 2631 gene locus_tag LOCUS_21760 2092 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 2674 3315 gene locus_tag LOCUS_21770 2674 3315 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462097.1 protein_id gnl|my_center|LOCUS_21770 3334 4875 gene locus_tag LOCUS_21780 3334 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 4982 5971 gene locus_tag LOCUS_21790 4982 5971 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815867.1 protein_id gnl|my_center|LOCUS_21790 7954 6053 gene locus_tag LOCUS_21800 gene ftsH 7954 6053 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_21800 8867 8109 gene locus_tag LOCUS_21810 8867 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 <9925 8927 gene locus_tag LOCUS_21820 <9925 8927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476295.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB >Feature sequence119 813 1 gene locus_tag LOCUS_21830 813 1 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016086425.1 protein_id gnl|my_center|LOCUS_21830 1558 827 gene locus_tag LOCUS_21840 1558 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 2854 1565 gene locus_tag LOCUS_21850 2854 1565 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896806.1 protein_id gnl|my_center|LOCUS_21850 3831 2890 gene locus_tag LOCUS_21860 3831 2890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_21860 4941 3850 gene locus_tag LOCUS_21870 4941 3850 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_21870 6471 4945 gene locus_tag LOCUS_21880 6471 4945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_21880 7682 6495 gene locus_tag LOCUS_21890 7682 6495 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_21890 8901 7711 gene locus_tag LOCUS_21900 gene deoB 8901 7711 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046067.1 protein_id gnl|my_center|LOCUS_21900 9341 8919 gene locus_tag LOCUS_21910 9341 8919 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964852.1 protein_id gnl|my_center|LOCUS_21910 <9873 9355 gene locus_tag LOCUS_21920 <9873 9355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001182060.1:uridine phosphorylase >Feature sequence120 39 686 gene locus_tag LOCUS_21930 39 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 868 1440 gene locus_tag LOCUS_21940 868 1440 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861641.1 protein_id gnl|my_center|LOCUS_21940 1632 2078 gene locus_tag LOCUS_21950 1632 2078 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048431.1 protein_id gnl|my_center|LOCUS_21950 3894 2122 gene locus_tag LOCUS_21960 3894 2122 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193735789.1 protein_id gnl|my_center|LOCUS_21960 4047 5327 gene locus_tag LOCUS_21970 gene galK 4047 5327 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_21970 5874 8114 gene locus_tag LOCUS_21980 5874 8114 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921762.1 protein_id gnl|my_center|LOCUS_21980 8851 8219 gene locus_tag LOCUS_21990 8851 8219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 >Feature sequence121 5851 1316 gene locus_tag LOCUS_22000 gene polC 5851 1316 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966712.1 protein_id gnl|my_center|LOCUS_22000 6923 5871 gene locus_tag LOCUS_22010 gene ispG 6923 5871 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965103.1 protein_id gnl|my_center|LOCUS_22010 8103 6961 gene locus_tag LOCUS_22020 8103 6961 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_22020 9375 8107 gene locus_tag LOCUS_22030 9375 8107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 >Feature sequence122 452 114 gene locus_tag LOCUS_22040 452 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 837 463 gene locus_tag LOCUS_22050 837 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 1531 884 gene locus_tag LOCUS_22060 1531 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 1697 1536 gene locus_tag LOCUS_22070 1697 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 2561 1797 gene locus_tag LOCUS_22080 2561 1797 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810589.1 protein_id gnl|my_center|LOCUS_22080 2766 2608 gene locus_tag LOCUS_22090 2766 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 3441 2920 gene locus_tag LOCUS_22100 3441 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 5510 3555 gene locus_tag LOCUS_22110 5510 3555 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048698132.1 protein_id gnl|my_center|LOCUS_22110 6172 5798 gene locus_tag LOCUS_22120 6172 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 6736 6392 gene locus_tag LOCUS_22130 6736 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 7355 6876 gene locus_tag LOCUS_22140 gene rlmH 7355 6876 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053094.1 protein_id gnl|my_center|LOCUS_22140 8139 7417 gene locus_tag LOCUS_22150 8139 7417 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948716.1 protein_id gnl|my_center|LOCUS_22150 8367 8224 gene locus_tag LOCUS_22160 8367 8224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 <9573 8404 gene locus_tag LOCUS_22170 <9573 8404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986285.1:NADPH-dependent glutamate synthase >Feature sequence123 147 1016 gene locus_tag LOCUS_22180 gene fba 147 1016 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_22180 2233 1118 gene locus_tag LOCUS_22190 gene glgD 2233 1118 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418641.1 protein_id gnl|my_center|LOCUS_22190 3374 2235 gene locus_tag LOCUS_22200 3374 2235 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922500.1 protein_id gnl|my_center|LOCUS_22200 3610 4971 gene locus_tag LOCUS_22210 3610 4971 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948912.1 protein_id gnl|my_center|LOCUS_22210 5217 5840 gene locus_tag LOCUS_22220 gene truA 5217 5840 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430279.1 protein_id gnl|my_center|LOCUS_22220 5875 6321 gene locus_tag LOCUS_22230 5875 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 6437 8116 gene locus_tag LOCUS_22240 6437 8116 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_22240 8121 9521 gene locus_tag LOCUS_22250 8121 9521 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891874.1 protein_id gnl|my_center|LOCUS_22250 >Feature sequence124 280 543 gene locus_tag LOCUS_22260 gene rpsT 280 543 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_22260 1585 608 gene locus_tag LOCUS_22270 gene holA 1585 608 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362655.1 protein_id gnl|my_center|LOCUS_22270 3252 1615 gene locus_tag LOCUS_22280 3252 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 3893 3504 gene locus_tag LOCUS_22290 3893 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 5391 3868 gene locus_tag LOCUS_22300 5391 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 7342 5372 gene locus_tag LOCUS_22310 7342 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 8476 7358 gene locus_tag LOCUS_22320 gene xerD 8476 7358 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546237.1 protein_id gnl|my_center|LOCUS_22320 8777 8490 gene locus_tag LOCUS_22330 8777 8490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence125 1453 761 gene locus_tag LOCUS_22340 gene cobI 1453 761 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392605.1 protein_id gnl|my_center|LOCUS_22340 2649 1480 gene locus_tag LOCUS_22350 gene cbiD 2649 1480 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861964.1 protein_id gnl|my_center|LOCUS_22350 2913 2764 gene locus_tag LOCUS_22360 2913 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 3548 2910 gene locus_tag LOCUS_22370 3548 2910 CDS product DUF3786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768312.1 protein_id gnl|my_center|LOCUS_22370 5124 3655 gene locus_tag LOCUS_22380 gene spoIVA 5124 3655 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_22380 5282 6784 gene locus_tag LOCUS_22390 5282 6784 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460409.1 protein_id gnl|my_center|LOCUS_22390 6832 7584 gene locus_tag LOCUS_22400 6832 7584 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943941.1 protein_id gnl|my_center|LOCUS_22400 8551 7700 gene locus_tag LOCUS_22410 8551 7700 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902122.1 protein_id gnl|my_center|LOCUS_22410 9230 8601 gene locus_tag LOCUS_22420 9230 8601 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432265.1 protein_id gnl|my_center|LOCUS_22420 >Feature sequence126 2565 1213 gene locus_tag LOCUS_22430 2565 1213 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_22430 3888 2668 gene locus_tag LOCUS_22440 3888 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 4868 3885 gene locus_tag LOCUS_22450 4868 3885 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005975400.1 protein_id gnl|my_center|LOCUS_22450 5643 4861 gene locus_tag LOCUS_22460 5643 4861 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903786.1 protein_id gnl|my_center|LOCUS_22460 6482 5655 gene locus_tag LOCUS_22470 6482 5655 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903784.1 protein_id gnl|my_center|LOCUS_22470 7427 6489 gene locus_tag LOCUS_22480 7427 6489 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015650.1 protein_id gnl|my_center|LOCUS_22480 9185 7521 gene locus_tag LOCUS_22490 9185 7521 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903785.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence127 116 1033 gene locus_tag LOCUS_22500 116 1033 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_22500 1166 2839 gene locus_tag LOCUS_22510 1166 2839 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382333.1 protein_id gnl|my_center|LOCUS_22510 2979 3296 gene locus_tag LOCUS_22520 2979 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 3374 3640 gene locus_tag LOCUS_22530 3374 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 4437 3727 gene locus_tag LOCUS_22540 4437 3727 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356424.1 protein_id gnl|my_center|LOCUS_22540 5020 4430 gene locus_tag LOCUS_22550 5020 4430 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_22550 5744 5049 gene locus_tag LOCUS_22560 5744 5049 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990639.1 protein_id gnl|my_center|LOCUS_22560 6093 5725 gene locus_tag LOCUS_22570 6093 5725 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963932.1 protein_id gnl|my_center|LOCUS_22570 6246 7466 gene locus_tag LOCUS_22580 gene pepT 6246 7466 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964023.1 protein_id gnl|my_center|LOCUS_22580 8452 7571 gene locus_tag LOCUS_22590 8452 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 9197 8664 gene locus_tag LOCUS_22600 9197 8664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence128 3553 833 gene locus_tag LOCUS_22610 3553 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 4538 3543 gene locus_tag LOCUS_22620 4538 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 5550 4531 gene locus_tag LOCUS_22630 5550 4531 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_22630 6938 5643 gene locus_tag LOCUS_22640 6938 5643 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775569.1 protein_id gnl|my_center|LOCUS_22640 8273 7041 gene locus_tag LOCUS_22650 8273 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 9225 8314 gene locus_tag LOCUS_22660 gene gpr 9225 8314 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460511.1 protein_id gnl|my_center|LOCUS_22660 >Feature sequence129 1868 399 gene locus_tag LOCUS_22670 1868 399 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861818.1 protein_id gnl|my_center|LOCUS_22670 3286 1919 gene locus_tag LOCUS_22680 3286 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 4290 3466 gene locus_tag LOCUS_22690 4290 3466 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723338.1 protein_id gnl|my_center|LOCUS_22690 4393 4265 gene locus_tag LOCUS_22700 4393 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 4909 4565 gene locus_tag LOCUS_22710 4909 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 5167 6045 gene locus_tag LOCUS_22720 5167 6045 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729003.1 protein_id gnl|my_center|LOCUS_22720 7002 6130 gene locus_tag LOCUS_22730 7002 6130 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_22730 9125 7236 gene locus_tag LOCUS_22740 9125 7236 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861587.1 protein_id gnl|my_center|LOCUS_22740 >Feature sequence130 336 554 gene locus_tag LOCUS_22750 336 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 1202 609 gene locus_tag LOCUS_22760 1202 609 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383106.1 protein_id gnl|my_center|LOCUS_22760 2281 1172 gene locus_tag LOCUS_22770 2281 1172 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966297.1 protein_id gnl|my_center|LOCUS_22770 3578 2286 gene locus_tag LOCUS_22780 3578 2286 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804836.1 protein_id gnl|my_center|LOCUS_22780 5256 3751 gene locus_tag LOCUS_22790 5256 3751 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_22790 5511 6197 gene locus_tag LOCUS_22800 5511 6197 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_22800 6862 6194 gene locus_tag LOCUS_22810 6862 6194 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_22810 9006 6952 gene locus_tag LOCUS_22820 9006 6952 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence131 166 966 gene locus_tag LOCUS_22830 166 966 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897350.1 protein_id gnl|my_center|LOCUS_22830 2076 955 gene locus_tag LOCUS_22840 gene mnmA 2076 955 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948825.1 protein_id gnl|my_center|LOCUS_22840 2519 2076 gene locus_tag LOCUS_22850 gene nifU 2519 2076 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272433.1 protein_id gnl|my_center|LOCUS_22850 3746 2553 gene locus_tag LOCUS_22860 gene nifS 3746 2553 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_22860 4243 3776 gene locus_tag LOCUS_22870 4243 3776 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_22870 4371 5687 gene locus_tag LOCUS_22880 4371 5687 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392657.1 protein_id gnl|my_center|LOCUS_22880 5786 6817 gene locus_tag LOCUS_22890 5786 6817 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_22890 7769 6885 gene locus_tag LOCUS_22900 gene xerD 7769 6885 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 protein_id gnl|my_center|LOCUS_22900 8516 7953 gene locus_tag LOCUS_22910 8516 7953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 <9136 8636 gene locus_tag LOCUS_22920 <9136 8636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003428216.1:ribonuclease Y >Feature sequence132 341 1135 gene locus_tag LOCUS_22930 341 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 2467 1166 gene locus_tag LOCUS_22940 2467 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 3171 2464 gene locus_tag LOCUS_22950 gene rgbR 3171 2464 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_22950 3326 3736 gene locus_tag LOCUS_22960 3326 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 3834 4829 gene locus_tag LOCUS_22970 3834 4829 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459514.1 protein_id gnl|my_center|LOCUS_22970 6075 4795 gene locus_tag LOCUS_22980 6075 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 6505 6059 gene locus_tag LOCUS_22990 6505 6059 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963521.1 protein_id gnl|my_center|LOCUS_22990 6700 7365 gene locus_tag LOCUS_23000 6700 7365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 7416 8117 gene locus_tag LOCUS_23010 7416 8117 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668240.1 protein_id gnl|my_center|LOCUS_23010 8358 8936 gene locus_tag LOCUS_23020 8358 8936 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814454.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence133 2742 97 gene locus_tag LOCUS_23030 2742 97 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_23030 3333 4385 gene locus_tag LOCUS_23040 3333 4385 CDS product endonuclease subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387048.1 protein_id gnl|my_center|LOCUS_23040 5783 4389 gene locus_tag LOCUS_23050 5783 4389 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_23050 6634 6419 gene locus_tag LOCUS_23060 6634 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 6928 6743 gene locus_tag LOCUS_23070 6928 6743 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816072.1 protein_id gnl|my_center|LOCUS_23070 7834 6944 gene locus_tag LOCUS_23080 7834 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 8655 7831 gene locus_tag LOCUS_23090 8655 7831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 8974 8657 gene locus_tag LOCUS_23100 8974 8657 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence134 240 1094 gene locus_tag LOCUS_23110 gene pgeF 240 1094 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_23110 1230 2420 gene locus_tag LOCUS_23120 1230 2420 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906400.1 protein_id gnl|my_center|LOCUS_23120 3635 2472 gene locus_tag LOCUS_23130 3635 2472 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_23130 3888 5294 gene locus_tag LOCUS_23140 3888 5294 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986849.1 protein_id gnl|my_center|LOCUS_23140 5233 6558 gene locus_tag LOCUS_23150 gene der 5233 6558 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_23150 6561 7205 gene locus_tag LOCUS_23160 gene plsY 6561 7205 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_23160 7211 8227 gene locus_tag LOCUS_23170 7211 8227 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_23170 <9037 8358 gene locus_tag LOCUS_23180 <9037 8358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010706576.1:aldo/keto reductase >Feature sequence135 249 46 gene locus_tag LOCUS_23190 249 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 3080 363 gene locus_tag LOCUS_23200 3080 363 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_23200 4052 3162 gene locus_tag LOCUS_23210 4052 3162 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892281.1 protein_id gnl|my_center|LOCUS_23210 4263 5258 gene locus_tag LOCUS_23220 4263 5258 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965979.1 protein_id gnl|my_center|LOCUS_23220 6058 5378 gene locus_tag LOCUS_23230 6058 5378 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_23230 7453 6080 gene locus_tag LOCUS_23240 7453 6080 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948237.1 protein_id gnl|my_center|LOCUS_23240 8851 7577 gene locus_tag LOCUS_23250 8851 7577 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_23250 >Feature sequence136 301 702 gene locus_tag LOCUS_23260 301 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 714 1205 gene locus_tag LOCUS_23270 714 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 2180 1287 gene locus_tag LOCUS_23280 2180 1287 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674958.1 protein_id gnl|my_center|LOCUS_23280 2419 4191 gene locus_tag LOCUS_23290 gene dhaK 2419 4191 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948658.1 protein_id gnl|my_center|LOCUS_23290 4205 5281 gene locus_tag LOCUS_23300 4205 5281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968139.1 protein_id gnl|my_center|LOCUS_23300 5303 6388 gene locus_tag LOCUS_23310 5303 6388 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379352.1 protein_id gnl|my_center|LOCUS_23310 6424 7323 gene locus_tag LOCUS_23320 6424 7323 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086069.1 protein_id gnl|my_center|LOCUS_23320 7334 8119 gene locus_tag LOCUS_23330 7334 8119 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966038.1 protein_id gnl|my_center|LOCUS_23330 8300 8746 gene locus_tag LOCUS_23340 8300 8746 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060880.1 protein_id gnl|my_center|LOCUS_23340 >Feature sequence137 507 229 gene locus_tag LOCUS_23350 507 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 4360 632 gene locus_tag LOCUS_23360 gene addA 4360 632 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965560.1 protein_id gnl|my_center|LOCUS_23360 7806 4363 gene locus_tag LOCUS_23370 gene addB 7806 4363 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_23370 <8583 7821 gene locus_tag LOCUS_23380 <8583 7821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108784.1:Cof-type HAD-IIB family hydrolase >Feature sequence138 1768 1544 gene locus_tag LOCUS_23390 1768 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 2068 4167 gene locus_tag LOCUS_23400 2068 4167 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461804.1 protein_id gnl|my_center|LOCUS_23400 4183 5574 gene locus_tag LOCUS_23410 gene purF 4183 5574 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461475.1 protein_id gnl|my_center|LOCUS_23410 6212 5778 gene locus_tag LOCUS_23420 6212 5778 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_23420 7149 6214 gene locus_tag LOCUS_23430 gene cysK 7149 6214 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_23430 7428 8390 gene locus_tag LOCUS_23440 7428 8390 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812829.1 protein_id gnl|my_center|LOCUS_23440 >Feature sequence139 100 462 gene locus_tag LOCUS_23450 100 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 462 854 gene locus_tag LOCUS_23460 462 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 905 1369 gene locus_tag LOCUS_23470 905 1369 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836897.1 protein_id gnl|my_center|LOCUS_23470 1516 1968 gene locus_tag LOCUS_23480 1516 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 2041 2505 gene locus_tag LOCUS_23490 2041 2505 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965786.1 protein_id gnl|my_center|LOCUS_23490 4052 2880 gene locus_tag LOCUS_23500 4052 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 4193 4726 gene locus_tag LOCUS_23510 4193 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 6138 4807 gene locus_tag LOCUS_23520 6138 4807 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261881.1 protein_id gnl|my_center|LOCUS_23520 6632 6114 gene locus_tag LOCUS_23530 6632 6114 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405372.1 protein_id gnl|my_center|LOCUS_23530 7982 6708 gene locus_tag LOCUS_23540 7982 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 >Feature sequence140 1433 69 gene locus_tag LOCUS_23550 1433 69 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_23550 1657 4836 gene locus_tag LOCUS_23560 1657 4836 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391798.1 protein_id gnl|my_center|LOCUS_23560 5159 4914 gene locus_tag LOCUS_23570 5159 4914 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788104.1 protein_id gnl|my_center|LOCUS_23570 5302 6003 gene locus_tag LOCUS_23580 5302 6003 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_23580 6175 6921 gene locus_tag LOCUS_23590 6175 6921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 6984 8333 gene locus_tag LOCUS_23600 6984 8333 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435635.1 protein_id gnl|my_center|LOCUS_23600 >Feature sequence141 <1 1092 gene locus_tag LOCUS_23610 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861645.1:histidinol-phosphate transaminase 1233 2429 gene locus_tag LOCUS_23620 1233 2429 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967768.1 protein_id gnl|my_center|LOCUS_23620 3212 2511 gene locus_tag LOCUS_23630 3212 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 3958 3563 gene locus_tag LOCUS_23640 3958 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 4679 3933 gene locus_tag LOCUS_23650 4679 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 5053 4676 gene locus_tag LOCUS_23660 5053 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 5929 5078 gene locus_tag LOCUS_23670 5929 5078 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963985.1 protein_id gnl|my_center|LOCUS_23670 6776 6069 gene locus_tag LOCUS_23680 6776 6069 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963984.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23680 8156 6807 gene locus_tag LOCUS_23690 8156 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 >Feature sequence142 355 1464 gene locus_tag LOCUS_23700 355 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23700 2616 1495 gene locus_tag LOCUS_23710 2616 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 2722 3645 gene locus_tag LOCUS_23720 2722 3645 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_23720 3697 5019 gene locus_tag LOCUS_23730 gene rsxC 3697 5019 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_23730 5032 5991 gene locus_tag LOCUS_23740 5032 5991 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428487.1 protein_id gnl|my_center|LOCUS_23740 5988 6596 gene locus_tag LOCUS_23750 5988 6596 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869097.1 protein_id gnl|my_center|LOCUS_23750 6598 7302 gene locus_tag LOCUS_23760 6598 7302 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948148.1 protein_id gnl|my_center|LOCUS_23760 7317 7901 gene locus_tag LOCUS_23770 gene rsxA 7317 7901 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_23770 >Feature sequence143 1793 417 gene locus_tag LOCUS_23780 gene murD 1793 417 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_23780 2774 1815 gene locus_tag LOCUS_23790 gene mraY 2774 1815 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358738.1 protein_id gnl|my_center|LOCUS_23790 4559 2835 gene locus_tag LOCUS_23800 4559 2835 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_23800 6846 4675 gene locus_tag LOCUS_23810 6846 4675 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266234.1 protein_id gnl|my_center|LOCUS_23810 7344 6859 gene locus_tag LOCUS_23820 7344 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 8169 7372 gene locus_tag LOCUS_23830 gene rsmH 8169 7372 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_23830 >Feature sequence144 1503 1000 gene locus_tag LOCUS_23840 1503 1000 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958555.1 protein_id gnl|my_center|LOCUS_23840 1984 1484 gene locus_tag LOCUS_23850 1984 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 2240 2028 gene locus_tag LOCUS_23860 gene atpE 2240 2028 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421370.1 protein_id gnl|my_center|LOCUS_23860 2869 2297 gene locus_tag LOCUS_23870 2869 2297 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356899.1 protein_id gnl|my_center|LOCUS_23870 4179 3439 gene locus_tag LOCUS_23880 4179 3439 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_23880 4351 5232 gene locus_tag LOCUS_23890 4351 5232 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938750.1 protein_id gnl|my_center|LOCUS_23890 5479 5787 gene locus_tag LOCUS_23900 gene trxA 5479 5787 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943892.1 protein_id gnl|my_center|LOCUS_23900 6567 5899 gene locus_tag LOCUS_23910 6567 5899 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_23910 6665 7360 gene locus_tag LOCUS_23920 6665 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence145 182 631 gene locus_tag LOCUS_23930 182 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 628 2043 gene locus_tag LOCUS_23940 628 2043 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_23940 4633 2123 gene locus_tag LOCUS_23950 4633 2123 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389901.1 protein_id gnl|my_center|LOCUS_23950 >Feature sequence146 2116 326 gene locus_tag LOCUS_23960 2116 326 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460031.1 protein_id gnl|my_center|LOCUS_23960 2384 4654 gene locus_tag LOCUS_23970 gene lon 2384 4654 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963778.1 protein_id gnl|my_center|LOCUS_23970 5381 4743 gene locus_tag LOCUS_23980 5381 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 5514 6737 gene locus_tag LOCUS_23990 5514 6737 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068831.1 protein_id gnl|my_center|LOCUS_23990 7353 6727 gene locus_tag LOCUS_24000 7353 6727 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852949.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence147 484 1314 gene locus_tag LOCUS_24010 484 1314 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921761.1 protein_id gnl|my_center|LOCUS_24010 1414 2319 gene locus_tag LOCUS_24020 1414 2319 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262870.1 protein_id gnl|my_center|LOCUS_24020 2334 3656 gene locus_tag LOCUS_24030 gene melA 2334 3656 CDS product alpha-galactosidase MelA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246000.1 protein_id gnl|my_center|LOCUS_24030 3697 5319 gene locus_tag LOCUS_24040 3697 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 6119 5415 gene locus_tag LOCUS_24050 6119 5415 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476110.1 protein_id gnl|my_center|LOCUS_24050 6320 7261 gene locus_tag LOCUS_24060 6320 7261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 >Feature sequence148 731 1015 gene locus_tag LOCUS_24070 731 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 1006 3105 gene locus_tag LOCUS_24080 1006 3105 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_24080 3299 4108 gene locus_tag LOCUS_24090 3299 4108 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109255.1 protein_id gnl|my_center|LOCUS_24090 5023 4094 gene locus_tag LOCUS_24100 gene trxB 5023 4094 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134963.1 protein_id gnl|my_center|LOCUS_24100 5391 5071 gene locus_tag LOCUS_24110 gene trxA 5391 5071 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018943.1 protein_id gnl|my_center|LOCUS_24110 5637 6626 gene locus_tag LOCUS_24120 5637 6626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 6788 7216 gene locus_tag LOCUS_24130 gene rplM 6788 7216 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420958.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence149 1839 2630 gene locus_tag LOCUS_24140 1839 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 2778 4169 gene locus_tag LOCUS_24150 2778 4169 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_24150 4185 4850 gene locus_tag LOCUS_24160 4185 4850 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814961.1 protein_id gnl|my_center|LOCUS_24160 4878 6080 gene locus_tag LOCUS_24170 4878 6080 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_24170 <7489 6130 gene locus_tag LOCUS_24180 <7489 6130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966001.1:ABC-F family ATP-binding cassette domain-containing protein >Feature sequence150 1137 196 gene locus_tag LOCUS_24190 1137 196 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775210.1 protein_id gnl|my_center|LOCUS_24190 1385 2398 gene locus_tag LOCUS_24200 1385 2398 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546223.1 protein_id gnl|my_center|LOCUS_24200 4870 3740 gene locus_tag LOCUS_24210 gene ytvI 4870 3740 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081388.1 protein_id gnl|my_center|LOCUS_24210 6576 5020 gene locus_tag LOCUS_24220 6576 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 7354 6743 gene locus_tag LOCUS_24230 7354 6743 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966864.1 protein_id gnl|my_center|LOCUS_24230 >Feature sequence151 64 1257 gene locus_tag LOCUS_24240 64 1257 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_24240 1285 2037 gene locus_tag LOCUS_24250 gene tpiA 1285 2037 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_24250 3011 2100 gene locus_tag LOCUS_24260 3011 2100 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_24260 3175 4656 gene locus_tag LOCUS_24270 3175 4656 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898068.1 protein_id gnl|my_center|LOCUS_24270 4792 5592 gene locus_tag LOCUS_24280 4792 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 5621 6313 gene locus_tag LOCUS_24290 5621 6313 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_24290 6303 7046 gene locus_tag LOCUS_24300 6303 7046 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255171.1 protein_id gnl|my_center|LOCUS_24300 >Feature sequence152 16 606 gene locus_tag LOCUS_24310 16 606 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213865.1 protein_id gnl|my_center|LOCUS_24310 2204 882 gene locus_tag LOCUS_24320 2204 882 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_24320 2399 3142 gene locus_tag LOCUS_24330 2399 3142 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016025.1 protein_id gnl|my_center|LOCUS_24330 5761 3290 gene locus_tag LOCUS_24340 5761 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 6803 6027 gene locus_tag LOCUS_24350 6803 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 >Feature sequence153 243 1187 gene locus_tag LOCUS_24360 243 1187 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814023.1 protein_id gnl|my_center|LOCUS_24360 1177 2367 gene locus_tag LOCUS_24370 gene rlmD 1177 2367 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288467.1 protein_id gnl|my_center|LOCUS_24370 2937 2710 gene locus_tag LOCUS_24380 2937 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 3257 2943 gene locus_tag LOCUS_24390 3257 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 4001 3318 gene locus_tag LOCUS_24400 4001 3318 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_24400 4123 4383 gene locus_tag LOCUS_24410 4123 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 4380 5093 gene locus_tag LOCUS_24420 4380 5093 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_24420 5111 6706 gene locus_tag LOCUS_24430 gene hcp 5111 6706 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_24430 >Feature sequence154 331 672 gene locus_tag LOCUS_24440 331 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 913 1110 gene locus_tag LOCUS_24450 913 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 1126 2325 gene locus_tag LOCUS_24460 1126 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 2424 2972 gene locus_tag LOCUS_24470 2424 2972 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_24470 2993 4492 gene locus_tag LOCUS_24480 2993 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 4810 4682 gene locus_tag LOCUS_24490 4810 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 5108 5347 gene locus_tag LOCUS_24500 5108 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 5286 6395 gene locus_tag LOCUS_24510 5286 6395 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285982.1 protein_id gnl|my_center|LOCUS_24510 6653 6913 gene locus_tag LOCUS_24520 6653 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24520 6862 7263 gene locus_tag LOCUS_24530 6862 7263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 >Feature sequence155 1641 7 gene locus_tag LOCUS_24540 1641 7 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329642.1 protein_id gnl|my_center|LOCUS_24540 2915 1887 gene locus_tag LOCUS_24550 2915 1887 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582593.1 protein_id gnl|my_center|LOCUS_24550 3870 3130 gene locus_tag LOCUS_24560 3870 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 5608 3893 gene locus_tag LOCUS_24570 5608 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 6013 5729 gene locus_tag LOCUS_24580 6013 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 6397 7158 gene locus_tag LOCUS_24590 6397 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 >Feature sequence156 834 187 gene locus_tag LOCUS_24600 834 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 1269 943 gene locus_tag LOCUS_24610 gene hisE 1269 943 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949117.1 protein_id gnl|my_center|LOCUS_24610 1598 1266 gene locus_tag LOCUS_24620 gene hisI 1598 1266 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721356.1 protein_id gnl|my_center|LOCUS_24620 2362 1601 gene locus_tag LOCUS_24630 gene hisF 2362 1601 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964259.1 protein_id gnl|my_center|LOCUS_24630 3081 2362 gene locus_tag LOCUS_24640 gene hisA 3081 2362 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989518.1 protein_id gnl|my_center|LOCUS_24640 3683 3078 gene locus_tag LOCUS_24650 gene hisH 3683 3078 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964257.1 protein_id gnl|my_center|LOCUS_24650 4261 3683 gene locus_tag LOCUS_24660 gene hisB 4261 3683 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436680.1 protein_id gnl|my_center|LOCUS_24660 5342 4290 gene locus_tag LOCUS_24670 gene hisC 5342 4290 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889400.1 protein_id gnl|my_center|LOCUS_24670 5995 5357 gene locus_tag LOCUS_24680 gene hisG 5995 5357 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964254.1 protein_id gnl|my_center|LOCUS_24680 7199 5982 gene locus_tag LOCUS_24690 7199 5982 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964253.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence157 12 3548 gene locus_tag LOCUS_24700 gene mfd 12 3548 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966492.1 protein_id gnl|my_center|LOCUS_24700 3624 4778 gene locus_tag LOCUS_24710 3624 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 4833 5540 gene locus_tag LOCUS_24720 4833 5540 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021134.1 protein_id gnl|my_center|LOCUS_24720 5533 7104 gene locus_tag LOCUS_24730 5533 7104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990774.1 protein_id gnl|my_center|LOCUS_24730 >Feature sequence158 2305 1538 gene locus_tag LOCUS_24740 2305 1538 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888532.1 protein_id gnl|my_center|LOCUS_24740 4232 2340 gene locus_tag LOCUS_24750 gene cooS 4232 2340 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860935.1 protein_id gnl|my_center|LOCUS_24750 5030 4260 gene locus_tag LOCUS_24760 5030 4260 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_24760 5500 5249 gene locus_tag LOCUS_24770 5500 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 5742 5560 gene locus_tag LOCUS_24780 5742 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 6060 5746 gene locus_tag LOCUS_24790 6060 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 >Feature sequence159 1239 397 gene locus_tag LOCUS_24800 1239 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24800 2313 1249 gene locus_tag LOCUS_24810 2313 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24810 3250 2336 gene locus_tag LOCUS_24820 gene pfkB 3250 2336 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_24820 3773 3477 gene locus_tag LOCUS_24830 3773 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 4385 3792 gene locus_tag LOCUS_24840 4385 3792 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889235.1 protein_id gnl|my_center|LOCUS_24840 5244 4420 gene locus_tag LOCUS_24850 5244 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 6105 5287 gene locus_tag LOCUS_24860 6105 5287 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363043.1 protein_id gnl|my_center|LOCUS_24860 6766 6266 gene locus_tag LOCUS_24870 6766 6266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 >Feature sequence160 1281 2453 gene locus_tag LOCUS_24880 1281 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 2556 3335 gene locus_tag LOCUS_24890 2556 3335 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680889.1 protein_id gnl|my_center|LOCUS_24890 3837 3430 gene locus_tag LOCUS_24900 3837 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 4769 3951 gene locus_tag LOCUS_24910 4769 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 5741 5079 gene locus_tag LOCUS_24920 5741 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 5976 5761 gene locus_tag LOCUS_24930 5976 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 6486 6007 gene locus_tag LOCUS_24940 6486 6007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence161 <1 806 gene locus_tag LOCUS_24950 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002297086.1:polyribonucleotide nucleotidyltransferase 864 1379 gene locus_tag LOCUS_24960 864 1379 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049186.1 protein_id gnl|my_center|LOCUS_24960 1490 2680 gene locus_tag LOCUS_24970 1490 2680 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963947.1 protein_id gnl|my_center|LOCUS_24970 3129 2734 gene locus_tag LOCUS_24980 3129 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 3324 4889 gene locus_tag LOCUS_24990 3324 4889 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033562369.1 protein_id gnl|my_center|LOCUS_24990 4926 6845 gene locus_tag LOCUS_25000 4926 6845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 >Feature sequence162 123 1649 gene locus_tag LOCUS_25010 123 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 1870 2379 gene locus_tag LOCUS_25020 1870 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25020 2381 2749 gene locus_tag LOCUS_25030 2381 2749 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419037.1 protein_id gnl|my_center|LOCUS_25030 4839 2755 gene locus_tag LOCUS_25040 4839 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 5962 5009 gene locus_tag LOCUS_25050 5962 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 >Feature sequence163 141 326 gene locus_tag LOCUS_25060 141 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 380 1912 gene locus_tag LOCUS_25070 380 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 2045 2272 gene locus_tag LOCUS_25080 2045 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 2383 2823 gene locus_tag LOCUS_25090 2383 2823 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837227.1 protein_id gnl|my_center|LOCUS_25090 3417 2971 gene locus_tag LOCUS_25100 3417 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 3940 3467 gene locus_tag LOCUS_25110 3940 3467 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261902.1 protein_id gnl|my_center|LOCUS_25110 4629 3955 gene locus_tag LOCUS_25120 4629 3955 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865299.1 protein_id gnl|my_center|LOCUS_25120 5211 4645 gene locus_tag LOCUS_25130 5211 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 5693 5235 gene locus_tag LOCUS_25140 5693 5235 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682186.1 protein_id gnl|my_center|LOCUS_25140 6276 5719 gene locus_tag LOCUS_25150 6276 5719 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245754.1 protein_id gnl|my_center|LOCUS_25150 >Feature sequence164 1777 575 gene locus_tag LOCUS_25160 1777 575 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462283.1 protein_id gnl|my_center|LOCUS_25160 3279 1915 gene locus_tag LOCUS_25170 3279 1915 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949126.1 protein_id gnl|my_center|LOCUS_25170 3929 3267 gene locus_tag LOCUS_25180 3929 3267 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405372.1 protein_id gnl|my_center|LOCUS_25180 4700 3957 gene locus_tag LOCUS_25190 4700 3957 CDS product lantibiotic immunity ABC transporter MutG family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861184.1 protein_id gnl|my_center|LOCUS_25190 5443 4700 gene locus_tag LOCUS_25200 5443 4700 CDS product lantibiotic immunity ABC transporter MutE/EpiE family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949125.1 protein_id gnl|my_center|LOCUS_25200 6053 5445 gene locus_tag LOCUS_25210 6053 5445 CDS product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896245.1 protein_id gnl|my_center|LOCUS_25210 >Feature sequence165 723 172 gene locus_tag LOCUS_25220 gene rsmD 723 172 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 protein_id gnl|my_center|LOCUS_25220 1134 742 gene locus_tag LOCUS_25230 gene mgsA 1134 742 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684755.1 protein_id gnl|my_center|LOCUS_25230 1423 1650 gene locus_tag LOCUS_25240 1423 1650 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_25240 2185 1784 gene locus_tag LOCUS_25250 2185 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 4374 2317 gene locus_tag LOCUS_25260 gene recG 4374 2317 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_25260 6147 4486 gene locus_tag LOCUS_25270 6147 4486 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454872.1 protein_id gnl|my_center|LOCUS_25270 6521 6165 gene locus_tag LOCUS_25280 6521 6165 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_25280 >Feature sequence166 <1 509 gene locus_tag LOCUS_25290 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003722103.1:fructose-6-phosphate aldolase 532 1371 gene locus_tag LOCUS_25300 532 1371 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_25300 1359 2297 gene locus_tag LOCUS_25310 1359 2297 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_25310 2931 2356 gene locus_tag LOCUS_25320 2931 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 3097 4245 gene locus_tag LOCUS_25330 3097 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 4303 5529 gene locus_tag LOCUS_25340 4303 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 5561 6265 gene locus_tag LOCUS_25350 5561 6265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 >Feature sequence167 <1 672 gene locus_tag LOCUS_25360 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009898714.1:transcription termination factor Rho 810 1013 gene locus_tag LOCUS_25370 gene rpmE 810 1013 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_25370 1073 2050 gene locus_tag LOCUS_25380 1073 2050 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947980.1 protein_id gnl|my_center|LOCUS_25380 2053 2910 gene locus_tag LOCUS_25390 gene prmC 2053 2910 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640077.1 protein_id gnl|my_center|LOCUS_25390 2903 3973 gene locus_tag LOCUS_25400 gene prfA 2903 3973 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_25400 3982 6036 gene locus_tag LOCUS_25410 3982 6036 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_25410 >Feature sequence168 138 1049 gene locus_tag LOCUS_25420 138 1049 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948557.1 protein_id gnl|my_center|LOCUS_25420 2205 1192 gene locus_tag LOCUS_25430 gene ilvC 2205 1192 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081338.1 protein_id gnl|my_center|LOCUS_25430 2829 2314 gene locus_tag LOCUS_25440 gene ilvN 2829 2314 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496411.1 protein_id gnl|my_center|LOCUS_25440 3590 3180 gene locus_tag LOCUS_25450 3590 3180 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035802.1 protein_id gnl|my_center|LOCUS_25450 4998 3604 gene locus_tag LOCUS_25460 gene atpD 4998 3604 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_25460 5920 5030 gene locus_tag LOCUS_25470 gene atpG 5920 5030 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_25470 <6434 5925 gene locus_tag LOCUS_25480 <6434 5925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851836.1:F0F1 ATP synthase subunit alpha >Feature sequence169 2086 950 gene locus_tag LOCUS_25490 2086 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 2212 2991 gene locus_tag LOCUS_25500 gene rluF 2212 2991 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936374.1 protein_id gnl|my_center|LOCUS_25500 3008 4966 gene locus_tag LOCUS_25510 gene ligA 3008 4966 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence170 <1 788 gene locus_tag LOCUS_25520 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244810.1:stage V sporulation protein E 869 2116 gene locus_tag LOCUS_25530 gene murA 869 2116 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940516.1 protein_id gnl|my_center|LOCUS_25530 2129 2968 gene locus_tag LOCUS_25540 2129 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 3165 4334 gene locus_tag LOCUS_25550 gene ftsZ 3165 4334 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386373.1 protein_id gnl|my_center|LOCUS_25550 4435 4911 gene locus_tag LOCUS_25560 gene moaC 4435 4911 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454438.1 protein_id gnl|my_center|LOCUS_25560 4923 5411 gene locus_tag LOCUS_25570 gene mog 4923 5411 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986482.1 protein_id gnl|my_center|LOCUS_25570 5429 6196 gene locus_tag LOCUS_25580 gene aroD 5429 6196 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897376.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence171 651 373 gene locus_tag LOCUS_25590 651 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 1180 824 gene locus_tag LOCUS_25600 1180 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 2287 1346 gene locus_tag LOCUS_25610 2287 1346 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812528.1 protein_id gnl|my_center|LOCUS_25610 2813 2331 gene locus_tag LOCUS_25620 2813 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 3614 2844 gene locus_tag LOCUS_25630 3614 2844 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268503.1 protein_id gnl|my_center|LOCUS_25630 3875 3693 gene locus_tag LOCUS_25640 3875 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 3814 4425 gene locus_tag LOCUS_25650 3814 4425 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_25650 5196 4498 gene locus_tag LOCUS_25660 5196 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 <6336 5740 gene locus_tag LOCUS_25670 <6336 5740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403694.1:leucine--tRNA ligase >Feature sequence172 506 1237 gene locus_tag LOCUS_25680 gene sigE 506 1237 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976948.1 protein_id gnl|my_center|LOCUS_25680 2218 1460 gene locus_tag LOCUS_25690 2218 1460 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_25690 2433 3074 gene locus_tag LOCUS_25700 2433 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25700 3105 4130 gene locus_tag LOCUS_25710 3105 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25710 4269 5294 gene locus_tag LOCUS_25720 4269 5294 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_25720 5359 5613 gene locus_tag LOCUS_25730 5359 5613 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392374.1 protein_id gnl|my_center|LOCUS_25730 >Feature sequence173 262 3801 gene locus_tag LOCUS_25740 262 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 3817 5064 gene locus_tag LOCUS_25750 3817 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 5077 5850 gene locus_tag LOCUS_25760 5077 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 >Feature sequence174 <1 646 gene locus_tag LOCUS_25770 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002285971.1:sugar ABC transporter permease 667 1641 gene locus_tag LOCUS_25780 667 1641 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_25780 1675 3171 gene locus_tag LOCUS_25790 1675 3171 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_25790 3460 5907 gene locus_tag LOCUS_25800 3460 5907 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_25800 >Feature sequence175 1163 354 gene locus_tag LOCUS_25810 1163 354 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436797.1 protein_id gnl|my_center|LOCUS_25810 2265 1264 gene locus_tag LOCUS_25820 gene pfkA 2265 1264 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_25820 5816 2328 gene locus_tag LOCUS_25830 5816 2328 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963838.1 protein_id gnl|my_center|LOCUS_25830 >Feature sequence176 <1 865 gene locus_tag LOCUS_25840 <1 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902660.1:sodium ion-translocating decarboxylase subunit beta 899 2311 gene locus_tag LOCUS_25850 899 2311 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017109.1 protein_id gnl|my_center|LOCUS_25850 2464 3330 gene locus_tag LOCUS_25860 2464 3330 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_25860 3333 4571 gene locus_tag LOCUS_25870 3333 4571 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_25870 4600 5277 gene locus_tag LOCUS_25880 gene cmk 4600 5277 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230555.1 protein_id gnl|my_center|LOCUS_25880 >Feature sequence177 2035 320 gene locus_tag LOCUS_25890 gene recJ 2035 320 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943623.1 protein_id gnl|my_center|LOCUS_25890 4355 2106 gene locus_tag LOCUS_25900 4355 2106 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944693.1 protein_id gnl|my_center|LOCUS_25900 5747 4377 gene locus_tag LOCUS_25910 gene scfB 5747 4377 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_25910 >Feature sequence178 140 1207 gene locus_tag LOCUS_25920 140 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 1227 1895 gene locus_tag LOCUS_25930 1227 1895 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 protein_id gnl|my_center|LOCUS_25930 1922 2593 gene locus_tag LOCUS_25940 1922 2593 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_25940 2597 4042 gene locus_tag LOCUS_25950 2597 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 4329 4619 gene locus_tag LOCUS_25960 4329 4619 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_25960 4622 5689 gene locus_tag LOCUS_25970 gene hydE 4622 5689 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_25970 >Feature sequence179 118 351 gene locus_tag LOCUS_25980 gene acpP 118 351 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_25980 466 1395 gene locus_tag LOCUS_25990 gene fabD 466 1395 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_25990 1405 2145 gene locus_tag LOCUS_26000 gene fabG 1405 2145 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_26000 2154 3389 gene locus_tag LOCUS_26010 gene fabF 2154 3389 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_26010 3403 3873 gene locus_tag LOCUS_26020 gene accB 3403 3873 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930864.1 protein_id gnl|my_center|LOCUS_26020 3885 4313 gene locus_tag LOCUS_26030 gene fabZ 3885 4313 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048424.1 protein_id gnl|my_center|LOCUS_26030 4327 5673 gene locus_tag LOCUS_26040 4327 5673 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_26040 >Feature sequence180 72 2915 gene locus_tag LOCUS_26050 72 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 3005 3796 gene locus_tag LOCUS_26060 gene minD 3005 3796 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419057.1 protein_id gnl|my_center|LOCUS_26060 3811 4071 gene locus_tag LOCUS_26070 3811 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 4118 5248 gene locus_tag LOCUS_26080 gene rodA 4118 5248 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_26080 >Feature sequence181 915 148 gene locus_tag LOCUS_26090 915 148 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_26090 1770 922 gene locus_tag LOCUS_26100 gene ylqF 1770 922 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_26100 2395 1790 gene locus_tag LOCUS_26110 gene lepB 2395 1790 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392487.1 protein_id gnl|my_center|LOCUS_26110 2816 2469 gene locus_tag LOCUS_26120 gene rplS 2816 2469 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419350.1 protein_id gnl|my_center|LOCUS_26120 4439 2988 gene locus_tag LOCUS_26130 4439 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 4953 4453 gene locus_tag LOCUS_26140 gene rimM 4953 4453 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889030.1 protein_id gnl|my_center|LOCUS_26140 5275 5045 gene locus_tag LOCUS_26150 5275 5045 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_26150 5540 5295 gene locus_tag LOCUS_26160 gene rpsP 5540 5295 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence182 231 989 gene locus_tag LOCUS_26170 gene speD 231 989 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965890.1 protein_id gnl|my_center|LOCUS_26170 1051 2505 gene locus_tag LOCUS_26180 1051 2505 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661024.1 protein_id gnl|my_center|LOCUS_26180 2508 3368 gene locus_tag LOCUS_26190 gene speE 2508 3368 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_26190 3349 4200 gene locus_tag LOCUS_26200 gene speB 3349 4200 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 protein_id gnl|my_center|LOCUS_26200 4307 5509 gene locus_tag LOCUS_26210 4307 5509 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 protein_id gnl|my_center|LOCUS_26210 >Feature sequence183 1953 484 gene locus_tag LOCUS_26220 gene gatA 1953 484 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966260.1 protein_id gnl|my_center|LOCUS_26220 2261 1968 gene locus_tag LOCUS_26230 gene gatC 2261 1968 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_26230 3604 2276 gene locus_tag LOCUS_26240 gene aspS 3604 2276 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966262.1 protein_id gnl|my_center|LOCUS_26240 4912 3698 gene locus_tag LOCUS_26250 4912 3698 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_26250 5478 4927 gene locus_tag LOCUS_26260 5478 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 >Feature sequence184 1374 445 gene locus_tag LOCUS_26270 gene cysK 1374 445 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393469.1 protein_id gnl|my_center|LOCUS_26270 3324 1528 gene locus_tag LOCUS_26280 gene uidA 3324 1528 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583888.1 protein_id gnl|my_center|LOCUS_26280 4648 3302 gene locus_tag LOCUS_26290 4648 3302 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265226.1 protein_id gnl|my_center|LOCUS_26290 5470 4700 gene locus_tag LOCUS_26300 5470 4700 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897033.1 protein_id gnl|my_center|LOCUS_26300 >Feature sequence185 184 1263 gene locus_tag LOCUS_26310 184 1263 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_26310 1303 2949 gene locus_tag LOCUS_26320 gene dnaX 1303 2949 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421622.1 protein_id gnl|my_center|LOCUS_26320 2967 3314 gene locus_tag LOCUS_26330 2967 3314 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_26330 3335 3934 gene locus_tag LOCUS_26340 gene recR 3335 3934 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_26340 3937 5034 gene locus_tag LOCUS_26350 3937 5034 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_26350 >Feature sequence186 1864 554 gene locus_tag LOCUS_26360 1864 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 2625 2783 gene locus_tag LOCUS_26370 2625 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 2737 4071 gene locus_tag LOCUS_26380 gene aspS 2737 4071 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948698.1 protein_id gnl|my_center|LOCUS_26380 <5411 4183 gene locus_tag LOCUS_26390 <5411 4183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047993.1:pyruvate, phosphate dikinase >Feature sequence187 80 979 gene locus_tag LOCUS_26400 80 979 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964642.1 protein_id gnl|my_center|LOCUS_26400 2653 1022 gene locus_tag LOCUS_26410 2653 1022 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 protein_id gnl|my_center|LOCUS_26410 2849 3253 gene locus_tag LOCUS_26420 2849 3253 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963442.1 protein_id gnl|my_center|LOCUS_26420 5167 3410 gene locus_tag LOCUS_26430 5167 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 >Feature sequence188 3037 923 gene locus_tag LOCUS_26440 3037 923 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_26440 3672 3118 gene locus_tag LOCUS_26450 gene ytaF 3672 3118 CDS product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861469.1 protein_id gnl|my_center|LOCUS_26450 4670 3732 gene locus_tag LOCUS_26460 4670 3732 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722230.1 protein_id gnl|my_center|LOCUS_26460 <5326 4802 gene locus_tag LOCUS_26470 <5326 4802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459109.1:50S ribosomal protein L17 >Feature sequence189 260 1291 gene locus_tag LOCUS_26480 260 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 1295 2266 gene locus_tag LOCUS_26490 1295 2266 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077130071.1 protein_id gnl|my_center|LOCUS_26490 2266 2892 gene locus_tag LOCUS_26500 2266 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 2892 3761 gene locus_tag LOCUS_26510 2892 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_26510 4442 3849 gene locus_tag LOCUS_26520 4442 3849 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642400.1 protein_id gnl|my_center|LOCUS_26520 4582 5187 gene locus_tag LOCUS_26530 4582 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 >Feature sequence190 1078 296 gene locus_tag LOCUS_26540 1078 296 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_26540 1275 1075 gene locus_tag LOCUS_26550 1275 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 1817 1287 gene locus_tag LOCUS_26560 1817 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 2097 1819 gene locus_tag LOCUS_26570 2097 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 2666 2205 gene locus_tag LOCUS_26580 2666 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 3904 2999 gene locus_tag LOCUS_26590 3904 2999 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_26590 4677 3901 gene locus_tag LOCUS_26600 gene pyrK 4677 3901 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232111.1 protein_id gnl|my_center|LOCUS_26600 <5325 4688 gene locus_tag LOCUS_26610 <5325 4688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389894.1:orotidine-5'-phosphate decarboxylase >Feature sequence191 238 609 gene locus_tag LOCUS_26620 238 609 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963919.1 protein_id gnl|my_center|LOCUS_26620 624 3068 gene locus_tag LOCUS_26630 624 3068 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966466.1 protein_id gnl|my_center|LOCUS_26630 3176 3589 gene locus_tag LOCUS_26640 3176 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 3747 5120 gene locus_tag LOCUS_26650 gene radA 3747 5120 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_26650 >Feature sequence192 208 891 gene locus_tag LOCUS_26660 208 891 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861401.1 protein_id gnl|my_center|LOCUS_26660 884 1912 gene locus_tag LOCUS_26670 884 1912 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861402.1 protein_id gnl|my_center|LOCUS_26670 4375 2009 gene locus_tag LOCUS_26680 4375 2009 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861404.1 protein_id gnl|my_center|LOCUS_26680 5064 4366 gene locus_tag LOCUS_26690 5064 4366 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861403.1 protein_id gnl|my_center|LOCUS_26690 >Feature sequence193 284 1420 gene locus_tag LOCUS_26700 gene tgt 284 1420 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965580.1 protein_id gnl|my_center|LOCUS_26700 1538 1855 gene locus_tag LOCUS_26710 1538 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 1960 2628 gene locus_tag LOCUS_26720 gene sdaAB 1960 2628 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877445.1 protein_id gnl|my_center|LOCUS_26720 2640 3521 gene locus_tag LOCUS_26730 gene sdaAA 2640 3521 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548060.1 protein_id gnl|my_center|LOCUS_26730 3969 5051 gene locus_tag LOCUS_26740 gene leuB 3969 5051 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_26740 >Feature sequence194 2297 1356 gene locus_tag LOCUS_26750 2297 1356 CDS product YhjD/YihY/BrkB family envelope integrity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963807.1 protein_id gnl|my_center|LOCUS_26750 3745 2351 gene locus_tag LOCUS_26760 3745 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 4949 3885 gene locus_tag LOCUS_26770 4949 3885 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108863.1 protein_id gnl|my_center|LOCUS_26770 >Feature sequence195 1177 227 gene locus_tag LOCUS_26780 1177 227 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906252.1 protein_id gnl|my_center|LOCUS_26780 1807 1214 gene locus_tag LOCUS_26790 gene sigH 1807 1214 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357363.1 protein_id gnl|my_center|LOCUS_26790 2571 1822 gene locus_tag LOCUS_26800 gene rlmB 2571 1822 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_26800 2995 2546 gene locus_tag LOCUS_26810 2995 2546 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293091.1 protein_id gnl|my_center|LOCUS_26810 4386 2980 gene locus_tag LOCUS_26820 gene cysS 4386 2980 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_26820 <5118 4383 gene locus_tag LOCUS_26830 <5118 4383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_069591551.1:serine O-acetyltransferase >Feature sequence196 1833 709 gene locus_tag LOCUS_26840 1833 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26840 2886 1870 gene locus_tag LOCUS_26850 2886 1870 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262368.1 protein_id gnl|my_center|LOCUS_26850 4144 3008 gene locus_tag LOCUS_26860 gene nspC 4144 3008 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764364.1 protein_id gnl|my_center|LOCUS_26860 <5007 4144 gene locus_tag LOCUS_26870 <5007 4144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000088780.1:saccharopine dehydrogenase family protein >Feature sequence197 1268 360 gene locus_tag LOCUS_26880 1268 360 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272589.1 protein_id gnl|my_center|LOCUS_26880 1879 1313 gene locus_tag LOCUS_26890 1879 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 2013 1876 gene locus_tag LOCUS_26900 2013 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 2827 2234 gene locus_tag LOCUS_26910 2827 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 3792 3001 gene locus_tag LOCUS_26920 3792 3001 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876725.1 protein_id gnl|my_center|LOCUS_26920 4877 3792 gene locus_tag LOCUS_26930 gene asd 4877 3792 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699652.1 protein_id gnl|my_center|LOCUS_26930 >Feature sequence198 334 693 gene locus_tag LOCUS_26940 334 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26940 724 2445 gene locus_tag LOCUS_26950 gene ureB 724 2445 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724295.1 protein_id gnl|my_center|LOCUS_26950 2457 2963 gene locus_tag LOCUS_26960 gene ureI 2457 2963 CDS product acid-activated urea channel protein UreI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901247.1 protein_id gnl|my_center|LOCUS_26960 2976 3488 gene locus_tag LOCUS_26970 gene ureE 2976 3488 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583097.1 protein_id gnl|my_center|LOCUS_26970 3485 4186 gene locus_tag LOCUS_26980 3485 4186 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357404.1 protein_id gnl|my_center|LOCUS_26980 4313 4921 gene locus_tag LOCUS_26990 gene ureG 4313 4921 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238762.1 protein_id gnl|my_center|LOCUS_26990 >Feature sequence199 881 48 gene locus_tag LOCUS_27000 gene epsE 881 48 CDS product glycosyltransferase EpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244557.1 protein_id gnl|my_center|LOCUS_27000 2034 778 gene locus_tag LOCUS_27010 2034 778 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242735.1 protein_id gnl|my_center|LOCUS_27010 3331 2198 gene locus_tag LOCUS_27020 3331 2198 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_27020 4267 3431 gene locus_tag LOCUS_27030 4267 3431 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764890.1 protein_id gnl|my_center|LOCUS_27030 4520 4296 gene locus_tag LOCUS_27040 4520 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 4945 4718 gene locus_tag LOCUS_27050 4945 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 >Feature sequence200 660 19 gene locus_tag LOCUS_27060 660 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 1748 756 gene locus_tag LOCUS_27070 1748 756 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393144.1 protein_id gnl|my_center|LOCUS_27070 2064 2234 gene locus_tag LOCUS_27080 2064 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 2980 3471 gene locus_tag LOCUS_27090 2980 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 3674 4543 gene locus_tag LOCUS_27100 3674 4543 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_27100 >Feature sequence201 277 1548 gene locus_tag LOCUS_27110 277 1548 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861133.1 protein_id gnl|my_center|LOCUS_27110 2837 1554 gene locus_tag LOCUS_27120 2837 1554 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989456.1 protein_id gnl|my_center|LOCUS_27120 3170 2841 gene locus_tag LOCUS_27130 3170 2841 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461784.1 protein_id gnl|my_center|LOCUS_27130 4010 3255 gene locus_tag LOCUS_27140 4010 3255 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721781.1 protein_id gnl|my_center|LOCUS_27140 4288 4022 gene locus_tag LOCUS_27150 4288 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 >Feature sequence202 1220 135 gene locus_tag LOCUS_27160 1220 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 2829 1324 gene locus_tag LOCUS_27170 gene araA 2829 1324 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229499.1 protein_id gnl|my_center|LOCUS_27170 2996 3868 gene locus_tag LOCUS_27180 2996 3868 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775503.1 protein_id gnl|my_center|LOCUS_27180 <4799 3977 gene locus_tag LOCUS_27190 <4799 3977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966512.1:sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC >Feature sequence203 24 581 gene locus_tag LOCUS_27200 gene efp 24 581 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_27200 765 1646 gene locus_tag LOCUS_27210 765 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 1785 1857 gene locus_tag LOCUS_t00100 1785 1857 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1907 2803 gene locus_tag LOCUS_27220 1907 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 4153 2990 gene locus_tag LOCUS_27230 4153 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 >Feature sequence204 198 1373 gene locus_tag LOCUS_27240 198 1373 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_27240 1721 1446 gene locus_tag LOCUS_27250 1721 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 3356 1734 gene locus_tag LOCUS_27260 gene ptsP 3356 1734 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_27260 3633 3376 gene locus_tag LOCUS_27270 3633 3376 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_27270 4564 3746 gene locus_tag LOCUS_27280 4564 3746 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987040.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence205 67 139 gene locus_tag LOCUS_t00110 67 139 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 251 1105 gene locus_tag LOCUS_27290 251 1105 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_27290 3320 1182 gene locus_tag LOCUS_27300 3320 1182 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_27300 <4695 3333 gene locus_tag LOCUS_27310 <4695 3333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814148.1:HD domain-containing protein >Feature sequence206 1451 201 gene locus_tag LOCUS_27320 1451 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 2921 1548 gene locus_tag LOCUS_27330 2921 1548 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986917.1 protein_id gnl|my_center|LOCUS_27330 3062 3844 gene locus_tag LOCUS_27340 3062 3844 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064761.1 protein_id gnl|my_center|LOCUS_27340 4248 3985 gene locus_tag LOCUS_27350 4248 3985 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250307.1 protein_id gnl|my_center|LOCUS_27350 >Feature sequence207 1067 123 gene locus_tag LOCUS_27360 1067 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 1127 1960 gene locus_tag LOCUS_27370 1127 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 2104 2610 gene locus_tag LOCUS_27380 2104 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 <4676 2685 gene locus_tag LOCUS_27390 <4676 2685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107432.1:glycoside hydrolase family 2 TIM barrel-domain containing protein >Feature sequence208 273 938 gene locus_tag LOCUS_27400 273 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 1613 1768 gene locus_tag LOCUS_27410 1613 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 1883 2251 gene locus_tag LOCUS_27420 1883 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 2292 2555 gene locus_tag LOCUS_27430 2292 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 2626 3405 gene locus_tag LOCUS_27440 2626 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 3852 3541 gene locus_tag LOCUS_27450 3852 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 <4637 3852 gene locus_tag LOCUS_27460 <4637 3852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203619.1:IS1182-like element ISBf5 family transposase >Feature sequence209 171 479 gene locus_tag LOCUS_27470 171 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 557 1846 gene locus_tag LOCUS_27480 557 1846 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_27480 1858 2415 gene locus_tag LOCUS_27490 1858 2415 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398483.1 protein_id gnl|my_center|LOCUS_27490 2423 3346 gene locus_tag LOCUS_27500 gene spoIID 2423 3346 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966145.1 protein_id gnl|my_center|LOCUS_27500 4252 3353 gene locus_tag LOCUS_27510 4252 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 >Feature sequence210 425 141 gene locus_tag LOCUS_27520 425 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 616 1200 gene locus_tag LOCUS_27530 616 1200 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948397.1 protein_id gnl|my_center|LOCUS_27530 1184 2260 gene locus_tag LOCUS_27540 1184 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 2297 2605 gene locus_tag LOCUS_27550 2297 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 2745 3137 gene locus_tag LOCUS_27560 2745 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 3260 4444 gene locus_tag LOCUS_27570 3260 4444 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681116.1 protein_id gnl|my_center|LOCUS_27570 >Feature sequence211 <1 580 gene locus_tag LOCUS_27580 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009891221.1:V-type ATP synthase subunit D 836 1858 gene locus_tag LOCUS_27590 836 1858 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215055.1 protein_id gnl|my_center|LOCUS_27590 1855 2379 gene locus_tag LOCUS_27600 1855 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 2470 4119 gene locus_tag LOCUS_27610 2470 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 4388 4227 gene locus_tag LOCUS_27620 4388 4227 CDS product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895603.1 protein_id gnl|my_center|LOCUS_27620 >Feature sequence212 855 700 gene locus_tag LOCUS_27630 855 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 1556 852 gene locus_tag LOCUS_27640 1556 852 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047881.1 protein_id gnl|my_center|LOCUS_27640 3190 1727 gene locus_tag LOCUS_27650 3190 1727 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110815093.1 protein_id gnl|my_center|LOCUS_27650 3388 4290 gene locus_tag LOCUS_27660 3388 4290 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264237.1 protein_id gnl|my_center|LOCUS_27660 >Feature sequence213 787 122 gene locus_tag LOCUS_27670 gene ktrC 787 122 CDS product Ktr system potassium transporter KtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222311.1 protein_id gnl|my_center|LOCUS_27670 2195 801 gene locus_tag LOCUS_27680 2195 801 CDS product Trk family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888508.1 protein_id gnl|my_center|LOCUS_27680 2442 2780 gene locus_tag LOCUS_27690 2442 2780 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963622.1 protein_id gnl|my_center|LOCUS_27690 2921 3307 gene locus_tag LOCUS_27700 2921 3307 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869552.1 protein_id gnl|my_center|LOCUS_27700 3436 4359 gene locus_tag LOCUS_27710 3436 4359 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_27710 >Feature sequence214 814 1005 gene locus_tag LOCUS_27720 814 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 1152 1913 gene locus_tag LOCUS_27730 gene rgbR 1152 1913 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_27730 1970 3139 gene locus_tag LOCUS_27740 1970 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 3136 3915 gene locus_tag LOCUS_27750 3136 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 3950 4363 gene locus_tag LOCUS_27760 3950 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence215 <1 914 gene locus_tag LOCUS_27770 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682235.1:ornithine carbamoyltransferase 914 1759 gene locus_tag LOCUS_27780 914 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 1813 2148 gene locus_tag LOCUS_27790 1813 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 2152 2943 gene locus_tag LOCUS_27800 2152 2943 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861999.1 protein_id gnl|my_center|LOCUS_27800 2933 3889 gene locus_tag LOCUS_27810 gene dusB 2933 3889 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_27810 >Feature sequence216 62 1171 gene locus_tag LOCUS_27820 gene secY 62 1171 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_27820 1360 2004 gene locus_tag LOCUS_27830 1360 2004 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966391.1 protein_id gnl|my_center|LOCUS_27830 2008 2763 gene locus_tag LOCUS_27840 gene map 2008 2763 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_27840 2777 3052 gene locus_tag LOCUS_27850 2777 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 3058 3276 gene locus_tag LOCUS_27860 gene infA 3058 3276 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029884.1 protein_id gnl|my_center|LOCUS_27860 3959 4330 gene locus_tag LOCUS_27870 gene rpsM 3959 4330 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_27870 >Feature sequence217 540 875 gene locus_tag LOCUS_27880 540 875 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_27880 1899 1030 gene locus_tag LOCUS_27890 1899 1030 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458966.1 protein_id gnl|my_center|LOCUS_27890 2526 2149 gene locus_tag LOCUS_27900 2526 2149 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889116.1 protein_id gnl|my_center|LOCUS_27900 3441 2704 gene locus_tag LOCUS_27910 3441 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 3596 4090 gene locus_tag LOCUS_27920 3596 4090 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_27920 >Feature sequence218 1118 87 gene locus_tag LOCUS_27930 1118 87 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398871.1 protein_id gnl|my_center|LOCUS_27930 1797 1231 gene locus_tag LOCUS_27940 1797 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 2897 1797 gene locus_tag LOCUS_27950 gene hitS 2897 1797 CDS product envelope stress sensor histidine kinase HitS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231621.1 protein_id gnl|my_center|LOCUS_27950 3565 2894 gene locus_tag LOCUS_27960 3565 2894 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948592.1 protein_id gnl|my_center|LOCUS_27960 3816 4316 gene locus_tag LOCUS_27970 gene thiW 3816 4316 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829480.1 protein_id gnl|my_center|LOCUS_27970 >Feature sequence219 1751 1176 gene locus_tag LOCUS_27980 1751 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 3199 1733 gene locus_tag LOCUS_27990 3199 1733 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_27990 3862 3230 gene locus_tag LOCUS_28000 3862 3230 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871221.1 protein_id gnl|my_center|LOCUS_28000 >Feature sequence220 420 130 gene locus_tag LOCUS_28010 420 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 1074 523 gene locus_tag LOCUS_28020 1074 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 1744 1382 gene locus_tag LOCUS_28030 1744 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 3286 3167 gene locus_tag LOCUS_28040 3286 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 >Feature sequence221 622 1791 gene locus_tag LOCUS_28050 622 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 1775 2815 gene locus_tag LOCUS_28060 1775 2815 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606740.1 protein_id gnl|my_center|LOCUS_28060 2819 3682 gene locus_tag LOCUS_28070 2819 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 >Feature sequence222 <1 744 gene locus_tag LOCUS_28080 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012027282.1:carbohydrate ABC transporter permease 761 2467 gene locus_tag LOCUS_28090 761 2467 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_28090 2504 3997 gene locus_tag LOCUS_28100 2504 3997 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063445845.1 protein_id gnl|my_center|LOCUS_28100 >Feature sequence223 1810 26 gene locus_tag LOCUS_28110 gene dnaG 1810 26 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_28110 2845 1829 gene locus_tag LOCUS_28120 2845 1829 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_28120 3824 2988 gene locus_tag LOCUS_28130 3824 2988 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_28130 >Feature sequence224 2204 156 gene locus_tag LOCUS_28140 2204 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 2796 2197 gene locus_tag LOCUS_28150 2796 2197 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_28150 3129 2809 gene locus_tag LOCUS_28160 3129 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 3599 3129 gene locus_tag LOCUS_28170 3599 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 3885 3733 gene locus_tag LOCUS_28180 3885 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 >Feature sequence225 188 379 gene locus_tag LOCUS_28190 188 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 484 816 gene locus_tag LOCUS_28200 484 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 873 1415 gene locus_tag LOCUS_28210 gene yfcE 873 1415 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_28210 1412 2578 gene locus_tag LOCUS_28220 1412 2578 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944494.1 protein_id gnl|my_center|LOCUS_28220 2585 3184 gene locus_tag LOCUS_28230 2585 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 3209 3694 gene locus_tag LOCUS_28240 3209 3694 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435609.1 protein_id gnl|my_center|LOCUS_28240 >Feature sequence226 432 1901 gene locus_tag LOCUS_28250 432 1901 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006194892.1 protein_id gnl|my_center|LOCUS_28250 1964 3565 gene locus_tag LOCUS_28260 1964 3565 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861711.1 protein_id gnl|my_center|LOCUS_28260 >Feature sequence227 <1 1189 gene locus_tag LOCUS_28270 <1 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986028.1:isoleucine--tRNA ligase >Feature sequence228 1322 126 gene locus_tag LOCUS_28280 1322 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 1798 1316 gene locus_tag LOCUS_28290 1798 1316 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439159.1 protein_id gnl|my_center|LOCUS_28290 3320 2028 gene locus_tag LOCUS_28300 3320 2028 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048319.1 protein_id gnl|my_center|LOCUS_28300 3698 3573 gene locus_tag LOCUS_28310 3698 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 >Feature sequence229 471 1280 gene locus_tag LOCUS_28320 gene yidA 471 1280 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065596971.1 protein_id gnl|my_center|LOCUS_28320 1392 1817 gene locus_tag LOCUS_28330 1392 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 1986 3575 gene locus_tag LOCUS_28340 1986 3575 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015673.1 protein_id gnl|my_center|LOCUS_28340 >Feature sequence230 1704 400 gene locus_tag LOCUS_28350 1704 400 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_28350 2850 1720 gene locus_tag LOCUS_28360 gene pheA 2850 1720 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_28360 2990 3376 gene locus_tag LOCUS_28370 2990 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 >Feature sequence231 1391 69 gene locus_tag LOCUS_28380 gene eno 1391 69 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815650.1 protein_id gnl|my_center|LOCUS_28380 1739 1413 gene locus_tag LOCUS_28390 1739 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 <3610 2233 gene locus_tag LOCUS_28400 <3610 2233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948029.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase >Feature sequence232 971 78 gene locus_tag LOCUS_28410 971 78 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891824.1 protein_id gnl|my_center|LOCUS_28410 1338 2678 gene locus_tag LOCUS_28420 1338 2678 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461524.1 protein_id gnl|my_center|LOCUS_28420 2675 3397 gene locus_tag LOCUS_28430 2675 3397 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392510.1 protein_id gnl|my_center|LOCUS_28430 >Feature sequence233 1904 1278 gene locus_tag LOCUS_28440 gene purN 1904 1278 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_28440 3011 1986 gene locus_tag LOCUS_28450 gene purM 3011 1986 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262435.1 protein_id gnl|my_center|LOCUS_28450 <3600 3093 gene locus_tag LOCUS_28460 <3600 3093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081520.1:5-(carboxyamino)imidazole ribonucleotide mutase >Feature sequence234 1137 241 gene locus_tag LOCUS_28470 1137 241 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892682.1 protein_id gnl|my_center|LOCUS_28470 2517 1348 gene locus_tag LOCUS_28480 2517 1348 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801628.1 protein_id gnl|my_center|LOCUS_28480 3492 2842 gene locus_tag LOCUS_28490 3492 2842 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262698.1 protein_id gnl|my_center|LOCUS_28490 >Feature sequence235 643 230 gene locus_tag LOCUS_28500 gene rpsL 643 230 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_28500 2037 802 gene locus_tag LOCUS_28510 gene nagZ 2037 802 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_28510 <3561 2117 gene locus_tag LOCUS_28520 <3561 2117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048356.1:DNA-directed RNA polymerase subunit beta' >Feature sequence236 41 931 gene locus_tag LOCUS_28530 gene dapA 41 931 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438799.1 protein_id gnl|my_center|LOCUS_28530 972 1733 gene locus_tag LOCUS_28540 gene dapB 972 1733 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_28540 1874 2143 gene locus_tag LOCUS_28550 1874 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 2374 2907 gene locus_tag LOCUS_28560 gene raiA 2374 2907 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_28560 >Feature sequence237 2319 1540 gene locus_tag LOCUS_28570 gene trpA 2319 1540 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_28570 3496 2312 gene locus_tag LOCUS_28580 gene trpB 3496 2312 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_28580 >Feature sequence238 922 314 gene locus_tag LOCUS_28590 gene dhaS 922 314 CDS product dihydroxyacetone kinase transcriptional activator DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009910868.1 protein_id gnl|my_center|LOCUS_28590 1442 900 gene locus_tag LOCUS_28600 1442 900 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020471.1 protein_id gnl|my_center|LOCUS_28600 2217 1474 gene locus_tag LOCUS_28610 2217 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 2677 2477 gene locus_tag LOCUS_28620 2677 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 3057 2911 gene locus_tag LOCUS_28630 3057 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 3463 3014 gene locus_tag LOCUS_28640 3463 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 >Feature sequence239 12 554 gene locus_tag LOCUS_28650 gene pgsA 12 554 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_28650 571 1863 gene locus_tag LOCUS_28660 571 1863 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_28660 2152 1835 gene locus_tag LOCUS_28670 2152 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 2510 2145 gene locus_tag LOCUS_28680 2510 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 2811 2659 gene locus_tag LOCUS_28690 2811 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 3020 3169 gene locus_tag LOCUS_28700 3020 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 >Feature sequence240 846 82 gene locus_tag LOCUS_28710 gene pdaB 846 82 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048155.1 protein_id gnl|my_center|LOCUS_28710 1360 968 gene locus_tag LOCUS_28720 1360 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence241 1177 509 gene locus_tag LOCUS_28730 1177 509 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897090.1 protein_id gnl|my_center|LOCUS_28730 1315 2196 gene locus_tag LOCUS_28740 1315 2196 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 protein_id gnl|my_center|LOCUS_28740 2193 2978 gene locus_tag LOCUS_28750 2193 2978 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262273.1 protein_id gnl|my_center|LOCUS_28750 3102 3230 gene locus_tag LOCUS_28760 3102 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 >Feature sequence242 336 1256 gene locus_tag LOCUS_28770 336 1256 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288005.1 protein_id gnl|my_center|LOCUS_28770 1749 1886 gene locus_tag LOCUS_28780 1749 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 2058 2648 gene locus_tag LOCUS_28790 2058 2648 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765993.1 protein_id gnl|my_center|LOCUS_28790 >Feature sequence243 2218 1529 gene locus_tag LOCUS_28800 2218 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 >Feature sequence244 907 1272 gene locus_tag LOCUS_28810 907 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 1288 1725 gene locus_tag LOCUS_28820 1288 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 2773 1976 gene locus_tag LOCUS_28830 2773 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 >Feature sequence245 168 425 gene locus_tag LOCUS_28840 168 425 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003394408.1 protein_id gnl|my_center|LOCUS_28840 1606 503 gene locus_tag LOCUS_28850 gene nagA 1606 503 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292242.1 protein_id gnl|my_center|LOCUS_28850 1785 2018 gene locus_tag LOCUS_28860 1785 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 2632 2096 gene locus_tag LOCUS_28870 2632 2096 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_28870 >Feature sequence246 84 446 gene locus_tag LOCUS_28880 84 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 461 700 gene locus_tag LOCUS_28890 461 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 725 1165 gene locus_tag LOCUS_28900 725 1165 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019670.1 protein_id gnl|my_center|LOCUS_28900 1268 1936 gene locus_tag LOCUS_28910 1268 1936 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868826.1 protein_id gnl|my_center|LOCUS_28910 2294 2977 gene locus_tag LOCUS_28920 gene pyrE 2294 2977 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_28920 >Feature sequence247 2024 1005 gene locus_tag LOCUS_28930 2024 1005 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435855.1 protein_id gnl|my_center|LOCUS_28930 2450 2040 gene locus_tag LOCUS_28940 2450 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 >Feature sequence248 302 1498 gene locus_tag LOCUS_28950 302 1498 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225872.1 protein_id gnl|my_center|LOCUS_28950 1482 1709 gene locus_tag LOCUS_28960 1482 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 >Feature sequence249 48 848 gene locus_tag LOCUS_28970 48 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 973 1452 gene locus_tag LOCUS_28980 973 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 1449 2861 gene locus_tag LOCUS_28990 1449 2861 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101592.1 protein_id gnl|my_center|LOCUS_28990 >Feature sequence250 894 70 gene locus_tag LOCUS_29000 894 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 1847 1038 gene locus_tag LOCUS_29010 1847 1038 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436797.1 protein_id gnl|my_center|LOCUS_29010 2870 1932 gene locus_tag LOCUS_29020 gene pfkA 2870 1932 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_29020 >Feature sequence251 83 766 gene locus_tag LOCUS_29030 83 766 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238594.1 protein_id gnl|my_center|LOCUS_29030 767 2056 gene locus_tag LOCUS_29040 767 2056 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984707.1 protein_id gnl|my_center|LOCUS_29040 2416 2135 gene locus_tag LOCUS_29050 2416 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 2875 2465 gene locus_tag LOCUS_29060 2875 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 >Feature sequence252 105 362 gene locus_tag LOCUS_29070 105 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 1025 429 gene locus_tag LOCUS_29080 1025 429 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964891.1 protein_id gnl|my_center|LOCUS_29080 1955 1080 gene locus_tag LOCUS_29090 1955 1080 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002023111.1 protein_id gnl|my_center|LOCUS_29090 2226 2738 gene locus_tag LOCUS_29100 2226 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 >Feature sequence253 1696 341 gene locus_tag LOCUS_29110 1696 341 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_29110 2164 2000 gene locus_tag LOCUS_29120 2164 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 2275 2763 gene locus_tag LOCUS_29130 2275 2763 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986971.1 protein_id gnl|my_center|LOCUS_29130 >Feature sequence254 >Feature sequence255 <1 958 gene locus_tag LOCUS_29140 <1 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236023556.1:discoidin domain-containing protein 1614 1048 gene locus_tag LOCUS_29150 1614 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 1949 1611 gene locus_tag LOCUS_29160 1949 1611 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102620.1 protein_id gnl|my_center|LOCUS_29160 2303 2449 gene locus_tag LOCUS_29170 2303 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 >Feature sequence256 161 505 gene locus_tag LOCUS_29180 161 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 568 1566 gene locus_tag LOCUS_29190 568 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 1647 2102 gene locus_tag LOCUS_29200 1647 2102 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361333.1 protein_id gnl|my_center|LOCUS_29200 2141 2263 gene locus_tag LOCUS_29210 2141 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 >Feature sequence257 >Feature sequence258 2192 1359 gene locus_tag LOCUS_29220 2192 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 2365 2219 gene locus_tag LOCUS_29230 2365 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 2583 2511 gene locus_tag LOCUS_t00120 2583 2511 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence259 <1 2558 gene locus_tag LOCUS_29240 <1 2558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814229.1:ABC transporter permease >Feature sequence260 280 714 gene locus_tag LOCUS_29250 280 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 776 2161 gene locus_tag LOCUS_29260 gene rsmF 776 2161 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228642.1 protein_id gnl|my_center|LOCUS_29260 2507 2223 gene locus_tag LOCUS_29270 gene spoVG 2507 2223 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_29270 >Feature sequence261 2366 333 gene locus_tag LOCUS_29280 2366 333 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209897.1 protein_id gnl|my_center|LOCUS_29280